Samd7 is a cell type-specific PRC1 component essential for establishing retinal rod photoreceptor identity.

Science.gov (United States)

Omori, Yoshihiro; Kubo, Shun; Kon, Tetsuo; Furuhashi, Mayu; Narita, Hirotaka; Kominami, Taro; Ueno, Akiko; Tsutsumi, Ryotaro; Chaya, Taro; Yamamoto, Haruka; Suetake, Isao; Ueno, Shinji; Koseki, Haruhiko; Nakagawa, Atsushi; Furukawa, Takahisa

2017-09-26

Precise transcriptional regulation controlled by a transcription factor network is known to be crucial for establishing correct neuronal cell identities and functions in the CNS. In the retina, the expression of various cone and rod photoreceptor cell genes is regulated by multiple transcription factors; however, the role of epigenetic regulation in photoreceptor cell gene expression has been poorly understood. Here, we found that Samd7, a rod-enriched sterile alpha domain (SAM) domain protein, is essential for silencing nonrod gene expression through H3K27me3 regulation in rod photoreceptor cells. Samd7- null mutant mice showed ectopic expression of nonrod genes including S-opsin in rod photoreceptor cells and rod photoreceptor cell dysfunction. Samd7 physically interacts with Polyhomeotic homologs (Phc proteins), components of the Polycomb repressive complex 1 (PRC1), and colocalizes with Phc2 and Ring1B in Polycomb bodies. ChIP assays showed a significant decrease of H3K27me3 in the genes up-regulated in the Samd7 -deficient retina, showing that Samd7 deficiency causes the derepression of nonrod gene expression in rod photoreceptor cells. The current study suggests that Samd7 is a cell type-specific PRC1 component epigenetically defining rod photoreceptor cell identity.

Knock-in strategy at 3'-end of Crx gene by CRISPR/Cas9 system shows the gene expression profiles during human photoreceptor differentiation.

Science.gov (United States)

Homma, Kohei; Usui, Sumiko; Kaneda, Makoto

2017-03-01

Fluorescent reporter gene knock-in induced pluripotent stem cell (iPSC) lines have been used to evaluate the efficiency of differentiation into specific cell lineages. Here, we report a knock-in strategy for the generation of human iPSC reporter lines in which a 2A peptide sequence and a red fluorescent protein (E2-Crimson) gene were inserted at the termination codon of the cone-rod homeobox (Crx) gene, a photoreceptor-specific transcriptional factor gene. The knock-in iPSC lines were differentiated into fluorescence-expressing cells in 3D retinal differentiation culture, and the fluorescent cells also expressed Crx specifically in the nucleus. We found that the fluorescence intensity was positively correlated with the expression levels of Crx mRNA and that fluorescent cells expressed rod photoreceptor-specific genes in the later stage of differentiation. Finally, we treated the fluorescent cells with DAPT, a Notch inhibitor, and found that DAPT-enhanced retinal differentiation was associated with up-regulation of Crx, Otx2 and NeuroD1, and down-regulation of Hes5 and Ngn2. These suggest that this knock-in strategy at the 3'-end of the target gene, combined with the 2A peptide linked to fluorescent proteins, offers a useful tool for labeling specific cell lineages or monitoring expression of any marker genes without affecting the function of the target gene. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Transcriptional regulation of rod photoreceptor homeostasis revealed by in vivo NRL targetome analysis.

Directory of Open Access Journals (Sweden)

Hong Hao

Full Text Available A stringent control of homeostasis is critical for functional maintenance and survival of neurons. In the mammalian retina, the basic motif leucine zipper transcription factor NRL determines rod versus cone photoreceptor cell fate and activates the expression of many rod-specific genes. Here, we report an integrated analysis of NRL-centered gene regulatory network by coupling chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-Seq data from Illumina and ABI platforms with global expression profiling and in vivo knockdown studies. We identified approximately 300 direct NRL target genes. Of these, 22 NRL targets are associated with human retinal dystrophies, whereas 95 mapped to regions of as yet uncloned retinal disease loci. In silico analysis of NRL ChIP-Seq peak sequences revealed an enrichment of distinct sets of transcription factor binding sites. Specifically, we discovered that genes involved in photoreceptor function include binding sites for both NRL and homeodomain protein CRX. Evaluation of 26 ChIP-Seq regions validated their enhancer functions in reporter assays. In vivo knockdown of 16 NRL target genes resulted in death or abnormal morphology of rod photoreceptors, suggesting their importance in maintaining retinal function. We also identified histone demethylase Kdm5b as a novel secondary node in NRL transcriptional hierarchy. Exon array analysis of flow-sorted photoreceptors in which Kdm5b was knocked down by shRNA indicated its role in regulating rod-expressed genes. Our studies identify candidate genes for retinal dystrophies, define cis-regulatory module(s for photoreceptor-expressed genes and provide a framework for decoding transcriptional regulatory networks that dictate rod homeostasis.

The Retinal Pigment Epithelium: a Convenient Source of New Photoreceptor cells?

Directory of Open Access Journals (Sweden)

Shu-Zhen Wang

2014-01-01

Full Text Available Recent success in restoring visual function through photoreceptor replacement in mouse models of photoreceptor degeneration intensifies the need to generate or regenerate photoreceptor cells for the ultimate goal of using cell replacement therapy for blindness caused by photoreceptor degeneration. Current research on deriving new photoreceptors for replacement, as regenerative medicine in general, focuses on the use of embryonic stem cells and induced pluripotent stem (iPS cells to generate transplantable cells. Nonetheless, naturally occurring regeneration, such as wound healing, involves awakening cells at or near a wound site to produce new cells needed to heal the wound. Here we discuss the possibility of tweaking an ocular tissue, the retinal pigment epithelium (RPE, to produce photoreceptor cells in situ in the eye. Unlike the neural retina, the RPE in adult mammals maintains cell proliferation capability. Furthermore, progeny cells from RPE proliferation may differentiate into cells other than RPE. The combination of proliferation and plasticity opens a question of whether they could be channeled by a regulatory gene with pro-photoreceptor activity towards photoreceptor production. Studies using embryonic chick and transgenic mouse showed that indeed photoreceptor-like cells were produced in culture and in vivo in the eye using genedirected reprogramming of RPE cells, supporting the feasibility of using the RPE as a convenient source of new photoreceptor cells for in situ retinal repair without involving cell transplantation.

In vitro transdifferentiation of human peripheral blood mononuclear cells to photoreceptor-like cells

Directory of Open Access Journals (Sweden)

Yukari Komuta

2016-06-01

Full Text Available Direct reprogramming is a promising, simple and low-cost approach to generate target cells from somatic cells without using induced pluripotent stem cells. Recently, peripheral blood mononuclear cells (PBMCs have attracted considerable attention as a somatic cell source for reprogramming. As a cell source, PBMCs have an advantage over dermal fibroblasts with respect to the ease of collecting tissues. Based on our studies involving generation of photosensitive photoreceptor cells from human iris cells and human dermal fibroblasts by transduction of photoreceptor-related transcription factors via retrovirus vectors, we transduced these transcription factors into PBMCs via Sendai virus vectors. We found that retinal disease-related genes were efficiently detected in CRX-transduced cells, most of which are crucial to photoreceptor functions. In functional studies, a light-induced inward current was detected in some CRX-transduced cells. Moreover, by modification of the culture conditions including additional transduction of RAX1 and NEUROD1, we found a greater variety of retinal disease-related genes than that observed in CRX-transduced PBMCs. These data suggest that CRX acts as a master control gene for reprogramming PBMCs into photoreceptor-like cells and that our induced photoreceptor-like cells might contribute to individualized drug screening and disease modeling of inherited retinal degeneration.

Mef2d is essential for the maturation and integrity of retinal photoreceptor and bipolar cells.

Science.gov (United States)

Omori, Yoshihiro; Kitamura, Tamiki; Yoshida, Satoyo; Kuwahara, Ryusuke; Chaya, Taro; Irie, Shoichi; Furukawa, Takahisa

2015-05-01

Mef2 transcription factors play a crucial role in cardiac and skeletal muscle differentiation. We found that Mef2d is highly expressed in the mouse retina and its loss causes photoreceptor degeneration similar to that observed in human retinitis pigmentosa patients. Electroretinograms (ERGs) were severely impaired in Mef2d-/- mice. Immunohistochemistry showed that photoreceptor and bipolar cell synapse protein levels severely decreased in the Mef2d-/- retina. Expression profiling by microarray analysis showed that Mef2d is required for the expression of various genes in photoreceptor and bipolar cells, including cone arrestin, Guca1b, Pde6h and Cacna1s, which encode outer segment and synapse proteins. We also observed that Mef2d synergistically activates the cone arrestin (Arr3) promoter with Crx, suggesting that functional cooperation between Mef2d and Crx is important for photoreceptor cell gene regulation. Taken together, our results show that Mef2d is essential for photoreceptor and bipolar cell gene expression, either independently or cooperatively with Crx. © 2015 Institution for Protein Research. Genes to Cells published by Wiley Publishing Asia Pty Ltd and the Molecular Biology Society of Japan.

Photoreceptor PhyB Involved in Arabidopsis Temperature Perception and Heat-Tolerance Formation.

Science.gov (United States)

Song, Junyi; Liu, Qijun; Hu, Biru; Wu, Wenjian

2017-06-05

The influence of temperature on plants is essential. However, our knowledge on the intricate regulation process underlying heat stress (HS) response in plants is limited. Recently, information about thermal sensors in vivo has begun to emerge. In this study, another primary environmental stimulus, light, was verified once again to work with temperature synergistically on plants, through the modulation of numerous biological processes. With the application of transcriptomic analysis, a substantial number of heat-responsive genes were detected involved in both light- and phytohormone-mediated pathways in Arabidopsis. During this process, phytoreceptor phyB acts as a molecular switch to turn on or turn off several other genes HS response, under different light conditions. Furthermore, a morphological study showed the afunction of phyB enhanced plants thermal tolerance, confirming the important role of this phytochrome in temperature perception and response in plants. This study adds data to the picture of light and temperature signaling cross-talk in plants, which is important for the exploration of complicated HS responses or light-mediated mechanisms. Furthermore, based on its influence on Arabidopsis thermal response in both morphological and physiological levels, phyB is a photoreceptor, as revealed before, as well as an essential thermal sensor in plants.

The UVR8 UV-B Photoreceptor: Perception, Signaling and Response

Science.gov (United States)

Tilbrook, Kimberley; Arongaus, Adriana B.; Binkert, Melanie; Heijde, Marc; Yin, Ruohe; Ulm, Roman

2013-01-01

Ultraviolet-B radiation (UV-B) is an intrinsic part of sunlight that is accompanied by significant biological effects. Plants are able to perceive UV-B using the UV-B photoreceptor UVR8 which is linked to a specific molecular signaling pathway and leads to UV-B acclimation. Herein we review the biological process in plants from initial UV-B perception and signal transduction through to the known UV-B responses that promote survival in sunlight. The UVR8 UV-B photoreceptor exists as a homodimer that instantly monomerises upon UV-B absorption via specific intrinsic tryptophans which act as UV-B chromophores. The UVR8 monomer interacts with COP1, an E3 ubiquitin ligase, initiating a molecular signaling pathway that leads to gene expression changes. This signaling output leads to UVR8-dependent responses including UV-B-induced photomorphogenesis and the accumulation of UV-B-absorbing flavonols. Negative feedback regulation of the pathway is provided by the WD40-repeat proteins RUP1 and RUP2, which facilitate UVR8 redimerization, disrupting the UVR8-COP1 interaction. Despite rapid advancements in the field of recent years, further components of UVR8 UV-B signaling are constantly emerging, and the precise interplay of these and the established players UVR8, COP1, RUP1, RUP2 and HY5 needs to be defined. UVR8 UV-B signaling represents our further understanding of how plants are able to sense their light environment and adjust their growth accordingly. PMID:23864838

Different effects of valproic acid on photoreceptor loss in Rd1 and Rd10 retinal degeneration mice.

Science.gov (United States)

Mitton, Kenneth P; Guzman, Alvaro E; Deshpande, Mrinalini; Byrd, David; DeLooff, Camryn; Mkoyan, Kristina; Zlojutro, Paul; Wallace, Adrianne; Metcalf, Brandon; Laux, Kirsten; Sotzen, Jason; Tran, Trung

2014-01-01

The histone-deacetylase inhibitor activity of valproic acid (VPA) was discovered after VPA's adoption as an anticonvulsant. This generated speculation for VPA's potential to increase the expression of neuroprotective genes. Clinical trials for retinitis pigmentosa (RP) are currently active, testing VPA's potential to reduce photoreceptor loss; however, we lack information regarding the effects of VPA on available mammalian models of retinal degeneration, nor do we know if retinal gene expression is perturbed by VPA in a predictable way. Thus, we examined the effects of systemic VPA on neurotrophic factor and Nrl-related gene expression in the mouse retina and compared VPA's effects on the rate of photoreceptor loss in two strains of mice, Pde6b(rd1/rd1) and Pde6b(rd10/rd10) . The expression of Bdnf, Gdnf, Cntf, and Fgf2 was measured by quantitative PCR after single and multiple doses of VPA (intraperitoneal) in wild-type and Pde6b(rd1/rd1) mice. Pde6b(rd1/rd1) mice were treated with daily doses of VPA during the period of rapid photoreceptor loss. Pde6b(rd10/rd10) mice were also treated with systemic VPA to compare in a partial loss-of-function model. Retinal morphology was assessed by virtual microscopy or spectral-domain optical coherence tomography (SD-OCT). Full-field and focal electroretinography (ERG) analysis were employed with Pde6b(rd10/rd10) mice to measure retinal function. In wild-type postnatal mice, a single VPA dose increased the expression of Bdnf and Gdnf in the neural retina after 18 h, while the expression of Cntf was reduced by 70%. Daily dosing of wild-type mice from postnatal day P17 to P28 resulted in smaller increases in Bdnf and Gdnf expression, normal Cntf expression, and reduced Fgf2 expression (25%). Nrl gene expression was decreased by 50%, while Crx gene expression was not affected. Rod-specific expression of Mef2c and Nr2e3 was decreased substantially by VPA treatment, while Rhodopsin and Pde6b gene expression was normal at P28. Daily

No evidence for a genetic blueprint: The case of the "complex" mammalian photoreceptor

Directory of Open Access Journals (Sweden)

G Kumaramanickavel

2015-01-01

Full Text Available Despite the intensity of the search for genes causing inherited retinal degenerations over the past 3 decades, of the approximately 200 disease genes identified to date, all appear to be ordinary housekeeping genes specifying proteins playing basic structural and functional roles in the mature photoreceptor cells. No genes or genetic elements have been identified which can be construed as having a specific morphogenic role, directing the development of the cytoarchitecture of any particular retinal cell. The evidence suggests that the cytoarchitecture of the retinal photoreceptors, although enormously complex, arises from the self-organization of the cells constituents without any regulation or direction from an external genetic blueprint.

Retinal neuroprotection by hypoxic preconditioning is independent of hypoxia-inducible factor-1 alpha expression in photoreceptors.

Science.gov (United States)

Thiersch, Markus; Lange, Christina; Joly, Sandrine; Heynen, Severin; Le, Yun Zheng; Samardzija, Marijana; Grimm, Christian

2009-06-01

Hypoxic preconditioning stabilizes hypoxia-inducible factor (HIF) 1 alpha in the retina and protects photoreceptors against light-induced cell death. HIF-1 alpha is one of the major transcription factors responding to low oxygen tension and can differentially regulate a large number of target genes. To analyse whether photoreceptor-specific expression of HIF-1 alpha is essential to protect photoreceptors by hypoxic preconditioning, we knocked down expression of HIF-1 alpha specifically in photoreceptor cells, using the cyclization recombinase (Cre)-lox system. The Cre-mediated knockdown caused a 20-fold reduced expression of Hif-1 alpha in the photoreceptor cell layer. In the total retina, RNA expression was reduced by 65%, and hypoxic preconditioning led to only a small increase in HIF-1 alpha protein levels. Accordingly, HIF-1 target gene expression after hypoxia was significantly diminished. Retinas of Hif-1 alpha knockdown animals did not show any pathological alterations, and tolerated hypoxic exposure in a comparable way to wild-type retinas. Importantly, the strong neuroprotective effect of hypoxic preconditioning against light-induced photoreceptor degeneration persisted in knockdown mice, suggesting that hypoxia-mediated survival of light exposure does not depend on an autocrine action of HIF-1 alpha in photoreceptor cells. Hypoxia-mediated stabilization of HIF-2 alpha and phosphorylation of signal transducer and activator of transcription 3 (STAT 3) were not affected in the retinas of Hif-1 alpha knockdown mice. Thus, these factors are candidates for regulating the resistance of photoreceptors to light damage after hypoxic preconditioning, along with several potentially neuroprotective genes that were similarly induced in hypoxic knockdown and control mice.

Usher protein functions in hair cells and photoreceptors.

Science.gov (United States)

Cosgrove, Dominic; Zallocchi, Marisa

2014-01-01

The 10 different genes associated with the deaf/blind disorder, Usher syndrome, encode a number of structurally and functionally distinct proteins, most expressed as multiple isoforms/protein variants. Functional characterization of these proteins suggests a role in stereocilia development in cochlear hair cells, likely owing to adhesive interactions in hair bundles. In mature hair cells, homodimers of the Usher cadherins, cadherin 23 and protocadherin 15, interact to form a structural fiber, the tip link, and the linkages that anchor the taller stereocilia's actin cytoskeleton core to the shorter adjacent stereocilia and the elusive mechanotransduction channels, explaining the deafness phenotype when these molecular interactions are perturbed. The conundrum is that photoreceptors lack a synonymous mechanotransduction apparatus, and so a common theory for Usher protein function in the two neurosensory cell types affected in Usher syndrome is lacking. Recent evidence linking photoreceptor cell dysfunction in the shaker 1 mouse model for Usher syndrome to light-induced protein translocation defects, combined with localization of an Usher protein interactome at the periciliary region of the photoreceptors suggests Usher proteins might regulate protein trafficking between the inner and outer segments of photoreceptors. A distinct Usher protein complex is trafficked to the ribbon synapses of hair cells, and synaptic defects have been reported in Usher mutants in both hair cells and photoreceptors. This review aims to clarify what is known about Usher protein function at the synaptic and apical poles of hair cells and photoreceptors and the prospects for identifying a unifying pathobiological mechanism to explain deaf/blindness in Usher syndrome. Copyright © 2013 Elsevier Ltd. All rights reserved.

The UV-B Photoreceptor UVR8: From Structure to Physiology

Science.gov (United States)

Jenkins, Gareth I.

2014-01-01

Low doses of UV-B light (280 to 315 nm) elicit photomorphogenic responses in plants that modify biochemical composition, photosynthetic competence, morphogenesis, and defense. UV RESISTANCE LOCUS8 (UVR8) mediates photomorphogenic responses to UV-B by regulating transcription of a set of target genes. UVR8 differs from other known photoreceptors in that it uses specific Trp amino acids instead of a prosthetic chromophore for light absorption during UV-B photoreception. Absorption of UV-B dissociates the UVR8 dimer into monomers, initiating signal transduction through interaction with CONSTITUTIVELY PHOTOMORPHOGENIC1. However, much remains to be learned about the physiological role of UVR8 and its interaction with other signaling pathways, the molecular mechanism of UVR8 photoreception, how the UVR8 protein initiates signaling, how it is regulated, and how UVR8 regulates transcription of its target genes. PMID:24481075

Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish.

Science.gov (United States)

Viringipurampeer, I A; Shan, X; Gregory-Evans, K; Zhang, J P; Mohammadi, Z; Gregory-Evans, C Y

2014-05-01

Achromatopsia is a progressive autosomal recessive retinal disease characterized by early loss of cone photoreceptors and later rod photoreceptor loss. In most cases, mutations have been identified in CNGA3, CNGB3, GNAT2, PDE6C or PDE6H genes. Owing to this genetic heterogeneity, mutation-independent therapeutic schemes aimed at preventing cone cell death are very attractive treatment strategies. In pde6c(w59) mutant zebrafish, cone photoreceptors expressed high levels of receptor-interacting protein kinase 1 (RIP1) and receptor-interacting protein kinase 3 (RIP3) kinases, key regulators of necroptotic cell death. In contrast, rod photoreceptor cells were alternatively immunopositive for caspase-3 indicating activation of caspase-dependent apoptosis in these cells. Morpholino gene knockdown of rip3 in pde6c(w59) embryos rescued the dying cone photoreceptors by inhibiting the formation of reactive oxygen species and by inhibiting second-order neuron remodelling in the inner retina. In rip3 morphant larvae, visual function was restored in the cones by upregulation of the rod phosphodiesterase genes (pde6a and pde6b), compensating for the lack of cone pde6c suggesting that cones are able to adapt to their local environment. Furthermore, we demonstrated through pharmacological inhibition of RIP1 and RIP3 activity that cone cell death was also delayed. Collectively, these results demonstrate that the underlying mechanism of cone cell death in the pde6c(w59) mutant retina is through necroptosis, whereas rod photoreceptor bystander death occurs through a caspase-dependent mechanism. This suggests that targeting the RIP kinase signalling pathway could be an effective therapeutic intervention in retinal degeneration patients. As bystander cell death is an important feature of many retinal diseases, combinatorial approaches targeting different cell death pathways may evolve as an important general principle in treatment.

The role of carcinine in signaling at the Drosophila photoreceptor synapse.

Directory of Open Access Journals (Sweden)

Brendan A Gavin

2007-12-01

Full Text Available The Drosophila melanogaster photoreceptor cell has long served as a model system for researchers focusing on how animal sensory neurons receive information from their surroundings and translate this information into chemical and electrical messages. Electroretinograph (ERG analysis of Drosophila mutants has helped to elucidate some of the genes involved in the visual transduction pathway downstream of the photoreceptor cell, and it is now clear that photoreceptor cell signaling is dependent upon the proper release and recycling of the neurotransmitter histamine. While the neurotransmitter transporters responsible for clearing histamine, and its metabolite carcinine, from the synaptic cleft have remained unknown, a strong candidate for a transporter of either substrate is the uncharacterized inebriated protein. The inebriated gene (ine encodes a putative neurotransmitter transporter that has been localized to photoreceptor cells in Drosophila and mutations in ine result in an abnormal ERG phenotype in Drosophila. Loss-of-function mutations in ebony, a gene required for the synthesis of carcinine in Drosophila, suppress components of the mutant ine ERG phenotype, while loss-of-function mutations in tan, a gene necessary for the hydrolysis of carcinine in Drosophila, have no effect on the ERG phenotype in ine mutants. We also show that by feeding wild-type flies carcinine, we can duplicate components of mutant ine ERGs. Finally, we demonstrate that treatment with H(3 receptor agonists or inverse agonists rescue several components of the mutant ine ERG phenotype. Here, we provide pharmacological and genetic epistatic evidence that ine encodes a carcinine neurotransmitter transporter. We also speculate that the oscillations observed in mutant ine ERG traces are the result of the aberrant activity of a putative H(3 receptor.

The Role of Carcinine in Signaling at the Drosophila Photoreceptor Synapse

Science.gov (United States)

Gavin, Brendan A; Arruda, Susan E; Dolph, Patrick J

2007-01-01

The Drosophila melanogaster photoreceptor cell has long served as a model system for researchers focusing on how animal sensory neurons receive information from their surroundings and translate this information into chemical and electrical messages. Electroretinograph (ERG) analysis of Drosophila mutants has helped to elucidate some of the genes involved in the visual transduction pathway downstream of the photoreceptor cell, and it is now clear that photoreceptor cell signaling is dependent upon the proper release and recycling of the neurotransmitter histamine. While the neurotransmitter transporters responsible for clearing histamine, and its metabolite carcinine, from the synaptic cleft have remained unknown, a strong candidate for a transporter of either substrate is the uncharacterized inebriated protein. The inebriated gene (ine) encodes a putative neurotransmitter transporter that has been localized to photoreceptor cells in Drosophila and mutations in ine result in an abnormal ERG phenotype in Drosophila. Loss-of-function mutations in ebony, a gene required for the synthesis of carcinine in Drosophila, suppress components of the mutant ine ERG phenotype, while loss-of-function mutations in tan, a gene necessary for the hydrolysis of carcinine in Drosophila, have no effect on the ERG phenotype in ine mutants. We also show that by feeding wild-type flies carcinine, we can duplicate components of mutant ine ERGs. Finally, we demonstrate that treatment with H3 receptor agonists or inverse agonists rescue several components of the mutant ine ERG phenotype. Here, we provide pharmacological and genetic epistatic evidence that ine encodes a carcinine neurotransmitter transporter. We also speculate that the oscillations observed in mutant ine ERG traces are the result of the aberrant activity of a putative H3 receptor. PMID:18069895

PAR-Complex and Crumbs Function During Photoreceptor Morphogenesis and Retinal Degeneration.

Science.gov (United States)

Pichaud, Franck

2018-01-01

The fly photoreceptor has long been used as a model to study sensory neuron morphogenesis and retinal degeneration. In particular, elucidating how these cells are built continues to help further our understanding of the mechanisms of polarized cell morphogenesis, intracellular trafficking and the causes of human retinal pathologies. The conserved PAR complex, which in flies consists of Cdc42-PAR6-aPKC-Bazooka, and the transmembrane protein Crumbs (Crb) are key players during photoreceptor morphogenesis. While the PAR complex regulates polarity in many cell types, Crb function in polarity is relatively specific to epithelial cells. Together Cdc42-PAR6-aPKC-Bazooka and Crb orchestrate the differentiation of the photoreceptor apical membrane (AM) and zonula adherens (ZA) , thus allowing these cells to assemble into a neuro-epithelial lattice. In addition to its function in epithelial polarity, Crb has also been shown to protect fly photoreceptors from light-induced degeneration, a process linked to Rhodopsin expression and trafficking. Remarkably, mutations in the human Crumbs1 (CRB1) gene lead to retinal degeneration, making the fly photoreceptor a powerful disease model system.

Plant responses to UV and blue light: biochemical and genetic approaches

International Nuclear Information System (INIS)

Jenkins, G.I.; Christie, J.M.; Fuglevand, G.; Long, J.C.; Jackson, J.A.

1995-01-01

UV and blue light control many aspects of plant growth and development. It is evident that several different photoreceptors mediate responses to UV and blue light, and there are reports of the functional and biochemical characterisation of a putative photoreceptor for phototropism and of the functional and molecular characterisation of the CRY1 photoreceptor, encoded by the Arabidopsis HY4 gene. The CRY1 photoreceptor mediates extension growth and gene expression responses to UV-A/blue light presumably through different or branching signal transduction pathways. Progress has been made in cell physiological and biochemical studies of UV/blue light signal transduction, but much remains to be done to relate candidate UV/blue signal transduction events to particular photoreceptors and responses. The application of a genetic approach in Arabidopsis has been responsible for many advances in understanding UV/blue responses, but further UV-B, UV-A and blue light response mutants need to be isolated. (author)

Apigenin-7-diglucuronide protects retinas against bright light-induced photoreceptor degeneration through the inhibition of retinal oxidative stress and inflammation.

Science.gov (United States)

Bian, Minjuan; Zhang, Yong; Du, Xiaoye; Xu, Jing; Cui, Jingang; Gu, Jiangping; Zhu, Weiliang; Zhang, Teng; Chen, Yu

2017-05-15

Vision impairment in retinal degenerative diseases such as age-related macular degeneration is primarily associated with photoreceptor degeneration, in which oxidative stress and inflammatory responses are mechanistically involved as central players. Therapies with photoreceptor protective properties remain to be developed. Apigenin-7-diglucuronide (A7DG), a flavonoid glycoside, is present in an assortment of medicinal plants with anti-inflammatory or ant-oxidant activities. However, the pharmacological significance of A7DG remains unknown in vivo. The current study isolated A7DG from Glechoma longituba (Nakai) Kuprian and investigated the retinal protective effect A7DG in mice characterized by bright light-induced photoreceptor degeneration. The results showed that A7DG treatment led to remarkable photoreceptor protection in bright light-exposed BALB/c mice. Moreover, A7DG treatment alleviated photoreceptor apoptosis, mitigated oxidative stress, suppressed reactive gliosis and microglial activation and attenuated the expression of proinflammatory genes in bright light-exposed retinas. The results demonstrated for the first time remarkable photoreceptor protective activities of A7DG in vivo. Inhibition of bright light-induced retinal oxidative stress and retinal inflammatory responses was associated with the retinal protection conferred by A7DG. The work here warrants further evaluation of A7DG as a pharmacological candidate for the treatment of vision-threatening retinal degenerative disorders. Moreover, given the general implication of oxidative stress and inflammation in the pathogenesis of neurodegeneration, A7DG could be further tested for the treatment of other neurodegenerative disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

PAR-Complex and Crumbs Function During Photoreceptor Morphogenesis and Retinal Degeneration

Directory of Open Access Journals (Sweden)

Franck Pichaud

2018-03-01

Full Text Available The fly photoreceptor has long been used as a model to study sensory neuron morphogenesis and retinal degeneration. In particular, elucidating how these cells are built continues to help further our understanding of the mechanisms of polarized cell morphogenesis, intracellular trafficking and the causes of human retinal pathologies. The conserved PAR complex, which in flies consists of Cdc42-PAR6-aPKC-Bazooka, and the transmembrane protein Crumbs (Crb are key players during photoreceptor morphogenesis. While the PAR complex regulates polarity in many cell types, Crb function in polarity is relatively specific to epithelial cells. Together Cdc42-PAR6-aPKC-Bazooka and Crb orchestrate the differentiation of the photoreceptor apical membrane (AM and zonula adherens (ZA, thus allowing these cells to assemble into a neuro-epithelial lattice. In addition to its function in epithelial polarity, Crb has also been shown to protect fly photoreceptors from light-induced degeneration, a process linked to Rhodopsin expression and trafficking. Remarkably, mutations in the human Crumbs1 (CRB1 gene lead to retinal degeneration, making the fly photoreceptor a powerful disease model system.

OFD1, as a Ciliary Protein, Exhibits Neuroprotective Function in Photoreceptor Degeneration Models.

Directory of Open Access Journals (Sweden)

Juan Wang

Full Text Available Ofd1 is a newly identified causative gene for Retinitis pigmentosa (RP, a photoreceptor degenerative disease. This study aimed to examine Ofd1 localization in retina and further to investigate its function in photoreceptor degeneration models. Ofd1 localization in rat retina was examined using immunofluorescence. N-methyl-N-nitrosourea (MNU-induced rats and Royal College of Surgeons (RCS rats were used as photoreceptor degeneration models. The expression pattern of Ofd1, other ciliary associated genes and Wnt signaling pathway genes were examined in rat models. Furthermore, pEGFP-Ofd1-CDS and pSUPER-Ofd1-shRNA were constructed to overexpress and knockdown the expression level in 661W and R28 cells. MNU was also used to induce cell death. Cilia formation was observed using immunocytochemistry (ICC. Reactive oxygen species (ROS were detected using the 2', 7'-Dichlorofluorescin diacetate (DCFH-DA assay. Apoptosis genes expression was examined using qRT-PCR, Western blotting and fluorescence-activated cell sorting (FACS. Ofd1 localized to outer segments of rat retina photoreceptors. Ofd1 and other ciliary proteins expression levels increased from the 1st and 4th postnatal weeks and decreased until the 6th week in the RCS rats, while their expression consistently decreased from the 1st and 7th day in the MNU rats. Moreover, Wnt signaling pathway proteins expression was significantly up-regulated in both rat models. Knockdown of Ofd1 expression resulted in a smaller population, shorter length of cell cilia, and lower cell viability. Ofd1 overexpression partially attenuated MNU toxic effects by reducing ROS levels and mitigating apoptosis. To the best of our knowledge, this is the first study demonstrating Ofd1 localization and its function in rat retina and in retinal degeneration rat models. Ofd1 plays a role in controlling photoreceptor cilium length and number. Importantly, it demonstrates a neuroprotective function by protecting the photoreceptor

The biochemistry of photoreceptor cells

International Nuclear Information System (INIS)

Voaden, M.J.; Marshall, J.; Oraedu, A.C.I.

1981-01-01

Photoreceptor cells have high rates of metabolism, and enzyme distributions suggest considerable substrate movement. The authors have used tracer techniques to study the effects of light on photoreceptor metabolism. In vitro, glutamine is metabolized alongside glucose by rat photoreceptors, and is, potentially, a major precursor of the neuroactive amino acids glutamate, aspartate and γ-aminobutyrate (GABA). The utilization of both substrates is decreased by light, as is the turnover of glutamate and aspartate. Tritiated glutamic and aspartic acids are taken up by photoreceptor cells. In the primates all rods but only some cones are labelled, whereas in the guinea pig the picture is reversed. The observations support the premise that glutamate and/or aspartate are photoreceptor neurotransmitters but show that cell and species differences may exist. The authors have been unable to find evidence for the involvement of free radical mechanisms in high light-induced photoreceptor damage but the initial results suggest a reduced metabolism of glutamine and GABA in damaged cells. (Auth.)

UV-B Perceived by the UVR8 Photoreceptor Inhibits Plant Thermomorphogenesis.

Science.gov (United States)

Hayes, Scott; Sharma, Ashutosh; Fraser, Donald P; Trevisan, Martine; Cragg-Barber, C Kester; Tavridou, Eleni; Fankhauser, Christian; Jenkins, Gareth I; Franklin, Keara A

2017-01-09

Small increases in ambient temperature can elicit striking effects on plant architecture, collectively termed thermomorphogenesis [1]. In Arabidopsis thaliana, these include marked stem elongation and leaf elevation, responses that have been predicted to enhance leaf cooling [2-5]. Thermomorphogenesis requires increased auxin biosynthesis, mediated by the bHLH transcription factor PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) [6-8], and enhanced stability of the auxin co-receptor TIR1, involving HEAT SHOCK PROTEIN 90 (HSP90) [9]. High-temperature-mediated hypocotyl elongation additionally involves localized changes in auxin metabolism, mediated by the indole-3-acetic acid (IAA)-amido synthetase Gretchen Hagen 3 (GH3).17 [10]. Here we show that ultraviolet-B light (UV-B) perceived by the photoreceptor UV RESISTANCE LOCUS 8 (UVR8) [11] strongly attenuates thermomorphogenesis via multiple mechanisms inhibiting PIF4 activity. Suppression of thermomorphogenesis involves UVR8 and CONSTITUTIVELY PHOTOMORPHOGENIC 1 (COP1)-mediated repression of PIF4 transcript accumulation, reducing PIF4 abundance. UV-B also stabilizes the bHLH protein LONG HYPOCOTYL IN FAR RED (HFR1), which can bind to and inhibit PIF4 function. Collectively, our results demonstrate complex crosstalk between UV-B and high-temperature signaling. As plants grown in sunlight would most likely experience concomitant elevations in UV-B and ambient temperature, elucidating how these pathways are integrated is of key importance to the understanding of plant development in natural environments. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Multimodal Imaging of Photoreceptor Structure in Choroideremia.

Science.gov (United States)

Sun, Lynn W; Johnson, Ryan D; Williams, Vesper; Summerfelt, Phyllis; Dubra, Alfredo; Weinberg, David V; Stepien, Kimberly E; Fishman, Gerald A; Carroll, Joseph

2016-01-01

Choroideremia is a progressive X-linked recessive dystrophy, characterized by degeneration of the retinal pigment epithelium (RPE), choroid, choriocapillaris, and photoreceptors. We examined photoreceptor structure in a series of subjects with choroideremia with particular attention to areas bordering atrophic lesions. Twelve males with clinically-diagnosed choroideremia and confirmed hemizygous mutations in the CHM gene were examined. High-resolution images of the retina were obtained using spectral domain optical coherence tomography (SD-OCT) and both confocal and non-confocal split-detector adaptive optics scanning light ophthalmoscope (AOSLO) techniques. Eleven CHM gene mutations (3 novel) were identified; three subjects had the same mutation and one subject had two mutations. SD-OCT findings included interdigitation zone (IZ) attenuation or loss in 10/12 subjects, often in areas with intact ellipsoid zones; RPE thinning in all subjects; interlaminar bridges in the imaged areas of 10/12 subjects; and outer retinal tubulations (ORTs) in 10/12 subjects. Only split-detector AOSLO could reliably resolve cones near lesion borders, and such cones were abnormally heterogeneous in morphology, diameter and density. On split-detector imaging, the cone mosaic terminated sharply at lesion borders in 5/5 cases examined. Split-detector imaging detected remnant cone inner segments within ORTs, which were generally contiguous with a central patch of preserved retina. Early IZ dropout and RPE thinning on SD-OCT are consistent with previously published results. Evidence of remnant cone inner segments within ORTs and the continuity of the ORTs with preserved retina suggests that these may represent an intermediate state of retinal degeneration prior to complete atrophy. Taken together, these results supports a model of choroideremia in which the RPE degenerates before photoreceptors.

Loss and gain of cone types in vertebrate ciliary photoreceptor evolution.

Science.gov (United States)

Musser, Jacob M; Arendt, Detlev

2017-11-01

Ciliary photoreceptors are a diverse cell type family that comprises the rods and cones of the retina and other related cell types such as pineal photoreceptors. Ciliary photoreceptor evolution has been dynamic during vertebrate evolution with numerous gains and losses of opsin and phototransduction genes, and changes in their expression. For example, early mammals lost all but two cone opsins, indicating loss of cone receptor types in response to nocturnal lifestyle. Our review focuses on the comparison of specifying transcription factors and cell type-specific transcriptome data in vertebrate retinae to build and test hypotheses on ciliary photoreceptor evolution. Regarding cones, recent data reveal that a combination of factors specific for long-wavelength sensitive opsin (Lws)- cones in non-mammalian vertebrates (Thrb and Rxrg) is found across all differentiating cone photoreceptors in mice. This suggests that mammalian ancestors lost all but one ancestral cone type, the Lws-cone. We test this hypothesis by a correlation analysis of cone transcriptomes in mouse and chick, and find that, indeed, transcriptomes of all mouse cones are most highly correlated to avian Lws-cones. These findings underscore the importance of specifying transcription factors in tracking cell type evolution, and shed new light on the mechanisms of cell type loss and gain in retina evolution. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Cryptochrome photoreceptors in green algae: Unexpected versatility of mechanisms and functions.

Science.gov (United States)

Kottke, Tilman; Oldemeyer, Sabine; Wenzel, Sandra; Zou, Yong; Mittag, Maria

2017-10-01

Green algae have a highly complex and diverse set of cryptochrome photoreceptor candidates including members of the following subfamilies: plant, plant-like, animal-like, DASH and cryptochrome photolyase family 1 (CPF1). While some green algae encode most or all of them, others lack certain members. Here we present an overview about functional analyses of so far investigated cryptochrome photoreceptors from the green algae Chlamydomonas reinhardtii (plant and animal-like cryptochromes) and Ostreococcus tauri (CPF1) with regard to their biological significance and spectroscopic properties. Cryptochromes of both algae have been demonstrated recently to be involved to various extents in circadian clock regulation and in Chlamydomonas additionally in life cycle control. Moreover, CPF1 even performs light-driven DNA repair. The plant cryptochrome and CPF1 are UVA/blue light receptors, whereas the animal-like cryptochrome responds to almost the whole visible spectrum including red light. Accordingly, plant cryptochrome, animal-like cryptochrome and CPF1 differ fundamentally in their structural response to light as revealed by their visible and infrared spectroscopic signatures, and in the role of the flavin neutral radical acting as dark form or signaling state. Copyright © 2017 Elsevier GmbH. All rights reserved.

Derivation of human differential photoreceptor-like cells from the iris by defined combinations of CRX, RX and NEUROD.

Directory of Open Access Journals (Sweden)

Yuko Seko

Full Text Available Examples of direct differentiation by defined transcription factors have been provided for beta-cells, cardiomyocytes and neurons. In the human visual system, there are four kinds of photoreceptors in the retina. Neural retina and iris-pigmented epithelium (IPE share a common developmental origin, leading us to test whether human iris cells could differentiate to retinal neurons. We here define the transcription factor combinations that can determine human photoreceptor cell fate. Expression of rhodopsin, blue opsin and green/red opsin in induced photoreceptor cells were dependent on combinations of transcription factors: A combination of CRX and NEUROD induced rhodopsin and blue opsin, but did not induce green opsin; a combination of CRX and RX induced blue opsin and green/red opsin, but did not induce rhodopsin. Phototransduction-related genes as well as opsin genes were up-regulated in those cells. Functional analysis; i.e. patch clamp recordings, clearly revealed that generated photoreceptor cells, induced by CRX, RX and NEUROD, responded to light. The response was an inward current instead of the typical outward current. These data suggest that photosensitive photoreceptor cells can be generated by combinations of transcription factors. The combination of CRX and RX generate immature photoreceptors: and additional NEUROD promotes maturation. These findings contribute substantially to a major advance toward eventual cell-based therapy for retinal degenerative diseases.

Characterization of photoreceptor cell types in the little brown bat Myotis lucifugus (Vespertilionidae).

Science.gov (United States)

Feller, K D; Lagerholm, S; Clubwala, R; Silver, M T; Haughey, D; Ryan, J M; Loew, E R; Deutschlander, M E; Kenyon, K L

2009-12-01

We report the expression of three visual opsins in the retina of the little brown bat (Myotis lucifugus, Vespertilionidae). Gene sequences for a rod-specific opsin and two cone-specific opsins were cloned from cDNA derived from bat eyes. Comparative sequence analyses indicate that the two cone opsins correspond to an ultraviolet short-wavelength opsin (SWS1) and a long-wavelength opsin (LWS). Immunocytochemistry using antisera to visual opsins revealed that the little brown bat retina contains two types of cone photoreceptors within a rod-dominated background. However, unlike other mammalian photoreceptors, M. lucifugus cones and rods are morphologically indistinguishable by light microscopy. Both photoreceptor types have a thin, elongated outer segment. Using microspectrophotometry we classified the absorption spectrum for the ubiquitous rods. Similar to other mammals, bat rhodopsin has an absorption peak near 500 nm. Although we were unable to confirm a spectral range, cellular and molecular analyses indicate that M. lucifugus expresses two types of cone visual pigments located within the photoreceptor layer. This study provides important insights into the visual capacity of a nocturnal microchiropteran species.

Restoration of vision after transplantation of photoreceptors.

Science.gov (United States)

Pearson, R A; Barber, A C; Rizzi, M; Hippert, C; Xue, T; West, E L; Duran, Y; Smith, A J; Chuang, J Z; Azam, S A; Luhmann, U F O; Benucci, A; Sung, C H; Bainbridge, J W; Carandini, M; Yau, K-W; Sowden, J C; Ali, R R

2012-05-03

Cell transplantation is a potential strategy for treating blindness caused by the loss of photoreceptors. Although transplanted rod-precursor cells are able to migrate into the adult retina and differentiate to acquire the specialized morphological features of mature photoreceptor cells, the fundamental question remains whether transplantation of photoreceptor cells can actually improve vision. Here we provide evidence of functional rod-mediated vision after photoreceptor transplantation in adult Gnat1−/− mice, which lack rod function and are a model of congenital stationary night blindness. We show that transplanted rod precursors form classic triad synaptic connections with second-order bipolar and horizontal cells in the recipient retina. The newly integrated photoreceptor cells are light-responsive with dim-flash kinetics similar to adult wild-type photoreceptors. By using intrinsic imaging under scotopic conditions we demonstrate that visual signals generated by transplanted rods are projected to higher visual areas, including V1. Moreover, these cells are capable of driving optokinetic head tracking and visually guided behaviour in the Gnat1−/− mouse under scotopic conditions. Together, these results demonstrate the feasibility of photoreceptor transplantation as a therapeutic strategy for restoring vision after retinal degeneration.

Role of kinesin heavy chain in Crumbs localization along the rhabdomere elongation in Drosophila photoreceptor.

Directory of Open Access Journals (Sweden)

Garrett P League

Full Text Available BACKGROUND: Crumbs (Crb, a cell polarity gene, has been shown to provide a positional cue for the extension of the apical membrane domain, adherens junction (AJ, and rhabdomere along the growing proximal-distal axis during Drosophila photoreceptor morphogenesis. In developing Drosophila photoreceptors, a stabilized microtubule structure was discovered and its presence was linked to polarity protein localization. It was therefore hypothesized that the microtubules may provide trafficking routes for the polarity proteins during photoreceptor morphogenesis. This study has examined whether Kinesin heavy chain (Khc, a subunit of the microtubule-based motor Kinesin-1, is essential in polarity protein localization in developing photoreceptors. METHODOLOGY/PRINCIPAL FINDINGS: Because a genetic interaction was found between crb and khc, Crb localization was examined in the developing photoreceptors of khc mutants. khc was dispensable during early eye differentiation and development. However, khc mutant photoreceptors showed a range of abnormalities in the apical membrane domain depending on the position along the proximal-distal axis in pupal photoreceptors. The khc mutant showed a progressive mislocalization in the apical domain along the distal-proximal axis during rhabdomere elongation. The khc mutation also led to a similar progressive defect in the stabilized microtubule structures, strongly suggesting that Khc is essential for microtubule structure and Crb localization during distal to proximal rhabdomere elongation in pupal morphogenesis. This role of Khc in apical domain control was further supported by khc's gain-of-function phenotype. Khc overexpression in photoreceptors caused disruption of the apical membrane domain and the stabilized microtubules in the developing photoreceptors. CONCLUSIONS/SIGNIFICANCE: In summary, we examined the role of khc in the regulation of the apical Crb domain in developing photoreceptors. Since the rhabdomeres in

The genetics of some planthormones and photoreceptors in Arabidopsis thaliana (L.) Heynh.

NARCIS (Netherlands)

Koornneef, M.

1982-01-01

This thesis describes the isolation and characterization in Arabidopsis thaliana (L.) Heynh. of induced mutants, deficient for gibberellins (GA's), abscisic acid (ABA) and photoreceptors.

These compounds are known to regulate various facets of plant growth and

Localization and expression of clarin-1, the Clrn1 gene product, in auditory hair cells and photoreceptors

Science.gov (United States)

Zallocchi, Marisa; Meehan, Daniel T.; Delimont, Duane; Askew, Charles; Garrige, Suneetha; Gratton, Michael Anne; Rothermund-Franklin, Christie A.; Cosgrove, Dominic

2009-01-01

The Usher syndrome 3A (CLRN1) gene encodes clarin-1, which is a member of the tetraspanin family of transmembrane proteins. Although identified more than 6 years ago, little is known about its localization or function in the eye and ear. We developed a polyclonal antibody that react with all clarin-1 isoforms and used it to characterize protein expression in cochlea and retina. In the cochlea, we observe clarin-1expression in the stereocilia of P0 mice, and in synaptic terminals present at the base of the auditory hair cells from E18 to P6. In the retina, clarin-1 localizes to the connecting cilia, inner segment of photoreceptors and to the ribbon synapses. RT-PCR from P0 cochlea and P28 retina show mRNAs encoding only isoforms 2 and 3. Western-blots show that only isoform 2 is present in protein extracts from these same tissues. We examined clarin-1 expression in the immortomouse-derived hair cell line UB/OC-1. Only isoform 2 is expressed in UB/OC-1 at both mRNA and protein levels, suggesting this isoform is biologically relevant to hair cell function. The protein co-localizes with microtubules and post-transgolgi vesicles. The sub-cellular localization of clarin-1 in hair cells and photoreceptors suggests it functions at both the basal and apical poles of neurosensoriepithelia. PMID:19539019

Hypoxic preconditioning protects photoreceptors against light damage independently of hypoxia inducible transcription factors in rods.

Science.gov (United States)

Kast, Brigitte; Schori, Christian; Grimm, Christian

2016-05-01

Hypoxic preconditioning protects photoreceptors against light-induced degeneration preserving retinal morphology and function. Although hypoxia inducible transcription factors 1 and 2 (HIF1, HIF2) are the main regulators of the hypoxic response, photoreceptor protection does not depend on HIF1 in rods. Here we used rod-specific Hif2a single and Hif1a;Hif2a double knockout mice to investigate the potential involvement of HIF2 in rods for protection after hypoxic preconditioning. To identify potential HIF2 target genes in rods we determined the retinal transcriptome of hypoxic control and rod-specific Hif2a knockouts by RNA sequencing. We show that rods do not need HIF2 for hypoxia-induced increased survival after light exposure. The transcriptomic analysis revealed a number of genes that are potentially regulated by HIF2 in rods; among those were Htra1, Timp3 and Hmox1, candidates that are interesting due to their connection to human degenerative diseases of the retina. We conclude that neither HIF1 nor HIF2 are required in photoreceptors for protection by hypoxic preconditioning. We hypothesize that HIF transcription factors may be needed in other cells to produce protective factors acting in a paracrine fashion on photoreceptor cells. Alternatively, hypoxic preconditioning induces a rod-intrinsic response that is independent of HIF transcription factors. Copyright © 2015 Elsevier Ltd. All rights reserved.

Activin Signals through SMAD2/3 to Increase Photoreceptor Precursor Yield during Embryonic Stem Cell Differentiation.

Science.gov (United States)

Lu, Amy Q; Popova, Evgenya Y; Barnstable, Colin J

2017-09-12

In vitro differentiation of mouse embryonic stem cells (ESCs) into retinal fates can be used to study the roles of exogenous factors acting through multiple signaling pathways during retina development. Application of activin A during a specific time frame that corresponds to early embryonic retinogenesis caused increased generation of CRX + photoreceptor precursors and decreased PAX6 + retinal progenitor cells (RPCs). Following activin A treatment, SMAD2/3 was activated in RPCs and bound to promoter regions of key RPC and photoreceptor genes. The effect of activin on CRX expression was repressed by pharmacological inhibition of SMAD2/3 phosphorylation. Activin signaling through SMAD2/3 in RPCs regulates expression of transcription factors involved in cell type determination and promotes photoreceptor lineage specification. Our findings can contribute to the production of photoreceptors for cell replacement therapy. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Excessive Myosin Activity in Mbs Mutants Causes Photoreceptor Movement Out of the Drosophila Eye Disc Epithelium

OpenAIRE

Lee, Arnold; Treisman, Jessica E.

2004-01-01

Neuronal cells must extend a motile growth cone while maintaining the cell body in its original position. In migrating cells, myosin contraction provides the driving force that pulls the rear of the cell toward the leading edge. We have characterized the function of myosin light chain phosphatase, which down-regulates myosin activity, in Drosophila photoreceptor neurons. Mutations in the gene encoding the myosin binding subunit of this enzyme cause photoreceptors to drop out of the eye disc e...

Dynamical adaptation in photoreceptors.

Directory of Open Access Journals (Sweden)

Damon A Clark

Full Text Available Adaptation is at the heart of sensation and nowhere is it more salient than in early visual processing. Light adaptation in photoreceptors is doubly dynamical: it depends upon the temporal structure of the input and it affects the temporal structure of the response. We introduce a non-linear dynamical adaptation model of photoreceptors. It is simple enough that it can be solved exactly and simulated with ease; analytical and numerical approaches combined provide both intuition on the behavior of dynamical adaptation and quantitative results to be compared with data. Yet the model is rich enough to capture intricate phenomenology. First, we show that it reproduces the known phenomenology of light response and short-term adaptation. Second, we present new recordings and demonstrate that the model reproduces cone response with great precision. Third, we derive a number of predictions on the response of photoreceptors to sophisticated stimuli such as periodic inputs, various forms of flickering inputs, and natural inputs. In particular, we demonstrate that photoreceptors undergo rapid adaptation of response gain and time scale, over ∼ 300[Formula: see text] ms-i. e., over the time scale of the response itself-and we confirm this prediction with data. For natural inputs, this fast adaptation can modulate the response gain more than tenfold and is hence physiologically relevant.

Photoreceptor Sensory Cilium: Traversing the Ciliary Gate

Directory of Open Access Journals (Sweden)

Hemant Khanna

2015-10-01

Full Text Available Cilia are antenna-like extensions of the plasma membrane found in nearly all cell types. In the retina of the eye, photoreceptors develop unique sensory cilia. Not much was known about the mechanisms underlying the formation and function of photoreceptor cilia, largely because of technical limitations and the specific structural and functional modifications that cannot be modeled in vitro. With recent advances in microscopy techniques and molecular and biochemical approaches, we are now beginning to understand the molecular basis of photoreceptor ciliary architecture, ciliary function and its involvement in human diseases. Here, I will discuss the studies that have revealed new knowledge of how photoreceptor cilia regulate their identity and function while coping with high metabolic and trafficking demands associated with processing light signal.

Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment.

Science.gov (United States)

Schietroma, Cataldo; Parain, Karine; Estivalet, Amrit; Aghaie, Asadollah; Boutet de Monvel, Jacques; Picaud, Serge; Sahel, José-Alain; Perron, Muriel; El-Amraoui, Aziz; Petit, Christine

2017-06-05

Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis , these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23 , encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15-containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. © 2017 Schietroma et al.

Functional photoreceptor loss revealed with adaptive optics: an alternate cause of color blindness.

Science.gov (United States)

Carroll, Joseph; Neitz, Maureen; Hofer, Heidi; Neitz, Jay; Williams, David R

2004-06-01

There is enormous variation in the X-linked L/M (long/middle wavelength sensitive) gene array underlying "normal" color vision in humans. This variability has been shown to underlie individual variation in color matching behavior. Recently, red-green color blindness has also been shown to be associated with distinctly different genotypes. This has opened the possibility that there may be important phenotypic differences within classically defined groups of color blind individuals. Here, adaptive optics retinal imaging has revealed a mechanism for producing dichromatic color vision in which the expression of a mutant cone photopigment gene leads to the loss of the entire corresponding class of cone photoreceptor cells. Previously, the theory that common forms of inherited color blindness could be caused by the loss of photoreceptor cells had been discounted. We confirm that remarkably, this loss of one-third of the cones does not impair any aspect of vision other than color.

Patterns of nucleotide diversity at photoperiod related genes in Norway spruce [Picea abies (L.) Karst].

Science.gov (United States)

Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin

2014-01-01

The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce.

Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

Directory of Open Access Journals (Sweden)

Ivette M Sandoval

Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

Derivation of Traceable and Transplantable Photoreceptors from Mouse Embryonic Stem Cells

Directory of Open Access Journals (Sweden)

Sarah Decembrini

2014-06-01

Full Text Available Retinal degenerative diseases resulting in the loss of photoreceptors are one of the major causes of blindness. Photoreceptor replacement therapy is a promising treatment because the transplantation of retina-derived photoreceptors can be applied now to different murine retinopathies to restore visual function. To have an unlimited source of photoreceptors, we derived a transgenic embryonic stem cell (ESC line in which the Crx-GFP transgene is expressed in photoreceptors and assessed the capacity of a 3D culture protocol to produce integration-competent photoreceptors. This culture system allows the production of a large number of photoreceptors recapitulating the in vivo development. After transplantation, integrated cells showed the typical morphology of mature rods bearing external segments and ribbon synapses. We conclude that a 3D protocol coupled with ESCs provides a safe and renewable source of photoreceptors displaying a development and transplantation competence comparable to photoreceptors from age-matched retinas.

Moderate Light-Induced Degeneration of Rod Photoreceptors with Delayed Transducin Translocation in shaker1 Mice

Science.gov (United States)

Zallocchi, Marisa; Wang, Wei-Min; Delimont, Duane; Cosgrove, Dominic

2011-01-01

Purpose. Usher syndrome is characterized by congenital deafness associated with retinitis pigmentosa (RP). Mutations in the myosin VIIa gene (MYO7A) cause a common and severe subtype of Usher syndrome (USH1B). Shaker1 mice have mutant MYO7A. They are deaf and have vestibular dysfunction but do not develop photoreceptor degeneration. The goal of this study was to investigate abnormalities of photoreceptors in shaker1 mice. Methods. Immunocytochemistry and hydroethidine-based detection of intracellular superoxide production were used. Photoreceptor cell densities under various conditions of light/dark exposures were evaluated. Results. In shaker1 mice, the rod transducin translocation is delayed because of a shift of its light activation threshold to a higher level. Even moderate light exposure can induce oxidative damage and significant rod degeneration in shaker1 mice. Shaker1 mice reared under a moderate light/dark cycle develop severe retinal degeneration in less than 6 months. Conclusions. These findings show that, contrary to earlier studies, shaker1 mice possess a robust retinal phenotype that may link to defective rod protein translocation. Importantly, USH1B animal models are likely vulnerable to light-induced photoreceptor damage, even under moderate light. PMID:21447681

Usher syndrome type 1–associated cadherins shape the photoreceptor outer segment

Science.gov (United States)

Parain, Karine; Aghaie, Asadollah; Picaud, Serge

2017-01-01

Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis, these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23, encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15–containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. PMID:28495838

RPGR: Its role in photoreceptor physiology, human disease, and future therapies.

Science.gov (United States)

Megaw, Roly D; Soares, Dinesh C; Wright, Alan F

2015-09-01

Mammalian photoreceptors contain specialised connecting cilia that connect the inner (IS) to the outer segments (OS). Dysfunction of the connecting cilia due to mutations in ciliary proteins are a common cause of the inherited retinal dystrophy retinitis pigmentosa (RP). Mutations affecting the Retinitis Pigmentosa GTPase Regulator (RPGR) protein is one such cause, affecting 10-20% of all people with RP and the majority of those with X-linked RP. RPGR is located in photoreceptor connecting cilia. It interacts with a wide variety of ciliary proteins, but its exact function is unknown. Recently, there have been important advances both in our understanding of RPGR function and towards the development of a therapy. This review summarises the existing literature on human RPGR function and dysfunction, and suggests that RPGR plays a role in the function of the ciliary gate, which controls access of both membrane and soluble proteins to the photoreceptor outer segment. We discuss key models used to investigate and treat RPGR disease and suggest that gene augmentation therapy offers a realistic therapeutic approach, although important questions still remain to be answered, while cell replacement therapy based on retinal progenitor cells represents a more distant prospect. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Expression of Root Genes in Arabidopsis Seedlings Grown by Standard and Improved Growing Methods.

Science.gov (United States)

Qu, Yanli; Liu, Shuai; Bao, Wenlong; Xue, Xian; Ma, Zhengwen; Yokawa, Ken; Baluška, František; Wan, Yinglang

2017-05-03

Roots of Arabidopsis thaliana seedlings grown in the laboratory using the traditional plant-growing culture system (TPG) were covered to maintain them in darkness. This new method is based on a dark chamber and is named the improved plant-growing method (IPG). We measured the light conditions in dark chambers, and found that the highest light intensity was dramatically reduced deeper in the dark chamber. In the bottom and side parts of dark chambers, roots were almost completely shaded. Using the high-throughput RNA sequencing method on the whole RNA extraction from roots, we compared the global gene expression levels in roots of seedlings from these two conditions and identified 141 differently expressed genes (DEGs) between them. According to the KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment, the flavone and flavonol biosynthesis and flavonoid biosynthesis pathways were most affected among all annotated pathways. Surprisingly, no genes of known plant photoreceptors were identified as DEGs by this method. Considering that the light intensity was decreased in the IPG system, we collected four sections (1.5 cm for each) of Arabidopsis roots grown in TPG and IPG conditions, and the spatial-related differential gene expression levels of plant photoreceptors and polar auxin transporters, including CRY1 , CRY2 , PHYA , PHYB , PHOT1 , PHOT2 , and UVR8 were analyzed by qRT-PCR. Using these results, we generated a map of the spatial-related expression patterns of these genes under IPG and TPG conditions. The expression levels of light-related genes in roots is highly sensitive to illumination and it provides a background reference for selecting an improved culture method for laboratory-maintained Arabidopsis seedlings.

Genetic Dissection of Dual Roles for the Transcription Factor six7 in Photoreceptor Development and Patterning in Zebrafish.

Directory of Open Access Journals (Sweden)

Mailin Sotolongo-Lopez

2016-04-01

Full Text Available The visual system of a particular species is highly adapted to convey detailed ecological and behavioral information essential for survival. The consequences of structural mutations of opsins upon spectral sensitivity and environmental adaptation have been studied in great detail, but lacking is knowledge of the potential influence of alterations in gene regulatory networks upon the diversity of cone subtypes and the variation in the ratio of rods and cones observed in numerous diurnal and nocturnal species. Exploiting photoreceptor patterning in cone-dominated zebrafish, we uncovered two independent mechanisms by which the sine oculis homeobox homolog 7 (six7 regulates photoreceptor development. In a genetic screen, we isolated the lots-of-rods-junior (ljrp23ahub mutation that resulted in an increased number and uniform distribution of rods in otherwise normal appearing larvae. Sequence analysis, genome editing using TALENs and knockdown strategies confirm ljrp23ahub as a hypomorphic allele of six7, a teleost orthologue of six3, with known roles in forebrain patterning and expression of opsins. Based on the lack of predicted protein-coding changes and a deletion of a conserved element upstream of the transcription start site, a cis-regulatory mutation is proposed as the basis of the reduced expression of six7 in ljrp23ahub. Comparison of the phenotypes of the hypomorphic and knock-out alleles provides evidence of two independent roles in photoreceptor development. EdU and PH3 labeling show that the increase in rod number is associated with extended mitosis of photoreceptor progenitors, and TUNEL suggests that the lack of green-sensitive cones is the result of cell death of the cone precursor. These data add six7 to the small but growing list of essential genes for specification and patterning of photoreceptors in non-mammalian vertebrates, and highlight alterations in transcriptional regulation as a potential source of photoreceptor variation

Transcriptomic analysis of human retinal detachment reveals both inflammatory response and photoreceptor death.

Directory of Open Access Journals (Sweden)

Marie-Noëlle Delyfer

Full Text Available BACKGROUND: Retinal detachment often leads to a severe and permanent loss of vision and its therapeutic management remains to this day exclusively surgical. We have used surgical specimens to perform a differential analysis of the transcriptome of human retinal tissues following detachment in order to identify new potential pharmacological targets that could be used in combination with surgery to further improve final outcome. METHODOLOGY/PRINCIPAL FINDINGS: Statistical analysis reveals major involvement of the immune response in the disease. Interestingly, using a novel approach relying on coordinated expression, the interindividual variation was monitored to unravel a second crucial aspect of the pathological process: the death of photoreceptor cells. Within the genes identified, the expression of the major histocompatibility complex I gene HLA-C enables diagnosis of the disease, while PKD2L1 and SLCO4A1 -which are both down-regulated- act synergistically to provide an estimate of the duration of the retinal detachment process. Our analysis thus reveals the two complementary cellular and molecular aspects linked to retinal detachment: an immune response and the degeneration of photoreceptor cells. We also reveal that the human specimens have a higher clinical value as compared to artificial models that point to IL6 and oxidative stress, not implicated in the surgical specimens studied here. CONCLUSIONS/SIGNIFICANCE: This systematic analysis confirmed the occurrence of both neurodegeneration and inflammation during retinal detachment, and further identifies precisely the modification of expression of the different genes implicated in these two phenomena. Our data henceforth give a new insight into the disease process and provide a rationale for therapeutic strategies aimed at limiting inflammation and photoreceptor damage associated with retinal detachment and, in turn, improving visual prognosis after retinal surgery.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Science.gov (United States)

Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

2014-01-01

Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Photoreceptor layer map using spectral-domain optical coherence tomography.

Science.gov (United States)

Lee, Ji Eun; Lim, Dae Won; Bae, Han Yong; Park, Hyun Jin

2009-12-01

To develop a novel method for analysis of the photoreceptor layer map (PLM) generated using spectral-domain optical coherence tomography (OCT). OCT scans were obtained from 20 eyes, 10 with macular holes (MH) and 10 with central serous chorioretinopathy (CSC) using the Macular Cube (512 x 128) protocol of the Cirrus HD-OCT (Carl Zeiss). The scanned data were processed using embedded tools of the advanced visualization. A partial thickness OCT fundus image of the photoreceptor layer was generated by setting the region of interest to a 50-microm thick layer that was parallel and adjacent to the retinal pigment epithelium. The resulting image depicted the photoreceptor layer as a map of the reflectivity in OCT. The PLM was compared with fundus photography, auto-fluorescence, tomography, and retinal thickness map. The signal from the photoreceptor layer of every OCT scan in each case was demonstrated as a single image of PLM in a fundus photograph fashion. In PLM images, detachment of the sensory retina is depicted as a hypo-reflective area, which represents the base of MH and serous detachment in CSC. Relative hypo-reflectivity, which was also noted at closed MH and at recently reattached retina in CSC, was associated with reduced signal from the junction between the inner and outer segments of photoreceptors in OCT images. Using PLM, changes in the area of detachment and reflectivity of the photoreceptor layer could be efficiently monitored. The photoreceptor layer can be analyzed as a map using spectral-domain OCT. In the treatment of both MH and CSC, PLM may provide new pathological information about the photoreceptor layer to expand our understanding of these diseases.

PlantTribes: a gene and gene family resource for comparative genomics in plants

OpenAIRE

Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

2007-01-01

The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

Blue light alters miR167 expression and microRNA-targeted auxin response factor genes in Arabidopsis thaliana plants.

Science.gov (United States)

Pashkovskiy, Pavel P; Kartashov, Alexander V; Zlobin, Ilya E; Pogosyan, Sergei I; Kuznetsov, Vladimir V

2016-07-01

The effect of blue LED (450 nm) on the photomorphogenesis of Arabidopsis thaliana Col-0 plants and the transcript levels of several genes, including miRNAs, photoreceptors and auxin response factors (ARF) was investigated. It was observed that blue light accelerated the generative development, reduced the rosette leaf number, significantly reduced the leaf area, dry biomass and led to the disruption of conductive tissue formation. The blue LED differentially influenced the transcript levels of several phytochromes (PHY a, b, c, d, and e), cryptochromes (CRY 1 and 2) and phototropins (PHOT 1 and 2). At the same time, the blue LED significantly increased miR167 expression compared to a fluorescent lamp or white LEDs. This increase likely resulted in the enhanced transcription of the auxin response factor genes ARF4 and ARF8, which are regulated by this miRNA. These findings support the hypothesis that the effects of blue light on A. thaliana are mediated by auxin signalling pathway involving miRNA-dependent regulation of ARF gene expression. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

Directory of Open Access Journals (Sweden)

Feng-Yu Wang

Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

Hif1a inactivation rescues photoreceptor degeneration induced by a chronic hypoxia-like stress.

Science.gov (United States)

Barben, Maya; Ail, Divya; Storti, Federica; Klee, Katrin; Schori, Christian; Samardzija, Marijana; Michalakis, Stylianos; Biel, Martin; Meneau, Isabelle; Blaser, Frank; Barthelmes, Daniel; Grimm, Christian

2018-04-17

Reduced choroidal blood flow and tissue changes in the ageing human eye impair oxygen delivery to photoreceptors and the retinal pigment epithelium. As a consequence, mild but chronic hypoxia may develop and disturb cell metabolism, function and ultimately survival, potentially contributing to retinal pathologies such as age-related macular degeneration (AMD). Here, we show that several hypoxia-inducible genes were expressed at higher levels in the aged human retina suggesting increased activity of hypoxia-inducible transcription factors (HIFs) during the physiological ageing process. To model chronically elevated HIF activity and investigate ensuing consequences for photoreceptors, we generated mice lacking von Hippel Lindau (VHL) protein in rods. This activated HIF transcription factors and led to a slowly progressing retinal degeneration in the ageing mouse retina. Importantly, this process depended mainly on HIF1 with only a minor contribution of HIF2. A gene therapy approach using AAV-mediated RNA interference through an anti-Hif1a shRNA significantly mitigated the degeneration suggesting a potential intervention strategy that may be applicable to human patients.

Gnaz couples the circadian and dopaminergic system to G protein-mediated signaling in mouse photoreceptors.

Directory of Open Access Journals (Sweden)

Patrick Vancura

Full Text Available The mammalian retina harbors a circadian clockwork that regulates vision and promotes healthiness of retinal neurons, mainly through directing the rhythmic release of the neurohormones dopamine-acting on dopamine D4 receptors-and melatonin-acting on MT1 and MT2 receptors. The gene Gnaz-a unique Gi/o subfamily member-was seen in the present study to be expressed in photoreceptors where its protein product Gαz shows a daily rhythm in its subcellular localization. Apart from subcellular localization, Gnaz displays a daily rhythm in expression-with peak values at night-in preparations of the whole retina, microdissected photoreceptors and photoreceptor-related pinealocytes. In retina, Gnaz rhythmicity was observed to persist under constant darkness and to be abolished in retina deficient for Clock or dopamine D4 receptors. Furthermore, circadian regulation of Gnaz was disturbed in the db/db mouse, a model of diabetic retinopathy. The data of the present study suggest that Gnaz links the circadian clockwork-via dopamine acting on D4 receptors-to G protein-mediated signaling in intact but not diabetic retina.

[Modification of retinal photoreceptor membranes and Ca ion binding].

Science.gov (United States)

Korchagin, V P; Berman, A L; Shukoliukov, S A; Rychkova, M P; Etingof, R N

1978-10-01

Calcium binding by modified photoreceptor membranes of cattle retina has been studied. Ca2+-binding the membranes significantly changes after C-phospholipase treatment, displaying the initial growth (less than 65% of lipid phosphorus removed) with subsequent decrease (more than 65% of phosphorus removed). Liposomes of the photoreceptor membranes lipids were found to bind more calcium than do the native photoreceptor membranes. Proteolytic enzymes (papaine, pronase) splitting some rhodopsin fragments do not affect the ability of the membrane to bind Ca2+. The increase of light-induced Ca-binding is observed only after the outer segments preincubation under conditions providing for rhodopsin phosphorylation. This effect was observed also after the splitting of the rhodopsin fragment by papaine. It is concluded that calcium binding in the photoreceptor membranes is mainly due to the phosphate groups of phospholipids.

Human Usher 1B/mouse shaker-1: the retinal phenotype discrepancy explained by the presence/absence of myosin VIIA in the photoreceptor cells.

Science.gov (United States)

el-Amraoui, A; Sahly, I; Picaud, S; Sahel, J; Abitbol, M; Petit, C

1996-08-01

Usher syndrome type 1 (USH1) associates severe congenital deafness, vestibular dysfunction and progressive retinitis pigmentosa leading to blindness. The gene encoding myosin VIIA is responsible for USH1B. Mutations in the murine orthologous gene lead to the shaker-1 phenotype, which manifests cochlear and vestibular dysfunction, without any retinal defect. To address this phenotypic discrepancy, the expression of myosin VIIA in retinal cells was analyzed in human and mouse during embryonic development and adult life. In the human embryo, myosin VIIA was present first in the pigment epithelium cells, and later in these cells as well as in the photoreceptor cells. In the adult human retina, myosin VIIA was present in both cell types. In contrast, in mouse, only pigment epithelium cells expressed the protein throughout development and adult life. Myosin VIIA was also found to be absent in the photoreceptor cells of other rodents (rat and guinea-pig), whereas these cells expressed the protein in amphibians, avians and primates. These observations suggest that retinitis pigmentosa of USH1B results from a primary rod and cone defect. The USH1B/shaker-1 paradigm illustrates a species-specific cell pattern of gene expression as a possible cause for the discrepancy between phenotypes involving defective orthologous genes in man and mouse. Interestingly, in the photoreceptor cells, myosin VIIA is mainly localized in the inner and base of outer segments as well as in the synaptic ending region where it is co-localized with the synaptic vesicles. Therefore, we suggest that myosin VIIA might play a role in the trafficking of ribbon-synaptic vesicle complexes and the renewal processes of the outer photoreceptor disks.

NADPH Oxidase Contributes to Photoreceptor Degeneration in Constitutively Active RAC1 Mice

Science.gov (United States)

Song, Hongman; Vijayasarathy, Camasamudram; Zeng, Yong; Marangoni, Dario; Bush, Ronald A.; Wu, Zhijian; Sieving, Paul A.

2016-01-01

Purpose The active form of small GTPase RAC1 is required for activation of NADPH oxidase (NOX), which in turn generates reactive oxygen species (ROS) in nonphagocytic cells. We explored whether NOX-induced oxidative stress contributes to rod degeneration in retinas expressing constitutively active (CA) RAC1. Methods Transgenic (Tg)–CA-RAC1 mice were given apocynin (10 mg/kg, intraperitoneal), a NOX inhibitor, or vehicle daily for up to 13 weeks. Superoxide production and oxidative damage were assessed by dihydroethidium staining and by protein carbonyls and malondialdehyde levels, respectively. Outer nuclear layer (ONL) cells were counted and electroretinogram (ERG) amplitudes measured in Tg-CA-RAC1 mice. Outer nuclear layer cells were counted in wild-type (WT) mice after transfer of CA-Rac1 gene by subretinal injection of AAV8-pOpsin-CA Rac1-GFP. Results Transgenic-CA-RAC1 retinas had significantly fewer photoreceptor cells and more apoptotic ONL cells than WT controls from postnatal week (Pw) 3 to Pw13. Superoxide accumulation and protein and lipid oxidation were increased in Tg-CA-RAC1 retinas and were reduced in mice treated with apocynin. Apocynin reduced the loss of photoreceptors and increased the rod ERG a- and b-wave amplitudes when compared with vehicle-injected transgenic controls. Photoreceptor loss was also observed in regions of adult WT retina transduced with AAV8-pOpsin-CA Rac1-GFP but not in neighboring regions that were not transduced or in AAV8-pOpsin-GFP–transduced retinas. Conclusions Constitutively active RAC1 promotes photoreceptor cell death by oxidative damage that occurs, at least partially, through NOX-induced ROS. Reactive oxygen species are likely involved in multiple forms of retinal degenerations, and our results support investigating RAC1 inhibition as a therapeutic approach that targets this disease pathway. PMID:27233035

Responses of photoreceptors in Hermissenda.

Science.gov (United States)

Akon, D L; Fuortes, M G

1972-12-01

The five photoreceptors in the eye of the mollusc Hermissenda crassicornis respond to light with depolarization and firing of impulses. The impulses of any one cell inhibit other cells, but the degree of inhibition differs in different pairs. Evidence is presented to show that the interactions occur at terminal branches of the photoreceptor axons, inside the cerebropleural ganglion. Properties of the generator potential are examined and it is shown that the depolarization develops in two phases which are affected differently by extrinsic currents. Finally, it is shown that by enhancing the differences in the responses of individual cells to a variety of stimuli, the interactions may facilitate a number of simple discriminations.

Identification of endogenous fluorophores in the photoreceptors using autofluorescence spectroscopy

Science.gov (United States)

Zhao, Lingling; Qu, Junle; Niu, Hanben

2007-11-01

In this paper, we present our investigation on the identification of endogenous fluorophores in photoreceptors using autofluorescence spectroscopy, which is performed with an inverted laser scanning confocal microscope equipped with an Argon ion laser and a GreNe laser. In our experiments, individual cones and rods are clearly resolved even in freshly prepared retina samples, without slicing or labeling. The experiment results show that autofluorescence spectrum of the photoreceptors has three peaks approximately at 525nm, 585nm and 665nm. Furthermore, the brightest autofluorescence originates from the photoreceptor outer segments. We can, therefore, come to a conclusion that the peaks at 525nm, 585nm are corresponding to FAD and A2-PE, respectively, which are distributed in the photoreceptor outer segments.

Generation, purification and transplantation of photoreceptors derived from human induced pluripotent stem cells.

Directory of Open Access Journals (Sweden)

Deepak A Lamba

2010-01-01

Full Text Available Inherited and acquired retinal degenerations are frequent causes of visual impairment and photoreceptor cell replacement therapy may restore visual function to these individuals. To provide a source of new retinal neurons for cell based therapies, we developed methods to derive retinal progenitors from human ES cells.In this report we have used a similar method to direct induced pluripotent stem cells (iPS from human fibroblasts to a retinal progenitor fate, competent to generate photoreceptors. We also found we could purify the photoreceptors derived from the iPS cells using fluorescence activated cell sorting (FACS after labeling photoreceptors with a lentivirus driving GFP from the IRBP cis-regulatory sequences. Moreover, we found that when we transplanted the FACS purified iPSC derived photoreceptors, they were able to integrate into a normal mouse retina and express photoreceptor markers.This report provides evidence that enriched populations of human photoreceptors can be derived from iPS cells.

Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules

Directory of Open Access Journals (Sweden)

Manuella Nóbrega Dourado

2013-12-01

Full Text Available Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules and/or by the plant roots (e.g. flavonoids, ethanol and methanol, respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones and plant exudates (including ethanol in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF, adaptation to stressful environment (crtI, phoU and sss, to interactions with plant metabolism compounds (acdS and pathogenicity (patatin and phoU. Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization, which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction.

Developmental and daily expression of the Pax4 and Pax6 homeobox genes in the rat retina: localization of Pax4 in photoreceptor cells

DEFF Research Database (Denmark)

Rath, Martin F; Bailey, Michael J; Kim, Jong-So

2009-01-01

Pax4 is a homeobox gene encoding Pax4, a transcription factor that is essential for embryonic development of the endocrine pancreas. In the pancreas, Pax4 counters the effects of the related transcription factor, Pax6, which is known to be essential for eye morphogenesis. In this study, we have...... in the foetal eye. Histological analysis revealed that Pax4 mRNA is exclusively expressed in the retinal photoreceptors, whereas Pax6 mRNA and protein are present in the inner nuclear layer and in the ganglion cell layer of the mature retina. In the adult retina, Pax4 transcripts exhibit a diurnal rhythm...

Characterization of multiple light damage paradigms reveals regional differences in photoreceptor loss.

Science.gov (United States)

Thomas, Jennifer L; Nelson, Craig M; Luo, Xixia; Hyde, David R; Thummel, Ryan

2012-04-01

Zebrafish provide an attractive model to study the retinal response to photoreceptor apoptosis due to its remarkable ability to spontaneously regenerate retinal neurons following damage. There are currently two widely-used light-induced retinal degeneration models to damage photoreceptors in the adult zebrafish. One model uses constant bright light, whereas the other uses a short exposure to extremely intense ultraviolet light. Although both models are currently used, it is unclear whether they differ in regard to the extent of photoreceptor damage or the subsequent regeneration response. Here we report a thorough analysis of the photoreceptor damage and subsequent proliferation response elicited by each individual treatment, as well as by the concomitant use of both treatments. We show a differential loss of rod and cone photoreceptors with each treatment. Additionally, we show that the extent of proliferation observed in the retina directly correlates with the severity of photoreceptor loss. We also demonstrate that both the ventral and posterior regions of the retina are partially protected from light damage. Finally, we show that combining a short ultraviolet exposure followed by a constant bright light treatment largely eliminates the neuroprotected regions, resulting in widespread loss of rod and cone photoreceptors and a robust regenerative response throughout the retina. Copyright © 2012 Elsevier Ltd. All rights reserved.

Three distinct roles for notch in Drosophila R7 photoreceptor specification.

Directory of Open Access Journals (Sweden)

Andrew Tomlinson

2011-08-01

Full Text Available Receptor tyrosine kinases (RTKs and Notch (N proteins are different types of transmembrane receptors that transduce extracellular signals and control cell fate. Here we examine cell fate specification in the Drosophila retina and ask how N acts together with the RTKs Sevenless (Sev and the EGF receptor (DER to specify the R7 photoreceptor. The retina is composed of many hundred ommatidia, each of which grows by recruiting surrounding, undifferentiated cells and directing them to particular fates. The R7 photoreceptor derives from a cohort of three cells that are incorporated together following specification of the R2-R5 and R8 photoreceptors. Two cells of the cohort are specified as the R1/6 photoreceptor type by DER activation. These cells then activate N in the third cell (the R7 precursor. By manipulation of N and RTK signaling in diverse combinations we establish three roles for N in specifying the R7 fate. The first role is to impose a block to photoreceptor differentiation; a block that DER activation cannot overcome. The second role, paradoxically, is to negate the first; Notch activation up-regulates Sev expression, enabling the presumptive R7 cell to receive an RTK signal from R8 that can override the block. The third role is to specify the cell as an R7 rather than an R1/6 once RTK signaling has specified the cells as a photoreceptor. We speculate why N acts both to block and to facilitate photoreceptor differentiation, and provide a model for how N and RTK signaling act combinatorially to specify the R1/6 and R7 photoreceptors as well as the surrounding non-neuronal cone cells.

Mutually exclusive expression of human red and green visual pigment-reporter transgenes occurs at high frequency in murine cone photoreceptors.

Science.gov (United States)

Wang, Y; Smallwood, P M; Cowan, M; Blesh, D; Lawler, A; Nathans, J

1999-04-27

This study examines the mechanism of mutually exclusive expression of the human X-linked red and green visual pigment genes in their respective cone photoreceptors by asking whether this expression pattern can be produced in a mammal that normally carries only a single X-linked visual pigment gene. To address this question, we generated transgenic mice that carry a single copy of a minimal human X chromosome visual pigment gene array in which the red and green pigment gene transcription units were replaced, respectively, by alkaline phosphatase and beta-galactosidase reporters. As determined by histochemical staining, the reporters are expressed exclusively in cone photoreceptor cells. In 20 transgenic mice carrying any one of three independent transgene insertion events, an average of 63% of expressing cones have alkaline phosphatase activity, 10% have beta-galactosidase activity, and 27% have activity for both reporters. Thus, mutually exclusive expression of red and green pigment transgenes can be achieved in a large fraction of cones in a dichromat mammal, suggesting a facile evolutionary path for the development of trichromacy after visual pigment gene duplication. These observations are consistent with a model of visual pigment expression in which stochastic pairing occurs between a locus control region and either the red or the green pigment gene promotor.

Bipolar Cell-Photoreceptor Connectivity in the Zebrafish (Danio rerio) Retina

Science.gov (United States)

Li, Yong N.; Tsujimura, Taro; Kawamura, Shoji; Dowling, John E.

2013-01-01

Bipolar cells convey luminance, spatial and color information from photoreceptors to amacrine and ganglion cells. We studied the photoreceptor connectivity of 321 bipolar cells in the adult zebrafish retina. 1,1'-Dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI) was inserted into whole-mounted transgenic zebrafish retinas to label bipolar cells. The photoreceptors that connect to these DiI-labeled cells were identified by transgenic fluorescence or their positions relative to the fluorescent cones, as cones are arranged in a highly-ordered mosaic: rows of alternating blue- (B) and ultraviolet-sensitive (UV) single cones alternate with rows of red- (R) and green-sensitive (G) double cones. Rod terminals intersperse among cone terminals. As many as 18 connectivity subtypes were observed, 9 of which – G, GBUV, RG, RGB, RGBUV, RGRod, RGBRod, RGBUVRod and RRod bipolar cells – accounted for 96% of the population. Based on their axon terminal stratification, these bipolar cells could be further sub-divided into ON, OFF, and ON-OFF cells. The dendritic spread size, soma depth and size, and photoreceptor connections of the 308 bipolar cells within the 9 common connectivity subtypes were determined, and their dendritic tree morphologies and axonal stratification patterns compared. We found that bipolar cells with the same axonal stratification patterns could have heterogeneous photoreceptor connectivity whereas bipolar cells with the same dendritic tree morphology usually had the same photoreceptor connectivity, although their axons might stratify on different levels. PMID:22907678

Coping with 'Dark Sides of the Sun' through Photoreceptor Signaling.

Science.gov (United States)

Demarsy, Emilie; Goldschmidt-Clermont, Michel; Ulm, Roman

2018-03-01

Plants grow in constantly changing environments, including highly variable light intensities. Sunlight provides the energy that drives photosynthesis and is thus of the utmost importance for plant growth and the generation of oxygen, which the majority of life on Earth depends on. However, exposure to either insufficient or excess levels of light can have detrimental effects and cause light stress. Whereas exposure to insufficient light limits photosynthetic activity, resulting in 'energy starvation', exposure to excess light can damage the photosynthetic apparatus. Furthermore, strong sunlight is associated with high levels of potentially damaging UV-B radiation. Different classes of photoreceptors play important roles in coping with the negative aspects of sunlight, for which specific mechanisms are emerging that are reviewed here. Copyright © 2017 Elsevier Ltd. All rights reserved.

Retinal cone photoreceptors of the deer mouse Peromyscus maniculatus: development, topography, opsin expression and spectral tuning.

Directory of Open Access Journals (Sweden)

Patrick Arbogast

Full Text Available A quantitative analysis of photoreceptor properties was performed in the retina of the nocturnal deer mouse, Peromyscus maniculatus, using pigmented (wildtype and albino animals. The aim was to establish whether the deer mouse is a more suitable model species than the house mouse for photoreceptor studies, and whether oculocutaneous albinism affects its photoreceptor properties. In retinal flatmounts, cone photoreceptors were identified by opsin immunostaining, and their numbers, spectral types, and distributions across the retina were determined. Rod photoreceptors were counted using differential interference contrast microscopy. Pigmented P. maniculatus have a rod-dominated retina with rod densities of about 450.000/mm(2 and cone densities of 3000-6500/mm(2. Two cone opsins, shortwave sensitive (S and middle-to-longwave sensitive (M, are present and expressed in distinct cone types. Partial sequencing of the S opsin gene strongly supports UV sensitivity of the S cone visual pigment. The S cones constitute a 5-15% minority of the cones. Different from house mouse, S and M cone distributions do not have dorsoventral gradients, and coexpression of both opsins in single cones is exceptional (<2% of the cones. In albino P. maniculatus, rod densities are reduced by approximately 40% (270.000/mm(2. Overall, cone density and the density of cones exclusively expressing S opsin are not significantly different from pigmented P. maniculatus. However, in albino retinas S opsin is coexpressed with M opsin in 60-90% of the cones and therefore the population of cones expressing only M opsin is significantly reduced to 5-25%. In conclusion, deer mouse cone properties largely conform to the general mammalian pattern, hence the deer mouse may be better suited than the house mouse for the study of certain basic cone properties, including the effects of albinism on cone opsin expression.

Acute Zonal Cone Photoreceptor Outer Segment Loss.

Science.gov (United States)

Aleman, Tomas S; Sandhu, Harpal S; Serrano, Leona W; Traband, Anastasia; Lau, Marisa K; Adamus, Grazyna; Avery, Robert A

2017-05-01

The diagnostic path presented narrows down the cause of acute vision loss to the cone photoreceptor outer segment and will refocus the search for the cause of similar currently idiopathic conditions. To describe the structural and functional associations found in a patient with acute zonal occult photoreceptor loss. A case report of an adolescent boy with acute visual field loss despite a normal fundus examination performed at a university teaching hospital. Results of a complete ophthalmic examination, full-field flash electroretinography (ERG) and multifocal ERG, light-adapted achromatic and 2-color dark-adapted perimetry, and microperimetry. Imaging was performed with spectral-domain optical coherence tomography (SD-OCT), near-infrared (NIR) and short-wavelength (SW) fundus autofluorescence (FAF), and NIR reflectance (REF). The patient was evaluated within a week of the onset of a scotoma in the nasal field of his left eye. Visual acuity was 20/20 OU, and color vision was normal in both eyes. Results of the fundus examination and of SW-FAF and NIR-FAF imaging were normal in both eyes, whereas NIR-REF imaging showed a region of hyporeflectance temporal to the fovea that corresponded with a dense relative scotoma noted on light-adapted static perimetry in the left eye. Loss in the photoreceptor outer segment detected by SD-OCT co-localized with an area of dense cone dysfunction detected on light-adapted perimetry and multifocal ERG but with near-normal rod-mediated vision according to results of 2-color dark-adapted perimetry. Full-field flash ERG findings were normal in both eyes. The outer nuclear layer and inner retinal thicknesses were normal. Localized, isolated cone dysfunction may represent the earliest photoreceptor abnormality or a distinct entity within the acute zonal occult outer retinopathy complex. Acute zonal occult outer retinopathy should be considered in patients with acute vision loss and abnormalities on NIR-REF imaging, especially if

JGI Plant Genomics Gene Annotation Pipeline

Energy Technology Data Exchange (ETDEWEB)

Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese

2014-07-14

Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.

Photoreceptor spectral sensitivity in the bumblebee, Bombus impatiens (Hymenoptera: Apidae.

Directory of Open Access Journals (Sweden)

Peter Skorupski

Full Text Available The bumblebee Bombus impatiens is increasingly used as a model in comparative studies of colour vision, or in behavioural studies relying on perceptual discrimination of colour. However, full spectral sensitivity data on the photoreceptor inputs underlying colour vision are not available for B. impatiens. Since most known bee species are trichromatic, with photoreceptor spectral sensitivity peaks in the UV, blue and green regions of the spectrum, data from a related species, where spectral sensitivity measurements have been made, are often applied to B impatiens. Nevertheless, species differences in spectral tuning of equivalent photoreceptor classes may result in peaks that differ by several nm, which may have small but significant effects on colour discrimination ability. We therefore used intracellular recording to measure photoreceptor spectral sensitivity in B. impatiens. Spectral peaks were estimated at 347, 424 and 539 nm for UV, blue and green receptors, respectively, suggesting that this species is a UV-blue-green trichromat. Photoreceptor spectral sensitivity peaks are similar to previous measurements from Bombus terrestris, although there is a significant difference in the peak sensitivity of the blue receptor, which is shifted in the short wave direction by 12-13 nm in B. impatiens compared to B. terrestris.

Roles of glucose in photoreceptor survival.

Science.gov (United States)

Chertov, Andrei O; Holzhausen, Lars; Kuok, Iok Teng; Couron, Drew; Parker, Ed; Linton, Jonathan D; Sadilek, Martin; Sweet, Ian R; Hurley, James B

2011-10-07

Vertebrate photoreceptor neurons have a high demand for metabolic energy, and their viability is very sensitive to genetic and environmental perturbations. We investigated the relationship between energy metabolism and cell death by evaluating the metabolic effects of glucose deprivation on mouse photoreceptors. Oxygen consumption, lactate production, ATP, NADH/NAD(+), TCA cycle intermediates, morphological changes, autophagy, and viability were evaluated. We compared retinas incubated with glucose to retinas deprived of glucose or retinas treated with a mixture of mitochondrion-specific fuels. Rapid and slow phases of cell death were identified. The rapid phase is linked to reduced mitochondrial activity, and the slower phase reflects a need for substrates for cell maintenance and repair.

Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

Directory of Open Access Journals (Sweden)

Salmela Iikka

2012-08-01

Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

UV-Induced Cell Death in Plants

Science.gov (United States)

Nawkar, Ganesh M.; Maibam, Punyakishore; Park, Jung Hoon; Sahi, Vaidurya Pratap; Lee, Sang Yeol; Kang, Chang Ho

2013-01-01

Plants are photosynthetic organisms that depend on sunlight for energy. Plants respond to light through different photoreceptors and show photomorphogenic development. Apart from Photosynthetically Active Radiation (PAR; 400–700 nm), plants are exposed to UV light, which is comprised of UV-C (below 280 nm), UV-B (280–320 nm) and UV-A (320–390 nm). The atmospheric ozone layer protects UV-C radiation from reaching earth while the UVR8 protein acts as a receptor for UV-B radiation. Low levels of UV-B exposure initiate signaling through UVR8 and induce secondary metabolite genes involved in protection against UV while higher dosages are very detrimental to plants. It has also been reported that genes involved in MAPK cascade help the plant in providing tolerance against UV radiation. The important targets of UV radiation in plant cells are DNA, lipids and proteins and also vital processes such as photosynthesis. Recent studies showed that, in response to UV radiation, mitochondria and chloroplasts produce a reactive oxygen species (ROS). Arabidopsis metacaspase-8 (AtMC8) is induced in response to oxidative stress caused by ROS, which acts downstream of the radical induced cell death (AtRCD1) gene making plants vulnerable to cell death. The studies on salicylic and jasmonic acid signaling mutants revealed that SA and JA regulate the ROS level and antagonize ROS mediated cell death. Recently, molecular studies have revealed genes involved in response to UV exposure, with respect to programmed cell death (PCD). PMID:23344059

Lateral interactions in the photoreceptor membrane: a NMR study

International Nuclear Information System (INIS)

Mollevanger, L.C.P.J.

1987-01-01

The photoreceptor membrane has an exceptionally high content of polyunsaturated fatty acyl chains combined with a high amount of phosphatidyl ethanolamine. It is situated in a cell organelle, the rod outer segment, with a high biological activity in which controlable trans-membrane currents of different ions play an important role. These characteristics make it a very interesting biological membrane to search for the existence of non-bilayer structures. Therefore in this thesis a detailed study of the polymorphic phase behaviour of the rod outer segment photoreceptor lipids was undertaken, concerning modulation of the polymorphic phase behaviour of photoreceptor membrane lipids by divalent cations and temperature, polymorphism of the individual phospholipid classes phosphatidylethanolamine and phosphatidylserine and effects of cholesterol, bilayer stabilization by (rhod)opsin. Morphologically intact rod outer segment possesses a large magnetic anisotropy. This property is used to obtain 31 P-NMR of oriented photoreceptor membranes which allows spectral analysis and identification of individual phospholipid classes, and allows to study lateral lipid diffusion in intact disk membranes. The power of high resolution solid state 13 C-NMR to study the conformation of the chromophore in rhodopsin is demonstrated. (Auth.)

Photoreceptor atrophy in acute zonal occult outer retinopathy

DEFF Research Database (Denmark)

Zibrandtsen, N.; Munch, I.C.; Klemp, K.

2008-01-01

appearance were examined using optical coherence tomography (OCT), automated perimetry and electroretinography (ERG). RESULTS: Both patients demonstrated photoreceptor atrophy corresponding to partial or complete scotomata with reduced or extinct electroretinographic responses. Attenuation or complete loss...... of all the segments composing the photoreceptor layer was found by OCT. Full-field ERG revealed affection of the 30 Hz flicker responses and subnormal photopic responses in both patients and subnormal scotopic responses in case 1. Multifocal electroretinography (mERG) revealed localized outer retinal...

Photoreceptor atrophy in acute zonal occult outer retinopathy

DEFF Research Database (Denmark)

Zibrandtsen, N.; Munch, I.C.; Klemp, K.

2008-01-01

examined using optical coherence tomography (OCT), automated perimetry and electroretinography (ERG). Both patients demonstrated photoreceptor atrophy corresponding to partial or complete scotomata with reduced or extinct electroretinographic responses. Attenuation or complete loss of all the segments...... composing the photoreceptor layer was found by OCT. Full-field ERG revealed affection of the 30 Hz flicker responses and subnormal photopic responses in both patients and subnormal scotopic responses in case 1. Multifocal electroretinography (mERG) revealed localized outer retinal dysfunction. The field...

Ultrafast spectroscopy of biological photoreceptors

NARCIS (Netherlands)

Kennis, J.T.M.; Groot, M.L.

2007-01-01

We review recent new insights on reaction dynamics of photoreceptors proteins gained from ultrafast spectroscopy. In Blue Light sensing Using FAD (BLUF) domains, a hydrogen-bond rearrangement around the flavin chromophore proceeds through a radical-pair mechanism, by which light-induced electron and

Laser induced photoreceptor damage and recovery in the high numerical aperture eye of the garter snake.

Science.gov (United States)

Zwick, H; Edsall, P; Stuck, B E; Wood, E; Elliott, R; Cheramie, R; Hacker, H

2008-02-01

The garter snake provides a unique model for in-vivo imaging of photoreceptor damage induced by laser retinal exposure. Laser thermal/mechanical retinal injury induced alterations in photoreceptor structure and leukocyte cellular behavior. Photoreceptors turned white, lost mode structure, and swelled; leukocyte activity was observed in the vicinity of photoreceptor cells. Non-thermal alterations were identified with a bio-tag for oxidative stress. Mechanisms of photoreceptor recovery and replacement were observed and evaluated for active cytoskeletal systems by using an anti-actin tag that could detect the presence of active cytoskeletal systems resident in photoreceptors as well as other retinal systems.

LONGITUDINAL QUANTITATIVE EVALUATION OF PHOTORECEPTOR VOLUME FOLLOWING REPAIR OF MACULA-OFF RETINAL DETACHMENT.

Science.gov (United States)

Narala, Ramsudha; Scarinci, Fabio; Shaarawy, Amr; Simonett, Joseph M; Flaxel, Christina J; Fawzi, Amani A

2016-08-01

To quantify photoreceptor volume changes after successful surgical repair of macula-off retinal detachment and to correlate these volumetric changes to postoperative best-corrected visual acuity (BCVA). Retrospective study of 15 eyes of 15 patients with macula-off retinal detachment who underwent successful surgical repair. A minimum of 4 optical coherence tomography scans that straddled the foveal center was used to quantify the central photoreceptor volume (central 1 mm). Mean photoreceptor volume at the first postoperative visit was 0.451 mm, increasing to 0.523 mm at the final postoperative visit (P = 0.004). Mean BCVA improved from 1.13 ± 0.59 logarithm of the minimum angle of resolution units (∼20/270) preoperatively to 0.52 ± 0.42 logarithm of the minimum angle of resolution units (∼20/66) at the final postoperative visit (P = 0.001). Mean photoreceptor volume at either the initial or final visit demonstrated significant correlations with final postoperative BCVA (r = -0.670, P = 0.017 and r = -0.753, P = 0.005, respectively). Shorter time interval from diagnosis to surgery was significantly associated with greater mean final postoperative photoreceptor volume (r = -0.588, P = 0.021) and better mean final postoperative BCVA (r = 0.709, P = 0.003). We observed a significant increase in photoreceptor volume after successful retinal detachment repair; photoreceptor volume was positively associated with BCVA and time to surgery. Our series emphasizes the importance of prompt surgical repair and shows that photoreceptor recovery and volumetric improvement correlate significantly with BCVA.

Fundus Autofluorescence and Photoreceptor Cell Rosettes in Mouse Models

Science.gov (United States)

Flynn, Erin; Ueda, Keiko; Auran, Emily; Sullivan, Jack M.; Sparrow, Janet R.

2014-01-01

Purpose. This study was conducted to study correlations among fundus autofluorescence (AF), RPE lipofuscin accumulation, and photoreceptor cell degeneration and to investigate the structural basis of fundus AF spots. Methods. Fundus AF images (55° lens; 488-nm excitation) and spectral-domain optical coherence tomography (SD-OCT) scans were acquired in pigmented Rdh8−/−/Abca4−/− mice (ages 1–9 months) with a confocal scanning laser ophthalmoscope (cSLO). For quantitative fundus AF (qAF), gray levels (GLs) were calibrated to an internal fluorescence reference. Retinal bisretinoids were measured by quantitative HPLC. Histometric analysis of outer nuclear layer (ONL) thicknesses was performed, and cryostat sections of retina were examined by fluorescence microscopy. Results. Quantified A2E and qAF intensities increased until age 4 months in the Rdh8−/−/Abca4−/− mice. The A2E levels declined after 4 months of age, but qAF intensity values continued to rise. The decline in A2E levels in the Rdh8−/−/Abca4−/− mice paralleled reduced photoreceptor cell viability as reflected in ONL thinning. Hyperautofluorescent puncta in fundus AF images corresponded to photoreceptor cell rosettes in SD-OCT images and histological sections stained with hematoxylin and eosin. The inner segment/outer segment–containing core of the rosette emitted an autofluorescence detected by fluorescence microscopy. Conclusions. When neural retina is disordered, AF from photoreceptor cells can contribute to noninvasive fundus AF images. Hyperautofluorescent puncta in fundus AF images are attributable, in at least some cases, to photoreceptor cell rosettes. PMID:25015357

On Dispersion in Visual Photoreceptors

NARCIS (Netherlands)

Stavenga, D.G.; Barneveld, H.H. van

1975-01-01

An idealized visual pigment absorbance spectrum is used together with a Kramers-Kronig dispersion relation to calculate the contribution of the visual pigment to the refractive index of the fly photoreceptor. It appears that an absorption coefficient of 0.010 µm-1 results in a refractive index

Plasticity of photoreceptor-generating retinal progenitors revealed by prolonged retinoic acid exposure

Directory of Open Access Journals (Sweden)

Cameron David A

2011-08-01

Full Text Available Abstract Background Retinoic acid (RA is important for vertebrate eye morphogenesis and is a regulator of photoreceptor development in the retina. In the zebrafish, RA treatment of postmitotic photoreceptor precursors has been shown to promote the differentiation of rods and red-sensitive cones while inhibiting the differentiation of blue- and UV-sensitive cones. The roles played by RA and its receptors in modifying photoreceptor fate remain to be determined. Results Treatment of zebrafish embryos with RA, beginning at the time of retinal progenitor cell proliferation and prior to photoreceptor terminal mitosis, resulted in a significant alteration of rod and cone mosaic patterns, suggesting an increase in the production of rods at the expense of red cones. Quantitative pattern analyses documented increased density of rod photoreceptors and reduced local spacing between rod cells, suggesting rods were appearing in locations normally occupied by cone photoreceptors. Cone densities were correspondingly reduced and cone photoreceptor mosaics displayed expanded and less regular spacing. These results were consistent with replacement of approximately 25% of positions normally occupied by red-sensitive cones, with additional rods. Analysis of embryos from a RA-signaling reporter line determined that multiple retinal cell types, including mitotic cells and differentiating rods and cones, are capable of directly responding to RA. The RA receptors RXRγ and RARαb are expressed in patterns consistent with mediating the effects of RA on photoreceptors. Selective knockdown of RARαb expression resulted in a reduction in endogenous RA signaling in the retina. Knockdown of RARαb also caused a reduced production of rods that was not restored by simultaneous treatments with RA. Conclusions These data suggest that developing retinal cells have a dynamic sensitivity to RA during retinal neurogenesis. In zebrafish RA may influence the rod vs. cone cell fate

Preservation of photoreceptors in dystrophic RCS rats following allo- and xenotransplantation of IPE cells.

Science.gov (United States)

Thumann, Gabriele; Salz, Anna Katharina; Walter, Peter; Johnen, Sandra

2009-03-01

To examine whether iris pigment epithelial (IPE) cells transplanted into the subretinal space of Royal College of Surgeons (RCS) rats have the ability to rescue photoreceptors. Rat IPE (rIPE) or human IPE (hIPE) cells were transplanted subretinally in 23-day-old RCS rats. Sham injection and transplantation of ARPE-19 cells served as controls. After 12 weeks, eyes were evaluated for photoreceptor survival by morphometric analysis and electron microscopy. Morphometric analysis showed photoreceptor rescue in all transplanted and sham-injected animals (number of photoreceptors/300 microm retina+/-sd: rIPE 41.67 +/- 28; hIPE 29.50 +/- 16; ARPE-19 36.12 +/- 21; sham 16.56 +/- 6) compared to age-matched, control rats (number of photoreceptors/300 microm retina+/-sd: 9.71 +/- 4). Photoreceptor rescue was prominent in IPE cell-transplanted rats and was significantly greater than sham-injected eyes (p = 0.02 for rIPE and p = 0.04 for hIPE). Since IPE cells transplanted into the subretinal space have the ability to rescue photoreceptors from degeneration in the RCS rat without any harmful effects, IPE cells may represent an ideal cell to genetically modify and thus carry essential genetic information for the repair of defects in the subretinal space.

Lrit1, a Retinal Transmembrane Protein, Regulates Selective Synapse Formation in Cone Photoreceptor Cells and Visual Acuity

Directory of Open Access Journals (Sweden)

Akiko Ueno

2018-03-01

Full Text Available Summary: In the vertebrate retina, cone photoreceptors play crucial roles in photopic vision by transmitting light-evoked signals to ON- and/or OFF-bipolar cells. However, the mechanisms underlying selective synapse formation in the cone photoreceptor pathway remain poorly understood. Here, we found that Lrit1, a leucine-rich transmembrane protein, localizes to the photoreceptor synaptic terminal and regulates the synaptic connection between cone photoreceptors and cone ON-bipolar cells. Lrit1-deficient retinas exhibit an aberrant morphology of cone photoreceptor pedicles, as well as an impairment of signal transmission from cone photoreceptors to cone ON-bipolar cells. Furthermore, we demonstrated that Lrit1 interacts with Frmpd2, a photoreceptor scaffold protein, and with mGluR6, an ON-bipolar cell-specific glutamate receptor. Additionally, Lrit1-null mice showed visual acuity impairments in their optokinetic responses. These results suggest that the Frmpd2-Lrit1-mGluR6 axis regulates selective synapse formation in cone photoreceptors and is essential for normal visual function. : Ueno et al. finds that Lrit1 plays an important role in regulating the synaptic connection between cone photoreceptors and cone ON-bipolar cells. The Frmpd2-Lrit1-mGluR6 axis is crucial for selective synapse formation in cone photoreceptors and for development of normal visual function. Keywords: retina, circuit, synapse formation, cone photoreceptor cell, ON-bipolar cell, visual acuity

Plant gene technology: social considerations

African Journals Online (AJOL)

Administrator

The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

Pineal photoreceptor cells are required for maintaining the circadian rhythms of behavioral visual sensitivity in zebrafish.

Directory of Open Access Journals (Sweden)

Xinle Li

Full Text Available In non-mammalian vertebrates, the pineal gland functions as the central pacemaker that regulates the circadian rhythms of animal behavior and physiology. We generated a transgenic zebrafish line [Tg(Gnat2:gal4-VP16/UAS:nfsB-mCherry] in which the E. coli nitroreductase is expressed in pineal photoreceptor cells. In developing embryos and young adults, the transgene is expressed in both retinal and pineal photoreceptor cells. During aging, the expression of the transgene in retinal photoreceptor cells gradually diminishes. By 8 months of age, the Gnat2 promoter-driven nitroreductase is no longer expressed in retinal photoreceptor cells, but its expression in pineal photoreceptor cells persists. This provides a tool for selective ablation of pineal photoreceptor cells, i.e., by treatments with metronidazole. In the absence of pineal photoreceptor cells, the behavioral visual sensitivity of the fish remains unchanged; however, the circadian rhythms of rod and cone sensitivity are diminished. Brief light exposures restore the circadian rhythms of behavioral visual sensitivity. Together, the data suggest that retinal photoreceptor cells respond to environmental cues and are capable of entraining the circadian rhythms of visual sensitivity; however, they are insufficient for maintaining the rhythms. Cellular signals from the pineal photoreceptor cells may be required for maintaining the circadian rhythms of visual sensitivity.

Protein and signaling networks in vertebrate photoreceptor cells

Directory of Open Access Journals (Sweden)

Karl-Wilhelm eKoch

2015-11-01

Full Text Available Vertebrate photoreceptor cells are exquisite light detectors operating under very dim and bright illumination. The photoexcitation and adaptation machinery in photoreceptor cells consists of protein complexes that can form highly ordered supramolecular structures and control the homeostasis and mutual dependence of the secondary messengers cGMP and Ca2+. The visual pigment in rod photoreceptors, the G protein-coupled receptor rhodopsin is organized in tracks of dimers thereby providing a signaling platform for the dynamic scaffolding of the G protein transducin. Illuminated rhodopsin is turned off by phosphorylation catalyzed by rhodopsin kinase GRK1 under control of Ca2+-recoverin. The GRK1 protein complex partly assembles in lipid raft structures, where shutting off rhodopsin seems to be more effective. Re-synthesis of cGMP is another crucial step in the recovery of the photoresponse after illumination. It is catalyzed by membrane bound sensory guanylate cyclases and is regulated by specific neuronal Ca2+-sensor proteins called GCAPs. At least one guanylate cyclase (ROS-GC1 was shown to be part of a multiprotein complex having strong interactions with the cytoskeleton and being controlled in a multimodal Ca2+-dependent fashion. The final target of the cGMP signaling cascade is a cyclic nucleotide-gated channel that is a hetero-oligomeric protein located in the plasma membrane and interacting with accessory proteins in highly organized microdomains. We summarize results and interpretations of findings related to the inhomogeneous organization of signaling units in photoreceptor outer segments.

Evolution of the YABBY gene family in seed plants.

Science.gov (United States)

Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

2016-01-01

Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

Lrit1, a Retinal Transmembrane Protein, Regulates Selective Synapse Formation in Cone Photoreceptor Cells and Visual Acuity.

Science.gov (United States)

Ueno, Akiko; Omori, Yoshihiro; Sugita, Yuko; Watanabe, Satoshi; Chaya, Taro; Kozuka, Takashi; Kon, Tetsuo; Yoshida, Satoyo; Matsushita, Kenji; Kuwahara, Ryusuke; Kajimura, Naoko; Okada, Yasushi; Furukawa, Takahisa

2018-03-27

In the vertebrate retina, cone photoreceptors play crucial roles in photopic vision by transmitting light-evoked signals to ON- and/or OFF-bipolar cells. However, the mechanisms underlying selective synapse formation in the cone photoreceptor pathway remain poorly understood. Here, we found that Lrit1, a leucine-rich transmembrane protein, localizes to the photoreceptor synaptic terminal and regulates the synaptic connection between cone photoreceptors and cone ON-bipolar cells. Lrit1-deficient retinas exhibit an aberrant morphology of cone photoreceptor pedicles, as well as an impairment of signal transmission from cone photoreceptors to cone ON-bipolar cells. Furthermore, we demonstrated that Lrit1 interacts with Frmpd2, a photoreceptor scaffold protein, and with mGluR6, an ON-bipolar cell-specific glutamate receptor. Additionally, Lrit1-null mice showed visual acuity impairments in their optokinetic responses. These results suggest that the Frmpd2-Lrit1-mGluR6 axis regulates selective synapse formation in cone photoreceptors and is essential for normal visual function. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Evidence for dynamic network regulation of Drosophila photoreceptor function from mutants lacking the neurotransmitter histamine

Directory of Open Access Journals (Sweden)

An eDau

2016-03-01

Full Text Available Synaptic feedback from interneurons to photoreceptors can help to optimize visual information flow by balancing its allocation on retinal pathways under changing light conditions. But little is known about how this critical network operation is regulated dynamically. Here, we investigate this question by comparing signaling properties and performance of wild-type Drosophila R1-R6 photoreceptors to those of the hdcJK910 mutant, which lacks the neurotransmitter histamine and therefore cannot transmit information to interneurons. Recordings show that hdcJK910 photoreceptors sample similar amounts of information from naturalistic stimulation to wild-type photoreceptors, but this information is packaged in smaller responses, especially under bright illumination. Analyses reveal how these altered dynamics primarily resulted from network overload that affected hdcJK910 photoreceptors in two ways. First, the missing inhibitory histamine input to interneurons almost certainly depolarized them irrevocably, which in turn increased their excitatory feedback to hdcJK910 R1-R6s. This tonic excitation depolarized the photoreceptors to artificially high potentials, reducing their operational range. Second, rescuing histamine input to interneurons in hdcJK910 mutant also restored their normal phasic feedback modulation to R1-R6s, causing photoreceptor output to accentuate dynamic intensity differences at bright illumination, similar to the wild-type. These results provide mechanistic explanations of how synaptic feedback connections optimize information packaging in photoreceptor output and novel insight into the operation and design of dynamic network regulation of sensory neurons.

Diversification of Root Hair Development Genes in Vascular Plants.

Science.gov (United States)

Huang, Ling; Shi, Xinhui; Wang, Wenjia; Ryu, Kook Hui; Schiefelbein, John

2017-07-01

The molecular genetic program for root hair development has been studied intensively in Arabidopsis ( Arabidopsis thaliana ). To understand the extent to which this program might operate in other plants, we conducted a large-scale comparative analysis of root hair development genes from diverse vascular plants, including eudicots, monocots, and a lycophyte. Combining phylogenetics and transcriptomics, we discovered conservation of a core set of root hair genes across all vascular plants, which may derive from an ancient program for unidirectional cell growth coopted for root hair development during vascular plant evolution. Interestingly, we also discovered preferential diversification in the structure and expression of root hair development genes, relative to other root hair- and root-expressed genes, among these species. These differences enabled the definition of sets of genes and gene functions that were acquired or lost in specific lineages during vascular plant evolution. In particular, we found substantial divergence in the structure and expression of genes used for root hair patterning, suggesting that the Arabidopsis transcriptional regulatory mechanism is not shared by other species. To our knowledge, this study provides the first comprehensive view of gene expression in a single plant cell type across multiple species. © 2017 American Society of Plant Biologists. All Rights Reserved.

A new photosensory function for simple photoreceptors, the intrinsically photoresponsive neurons of the sea slug Onchidium

Directory of Open Access Journals (Sweden)

Tsukasa Gotow

2009-12-01

Full Text Available Simple photoreceptors, namely intrinsically light-sensitive neurons without microvilli and/or cilia, have long been known to exist in the central ganglia of crayfish, Aplysia, Onchidium, and Helix. These simple photoreceptors are not only first-order photosensory cells, but also second-order neurons (interneurons, relaying several kinds of sensory synaptic inputs. Another important issue is that the photoresponses of these simple photoreceptors show very slow kinetics and little adaptation. These characteristics suggest that the simple photoreceptors of the Onchidium have a function in non-image-forming vision, different from classical eye photoreceptors used for cording dynamic images of vision. The cited literature provides evidence that the depolarizing and hyperpolarizing photoresponses of simple photoreceptors play a role in the long-lasting potentiation of synaptic transmission of excitatory and inhibitory sensory inputs, and as well as in the potentiation and the suppression of the subsequent behavioral outputs. In short, we suggest that simple photoreceptors operate in the general potentiation of synaptic transmission and subsequent motor output; i.e., they perform a new photosensory function.

Effective delivery of recombinant proteins to rod photoreceptors via lipid nanovesicles

Energy Technology Data Exchange (ETDEWEB)

Asteriti, Sabrina [Dept. of Translational Research, University of Pisa, Pisa (Italy); Dal Cortivo, Giuditta [Dept. of Life Sciences and Reproduction, University of Verona, Strada Le Grazie 8, Verona (Italy); Pontelli, Valeria [Dept. of Neurological and Movement Sciences, University of Verona, Strada Le Grazie 8, Verona (Italy); Cangiano, Lorenzo [Dept. of Translational Research, University of Pisa, Pisa (Italy); Buffelli, Mario, E-mail: mario.buffelli@univr.it [Dept. of Neurological and Movement Sciences, University of Verona, Strada Le Grazie 8, Verona (Italy); Center for Biomedical Computing, University of Verona, Strada le Grazie 8, 37134 Verona (Italy); Dell’Orco, Daniele, E-mail: daniele.dellorco@univr.it [Dept. of Life Sciences and Reproduction, University of Verona, Strada Le Grazie 8, Verona (Italy); Center for Biomedical Computing, University of Verona, Strada le Grazie 8, 37134 Verona (Italy)

2015-06-12

The potential of liposomes to deliver functional proteins in retinal photoreceptors and modulate their physiological response was investigated by two experimental approaches. First, we treated isolated mouse retinas with liposomes encapsulating either recoverin, an important endogenous protein operating in visual phototransduction, or antibodies against recoverin. We then intravitrally injected in vivo liposomes encapsulating either rhodamin B or recoverin and we investigated the distribution in retina sections by confocal microscopy. The content of liposomes was found to be released in higher amount in the photoreceptor layer than in the other regions of the retina and the functional effects of the release were in line with the current model of phototransduction. Our study sets the basis for quantitative investigations aimed at assessing the potential of intraocular protein delivery via biocompatible nanovesicles, with promising implications for the treatment of retinal diseases affecting the photoreceptor layer. - Highlights: • Recombinant proteins encapsulated in nano-sized liposomes injected intravitreally reach retinal photoreceptors. • The phototransduction cascade in rods is modulated by the liposome content. • Mathematical modeling predicts the alteration of the photoresponses following liposome fusion.

Edaravone, an ROS Scavenger, Ameliorates Photoreceptor Cell Death after Experimental Retinal Detachment

Science.gov (United States)

Roh, Mi In; Murakami, Yusuke; Thanos, Aristomenis; Miller, Joan W.

2011-01-01

Purpose. To investigate whether edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one), a free radical scavenger, would be neuroprotective against photoreceptor cell death in a rat model of retinal detachment (RD). Methods. RD was induced in adult Brown Norway rats by subretinal injection of sodium hyaluronate. Edaravone (3, 5, or 10 mg/kg) or physiologic saline was administered intraperitoneally once a day until death on day 3 or 5. Oxidative stress in the retina was assessed by 4-hydroxynonenal staining or ELISA for protein carbonyl content. Photoreceptor death was assessed by TUNEL and measurement of the outer nuclear layer thickness. Western blot analysis and caspase activity assays were performed. Inflammatory cytokine secretion and inflammatory cell infiltration were evaluated by ELISA and immunostaining, respectively. Results. RD resulted in increased generation of ROS. Treatment with 5 mg/kg edaravone significantly reduced the ROS level, along with a decrease in TUNEL-positive cells in the photoreceptor layer. A caspase assay also confirmed decreased activation of caspase-3, -8, and -9 in RD treated with edaravone. The level of the antiapoptotic Bcl-2 was increased in detached retinas after edaravone treatment, whereas the levels of the stress-activated p-ERK1/2 were decreased. In addition, edaravone treatment resulted in a significant decrease in the levels of TNF-α, MCP-1, and macrophage infiltration. Conclusions. Oxidative stress plays an important role in photoreceptor cell death after RD. Edaravone treatment may aid in preventing photoreceptor cell death after RD by suppressing ROS-induced photoreceptor damage. PMID:21310909

Photoreceptor cells with profound structural deficits can support useful vision in mice.

Science.gov (United States)

Thompson, Stewart; Blodi, Frederick R; Lee, Swan; Welder, Chris R; Mullins, Robert F; Tucker, Budd A; Stasheff, Steven F; Stone, Edwin M

2014-03-25

In animal models of degenerative photoreceptor disease, there has been some success in restoring photoreception by transplanting stem cell-derived photoreceptor cells into the subretinal space. However, only a small proportion of transplanted cells develop extended outer segments, considered critical for photoreceptor cell function. The purpose of this study was to determine whether photoreceptor cells that lack a fully formed outer segment could usefully contribute to vision. Retinal and visual function was tested in wild-type and Rds mice at 90 days of age (Rds(P90)). Photoreceptor cells of mice homozygous for the Rds mutation in peripherin 2 never develop a fully formed outer segment. The electroretinogram and multielectrode recording of retinal ganglion cells were used to test retinal responses to light. Three distinct visual behaviors were used to assess visual capabilities: the optokinetic tracking response, the discrimination-based visual water task, and a measure of the effect of vision on wheel running. Rds(P90) mice had reduced but measurable electroretinogram responses to light, and exhibited light-evoked responses in multiple types of retinal ganglion cells, the output neurons of the retina. In optokinetic and discrimination-based tests, acuity was measurable but reduced, most notably when contrast was decreased. The wheel running test showed that Rds(P90) mice needed 3 log units brighter luminance than wild type to support useful vision (10 cd/m(2)). Photoreceptors that lack fully formed outer segments can support useful vision. This challenges the idea that normal cellular structure needs to be completely reproduced for transplanted cells to contribute to useful vision.

Generation of a genetically encoded marker of rod photoreceptor outer segment growth and renewal

Directory of Open Access Journals (Sweden)

John J. Willoughby

2011-10-01

Vertebrate photoreceptors are specialized light sensing neurons. The photoreceptor outer segment is a highly modified cilium where photons of light are transduced into a chemical and electrical signal. The outer segment has the typical cilary axoneme but, in addition, it has a large number of densely packed, stacked, intramembranous discs. The molecular and cellular mechanisms that contribute to vertebrate photoreceptor outer segment morphogenesis are still largely unknown. Unlike typical cilia, the outer segment is continuously regenerated or renewed throughout the life of the animal through the combined process of distal outer segment shedding and proximal outer segment growth. The process of outer segment renewal was discovered over forty years ago, but we still lack an understanding of how photoreceptors renew their outer segments and few, if any, molecular mechanisms that regulate outer segment growth or shedding have been described. Our lack of progress in understanding how photoreceptors renew their outer segments has been hampered by the difficulty in measuring rates of renewal. We have created a new method that uses heat-shock induction of a fluorescent protein that can be used to rapidly measure outer segment growth rates. We describe this method, the stable transgenic line we created, and the growth rates observed in larval and adult rod photoreceptors using this new method. This new method will allow us to begin to define the genetic and molecular mechanisms that regulate rod outer segment renewal, a crucial aspect of photoreceptor function and, possibly, viability.

Photoreceptor processing speed and input resistance changes during light adaptation correlate with spectral class in the bumblebee, Bombus impatiens.

Directory of Open Access Journals (Sweden)

Peter Skorupski

Full Text Available Colour vision depends on comparison of signals from photoreceptors with different spectral sensitivities. However, response properties of photoreceptor cells may differ in ways other than spectral tuning. In insects, for example, broadband photoreceptors, with a major sensitivity peak in the green region of the spectrum (>500 nm, drive fast visual processes, which are largely blind to chromatic signals from more narrowly-tuned photoreceptors with peak sensitivities in the blue and UV regions of the spectrum. In addition, electrophysiological properties of the photoreceptor membrane may result in differences in response dynamics of photoreceptors of similar spectral class between species, and different spectral classes within a species. We used intracellular electrophysiological techniques to investigate response dynamics of the three spectral classes of photoreceptor underlying trichromatic colour vision in the bumblebee, Bombus impatiens, and we compare these with previously published data from a related species, Bombus terrestris. In both species, we found significantly faster responses in green, compared with blue- or UV-sensitive photoreceptors, although all 3 photoreceptor types are slower in B. impatiens than in B. terrestris. Integration times for light-adapted B. impatiens photoreceptors (estimated from impulse response half-width were 11.3 ± 1.6 ms for green photoreceptors compared with 18.6 ± 4.4 ms and 15.6 ± 4.4 for blue and UV, respectively. We also measured photoreceptor input resistance in dark- and light-adapted conditions. All photoreceptors showed a decrease in input resistance during light adaptation, but this decrease was considerably larger (declining to about 22% of the dark value in green photoreceptors, compared to blue and UV (41% and 49%, respectively. Our results suggest that the conductances associated with light adaptation are largest in green photoreceptors, contributing to their greater temporal processing speed

Actin gene identification from selected medicinal plants for their use as internal controls for gene expression studies

International Nuclear Information System (INIS)

Mufti, F.U.D.; Banaras, S.

2015-01-01

Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)

Presynaptic dystroglycan-pikachurin complex regulates the proper synaptic connection between retinal photoreceptor and bipolar cells.

Science.gov (United States)

Omori, Yoshihiro; Araki, Fumiyuki; Chaya, Taro; Kajimura, Naoko; Irie, Shoichi; Terada, Koji; Muranishi, Yuki; Tsujii, Toshinori; Ueno, Shinji; Koyasu, Toshiyuki; Tamaki, Yasuhiro; Kondo, Mineo; Amano, Shiro; Furukawa, Takahisa

2012-05-02

Dystroglycan (DG) is a key component of the dystrophin-glycoprotein complex (DGC) at the neuromuscular junction postsynapse. In the mouse retina, the DGC is localized at the presynapse of photoreceptor cells, however, the function of presynaptic DGC is poorly understood. Here, we developed and analyzed retinal photoreceptor-specific DG conditional knock-out (DG CKO) mice. We found that the DG CKO retina showed a reduced amplitude and a prolonged implicit time of the ERG b-wave. Electron microscopic analysis revealed that bipolar dendrite invagination into the photoreceptor terminus is perturbed in the DG CKO retina. In the DG CKO retina, pikachurin, a DG ligand in the retina, is markedly decreased at photoreceptor synapses. Interestingly, in the Pikachurin(-/-) retina, the DG signal at the ribbon synaptic terminus was severely reduced, suggesting that pikachurin is required for the presynaptic accumulation of DG at the photoreceptor synaptic terminus, and conversely DG is required for pikachurin accumulation. Furthermore, we found that overexpression of pikachurin induces formation and clustering of a DG-pikachurin complex on the cell surface. The Laminin G repeats of pikachurin, which are critical for its oligomerization and interaction with DG, were essential for the clustering of the DG-pikachurin complex as well. These results suggest that oligomerization of pikachurin and its interaction with DG causes DG assembly on the synapse surface of the photoreceptor synaptic terminals. Our results reveal that the presynaptic interaction of pikachurin with DG at photoreceptor terminals is essential for both the formation of proper photoreceptor ribbon synaptic structures and normal retinal electrophysiology.

PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

Directory of Open Access Journals (Sweden)

Huang Hsien-Da

2008-11-01

Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

Transfer of engineered genes from crop to wild plants

DEFF Research Database (Denmark)

Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.

1996-01-01

The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...

Retinal Thickening and Photoreceptor Loss in HIV Eyes without Retinitis.

Directory of Open Access Journals (Sweden)

Cheryl A Arcinue

Full Text Available To determine the presence of structural changes in HIV retinae (i.e., photoreceptor density and retinal thickness in the macula compared with age-matched HIV-negative controls.Cohort of patients with known HIV under CART (combination Antiretroviral Therapy treatment were examined with a flood-illuminated retinal AO camera to assess the cone photoreceptor mosaic and spectral-domain optical coherence tomography (SD-OCT to assess retinal layers and retinal thickness.Twenty-four eyes of 12 patients (n = 6 HIV-positive and 6 HIV-negative were imaged with the adaptive optics camera. In each of the regions of interest studied (nasal, temporal, superior, inferior, the HIV group had significantly less mean cone photoreceptor density compared with age-matched controls (difference range, 4,308-6,872 cones/mm2. A different subset of forty eyes of 20 patients (n = 10 HIV-positive and 10 HIV-negative was included in the retinal thickness measurements and retinal layer segmentation with the SD-OCT. We observed significant thickening in HIV positive eyes in the total retinal thickness at the foveal center, and in each of the three horizontal B-scans (through the macular center, superior, and inferior to the fovea. We also noted that the inner retina (combined thickness from ILM through RNFL to GCL layer was also significantly thickened in all the different locations scanned compared with HIV-negative controls.Our present study shows that the cone photoreceptor density is significantly reduced in HIV retinae compared with age-matched controls. HIV retinae also have increased macular retinal thickness that may be caused by inner retinal edema secondary to retinovascular disease in HIV. The interaction of photoreceptors with the aging RPE, as well as possible low-grade ocular inflammation causing diffuse inner retinal edema, may be the key to the progressive vision changes in HIV-positive patients without overt retinitis.

The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina.

Science.gov (United States)

Young, T L; Matsuda, T; Cepko, C L

2005-03-29

With the advent of genome-wide analyses, it is becoming evident that a large number of noncoding RNAs (ncRNAs) are expressed in vertebrates. However, of the thousands of ncRNAs identified, the functions of relatively few have been established. In a screen for genes upregulated by taurine in developing retinal cells, we identified a gene that appears to be a ncRNA. Taurine Upregulated Gene 1 (TUG1) is a spliced, polyadenylated RNA that does not encode any open reading frame greater than 82 amino acids in its full-length, 6.7 kilobase (kb) RNA sequence. Analyses of Northern blots and in situ hybridization revealed that TUG1 is expressed in the developing retina and brain, as well as in adult tissues. In the newborn retina, knockdown of TUG1 with RNA interference (RNAi) resulted in malformed or nonexistent outer segments of transfected photoreceptors. Immunofluorescent staining and microarray analyses suggested that this loss of proper photoreceptor differentiation is a result of the disregulation of photoreceptor gene expression. A function for a newly identified ncRNA, TUG1, has been established. TUG1 is necessary for the proper formation of photoreceptors in the developing rodent retina.

Expression of streptavidin gene in bacteria and plants

International Nuclear Information System (INIS)

Guan, Xueni; Wurtele, E.S.; Nikolau, B.J.

1990-01-01

Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot

Chemically-induced photoreceptor degeneration and protection in mouse iPSC-derived three-dimensional retinal organoids

Directory of Open Access Journals (Sweden)

Shin-ichiro Ito

2017-10-01

Full Text Available Induced pluripotent stem cells (iPSCs, which can be differentiated into various tissues and cell types, have been used for clinical research and disease modeling. Self-organizing three-dimensional (3D tissue engineering has been established within the past decade and enables researchers to obtain tissues and cells that almost mimic in vivo development. However, there are no reports of practical experimental procedures that reproduce photoreceptor degeneration. In this study, we induced photoreceptor cell death in mouse iPSC-derived 3D retinal organoids (3D-retinas by 4-hydroxytamoxifen (4-OHT, which induces photoreceptor degeneration in mouse retinal explants, and then established a live-cell imaging system to measure degeneration-related properties. Furthermore, we quantified the protective effects of representative ophthalmic supplements for treating the photoreceptor degeneration. This drug evaluation system enables us to monitor drug effects in photoreceptor cells and could be useful for drug screening.

Calcium homeostasis in fly photoreceptor cells

NARCIS (Netherlands)

Oberwinkler, J

2002-01-01

In fly photoreceptor cells, two processes dominate the Ca2+ homeostasis: light-induced Ca2+ influx through members of the TRP family of ion channels, and Ca2+ extrusion by Na+/Ca2+ exchange.Ca2+ release from intracellular stores is quantitatively insignificant. Both, the light-activated channels and

Responses of crayfish photoreceptor cells following intense light adaptation.

Science.gov (United States)

Cummins, D R; Goldsmith, T H

1986-01-01

After intense orange adapting exposures that convert 80% of the rhodopsin in the eye to metarhodopsin, rhabdoms become covered with accessory pigment and appear to lose some microvillar order. Only after a delay of hours or even days is the metarhodopsin replaced by rhodopsin (Cronin and Goldsmith 1984). After 24 h of dark adaptation, when there has been little recovery of visual pigment, the photoreceptor cells have normal resting potentials and input resistances, and the reversal potential of the light response is 10-15 mV (inside positive), unchanged from controls. The log V vs log I curve is shifted about 0.6 log units to the right on the energy axis, quantitatively consistent with the decrease in the probability of quantum catch expected from the lowered concentration of rhodopsin in the rhabdoms. Furthermore, at 24 h the photoreceptors exhibit a broader spectral sensitivity than controls, which is also expected from accumulations of metarhodopsin in the rhabdoms. In three other respects, however, the transduction process appears to be light adapted: The voltage responses are more phasic than those of control photoreceptors. The relatively larger effect (compared to controls) of low extracellular Ca++ (1 mmol/l EGTA) in potentiating the photoresponses suggests that the photoreceptors may have elevated levels of free cytoplasmic Ca++. The saturating depolarization is only about 30% as large as the maximal receptor potentials of contralateral, dark controls, and by that measure the log V-log I curve is shifted downward by 0.54 log units.(ABSTRACT TRUNCATED AT 250 WORDS)

Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

Science.gov (United States)

Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

2014-01-13

Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

Lysergic acid diethylamide causes photoreceptor cell damage through inducing inflammatory response and oxidative stress.

Science.gov (United States)

Hu, Qi-Di; Xu, Ling-Li; Gong, Yan; Wu, Guo-Hai; Wang, Yu-Wen; Wu, Shan-Jun; Zhang, Zhe; Mao, Wei; Zhou, Yu-Sheng; Li, Qin-Bo; Yuan, Jian-Shu

2018-01-19

Lysergic acid diethylamide (LSD), a classical hallucinogen, was used as a popular and notorious substance of abuse in various parts of the world. Its abuse could result in long-lasting abnormalities in retina and little is known about the exact mechanism. This study was to investigate the effect of LSD on macrophage activation state at non-toxic concentration and its resultant toxicity to photoreceptor cells. Results showed that cytotoxicity was caused by LSD on 661 W cells after co-culturing with RAW264.7 cells. Treatment with LSD-induced RAW264.7 cells to the M1 phenotype, releasing more pro-inflammatory cytokines, and increasing the M1-related gene expression. Moreover, after co-culturing with RAW264.7 cells, significant oxidative stress in 661 W cells treated with LSD was observed, by increasing the level of malondialdehyde (MDA) and reactive oxygen species (ROS), and decreasing the level of glutathione (GSH) and the activity of superoxide dismutase (SOD). Our study demonstrated that LSD caused photoreceptor cell damage by inducing inflammatory response and resultant oxidative stress, providing the scientific rationale for the toxicity of LSD to retina.

Analysis of macular cone photoreceptors in a case of occult macular dystrophy

Directory of Open Access Journals (Sweden)

Tojo N

2013-05-01

Full Text Available Naoki Tojo Tomoko Nakamura Hironori Ozaki Miyako Oka Toshihiko Oiwake Atsushi HayashiDepartment of Ophthalmology, University of Toyama, Toyama, JapanPurpose: To investigate changes in cone photoreceptors with adaptive optics (AO fundus imaging and spectral domain optical coherence tomography (SD-OCT in a case of occult macular dystrophy (OMD.Patient and methods: Both eyes of a 42-year-old woman diagnosed with OMD were examined. We used an AO fundus camera to obtain images of cone photoreceptors in the macula of the OMD subject and five healthy control subjects. Correlations between the AO images and the SD-OCT images were examined. Cone photoreceptors in eight areas in the macula of OMD and healthy control subjects were analyzed and compared.Results: SD-OCT showed a loss of the cone outer-segment tips line outside of the fovea in both eyes of the subject with OMD. The left eye with decreased visual acuity showed a discontinuous photoreceptor inner-segment and outer-segment line and cone outer-segment tips line at the fovea in SD-OCT and loss of cone mosaics as a dark spot in the AO image. In panoramic AO images and cone-density maps, less cone density was observed in a ring-like region outside the fovea than in the peripheral retina. In most of the areas examined, the cone densities were lower in the OMD eyes than in the healthy control eyes.Conclusions: Cone densities in the macula of the OMD patient were greatly decreased. AO images were found to be useful to evaluate morphologic changes in cone photoreceptors in patients with OMD.Keywords: occult macular dystrophy, adaptive optics, cone photoreceptor, cone analysis, optical coherence tomography

Emerging use of gene expression microarrays in plant physiology.

Science.gov (United States)

Wullschleger, Stan D; Difazio, Stephen P

2003-01-01

Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

Correction of the retinal dystrophy phenotype of the RCS rat by viral gene transfer of Mertk.

Science.gov (United States)

Vollrath, D; Feng, W; Duncan, J L; Yasumura, D; D'Cruz, P M; Chappelow, A; Matthes, M T; Kay, M A; LaVail, M M

2001-10-23

The Royal College of Surgeons (RCS) rat is a widely studied animal model of retinal degeneration in which the inability of the retinal pigment epithelium (RPE) to phagocytize shed photoreceptor outer segments leads to a progressive loss of rod and cone photoreceptors. We recently used positional cloning to demonstrate that the gene Mertk likely corresponds to the retinal dystrophy (rdy) locus of the RCS rat. In the present study, we sought to determine whether gene transfer of Mertk to a RCS rat retina would result in correction of the RPE phagocytosis defect and preservation of photoreceptors. We used subretinal injection of a recombinant replication-deficient adenovirus encoding rat Mertk to deliver the gene to the eyes of young RCS rats. Electrophysiological assessment of animals 30 days after injection revealed an increased sensitivity of treated eyes to low-intensity light. Histologic and ultrastructural assessment demonstrated substantial sparing of photoreceptors, preservation of outer segment structure, and correction of the RPE phagocytosis defect in areas surrounding the injection site. Our results provide definitive evidence that mutation of Mertk underlies the RCS retinal dystrophy phenotype, and that the phenotype can be corrected by treatment of juvenile animals. To our knowledge, this is the first demonstration of complementation of both a functional cellular defect (phagocytosis) and a photoreceptor degeneration by gene transfer to the RPE. These results, together with the recent discovery of MERTK mutations in individuals with retinitis pigmentosa, emphasize the importance of the RCS rat as a model for gene therapy of diseases that arise from RPE dysfunction.

Fungal and plant gene expression in arbuscular mycorrhizal symbiosis.

Science.gov (United States)

Balestrini, Raffaella; Lanfranco, Luisa

2006-11-01

Arbuscular mycorrhizas (AMs) are a unique example of symbiosis between two eukaryotes, soil fungi and plants. This association induces important physiological changes in each partner that lead to reciprocal benefits, mainly in nutrient supply. The symbiosis results from modifications in plant and fungal cell organization caused by specific changes in gene expression. Recently, much effort has gone into studying these gene expression patterns to identify a wider spectrum of genes involved. We aim in this review to describe AM symbiosis in terms of current knowledge on plant and fungal gene expression profiles.

Shaggy Photoreceptors with Subfoveal Fluid Associated with a Distant Choroidal Melanoma

Directory of Open Access Journals (Sweden)

Ann Q. Tran

2015-01-01

Full Text Available Purpose. To describe the enhanced depth imaging optical coherence tomography (EDI-OCT findings in a patient with an extra macula choroidal melanoma before and after treatment. Methods. Observational case report. Results. A 45 year-old Caucasian male patient was referred to retina clinic for management of choroidal melanoma. Examination revealed a nasal choroidal melanoma while EDI-OCT illustrated subfoveal fluid pocket with elongated shaggy photoreceptors distant and separate from the tumor. The patient was treated with plaque brachytherapy and intravitreal bevacizumab. One week after plaque removal, there was a dramatic reduction in the shaggy photoreceptors. Conclusion. Choroidal melanomas have effects that are not localized to the area of the tumor. This loculated pocket of subretinal fluid and coinciding changes to photoreceptor morphology may be related to global changes in choroidal function or release of tumor related cytokines.

Emerging Use of Gene Expression Microarrays in Plant Physiology

Directory of Open Access Journals (Sweden)

Stephen P. Difazio

2006-04-01

Full Text Available Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

Divergence and Conservative Evolution of XTNX Genes in Land Plants

Directory of Open Access Journals (Sweden)

Yan-Mei Zhang

2017-10-01

Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.

UV-B photoreceptor-mediated protection of the photosynthetic machinery in Chlamydomonas reinhardtii

Science.gov (United States)

Allorent, Guillaume; Lefebvre-Legendre, Linnka; Chappuis, Richard; Kuntz, Marcel; Truong, Thuy B.; Niyogi, Krishna K.; Goldschmidt-Clermont, Michel

2016-01-01

Life on earth is dependent on the photosynthetic conversion of light energy into chemical energy. However, absorption of excess sunlight can damage the photosynthetic machinery and limit photosynthetic activity, thereby affecting growth and productivity. Photosynthetic light harvesting can be down-regulated by nonphotochemical quenching (NPQ). A major component of NPQ is qE (energy-dependent nonphotochemical quenching), which allows dissipation of light energy as heat. Photodamage peaks in the UV-B part of the spectrum, but whether and how UV-B induces qE are unknown. Plants are responsive to UV-B via the UVR8 photoreceptor. Here, we report in the green alga Chlamydomonas reinhardtii that UVR8 induces accumulation of specific members of the light-harvesting complex (LHC) superfamily that contribute to qE, in particular LHC Stress-Related 1 (LHCSR1) and Photosystem II Subunit S (PSBS). The capacity for qE is strongly induced by UV-B, although the patterns of qE-related proteins accumulating in response to UV-B or to high light are clearly different. The competence for qE induced by acclimation to UV-B markedly contributes to photoprotection upon subsequent exposure to high light. Our study reveals an anterograde link between photoreceptor-mediated signaling in the nucleocytosolic compartment and the photoprotective regulation of photosynthetic activity in the chloroplast. PMID:27930292

UV-B photoreceptor-mediated protection of the photosynthetic machinery in Chlamydomonas reinhardtii.

Science.gov (United States)

Allorent, Guillaume; Lefebvre-Legendre, Linnka; Chappuis, Richard; Kuntz, Marcel; Truong, Thuy B; Niyogi, Krishna K; Ulm, Roman; Goldschmidt-Clermont, Michel

2016-12-20

Life on earth is dependent on the photosynthetic conversion of light energy into chemical energy. However, absorption of excess sunlight can damage the photosynthetic machinery and limit photosynthetic activity, thereby affecting growth and productivity. Photosynthetic light harvesting can be down-regulated by nonphotochemical quenching (NPQ). A major component of NPQ is qE (energy-dependent nonphotochemical quenching), which allows dissipation of light energy as heat. Photodamage peaks in the UV-B part of the spectrum, but whether and how UV-B induces qE are unknown. Plants are responsive to UV-B via the UVR8 photoreceptor. Here, we report in the green alga Chlamydomonas reinhardtii that UVR8 induces accumulation of specific members of the light-harvesting complex (LHC) superfamily that contribute to qE, in particular LHC Stress-Related 1 (LHCSR1) and Photosystem II Subunit S (PSBS). The capacity for qE is strongly induced by UV-B, although the patterns of qE-related proteins accumulating in response to UV-B or to high light are clearly different. The competence for qE induced by acclimation to UV-B markedly contributes to photoprotection upon subsequent exposure to high light. Our study reveals an anterograde link between photoreceptor-mediated signaling in the nucleocytosolic compartment and the photoprotective regulation of photosynthetic activity in the chloroplast.

Short-term psychosocial stress protects photoreceptors from damage via corticosterone-mediated activation of the AKT pathway.

Science.gov (United States)

Forkwa, Tembei K; Neumann, Inga D; Tamm, Ernst R; Ohlmann, Andreas; Reber, Stefan O

2014-02-01

Apoptotic death of photoreceptors in hereditary retinal degenerations can be prevented by neuroprotective molecules. Here, we report that adrenal glucocorticoids (GC) released during psychosocial stress protect photoreceptors from apoptosis after light damage. Psychosocial stress is known to be the main type of stressor humans are exposed to and was induced here in mice by 10h of chronic subordinate colony housing (CSC). Photoreceptor damage was generated by subsequent exposure to white light. Short-term psychosocial stress prior to illumination significantly reduced the number of apoptotic photoreceptors, an effect that was absent in adrenalectomized (ADX) mice. The neuroprotective effect was completely restored in ADX mice substituted with GC. Moreover, phosphorylation of retinal AKT increased following CSC or exogenous GC treatment, an effect that was again absent in ADX mice exposed to CSC. Finally, inhibition of AKT signaling with triciribine blocked the stress- and GC-mediated neuroprotective effects on photoreceptors. In summary, we provide evidence that 1) short-term psychosocial stress protects photoreceptors from light-induced damage and 2) the protective effect is most likely mediated by GC-induced activation of the AKT signaling pathway. Copyright © 2013 Elsevier Inc. All rights reserved.

Development of transgenic crops based on photo-biotechnology.

Science.gov (United States)

Ganesan, Markkandan; Lee, Hyo-Yeon; Kim, Jeong-Il; Song, Pill-Soon

2017-11-01

The phenotypes associated with plant photomorphogenesis such as the suppressed shade avoidance response and de-etiolation offer the potential for significant enhancement of crop yields. Of many light signal transducers and transcription factors involved in the photomorphogenic responses of plants, this review focuses on the transgenic overexpression of the photoreceptor genes at the uppermost stream of the signalling events, particularly phytochromes, crytochromes and phototropins as the transgenes for the genetic engineering of crops with improved harvest yields. In promoting the harvest yields of crops, the photoreceptors mediate the light regulation of photosynthetically important genes, and the improved yields often come with the tolerance to abiotic stresses such as drought, salinity and heavy metal ions. As a genetic engineering approach, the term photo-biotechnology has been coined to convey the idea that the greater the photosynthetic efficiency that crop plants can be engineered to possess, the stronger the resistance to biotic and abiotic stresses. Development of GM crops based on photoreceptor transgenes (mainly phytochromes, crytochromes and phototropins) is reviewed with the proposal of photo-biotechnology that the photoreceptors mediate the light regulation of photosynthetically important genes, and the improved yields often come with the added benefits of crops' tolerance to environmental stresses. © 2016 John Wiley & Sons Ltd.

Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants

Science.gov (United States)

Basyuni, M.; Wati, R.

2018-03-01

The present study evaluates the bioinformatics methods to analyze twenty-four predicted polyprenol reductase genes from higher plants on GenBank as well as predicted the structure, composition, similarity, subcellular localization, and phylogenetic. The physicochemical properties of plant polyprenol showed diversity among the observed genes. The percentage of the secondary structure of plant polyprenol genes followed the ratio order of α helix > random coil > extended chain structure. The values of chloroplast but not signal peptide were too low, indicated that few chloroplast transit peptide in plant polyprenol reductase genes. The possibility of the potential transit peptide showed variation among the plant polyprenol reductase, suggested the importance of understanding the variety of peptide components of plant polyprenol genes. To clarify this finding, a phylogenetic tree was drawn. The phylogenetic tree shows several branches in the tree, suggested that plant polyprenol reductase genes grouped into divergent clusters in the tree.

Optical properties of photoreceptor and retinal pigment epithelium cells investigated with adaptive optics optical coherence tomography

Science.gov (United States)

Liu, Zhuolin

Human vision starts when photoreceptors collect and respond to light. Photoreceptors do not function in isolation though, but share close interdependence with neighboring photoreceptors and underlying retinal pigment epithelium (RPE) cells. These cellular interactions are essential for normal function of the photoreceptor-RPE complex, but methods to assess these in the living human eye are limited. One approach that has gained increased promise is high-resolution retinal imaging that has undergone tremendous technological advances over the last two decades to probe the living retina at the cellular level. Pivotal in these advances has been adaptive optics (AO) and optical coherence tomography (OCT) that together allow unprecedented spatial resolution of retinal structures in all three dimensions. Using these high-resolution systems, cone photoreceptor are now routinely imaged in healthy and diseased retina enabling fundamental structural properties of cones to be studied such as cell spacing, packing arrangement, and alignment. Other important cell properties, however, have remained elusive to investigation as even better imaging performance is required and thus has resulted in an incomplete understanding of how cells in the photoreceptor-RPE complex interact with light. To address this technical bottleneck, we expanded the imaging capability of AO-OCT to detect and quantify more accurately and completely the optical properties of cone photoreceptor and RPE cells at the cellular level in the living human retina. The first objective of this thesis was development of a new AO-OCT method that is more precise and sensitive, thus enabling a more detailed view of the 3D optical signature of the photoreceptor-RPE complex than was previously possible (Chapter 2). Using this new system, the second objective was quantifying the waveguide properties of individual cone photoreceptor inner and outer segments across the macula (Chapter 3). The third objective extended the AO

Extracellular electrical activity from the photoreceptors of midge

Indian Academy of Sciences (India)

Unknown

349. Keywords. Chironomus; electroretinogram; insect development; midge; photoreceptor ... ceran insects, only larval ocelli of mosquito (Family: Culi- cidae) have been ... and Ball (1995) studied the influence of light in Chiro- nomus tentans ...

The influence of photoreceptor size and distribution on optical sensitivity in the eyes of lanternfishes (Myctophidae)

KAUST Repository

Busserolles, Fanny de; Fitzpatrick, John L.; Marshall, N. Justin; Collin, Shaun P.

2014-01-01

The mesopelagic zone of the deep-sea (200-1000 m) is characterised by exponentially diminishing levels of downwelling sunlight and by the predominance of bioluminescence emissions. The ability of mesopelagic organisms to detect and behaviourally react to downwelling sunlight and/or bioluminescence will depend on the visual task and ultimately on the eyes and their capacity for detecting low levels of illumination and intermittent point sources of bioluminescent light. In this study, we investigate the diversity of the visual system of the lanternfish (Myctophidae). We focus specifically on the photoreceptor cells by examining their size, arrangement, topographic distribution and contribution to optical sensitivity in 53 different species from 18 genera. We also examine the influence(s) of both phylogeny and ecology on these photoreceptor variables using phylogenetic comparative analyses in order to understand the constraints placed on the visual systems of this large group of mesopelagic fishes at the first stage of retinal processing. We report great diversity in the visual system of the Myctophidae at the level of the photoreceptors. Photoreceptor distribution reveals clear interspecific differences in visual specialisations (areas of high rod photoreceptor density), indicating potential interspecific differences in interactions with prey, predators and/or mates. A great diversity in photoreceptor design (length and diameter) and density is also present. Overall, the myctophid eye is very sensitive compared to other teleosts and each species seems to be specialised for the detection of a specific signal (downwelling light or bioluminescence), potentially reflecting different visual demands for survival. Phylogenetic comparative analyses highlight several relationships between photoreceptor characteristics and the ecological variables tested (depth distribution and luminous tissue patterns). Depth distribution at night was a significant factor in most of the

The influence of photoreceptor size and distribution on optical sensitivity in the eyes of lanternfishes (Myctophidae)

KAUST Repository

Busserolles, Fanny de

2014-06-13

The mesopelagic zone of the deep-sea (200-1000 m) is characterised by exponentially diminishing levels of downwelling sunlight and by the predominance of bioluminescence emissions. The ability of mesopelagic organisms to detect and behaviourally react to downwelling sunlight and/or bioluminescence will depend on the visual task and ultimately on the eyes and their capacity for detecting low levels of illumination and intermittent point sources of bioluminescent light. In this study, we investigate the diversity of the visual system of the lanternfish (Myctophidae). We focus specifically on the photoreceptor cells by examining their size, arrangement, topographic distribution and contribution to optical sensitivity in 53 different species from 18 genera. We also examine the influence(s) of both phylogeny and ecology on these photoreceptor variables using phylogenetic comparative analyses in order to understand the constraints placed on the visual systems of this large group of mesopelagic fishes at the first stage of retinal processing. We report great diversity in the visual system of the Myctophidae at the level of the photoreceptors. Photoreceptor distribution reveals clear interspecific differences in visual specialisations (areas of high rod photoreceptor density), indicating potential interspecific differences in interactions with prey, predators and/or mates. A great diversity in photoreceptor design (length and diameter) and density is also present. Overall, the myctophid eye is very sensitive compared to other teleosts and each species seems to be specialised for the detection of a specific signal (downwelling light or bioluminescence), potentially reflecting different visual demands for survival. Phylogenetic comparative analyses highlight several relationships between photoreceptor characteristics and the ecological variables tested (depth distribution and luminous tissue patterns). Depth distribution at night was a significant factor in most of the

Evolutionary diversification of plant shikimate kinase gene duplicates.

Directory of Open Access Journals (Sweden)

Geoffrey Fucile

2008-12-01

Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

Early photoreceptor outer segment loss and retinoschisis in Cohen syndrome.

Science.gov (United States)

Uyhazi, Katherine E; Binenbaum, Gil; Carducci, Nicholas; Zackai, Elaine H; Aleman, Tomas S

2018-06-01

To describe early structural and functional retinal changes in a patient with Cohen syndrome. A 13-month-old Caucasian girl of Irish and Spanish ancestry was noted to have micrognathia and laryngomalacia at birth, which prompted a genetic evaluation that revealed biallelic deletions in COH1 (VPS13B) (a maternally inherited 60-kb deletion involving exons 26-32 and a paternally inherited 3.5-kb deletion within exon 17) consistent with Cohen syndrome. She underwent a complete ophthalmic examination, full-field flash electroretinography and retinal imaging with spectral domain optical coherence tomography. Central vision was central, steady, and maintained. There was bilateral myopic astigmatic refractive error. Fundus exam was notable for dark foveolar pigmentation, but no obvious abnormalities of either eye. Spectral domain optical coherence tomography cross sections through the fovea revealed a normal appearing photoreceptor outer nuclear layer but loss of the interdigitation signal between the photoreceptor outer segments and the apical retinal pigment epithelium. Retinoschisis involving the inner nuclear layer of both eyes and possible ganglion cell layer thinning were also noted. There was a detectable electroretinogram with similarly reduced amplitudes of rod- (white, 0.01 cd.s.m -2 ) and cone-mediated (3 cd.s.m -2 , 30 Hz) responses. Photoreceptor outer segment abnormalities and retinoschisis may represent the earliest structural retinal change detected by spectral domain optical coherence tomography in patients with Cohen syndrome, suggesting a complex pathophysiology with primary involvement of the photoreceptor cilium and disorganization of the structural integrity of the inner retina.

In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

Science.gov (United States)

Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

2018-01-01

DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

Functional Optical Coherence Tomography Enables In Vivo Physiological Assessment of Retinal Rod and Cone Photoreceptors

Science.gov (United States)

Zhang, Qiuxiang; Lu, Rongwen; Wang, Benquan; Messinger, Jeffrey D.; Curcio, Christine A.; Yao, Xincheng

2015-04-01

Transient intrinsic optical signal (IOS) changes have been observed in retinal photoreceptors, suggesting a unique biomarker for eye disease detection. However, clinical deployment of IOS imaging is challenging due to unclear IOS sources and limited signal-to-noise ratios (SNRs). Here, by developing high spatiotemporal resolution optical coherence tomography (OCT) and applying an adaptive algorithm for IOS processing, we were able to record robust IOSs from single-pass measurements. Transient IOSs, which might reflect an early stage of light phototransduction, are consistently observed in the photoreceptor outer segment almost immediately (retinal stimulation. Comparative studies of dark- and light-adapted retinas have demonstrated the feasibility of functional OCT mapping of rod and cone photoreceptors, promising a new method for early disease detection and improved treatment of diseases such as age-related macular degeneration (AMD) and other eye diseases that can cause photoreceptor damage.

Calcium channel-dependent molecular maturation of photoreceptor synapses.

Directory of Open Access Journals (Sweden)

Nawal Zabouri

Full Text Available Several studies have shown the importance of calcium channels in the development and/or maturation of synapses. The Ca(V1.4(α(1F knockout mouse is a unique model to study the role of calcium channels in photoreceptor synapse formation. It features abnormal ribbon synapses and aberrant cone morphology. We investigated the expression and targeting of several key elements of ribbon synapses and analyzed the cone morphology in the Ca(V1.4(α(1F knockout retina. Our data demonstrate that most abnormalities occur after eye opening. Indeed, scaffolding proteins such as Bassoon and RIM2 are properly targeted at first, but their expression and localization are not maintained in adulthood. This indicates that either calcium or the Ca(V1.4 channel, or both are necessary for the maintenance of their normal expression and distribution in photoreceptors. Other proteins, such as Veli3 and PSD-95, also display abnormal expression in rods prior to eye opening. Conversely, vesicle related proteins appear normal. Our data demonstrate that the Ca(V1.4 channel is important for maintaining scaffolding proteins in the ribbon synapse but less vital for proteins related to vesicular release. This study also confirms that in adult retinae, cones show developmental features such as sprouting and synaptogenesis. Overall we present evidence that in the absence of the Ca(V1.4 channel, photoreceptor synapses remain immature and are unable to stabilize.

Calcium channel-dependent molecular maturation of photoreceptor synapses.

Science.gov (United States)

Zabouri, Nawal; Haverkamp, Silke

2013-01-01

Several studies have shown the importance of calcium channels in the development and/or maturation of synapses. The Ca(V)1.4(α(1F)) knockout mouse is a unique model to study the role of calcium channels in photoreceptor synapse formation. It features abnormal ribbon synapses and aberrant cone morphology. We investigated the expression and targeting of several key elements of ribbon synapses and analyzed the cone morphology in the Ca(V)1.4(α(1F)) knockout retina. Our data demonstrate that most abnormalities occur after eye opening. Indeed, scaffolding proteins such as Bassoon and RIM2 are properly targeted at first, but their expression and localization are not maintained in adulthood. This indicates that either calcium or the Ca(V)1.4 channel, or both are necessary for the maintenance of their normal expression and distribution in photoreceptors. Other proteins, such as Veli3 and PSD-95, also display abnormal expression in rods prior to eye opening. Conversely, vesicle related proteins appear normal. Our data demonstrate that the Ca(V)1.4 channel is important for maintaining scaffolding proteins in the ribbon synapse but less vital for proteins related to vesicular release. This study also confirms that in adult retinae, cones show developmental features such as sprouting and synaptogenesis. Overall we present evidence that in the absence of the Ca(V)1.4 channel, photoreceptor synapses remain immature and are unable to stabilize.

Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

Science.gov (United States)

2010-01-01

Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests

Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

Directory of Open Access Journals (Sweden)

Hao Weilong

2010-12-01

Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

Characterization of Multiple Light Damage Paradigms Reveals Regional Differences in Photoreceptor Loss

OpenAIRE

Thomas, Jennifer L.; Nelson, Craig M.; Luo, Xixia; Hyde, David R.; Thummel, Ryan

2012-01-01

Zebrafish provide an attractive model to study the retinal response to photoreceptor apoptosis due to its remarkable ability to spontaneously regenerate retinal neurons following damage. There are currently two widely used light-induced retinal degeneration models to damage photoreceptors in the adult zebrafish. One model uses constant bright light, whereas the other uses a short exposure to extremely intense ultraviolet light. Although both models are currently used, it is unclear whether th...

Human retinal gene therapy for Leber congenital amaurosis shows advancing retinal degeneration despite enduring visual improvement

OpenAIRE

Cideciyan, Artur V.; Jacobson, Samuel G.; Beltran, William A.; Sumaroka, Alexander; Swider, Malgorzata; Iwabe, Simone; Roman, Alejandro J.; Olivares, Melani B.; Schwartz, Sharon B.; Komáromy, András M.; Hauswirth, William W.; Aguirre, Gustavo D.

2013-01-01

The first retinal gene therapy in human blindness from RPE65 mutations has focused on safety and efficacy, as defined by improved vision. The disease component not studied, however, has been the fate of photoreceptors in this progressive retinal degeneration. We show that gene therapy improves vision for at least 3 y, but photoreceptor degeneration progresses unabated in humans. In the canine model, the same result occurs when treatment is at the disease stage equivalent to humans. The study ...

Plant ion channels: gene families, physiology, and functional genomics analyses.

Science.gov (United States)

Ward, John M; Mäser, Pascal; Schroeder, Julian I

2009-01-01

Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein

Science.gov (United States)

Cloix, Catherine; Kaiserli, Eirini; Heilmann, Monika; Baxter, Katherine J.; Brown, Bobby A.; O’Hara, Andrew; Smith, Brian O.; Christie, John M.; Jenkins, Gareth I.

2012-01-01

UV-B light initiates photomorphogenic responses in plants. Arabidopsis UV RESISTANCE LOCUS8 (UVR8) specifically mediates these responses by functioning as a UV-B photoreceptor. UV-B exposure converts UVR8 from a dimer to a monomer, stimulates the rapid accumulation of UVR8 in the nucleus, where it binds to chromatin, and induces interaction of UVR8 with CONSTITUTIVELY PHOTOMORPHOGENIC1 (COP1), which functions with UVR8 to control photomorphogenic UV-B responses. Although the crystal structure of UVR8 reveals the basis of photoreception, it does not show how UVR8 initiates signaling through interaction with COP1. Here we report that a region of 27 amino acids from the C terminus of UVR8 (C27) mediates the interaction with COP1. The C27 region is necessary for UVR8 function in the regulation of gene expression and hypocotyl growth suppression in Arabidopsis. However, UVR8 lacking C27 still undergoes UV-B–induced monomerization in both yeast and plant protein extracts, accumulates in the nucleus in response to UV-B, and interacts with chromatin at the UVR8-regulated ELONGATED HYPOCOTYL5 (HY5) gene. The UV-B–dependent interaction of UVR8 and COP1 is reproduced in yeast cells and we show that C27 is both necessary and sufficient for the interaction of UVR8 with the WD40 domain of COP1. Furthermore, we show that C27 interacts in yeast with the REPRESSOR OF UV-B PHOTOMORPHOGENESIS proteins, RUP1 and RUP2, which are negative regulators of UVR8 function. Hence the C27 region has a key role in UVR8 function. PMID:22988111

EIAV-based retinal gene therapy in the shaker1 mouse model for usher syndrome type 1B: development of UshStat.

Directory of Open Access Journals (Sweden)

Marisa Zallocchi

Full Text Available Usher syndrome type 1B is a combined deaf-blindness condition caused by mutations in the MYO7A gene. Loss of functional myosin VIIa in the retinal pigment epithelia (RPE and/or photoreceptors leads to blindness. We evaluated the impact of subretinally delivered UshStat, a recombinant EIAV-based lentiviral vector expressing human MYO7A, on photoreceptor function in the shaker1 mouse model for Usher type 1B that lacks a functional Myo7A gene. Subretinal injections of EIAV-CMV-GFP, EIAV-RK-GFP (photoreceptor specific, EIAV-CMV-MYO7A (UshStat or EIAV-CMV-Null (control vectors were performed in shaker1 mice. GFP and myosin VIIa expression was evaluated histologically. Photoreceptor function in EIAV-CMV-MYO7A treated eyes was determined by evaluating α-transducin translocation in photoreceptors in response to low light intensity levels, and protection from light induced photoreceptor degeneration was measured. The safety and tolerability of subretinally delivered UshStat was evaluated in macaques. Expression of GFP and myosin VIIa was confirmed in the RPE and photoreceptors in shaker1 mice following subretinal delivery of the EIAV-CMV-GFP/MYO7A vectors. The EIAV-CMV-MYO7A vector protected the shaker1 mouse photoreceptors from acute and chronic intensity light damage, indicated by a significant reduction in photoreceptor cell loss, and restoration of the α-transducin translocation threshold in the photoreceptors. Safety studies in the macaques demonstrated that subretinal delivery of UshStat is safe and well-tolerated. Subretinal delivery of EIAV-CMV-MYO7A (UshStat rescues photoreceptor phenotypes in the shaker1 mouse. In addition, subretinally delivered UshStat is safe and well-tolerated in macaque safety studies These data support the clinical development of UshStat to treat Usher type 1B syndrome.

EIAV-based retinal gene therapy in the shaker1 mouse model for usher syndrome type 1B: development of UshStat.

Science.gov (United States)

Zallocchi, Marisa; Binley, Katie; Lad, Yatish; Ellis, Scott; Widdowson, Peter; Iqball, Sharifah; Scripps, Vicky; Kelleher, Michelle; Loader, Julie; Miskin, James; Peng, You-Wei; Wang, Wei-Min; Cheung, Linda; Delimont, Duane; Mitrophanous, Kyriacos A; Cosgrove, Dominic

2014-01-01

Usher syndrome type 1B is a combined deaf-blindness condition caused by mutations in the MYO7A gene. Loss of functional myosin VIIa in the retinal pigment epithelia (RPE) and/or photoreceptors leads to blindness. We evaluated the impact of subretinally delivered UshStat, a recombinant EIAV-based lentiviral vector expressing human MYO7A, on photoreceptor function in the shaker1 mouse model for Usher type 1B that lacks a functional Myo7A gene. Subretinal injections of EIAV-CMV-GFP, EIAV-RK-GFP (photoreceptor specific), EIAV-CMV-MYO7A (UshStat) or EIAV-CMV-Null (control) vectors were performed in shaker1 mice. GFP and myosin VIIa expression was evaluated histologically. Photoreceptor function in EIAV-CMV-MYO7A treated eyes was determined by evaluating α-transducin translocation in photoreceptors in response to low light intensity levels, and protection from light induced photoreceptor degeneration was measured. The safety and tolerability of subretinally delivered UshStat was evaluated in macaques. Expression of GFP and myosin VIIa was confirmed in the RPE and photoreceptors in shaker1 mice following subretinal delivery of the EIAV-CMV-GFP/MYO7A vectors. The EIAV-CMV-MYO7A vector protected the shaker1 mouse photoreceptors from acute and chronic intensity light damage, indicated by a significant reduction in photoreceptor cell loss, and restoration of the α-transducin translocation threshold in the photoreceptors. Safety studies in the macaques demonstrated that subretinal delivery of UshStat is safe and well-tolerated. Subretinal delivery of EIAV-CMV-MYO7A (UshStat) rescues photoreceptor phenotypes in the shaker1 mouse. In addition, subretinally delivered UshStat is safe and well-tolerated in macaque safety studies These data support the clinical development of UshStat to treat Usher type 1B syndrome.

Automated Photoreceptor Cell Identification on Nonconfocal Adaptive Optics Images Using Multiscale Circular Voting.

Science.gov (United States)

Liu, Jianfei; Jung, HaeWon; Dubra, Alfredo; Tam, Johnny

2017-09-01

Adaptive optics scanning light ophthalmoscopy (AOSLO) has enabled quantification of the photoreceptor mosaic in the living human eye using metrics such as cell density and average spacing. These rely on the identification of individual cells. Here, we demonstrate a novel approach for computer-aided identification of cone photoreceptors on nonconfocal split detection AOSLO images. Algorithms for identification of cone photoreceptors were developed, based on multiscale circular voting (MSCV) in combination with a priori knowledge that split detection images resemble Nomarski differential interference contrast images, in which dark and bright regions are present on the two sides of each cell. The proposed algorithm locates dark and bright region pairs, iteratively refining the identification across multiple scales. Identification accuracy was assessed in data from 10 subjects by comparing automated identifications with manual labeling, followed by computation of density and spacing metrics for comparison to histology and published data. There was good agreement between manual and automated cone identifications with overall recall, precision, and F1 score of 92.9%, 90.8%, and 91.8%, respectively. On average, computed density and spacing values using automated identification were within 10.7% and 11.2% of the expected histology values across eccentricities ranging from 0.5 to 6.2 mm. There was no statistically significant difference between MSCV-based and histology-based density measurements (P = 0.96, Kolmogorov-Smirnov 2-sample test). MSCV can accurately detect cone photoreceptors on split detection images across a range of eccentricities, enabling quick, objective estimation of photoreceptor mosaic metrics, which will be important for future clinical trials utilizing adaptive optics.

Regulation of meiotic gene expression in plants

Directory of Open Access Journals (Sweden)

Adele eZhou

2014-08-01

Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

Light adaptation and the evolution of vertebrate photoreceptors.

Science.gov (United States)

Morshedian, Ala; Fain, Gordon L

2017-07-15

Lamprey are cyclostomes, a group of vertebrates that diverged from lines leading to jawed vertebrates (including mammals) in the late Cambrian, 500 million years ago. It may therefore be possible to infer properties of photoreceptors in early vertebrate progenitors by comparing lamprey to other vertebrates. We show that lamprey rods and cones respond to light much like rods and cones in amphibians and mammals. They operate over a similar range of light intensities and adapt to backgrounds and bleaches nearly identically. These correspondences are pervasive and detailed; they argue for the presence of rods and cones very early in the evolution of vertebrates with properties much like those of rods and cones in existing vertebrate species. The earliest vertebrates were agnathans - fish-like organisms without jaws, which first appeared near the end of the Cambrian radiation. One group of agnathans became cyclostomes, which include lamprey and hagfish. Other agnathans gave rise to jawed vertebrates or gnathostomes, the group including all other existing vertebrate species. Because cyclostomes diverged from other vertebrates 500 million years ago, it may be possible to infer some of the properties of the retina of early vertebrate progenitors by comparing lamprey to other vertebrates. We have previously shown that rods and cones in lamprey respond to light much like photoreceptors in other vertebrates and have a similar sensitivity. We now show that these affinities are even closer. Both rods and cones adapt to background light and to bleaches in a manner almost identical to other vertebrate photoreceptors. The operating range in darkness is nearly the same in lamprey and in amphibian or mammalian rods and cones; moreover background light shifts response-intensity curves downward and to the right over a similar range of ambient intensities. Rods show increment saturation at about the same intensity as mammalian rods, and cones never saturate. Bleaches decrease

In silico identification and analysis of phytoene synthase genes in plants.

Science.gov (United States)

Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

2015-08-14

In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

Repressor-mediated tissue-specific gene expression in plants

Science.gov (United States)

Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

2009-02-17

Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

Photobiomodulation reduces photoreceptor death and regulates cytoprotection in early states of P23H retinal dystrophy

Science.gov (United States)

Kirk, Diana K.; Gopalakrishnan, Sandeep; Schmitt, Heather; Abroe, Betsy; Stoehr, Michele; Dubis, Adam; Carroll, Joseph; Stone, Jonathan; Valter, Krisztina; Eells, Janis

2013-03-01

Irradiation by light in the far-red to near-infrared (NIR) region of the spectrum (photobiomodulation, PBM) has been demonstrated to attenuate the severity of neurodegenerative disease in experimental and clinical studies. The purpose of this study was to test the hypothesis that 670 nm PBM would protect against the loss of retinal function and improve photoreceptor survival in a rodent model of retinitis pigmentosa, the P23H transgenic rat. P23H rat pups were treated once per day with a 670 nm LED array (180 sec treatments at 50 mW/cm2; fluence 9 joules/cm2) (Quantum Devices Inc., Barneveld WI) from postnatal day (p) 16-20 or from p10-20. Sham-treated rats were restrained, but not exposed to NIR light. The status of the retina was determined at p22 by assessment of mitochondrial function, oxidative stress and cell death. In a second series of studies, retinal status was assessed at p30 by measuring photoreceptor function by ERG and retinal morphology by Spectral Domain Optical Coherence Tomography (SD-OCT). 670 nm PBM increased retinal mitochondrial cytochrome oxidase activity and upregulated the retina's production of the key mitochondrial antioxidant enzyme, MnSOD. PBM also attenuated photoreceptor cell loss and improved photoreceptor function. PBM protects photoreceptors in the developing P23H retina, by augmenting mitochondrial function and stimulating antioxidant protective pathways. Photobiomodulation may have therapeutic potential, where mitochondrial damage is a step in the death of photoreceptors.

Plant domestication and gene banks

International Nuclear Information System (INIS)

Perrino, P.

1989-01-01

At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs

Gene therapy for Stargardt disease associated with ABCA4 gene.

Science.gov (United States)

Han, Zongchao; Conley, Shannon M; Naash, Muna I

2014-01-01

Mutations in the photoreceptor-specific flippase ABCA4 lead to accumulation of the toxic bisretinoid A2E, resulting in atrophy of the retinal pigment epithelium (RPE) and death of the photoreceptor cells. Many blinding diseases are associated with these mutations including Stargardt's disease (STGD1), cone-rod dystrophy, retinitis pigmentosa (RP), and increased susceptibility to age-related macular degeneration. There are no curative treatments for any of these dsystrophies. While the monogenic nature of many of these conditions makes them amenable to treatment with gene therapy, the ABCA4 cDNA is 6.8 kb and is thus too large for the AAV vectors which have been most successful for other ocular genes. Here we review approaches to ABCA4 gene therapy including treatment with novel AAV vectors, lentiviral vectors, and non-viral compacted DNA nanoparticles. Lentiviral and compacted DNA nanoparticles in particular have a large capacity and have been successful in improving disease phenotypes in the Abca4 (-/-) murine model. Excitingly, two Phase I/IIa clinical trials are underway to treat patients with ABCA4-associated Startgardt's disease (STGD1). As a result of the development of these novel technologies, effective therapies for ABCA4-associated diseases may finally be within reach.

Phylogenetics and evolution of Trx SET genes in fully sequenced land plants.

Science.gov (United States)

Zhu, Xinyu; Chen, Caoyi; Wang, Baohua

2012-04-01

Plant Trx SET proteins are involved in H3K4 methylation and play a key role in plant floral development. Genes encoding Trx SET proteins constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. To investigate the evolutionary history of the Trx SET gene family, we made a comprehensive evolutionary analysis on this gene family from 13 major representatives of green plants. A novel clustering (here named as cpTrx clade), which included the III-1, III-2, and III-4 orthologous groups, previously resolved was identified. Our analysis showed that plant Trx proteins possessed a variety of domain organizations and gene structures among paralogs. Additional domains such as PHD, PWWP, and FYR were early integrated into primordial SET-PostSET domain organization of cpTrx clade. We suggested that the PostSET domain was lost in some members of III-4 orthologous group during the evolution of land plants. At least four classes of gene structures had been formed at the early evolutionary stage of land plants. Three intronless orphan Trx SET genes from the Physcomitrella patens (moss) were identified, and supposedly, their parental genes have been eliminated from the genome. The structural differences among evolutionary groups of plant Trx SET genes with different functions were described, contributing to the design of further experimental studies.

Mfsd2a Is a Transporter for the Essential ω-3 Fatty Acid Docosahexaenoic Acid (DHA) in Eye and Is Important for Photoreceptor Cell Development.

Science.gov (United States)

Wong, Bernice H; Chan, Jia Pei; Cazenave-Gassiot, Amaury; Poh, Rebecca W; Foo, Juat Chin; Galam, Dwight L A; Ghosh, Sujoy; Nguyen, Long N; Barathi, Veluchamy A; Yeo, Sia W; Luu, Chi D; Wenk, Markus R; Silver, David L

2016-05-13

Eye photoreceptor membrane discs in outer rod segments are highly enriched in the visual pigment rhodopsin and the ω-3 fatty acid docosahexaenoic acid (DHA). The eye acquires DHA from blood, but transporters for DHA uptake across the blood-retinal barrier or retinal pigment epithelium have not been identified. Mfsd2a is a newly described sodium-dependent lysophosphatidylcholine (LPC) symporter expressed at the blood-brain barrier that transports LPCs containing DHA and other long-chain fatty acids. LPC transport via Mfsd2a has been shown to be necessary for human brain growth. Here we demonstrate that Mfsd2a is highly expressed in retinal pigment epithelium in embryonic eye, before the development of photoreceptors, and is the primary site of Mfsd2a expression in the eye. Eyes from whole body Mfsd2a-deficient (KO) mice, but not endothelium-specific Mfsd2a-deficient mice, were DHA-deficient and had significantly reduced LPC/DHA transport in vivo Fluorescein angiography indicated normal blood-retinal barrier function. Histological and electron microscopic analysis indicated that Mfsd2a KO mice exhibited a specific reduction in outer rod segment length, disorganized outer rod segment discs, and mislocalization of and reduction in rhodopsin early in postnatal development without loss of photoreceptors. Minor photoreceptor cell loss occurred in adult Mfsd2a KO mice, but electroretinography indicated visual function was normal. The developing eyes of Mfsd2a KO mice had activated microglia and up-regulation of lipogenic and cholesterogenic genes, likely adaptations to loss of LPC transport. These findings identify LPC transport via Mfsd2a as an important pathway for DHA uptake in eye and for development of photoreceptor membrane discs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Drosophila photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter protein.

Science.gov (United States)

Garrity, P A; Rao, Y; Salecker, I; McGlade, J; Pawson, T; Zipursky, S L

1996-05-31

Mutations in the Drosophila gene dreadlocks (dock) disrupt photoreceptor cell (R cell) axon guidance and targeting. Genetic mosaic analysis and cell-type-specific expression of dock transgenes demonstrate dock is required in R cells for proper innervation. Dock protein contains one SH2 and three SH3 domains, implicating it in tyrosine kinase signaling, and is highly related to the human proto-oncogene Nck. Dock expression is detected in R cell growth cones in the target region. We propose Dock transmits signals in the growth cone in response to guidance and targeting cues. These findings provide an important step for dissection of signaling pathways regulating growth cone motility.

Plant isoflavone and isoflavanone O-methyltransferase genes

Science.gov (United States)

Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

2014-08-19

The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

Gene expression regulation in photomorphogenesis from the perspective of the central dogma.

Science.gov (United States)

Wu, Shu-Hsing

2014-01-01

Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.

Ferritin gene organization: differences between plants and animals suggest possible kingdom-specific selective constraints.

Science.gov (United States)

Proudhon, D; Wei, J; Briat, J; Theil, E C

1996-03-01

Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may

Simple explant culture of the embryonic chicken retina with long-term preservation of photoreceptors.

Science.gov (United States)

Thangaraj, Gopenath; Greif, Alexander; Layer, Paul G

2011-10-01

Structurally stable in vitro-model systems are indispensible to analyse neural development during embryogenesis, follow cellular differentiation and evaluate neurotoxicological or growth factor effects. Here we describe a three-dimensional, long-term in vitro-culture system of the embryonic chick retina which supports photoreceptor development. Retinal tissue was isolated from E6 chick eye, and cultured as explants by continuous orbital rotation to allow free floatation without any supporting materials. Young stage (E6) immature retinas were cultured for various time periods in order to follow the differentiation of cell types and plexiform layers by immunocytochemical methods. These explants could be cultured for at least 2-3 weeks with remarkable retention of retinal architecture. Interestingly, photoreceptors developed in the absence of pigment epithelium. Electron microscopic studies revealed formation of structures resembling photoreceptor outer segments, a feature not reported previously. Thus, the verification of photoreceptors, Müller cells, inner retinal cells and the inner plexiform layer described in our study establishes this explant culture as a valuable in vivo-like model system. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Melanopsin-expressing amphioxus photoreceptors transduce light via a phospholipase C signaling cascade.

Directory of Open Access Journals (Sweden)

Juan Manuel Angueyra

Full Text Available Melanopsin, the receptor molecule that underlies light sensitivity in mammalian 'circadian' receptors, is homologous to invertebrate rhodopsins and has been proposed to operate via a similar signaling pathway. Its downstream effectors, however, remain elusive. Melanopsin also expresses in two distinct light-sensitive cell types in the neural tube of amphioxus. This organism is the most basal extant chordate and can help outline the evolutionary history of different photoreceptor lineages and their transduction mechanisms; moreover, isolated amphioxus photoreceptors offer unique advantages, because they are unambiguously identifiable and amenable to single-cell physiological assays. In the present study whole-cell patch clamp recording, pharmacological manipulations, and immunodetection were utilized to investigate light transduction in amphioxus photoreceptors. A G(q was identified and selectively localized to the photosensitive microvillar membrane, while the pivotal role of phospholipase C was established pharmacologically. The photocurrent was profoundly depressed by IP₃ receptor antagonists, highlighting the importance of IP₃ receptors in light signaling. By contrast, surrogates of diacylglycerol (DAG, as well as poly-unsaturated fatty acids failed to activate a membrane conductance or to alter the light response. The results strengthen the notion that calcium released from the ER via IP₃-sensitive channels may fulfill a key role in conveying--directly or indirectly--the melanopsin-initiated light signal to the photoconductance; moreover, they challenge the dogma that microvillar photoreceptors and phoshoinositide-based light transduction are a prerogative of invertebrate eyes.

Usher syndrome: animal models, retinal function of Usher proteins, and prospects for gene therapy

Science.gov (United States)

Williams, David S.

2009-01-01

Usher syndrome is a deafness-blindness disorder. The blindness occurs from a progressive retinal degeneration that begins after deafness and after the retina has developed. Three clinical subtypes of Usher syndrome have been identified, with mutations in any one of six different genes giving rise to type 1, in any one of three different genes to type 2, and in one identified gene causing Usher type 3. Mutant mice for most of the genes have been studied; while they have clear inner ear defects, retinal phenotypes are relatively mild and have been difficult to characterize. The retinal functions of the Usher proteins are still largely unknown. Protein binding studies have suggested many interactions among the proteins, and a model of interaction among all the proteins in the photoreceptor synapse has been proposed. However this model is not supported by localization data from some laboratories, or the indication of any synaptic phenotype in mutant mice. An earlier suggestion, based on patient pathologies, of Usher protein function in the photoreceptor cilium continues to gain support from immunolocalization and mutant mouse studies, which are consistent with Usher protein interaction in the photoreceptor ciliary/periciliary region. So far, the most characterized Usher protein is myosin VIIa. It is present in the apical RPE and photoreceptor ciliary/periciliary region, where it is required for organelle transport and clearance of opsin from the connecting cilium, respectively. Usher syndrome is amenable to gene replacement therapy, but also has some specific challenges. Progress in this treatment approach has been achieved by correction of mutant phenotypes in Myo7a-null mouse retinas, following lentiviral delivery of MYO7A. PMID:17936325

Knocking Down Snrnp200 Initiates Demorphogenesis of Rod Photoreceptors in Zebrafish

Directory of Open Access Journals (Sweden)

Yuan Liu

2015-01-01

Full Text Available Purpose. The small nuclear ribonucleoprotein 200 kDa (SNRNP200 gene is a fundamental component for precursor message RNA (pre-mRNA splicing and has been implicated in the etiology of autosomal dominant retinitis pigmentosa (adRP. This study aims to determine the consequences of knocking down Snrnp200 in zebrafish. Methods. Expression of the Snrnp200 transcript in zebrafish was determined via whole mount in situ hybridization. Morpholino oligonucleotide (MO aiming to knock down the expression of Snrnp200 was injected into zebrafish embryos, followed by analyses of aberrant splicing and expression of the U4/U6-U5 tri-small nuclear ribonucleoproteins (snRNPs components and retina-specific transcripts. Systemic changes and retinal phenotypes were further characterized by histological study and immunofluorescence staining. Results. Snrnp200 was ubiquitously expressed in zebrafish. Knocking down Snrnp200 in zebrafish triggered aberrant splicing of the cbln1 gene, upregulation of other U4/U6-U5 tri-snRNP components, and downregulation of a panel of retina-specific transcripts. Systemic defects were found correlated with knockdown of Snrnp200 in zebrafish. Only demorphogenesis of rod photoreceptors was detected in the initial stage, mimicking the disease characteristics of RP. Conclusions. We conclude that knocking down Snrnp200 in zebrafish could alter regular splicing and expression of a panel of genes, which may eventually trigger rod defects.

Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

International Nuclear Information System (INIS)

Yousaf, Sohail; Afzal, Muhammad; Reichenauer, Thomas G.; Brady, Carrie L.; Sessitsch, Angela

2011-01-01

The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: → E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. → E. ludwigii strains efficiently expressed alkane degradation genes in plants. → E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. → E. ludwigii interacted more effectively with Italian ryegrass than with other plants. → Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

Energy Technology Data Exchange (ETDEWEB)

Yousaf, Sohail [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); Afzal, Muhammad [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad (Pakistan); Reichenauer, Thomas G. [AIT Austrian Institute of Technology GmbH, Environmental Resources and Technologies Unit, A-2444 Seibersdorf (Austria); Brady, Carrie L. [Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria (South Africa); Sessitsch, Angela, E-mail: angela.sessitsch@ait.ac.at [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria)

2011-10-15

The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: > E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. > E. ludwigii strains efficiently expressed alkane degradation genes in plants. > E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. > E. ludwigii interacted more effectively with Italian ryegrass than with other plants. > Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

Atypical retinal pigment epithelial defects with retained photoreceptor layers

DEFF Research Database (Denmark)

Giannakaki-Zimmermann, Helena; Querques, Giuseppe; Munch, Inger Christine

2017-01-01

BACKGROUND: To report patients with age-related macular degeneration and atypical central retinal pigment epithelium (RPE) defects not attributable to geographic atrophy (GA) or RPE-tears with overlying preserved photoreceptor layers. METHODS: Multimodal imaging case-series evaluating the course...

Role of fractalkine/CX3CR1 interaction in light-induced photoreceptor degeneration through regulating retinal microglial activation and migration.

Directory of Open Access Journals (Sweden)

Meng Zhang

Full Text Available BACKGROUND: Excessive exposure to light enhances the progression and severity of some human retinal degenerative diseases. While retinal microglia are likely to be important in neuron damage associated with these diseases, the relationship between photoreceptor damage and microglial activation remains poorly understood. Some recent studies have indicated that the chemokine fractalkine is involved in the pathogenesis of many neurodegenerative diseases. The present study was performed to investigate the cross-talk between injured photoreceptors and activated retinal microglia, focusing on the role of fractalkine and its receptor CX3CR1 in light-induced photoreceptor degeneration. METHODOLOGY/PRINCIPAL FINDINGS: Both in vivo and in vitro experiments were involved in the research. In vivo, Sprague-Dawley rats were exposed to blue light for 24 hours. In vitro, the co-culture of primary retinal microglia and a photoreceptor cell line (661W cell was exposed to blue light for five hours. Some cultures were pretreated by the addition of anti-CX3CR1 neutralizing antibody or recombinant fractalkine. Expression of fractalkine/CX3CR1 and inflammatory cytokines was detected by immunofluorescence, real-time PCR, Western immunoblot analysis, and ELISA assay. TUNEL method was used to detect cell apoptosis. In addition, chemotaxis assay was performed to evaluate the impact of soluble fractalkine on microglial migration. Our results showed that the expression of fractalkine that was significantly upregulated after exposure to light, located mainly at the photoreceptors. The extent of photoreceptor degeneration and microglial migration paralleled the increased level of fractalkine/CX3CR1. Compared with the control, the expression of inflammatory cytokines was significantly downregulated in the anti-CX3CR1 neutralizing antibody-treated group, and the number of photoreceptors was also well preserved. The addition of recombinant full-length fractalkine or soluble

High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

International Nuclear Information System (INIS)

Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

2013-05-01

Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application

High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

Energy Technology Data Exchange (ETDEWEB)

Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

2013-05-15

Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application.

Xbp1-Independent Ire1 Signaling Is Required for Photoreceptor Differentiation and Rhabdomere Morphogenesis in Drosophila

Directory of Open Access Journals (Sweden)

Dina S. Coelho

2013-11-01

Full Text Available The unfolded protein response (UPR is composed by homeostatic signaling pathways that are activated by excessive protein misfolding in the endoplasmic reticulum. Ire1 signaling is an important mediator of the UPR, leading to the activation of the transcription factor Xbp1. Here, we show that Drosophila Ire1 mutant photoreceptors have defects in the delivery of rhodopsin-1 to the rhabdomere and in the secretion of Spacemaker/Eyes Shut into the interrhabdomeral space. However, these defects are not observed in Xbp1 mutant photoreceptors. Ire1 mutant retinas have higher mRNA levels for targets of regulated Ire1-dependent decay (RIDD, including for the fatty acid transport protein (fatp. Importantly, the downregulation of fatp by RNAi rescues the rhodopsin-1 delivery defects observed in Ire1 mutant photoreceptors. Our results show that the role of Ire1 during photoreceptor differentiation is independent of Xbp1 function and demonstrate the physiological relevance of the RIDD mechanism in this specific paradigm.

An Unexpected Diversity of Photoreceptor Classes in the Longfin Squid, Doryteuthis pealeii.

Science.gov (United States)

Kingston, Alexandra C N; Wardill, Trevor J; Hanlon, Roger T; Cronin, Thomas W

2015-01-01

Cephalopods are famous for their ability to change color and pattern rapidly for signaling and camouflage. They have keen eyes and remarkable vision, made possible by photoreceptors in their retinas. External to the eyes, photoreceptors also exist in parolfactory vesicles and some light organs, where they function using a rhodopsin protein that is identical to that expressed in the retina. Furthermore, dermal chromatophore organs contain rhodopsin and other components of phototransduction (including retinochrome, a photoisomerase first found in the retina), suggesting that they are photoreceptive. In this study, we used a modified whole-mount immunohistochemical technique to explore rhodopsin and retinochrome expression in a number of tissues and organs in the longfin squid, Doryteuthis pealeii. We found that fin central muscles, hair cells (epithelial primary sensory neurons), arm axial ganglia, and sucker peduncle nerves all express rhodopsin and retinochrome proteins. Our findings indicate that these animals possess an unexpected diversity of extraocular photoreceptors and suggest that extraocular photoreception using visual opsins and visual phototransduction machinery is far more widespread throughout cephalopod tissues than previously recognized.

An Unexpected Diversity of Photoreceptor Classes in the Longfin Squid, Doryteuthis pealeii.

Directory of Open Access Journals (Sweden)

Alexandra C N Kingston

Full Text Available Cephalopods are famous for their ability to change color and pattern rapidly for signaling and camouflage. They have keen eyes and remarkable vision, made possible by photoreceptors in their retinas. External to the eyes, photoreceptors also exist in parolfactory vesicles and some light organs, where they function using a rhodopsin protein that is identical to that expressed in the retina. Furthermore, dermal chromatophore organs contain rhodopsin and other components of phototransduction (including retinochrome, a photoisomerase first found in the retina, suggesting that they are photoreceptive. In this study, we used a modified whole-mount immunohistochemical technique to explore rhodopsin and retinochrome expression in a number of tissues and organs in the longfin squid, Doryteuthis pealeii. We found that fin central muscles, hair cells (epithelial primary sensory neurons, arm axial ganglia, and sucker peduncle nerves all express rhodopsin and retinochrome proteins. Our findings indicate that these animals possess an unexpected diversity of extraocular photoreceptors and suggest that extraocular photoreception using visual opsins and visual phototransduction machinery is far more widespread throughout cephalopod tissues than previously recognized.

Horizontal transfer of a subtilisin gene from plants into an ancestor of the plant pathogenic fungal genus Colletotrichum.

Science.gov (United States)

Armijos Jaramillo, Vinicio Danilo; Vargas, Walter Alberto; Sukno, Serenella Ana; Thon, Michael R

2013-01-01

The genus Colletotrichum contains a large number of phytopathogenic fungi that produce enormous economic losses around the world. The effect of horizontal gene transfer (HGT) has not been studied yet in these organisms. Inter-Kingdom HGT into fungal genomes has been reported in the past but knowledge about the HGT between plants and fungi is particularly limited. We describe a gene in the genome of several species of the genus Colletotrichum with a strong resemblance to subtilisins typically found in plant genomes. Subtilisins are an important group of serine proteases, widely distributed in all of the kingdoms of life. Our hypothesis is that the gene was acquired by Colletotrichum spp. through (HGT) from plants to a Colletotrichum ancestor. We provide evidence to support this hypothesis in the form of phylogenetic analyses as well as a characterization of the similarity of the subtilisin at the primary, secondary and tertiary structural levels. The remarkable level of structural conservation of Colletotrichum plant-like subtilisin (CPLS) with plant subtilisins and the differences with the rest of Colletotrichum subtilisins suggests the possibility of molecular mimicry. Our phylogenetic analysis indicates that the HGT event would have occurred approximately 150-155 million years ago, after the divergence of the Colletotrichum lineage from other fungi. Gene expression analysis shows that the gene is modulated during the infection of maize by C. graminicola suggesting that it has a role in plant disease. Furthermore, the upregulation of the CPLS coincides with the downregulation of several plant genes encoding subtilisins. Based on the known roles of subtilisins in plant pathogenic fungi and the gene expression pattern that we observed, we postulate that the CPLSs have an important role in plant infection.

Differentiation of retinal ganglion cells and photoreceptor precursors from mouse induced pluripotent stem cells carrying an Atoh7/Math5 lineage reporter.

Directory of Open Access Journals (Sweden)

Bin-Bin Xie

Full Text Available The neural retina is a critical component of the visual system, which provides the majority of sensory input in humans. Various retinal degenerative diseases can result in the permanent loss of retinal neurons, especially the light-sensing photoreceptors and the centrally projecting retinal ganglion cells (RGCs. The replenishment of lost RGCs and the repair of optic nerve damage are particularly challenging, as both RGC specification and their subsequent axonal growth and projection involve complex and precise regulation. To explore the developmental potential of pluripotent stem cell-derived neural progenitors, we have established mouse iPS cells that allow cell lineage tracing of progenitors that have expressed Atoh7/Math5, a bHLH transcription factor required for RGC production. These Atoh7 lineage reporter iPS cells encode Cre to replace one copy of the endogenous Atoh7 gene and a Cre-dependent YFP reporter in the ROSA locus. In addition, they express pluripotent markers and are capable of generating teratomas in vivo. Under anterior neural induction and neurogenic conditions in vitro, the Atoh7-Cre/ROSA-YFP iPS cells differentiate into neurons that co-express various RGC markers and YFP, indicating that these neurons are derived from Atoh7-expressing progenitors. Consistent with previous in vivo cell lineage studies, the Atoh7-Cre/ROSA-YFP iPS cells also give rise to a subset of Crx-positive photoreceptor precursors. Furthermore, inhibition of Notch signaling in the iPSC cultures results in a significant increase of YFP-positive RGCs and photoreceptor precursors. Together, these results show that Atoh7-Cre/ROSA-YFP iPS cells can be used to monitor the development and survival of RGCs and photoreceptors from pluripotent stem cells.

Molecular Evolution and Expression Divergence of HMT Gene Family in Plants

Directory of Open Access Journals (Sweden)

Man Zhao

2018-04-01

Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.

Effector gene birth in plant parasitic nematodes: Neofunctionalization of a housekeeping glutathione synthetase gene

Science.gov (United States)

Lilley, Catherine J.; Maqbool, Abbas; Wu, Duqing; Yusup, Hazijah B.; Jones, Laura M.; Birch, Paul R. J.; Urwin, Peter E.

2018-01-01

Plant pathogens and parasites are a major threat to global food security. Plant parasitism has arisen four times independently within the phylum Nematoda, resulting in at least one parasite of every major food crop in the world. Some species within the most economically important order (Tylenchida) secrete proteins termed effectors into their host during infection to re-programme host development and immunity. The precise detail of how nematodes evolve new effectors is not clear. Here we reconstruct the evolutionary history of a novel effector gene family. We show that during the evolution of plant parasitism in the Tylenchida, the housekeeping glutathione synthetase (GS) gene was extensively replicated. New GS paralogues acquired multiple dorsal gland promoter elements, altered spatial expression to the secretory dorsal gland, altered temporal expression to primarily parasitic stages, and gained a signal peptide for secretion. The gene products are delivered into the host plant cell during infection, giving rise to “GS-like effectors”. Remarkably, by solving the structure of GS-like effectors we show that during this process they have also diversified in biochemical activity, and likely represent the founding members of a novel class of GS-like enzyme. Our results demonstrate the re-purposing of an endogenous housekeeping gene to form a family of effectors with modified functions. We anticipate that our discovery will be a blueprint to understand the evolution of other plant-parasitic nematode effectors, and the foundation to uncover a novel enzymatic function. PMID:29641602

Subretinally transplanted embryonic stem cells rescue photoreceptor cells from degeneration in the RCS rats.

Science.gov (United States)

Schraermeyer, U; Thumann, G; Luther, T; Kociok, N; Armhold, S; Kruttwig, K; Andressen, C; Addicks, K; Bartz-Schmidt, K U

2001-01-01

The Royal College of Surgeons (RCS) rat is an animal model for retinal degeneration such as the age-related macular degeneration. The RCS rat undergoes a progressive retinal degeneration during the early postnatal period. A potential treatment to prevent this retinal degeneration is the transplantation into the subretinal space of cells that would replace functions of the degenerating retinal pigment epithelium (RPE) cells or may form neurotrophic factors. In this study we have investigated the potential of subretinally transplanted embryonic stem cells to prevent the genetically determined photoreceptor cell degeneration in the RCS rat. Embryonic stem cells from the inner cell mass of the mouse blastocyst were allowed to differentiate to neural precursor cells in vitro and were then transplanted into the subretinal space of 20-day-old RCS rats. Transplanted and sham-operated rats were sacrificed 2 months following cell transplantation. The eyes were enucleated and photoreceptor degeneration was quantified by analyzing and determining the thickness of the outer nuclear layer by light and electron microscopy. In the eyes transplanted with embryonic cells up to 8 rows of photoreceptor cell nuclei were observed, whereas in nontreated control eyes the outer nuclear layer had degenerated completely. Transplantation of embryonic stem cells appears to delay photoreceptor cell degeneration in RCS rats.

A novel Usher protein network at the periciliary reloading point between molecular transport machineries in vertebrate photoreceptor cells.

Science.gov (United States)

Maerker, Tina; van Wijk, Erwin; Overlack, Nora; Kersten, Ferry F J; McGee, Joann; Goldmann, Tobias; Sehn, Elisabeth; Roepman, Ronald; Walsh, Edward J; Kremer, Hannie; Wolfrum, Uwe

2008-01-01

The human Usher syndrome (USH) is the most frequent cause of combined deaf-blindness. USH is genetically heterogeneous with at least 12 chromosomal loci assigned to three clinical types, USH1-3. Although these USH types exhibit similar phenotypes in human, the corresponding gene products belong to very different protein classes and families. The scaffold protein harmonin (USH1C) was shown to integrate all identified USH1 and USH2 molecules into protein networks. Here, we analyzed a protein network organized in the absence of harmonin by the scaffold proteins SANS (USH1G) and whirlin (USH2D). Immunoelectron microscopic analyses disclosed the colocalization of all network components in the apical inner segment collar and the ciliary apparatus of mammalian photoreceptor cells. In this complex, whirlin and SANS directly interact. Furthermore, SANS provides a linkage to the microtubule transport machinery, whereas whirlin may anchor USH2A isoform b and VLGR1b (very large G-protein coupled receptor 1b) via binding to their cytodomains at specific membrane domains. The long ectodomains of both transmembrane proteins extend into the gap between the adjacent membranes of the connecting cilium and the apical inner segment. Analyses of Vlgr1/del7TM mice revealed the ectodomain of VLGR1b as a component of fibrous links present in this gap. Comparative analyses of mouse and Xenopus photoreceptors demonstrated that this USH protein network is also part of the periciliary ridge complex in Xenopus. Since this structural specialization in amphibian photoreceptor cells defines a specialized membrane domain for docking and fusion of transport vesicles, we suggest a prominent role of the USH proteins in cargo shipment.

Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.

Science.gov (United States)

Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji

2018-02-15

Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.

Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

Science.gov (United States)

Panwar, Vinay; Bakkeren, Guus

2017-01-01

Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

Science.gov (United States)

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

Negative regulation of ciliary length by ciliary male germ cell-associated kinase (Mak) is required for retinal photoreceptor survival.

Science.gov (United States)

Omori, Yoshihiro; Chaya, Taro; Katoh, Kimiko; Kajimura, Naoko; Sato, Shigeru; Muraoka, Koichiro; Ueno, Shinji; Koyasu, Toshiyuki; Kondo, Mineo; Furukawa, Takahisa

2010-12-28

Cilia function as cell sensors in many organs, and their disorders are referred to as "ciliopathies." Although ciliary components and transport machinery have been well studied, regulatory mechanisms of ciliary formation and maintenance are poorly understood. Here we show that male germ cell-associated kinase (Mak) regulates retinal photoreceptor ciliary length and subcompartmentalization. Mak was localized both in the connecting cilia and outer-segment axonemes of photoreceptor cells. In the Mak-null retina, photoreceptors exhibit elongated cilia and progressive degeneration. We observed accumulation of intraflagellar transport 88 (IFT88) and IFT57, expansion of kinesin family member 3A (Kif3a), and acetylated α-tubulin signals in the Mak-null photoreceptor cilia. We found abnormal rhodopsin accumulation in the Mak-null photoreceptor cell bodies at postnatal day 14. In addition, overexpression of retinitis pigmentosa 1 (RP1), a microtubule-associated protein localized in outer-segment axonemes, induced ciliary elongation, and Mak coexpression rescued excessive ciliary elongation by RP1. The RP1 N-terminal portion induces ciliary elongation and increased intensity of acetylated α-tubulin labeling in the cells and is phosphorylated by Mak. These results suggest that Mak is essential for the regulation of ciliary length and is required for the long-term survival of photoreceptors.

Alteration of plant meristem function by manipulation of the Retinoblastoma-like plant RRB gene

Science.gov (United States)

Durfee, Tim [Madison, WI; Feiler, Heidi [Albany, CA; Gruissem, Wilhelm [Forch, CH; Jenkins, Susan [Martinez, CA; Roe, Judith [Manhattan, KS; Zambryski, Patricia [Berkeley, CA

2007-01-16

This invention provides methods and compositions for altering the growth, organization, and differentiation of plant tissues. The invention is based on the discovery that, in plants, genetically altering the levels of Retinoblastoma-related gene (RRB) activity produces dramatic effects on the growth, proliferation, organization, and differentiation of plant meristem.

Regulatory arrestin cycle secures the fidelity and maintenance of the fly photoreceptor cell.

Science.gov (United States)

Byk, T; Bar-Yaacov, M; Doza, Y N; Minke, B; Selinger, Z

1993-01-01

Excitation of fly photoreceptor cells is initiated by photoisomerization of rhodopsin to the active form of metarhodopsin. Fly metarhodopsin is thermostable, does not bleach, and does not regenerate spontaneously to rhodopsin. For this reason, the activity of metarhodopsin must be stopped by an effective termination reaction. On the other hand, there is also a need to restore the inactivated photopigment to an excitable state in order to keep a sufficient number of photopigment molecules available for excitation. The following findings reveal how these demands are met. The photopigment undergoes rapid phosphorylation upon photoconversion of rhodopsin to metarhodopsin and an efficient Ca2+ dependent dephosphorylation upon regeneration of metarhodopsin to rhodopsin. Phosphorylation decreases the ability of metarhodopsin to activate the guanine nucleotide-binding protein. Binding of 49-kDa arrestin further quenches the activity of metarhodopsin and protects it from dephosphorylation. Light-dependent binding and release of 49-kDa arrestin from metarhodopsin- and rhodopsin-containing membranes, respectively, directs the dephosphorylation reaction toward rhodopsin. This ensures the return of phosphorylated metarhodopsin to the rhodopsin pool without initiating transduction in the dark. Assays of rhodopsin dephosphorylation in the Drosophila retinal degeneration C (rdgC) mutant, a mutant in a gene previously cloned and predicted to encode a serine/threonine protein phosphatase, reveal that phosphorylated rhodopsin is a major substrate for the rdgC phosphatase. We propose that mutations resulting in either a decrease or an improper regulation of rhodopsin phosphatase activity bring about degeneration of the fly photoreceptor cells. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8446607

Cone photoreceptor structure in patients with x-linked cone dysfunction and red-green color vision deficiency

DEFF Research Database (Denmark)

Patterson, Emily J.; Wilk, Melissa; Langlo, Christopher S.

2016-01-01

encoded by exon 4, and two with a novel insertion in exon 2. Foveal cone structure and retinal thickness was disrupted to a variable degree, even among related individuals with the same L/M array. CONCLUSIONS. Our findings provide a direct link between disruption of the cone mosaic and L/ M opsin variants......PURPOSE. Mutations in the coding sequence of the L and M opsin genes are often associated with X-linked cone dysfunction (such as Bornholm Eye Disease, BED), though the exact color vision phenotype associated with these disorders is variable. We examined individuals with L/ M opsin gene mutations...... to clarify the link between color vision deficiency and cone dysfunction.  METHODS. We recruited 17 males for imaging. The thickness and integrity of the photoreceptor layers were evaluated using spectral-domain optical coherence tomography. Cone density was measured using high-resolution images of the cone...

Adaptive optics fundus images of cone photoreceptors in the macula of patients with retinitis pigmentosa

Directory of Open Access Journals (Sweden)

Tojo N

2013-01-01

Full Text Available Naoki Tojo, Tomoko Nakamura, Chiharu Fuchizawa, Toshihiko Oiwake, Atsushi HayashiDepartment of Ophthalmology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama, JapanBackground: The purpose of this study was to examine cone photoreceptors in the macula of patients with retinitis pigmentosa using an adaptive optics fundus camera and to investigate any correlations between cone photoreceptor density and findings on optical coherence tomography and fundus autofluorescence.Methods: We examined two patients with typical retinitis pigmentosa who underwent ophthalmological examination, including measurement of visual acuity, and gathering of electroretinographic, optical coherence tomographic, fundus autofluorescent, and adaptive optics fundus images. The cone photoreceptors in the adaptive optics images of the two patients with retinitis pigmentosa and five healthy subjects were analyzed.Results: An abnormal parafoveal ring of high-density fundus autofluorescence was observed in the macula in both patients. The border of the ring corresponded to the border of the external limiting membrane and the inner segment and outer segment line in the optical coherence tomographic images. Cone photoreceptors at the abnormal parafoveal ring were blurred and decreased in the adaptive optics images. The blurred area corresponded to the abnormal parafoveal ring in the fundus autofluorescence images. Cone densities were low at the blurred areas and at the nasal and temporal retina along a line from the fovea compared with those of healthy controls. The results for cone spacing and Voronoi domains in the macula corresponded with those for the cone densities.Conclusion: Cone densities were heavily decreased in the macula, especially at the parafoveal ring on high-density fundus autofluorescence in both patients with retinitis pigmentosa. Adaptive optics images enabled us to observe in vivo changes in the cone photoreceptors of

pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature

Science.gov (United States)

Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.

2015-01-01

Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475

Lactococcus lactis Metabolism and Gene Expression during Growth on Plant Tissues

Science.gov (United States)

Golomb, Benjamin L.

2014-01-01

Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484

Re-interpreting plant morphological responses to UV-B radiation

Czech Academy of Sciences Publication Activity Database

Matthew Robson, T.; Klem, Karel; Urban, Otmar; Jansen, M. A.

2015-01-01

Roč. 38, č. 5 (2015), s. 856-866 ISSN 0140-7791 R&D Projects: GA MŠk LD12030 Institutional support: RVO:67179843 Keywords : auxin homeostasis * canopy structure and light interception * chronic * acute stress * flavonoid accumulation * plant-plant interactions * stress-induced morphogenic responses (SIMR) * ultraviolet radiation * UVR8 photoreceptor * whole-plant phenotype Subject RIV: EH - Ecology, Behaviour Impact factor: 6.169, year: 2015

Human amniotic fluid promotes retinal pigmented epithelial cells' trans-differentiation into rod photoreceptors and retinal ganglion cells.

Science.gov (United States)

Ghaderi, Shima; Soheili, Zahra-Soheila; Ahmadieh, Hamid; Davari, Maliheh; Jahromi, Fatemeh Sanie; Samie, Shahram; Rezaie-Kanavi, Mozhgan; Pakravesh, Jalil; Deezagi, Abdolkhalegh

2011-09-01

To evaluate the effect of human amniotic fluid (HAF) on retinal pigmented epithelial cells growth and trans-differentiation into retinal neurons, retinal pigmented epithelium (RPE) cells were isolated from neonatal human cadaver eye globes and cultured in Dulbecco's modified Eagle's medium-F12 supplemented with 10% fetal bovine serum (FBS). Confluent monolayer cultures were trypsinized and passaged using FBS-containing or HAF-containing media. Amniotic fluid samples were received from pregnant women in the first trimester of gestation. Cell proliferation and death enzyme-linked immunosorbent assays were performed to assess the effect of HAF on RPE cell growth. Trans-differentiation into rod photoreceptors and retinal ganglion cells was also studied using immunocytochemistry and real-time polymerase chain reaction techniques. Primary cultures of RPE cells were successfully established under FBS-containing or HAF-containing media leading to rapid cell growth and proliferation. When RPE cells were moved to in vitro culture system, they began to lose their differentiation markers such as pigmentation and RPE65 marker and trans-differentiated neural-like cells followed by spheroid colonies pertaining to stem/progenitor cells were morphologically detected. Immunocytochemistry (ICC) analysis of HAF-treated cultures showed a considerable expression of Rhodopsin gene (30% Rhodopsin-positive cells) indicating trans-differentiation of RPE cells to rod photoreceptors. Real-time polymerase chain reaction revealed an HAF-dose-dependant expression of Thy-1 gene (RGC marker) and significant promoting effect of HAF on RGCs generation. The data presented here suggest that HAF possesses invaluable stimulatory effect on RPE cells growth and trans-differentiation into retinal neurons. It can be regarded as a newly introduced enriched supplement in serum-free kinds of media used in neuro-retinal regeneration studies.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

Directory of Open Access Journals (Sweden)

Tran Lan T

2012-08-01

Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

Directory of Open Access Journals (Sweden)

Craxton Molly

2007-07-01

Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

Arabidopsis cryptochrome 1 is a soluble protein mediating blue light-dependent regulation of plant growth and development

International Nuclear Information System (INIS)

Lin ChenTao; Ahmad, M.; Cashmore, A.R.

1996-01-01

Cryptochrome 1 (CRY1) is a flavin-type blue type receptor of Arabidopsis thaliana which mediates inhibition of hypocotyl elongation. In the work described in this report it is demonstrated that CRY1 is a soluble protein expressed in both young seedlings grown either in the dark or under light, and in different organs of adult plants. The functional role of CRY1 was further investigated using transgenic Arabidopsis plants overexpressing CRY1. It is demonstrated that overexpression of CRY1 resulted in hypersensitivity to blue, UV-A, and green light for the inhibition of hypocotyl elongation response. Transgenic plants overexpressing CRY1 also exhibited a dwarf phenotype with reduced size in almost every organ. This was in keeping with the previous observation of reciprocal alterations found in hy4 mutant plants and is consistent with a hypothesis that CRY1 mediates a light-dependent process resulting in a general inhibitory effect on plant growth. In addition, transgenic plants overexpressing CRY1 showed increased anthocyanin accumulation in response to blue, UV-A, and green light in a fluence rate-dependent manner. This increase in anthocyanin accumulation in transgenic plants was shown to be concomitant with increased blue light-induction of CHS gene expression. It is concluded that CRY1 is a photoreceptor mediating blue light-dependent regulation of gene expression in addition to its affect on plant growth. (author)

Domestication of transposable elements into MicroRNA genes in plants.

Directory of Open Access Journals (Sweden)

Yang Li

Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.

Adaptive optics fundus images of cone photoreceptors in the macula of patients with retinitis pigmentosa.

Science.gov (United States)

Tojo, Naoki; Nakamura, Tomoko; Fuchizawa, Chiharu; Oiwake, Toshihiko; Hayashi, Atsushi

2013-01-01

The purpose of this study was to examine cone photoreceptors in the macula of patients with retinitis pigmentosa using an adaptive optics fundus camera and to investigate any correlations between cone photoreceptor density and findings on optical coherence tomography and fundus autofluorescence. We examined two patients with typical retinitis pigmentosa who underwent ophthalmological examination, including measurement of visual acuity, and gathering of electroretinographic, optical coherence tomographic, fundus autofluorescent, and adaptive optics fundus images. The cone photoreceptors in the adaptive optics images of the two patients with retinitis pigmentosa and five healthy subjects were analyzed. An abnormal parafoveal ring of high-density fundus autofluorescence was observed in the macula in both patients. The border of the ring corresponded to the border of the external limiting membrane and the inner segment and outer segment line in the optical coherence tomographic images. Cone photoreceptors at the abnormal parafoveal ring were blurred and decreased in the adaptive optics images. The blurred area corresponded to the abnormal parafoveal ring in the fundus autofluorescence images. Cone densities were low at the blurred areas and at the nasal and temporal retina along a line from the fovea compared with those of healthy controls. The results for cone spacing and Voronoi domains in the macula corresponded with those for the cone densities. Cone densities were heavily decreased in the macula, especially at the parafoveal ring on high-density fundus autofluorescence in both patients with retinitis pigmentosa. Adaptive optics images enabled us to observe in vivo changes in the cone photoreceptors of patients with retinitis pigmentosa, which corresponded to changes in the optical coherence tomographic and fundus autofluorescence images.

Noninvasive imaging of the human rod photoreceptor mosaic using a confocal adaptive optics scanning ophthalmoscope

Science.gov (United States)

Dubra, Alfredo; Sulai, Yusufu; Norris, Jennifer L.; Cooper, Robert F.; Dubis, Adam M.; Williams, David R.; Carroll, Joseph

2011-01-01

The rod photoreceptors are implicated in a number of devastating retinal diseases. However, routine imaging of these cells has remained elusive, even with the advent of adaptive optics imaging. Here, we present the first in vivo images of the contiguous rod photoreceptor mosaic in nine healthy human subjects. The images were collected with three different confocal adaptive optics scanning ophthalmoscopes at two different institutions, using 680 and 775 nm superluminescent diodes for illumination. Estimates of photoreceptor density and rod:cone ratios in the 5°–15° retinal eccentricity range are consistent with histological findings, confirming our ability to resolve the rod mosaic by averaging multiple registered images, without the need for additional image processing. In one subject, we were able to identify the emergence of the first rods at approximately 190 μm from the foveal center, in agreement with previous histological studies. The rod and cone photoreceptor mosaics appear in focus at different retinal depths, with the rod mosaic best focus (i.e., brightest and sharpest) being at least 10 μm shallower than the cones at retinal eccentricities larger than 8°. This study represents an important step in bringing high-resolution imaging to bear on the study of rod disorders. PMID:21750765

High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes

DEFF Research Database (Denmark)

Wang, Wen; Zheng, Hongkung; Fan, Chuanzhu

2006-01-01

Retroposition is widely found to play essential roles in origination of new mammalian and other animal genes. However, the scarcity of retrogenes in plants has led to the assumption that plant genomes rarely evolve new gene duplicates by retroposition, despite abundant retrotransposons in plants......, confirming a previously observed role of retroelements in generating plant retrogenes. Substitution analyses revealed that the vast majority are subject to negative selection, suggesting, along with expression data and evidence of age, that they are likely functional retrogenes. In addition, 42...

In Silico Identification, Phylogenetic and Bioinformatic Analysis of Argonaute Genes in Plants

Directory of Open Access Journals (Sweden)

Khaled Mirzaei

2014-01-01

Full Text Available Argonaute protein family is the key players in pathways of gene silencing and small regulatory RNAs in different organisms. Argonaute proteins can bind small noncoding RNAs and control protein synthesis, affect messenger RNA stability, and even participate in the production of new forms of small RNAs. The aim of this study was to characterize and perform bioinformatic analysis of Argonaute proteins in 32 plant species that their genome was sequenced. A total of 437 Argonaute genes were identified and were analyzed based on lengths, gene structure, and protein structure. Results showed that Argonaute proteins were highly conserved across plant kingdom. Phylogenic analysis divided plant Argonautes into three classes. Argonaute proteins have three conserved domains PAZ, MID and PIWI. In addition to three conserved domains namely, PAZ, MID, and PIWI, we identified few more domains in AGO of some plant species. Expression profile analysis of Argonaute proteins showed that expression of these genes varies in most of tissues, which means that these proteins are involved in regulation of most pathways of the plant system. Numbers of alternative transcripts of Argonaute genes were highly variable among the plants. A thorough analysis of large number of putative Argonaute genes revealed several interesting aspects associated with this protein and brought novel information with promising usefulness for both basic and biotechnological applications.

Horizontal gene transfer of a plastid gene in the non-photosynthetic flowering plants Orobanche and Phelipanche (Orobanchaceae).

Science.gov (United States)

Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M

2007-06-01

Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.

Localizing genes using linkage disequilibrium in plants: integrating ...

African Journals Online (AJOL)

GREGO

2007-03-19

Mar 19, 2007 ... Localizing genes using linkage disequilibrium in plants: integrating lessons ... reduce that association as a function of the marker distance from the QTL. ..... the gene locus enhanced the resolution power of asso- ciation tests .... agents, such as insects, birds, water and wind, so mating is determined by a ...

Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

DEFF Research Database (Denmark)

Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

2006-01-01

MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

Cell Fate of Müller Cells During Photoreceptor Regeneration in an N-Methyl-N-nitrosourea-Induced Retinal Degeneration Model of Zebrafish.

Science.gov (United States)

Ogai, Kazuhiro; Hisano, Suguru; Sugitani, Kayo; Koriyama, Yoshiki; Kato, Satoru

2016-01-01

Zebrafish can regenerate several organs such as the tail fin, heart, central nervous system, and photoreceptors. Very recently, a study has demonstrated the photoreceptor regeneration in the alkylating agent N-methyl-N-nitrosourea (MNU)-induced retinal degeneration (RD) zebrafish model, in which whole photoreceptors are lost within a week after MNU treatment and then regenerated within a month. The research has also shown massive proliferation of Müller cells within a week. To address the question of whether proliferating Müller cells are the source of regenerating photoreceptors, which remains unknown in the MNU-induced zebrafish RD model, we employed a BrdU pulse-chase technique to label the proliferating cells within a week after MNU treatment. As a result of the BrdU pulse-chase technique, a number of BrdU(+) cells were observed in the outer nuclear layer as well as the inner nuclear layer. This implies that regenerating photoreceptors are derived from proliferating Müller cells in the zebrafish MNU-induced RD model.

Photoreceptor inner segment ellipsoid band integrity on spectral domain optical coherence tomography

Directory of Open Access Journals (Sweden)

Saxena S

2014-12-01

Full Text Available Sandeep Saxena,1 Khushboo Srivastav,1 Chui M Cheung,2 Joanne YW Ng,3 Timothy YY Lai3 1Retina Service, Department of Ophthalmology, King George’s Medical University Lucknow, India; 2Singapore National Eye Centre, Singapore; 3Department of Ophthalmology and Visual Sciences, The Chinese University of Hong Kong, Kowloon, Hong Kong Abstract: Spectral domain optical coherence tomography cross-sectional imaging of the macula has conventionally been resolved into four bands. However, some doubts were raised regarding authentication of the existence of these bands. Recently, a number of studies have suggested that the second band appeared to originate from the inner segment ellipsoids of the foveal cone photoreceptors, and therefore the previously called inner segment-outer segment junction is now referred to as inner segment ellipsoidband. Photoreceptor dysfunction may be a significant predictor of visual acuity in a spectrum of surgical and medical retinal diseases. This review aims to provide an overview and summarizes the role of the photoreceptor inner segment ellipsoid band in the management and prognostication of various vitreoretinal diseases. Keywords: spectral domain optical coherence tomography, inner segment-outer segment junction, external limiting membrane, macular hole, diabetic macular edema, age relate macular degeneration

Unidirectional photoreceptor-to-Müller glia coupling and unique K+ channel expression in Caiman retina.

Directory of Open Access Journals (Sweden)

Astrid Zayas-Santiago

Full Text Available Müller cells, the principal glial cells of the vertebrate retina, are fundamental for the maintenance and function of neuronal cells. In most vertebrates, including humans, Müller cells abundantly express Kir4.1 inwardly rectifying potassium channels responsible for hyperpolarized membrane potential and for various vital functions such as potassium buffering and glutamate clearance; inter-species differences in Kir4.1 expression were, however, observed. Localization and function of potassium channels in Müller cells from the retina of crocodiles remain, hitherto, unknown.We studied retinae of the Spectacled caiman (Caiman crocodilus fuscus, endowed with both diurnal and nocturnal vision, by (i immunohistochemistry, (ii whole-cell voltage-clamp, and (iii fluorescent dye tracing to investigate K+ channel distribution and glia-to-neuron communications.Immunohistochemistry revealed that caiman Müller cells, similarly to other vertebrates, express vimentin, GFAP, S100β, and glutamine synthetase. In contrast, Kir4.1 channel protein was not found in Müller cells but was localized in photoreceptor cells. Instead, 2P-domain TASK-1 channels were expressed in Müller cells. Electrophysiological properties of enzymatically dissociated Müller cells without photoreceptors and isolated Müller cells with adhering photoreceptors were significantly different. This suggests ion coupling between Müller cells and photoreceptors in the caiman retina. Sulforhodamine-B injected into cones permeated to adhering Müller cells thus revealing a uni-directional dye coupling.Our data indicate that caiman Müller glial cells are unique among vertebrates studied so far by predominantly expressing TASK-1 rather than Kir4.1 K+ channels and by bi-directional ion and uni-directional dye coupling to photoreceptor cells. This coupling may play an important role in specific glia-neuron signaling pathways and in a new type of K+ buffering.

Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.

Science.gov (United States)

Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella

2017-10-01

Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Plant-bacteria partnership: phytoremediation of hydrocarbons contaminated soil and expression of catabolic genes

Directory of Open Access Journals (Sweden)

Hamna Saleem

2016-01-01

Full Text Available Petroleum hydrocarbons are harmful to living organisms when they are exposed in natural environment. Once they come in contact, it is not an easy to remove them because many of their constituents are persistent in nature. To achieve this target, different approaches have been exploited by using plants, bacteria, and plant-bacteria together. Among them, combined use of plants and bacteria has gained tremendous attention as bacteria possess set of catabolic genes which produce catabolic enzymes to decontaminate hydrocarbons. In return, plant ooze out root exudates containing nutrients and necessary metabolites which facilitate the microbial colonization in plant rhizosphere. This results into high gene abundance and gene expression in the rhizosphere and, thus, leads to enhanced degradation. Moreover, high proportions of beneficial bacteria helps plant to gain more biomass due to their plant growth promoting activities and production of phytohromones. This review focuses functioning and mechanisms of catabolic genes responsible for degradation of straight chain and aromatic hydrocarbons with their potential of degradation in bioremediation. With the understanding of expression mechanisms, rate of degradation can be enhanced by adjusting environmental factors and acclimatizing plant associated bacteria in plant rhizosphere.

Transcriptomic changes reveal gene networks responding to the overexpression of a blueberry DWARF AND DELAYED FLOWERING 1 gene in transgenic blueberry plants.

Science.gov (United States)

Song, Guo-Qing; Gao, Xuan

2017-06-19

Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.

The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

Science.gov (United States)

Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

1995-09-01

The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

Agrobacterium-mediated gene transfer in plants and biosafety considerations.

Science.gov (United States)

Mehrotra, Shweta; Goyal, Vinod

2012-12-01

Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.

The xanthopsins : a new family of eubacterial blue-light photoreceptors

NARCIS (Netherlands)

Kort, R; Hoff, W.D.; West, M.E.; Kroon, A R; Hoffer, S.M.; Vlieg, K H; Crielaand, W; van Beeumen, J.; Hellingwerf, K J

1996-01-01

Photoactive yellow protein (PYP) is a photoreceptor that has been isolated from three halophilic phototrophic purple bacteria. The PYP from Ectothiorhodospira halophila BN9626 is the only member for which the sequence has been reported at the DNA level. Here we describe the cloning and sequencing of

The Xanthopsins: a new family of eubacterial blue-light photoreceptors

NARCIS (Netherlands)

Kort, R.; Hoff, W.D.; van West, W.S.; Kroon, A.R.; Hoffer, S.M.; Vlieg, K.H.; Crielaard, W.; van Beeumen, J.J.; Hellingwerf, K.J.

1996-01-01

Photoactive yellow protein (PYP) is a photoreceptor that has been isolated from three halophilic phototrophic purple bacteria. The PYP from Ectothiorhodospira halophila BN9626 is the only member for which the sequence has been reported at the DNA level. Here we describe the cloning and sequencing of

Cubozoan genome illuminates functional diversification of opsins and photoreceptor evolution

Czech Academy of Sciences Publication Activity Database

Liegertová, Michaela; Pergner, Jiří; Kozmiková, Iryna; Fabian, Peter; Pombinho, António R.; Strnad, Hynek; Pačes, Jan; Vlček, Čestmír; Bartůněk, Petr; Kozmik, Zbyněk

2015-01-01

Roč. 5, Jul 8 (2015) ISSN 2045-2322 R&D Projects: GA ČR GAP305/10/2141; GA MŠk LO1220 Institutional support: RVO:68378050 Keywords : Cubozoan genome * opsins * photoreceptor * evolution Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.228, year: 2015

Effect of late-stage therapy on disease progression in AAV-mediated rescue of photoreceptor cells in the retinoschisin-deficient mouse.

Science.gov (United States)

Janssen, Andreas; Min, Seok H; Molday, Laurie L; Tanimoto, Naoyuki; Seeliger, Mathias W; Hauswirth, William W; Molday, Robert S; Weber, Bernhard H F

2008-06-01

Proof-of-concept for a successful adeno-associated virus serotype 5 (AAV5)-mediated gene therapy in X-linked juvenile retinoschisis (XLRS) has been demonstrated in an established mouse model for this condition. The initial studies concentrated on early time-points of treatment. In this study, we aimed to explore the consequences of single subretinal injections administered at various stages of more advanced disease. By electroretinogram (ERG), functional improvement in treated versus untreated eyes is found to be significant in retinoschisin-deficient mice injected at the time-points of 15 days (P15), 1 month (PM1), and 2 months (PM2) after birth. In mice treated at 7 months after birth (PM7), an age previously shown to exhibit advanced retinal disease, ERG responses reveal no beneficial effects of vector treatment. Generally, functional rescue is paralleled by sustained retinoschisin expression and significant photoreceptor survival relative to untreated eyes. Quantitative measures of photoreceptors and peanut agglutinin-labeled ribbon synapses demonstrate rescue effects even in mice injected as late as PM7. Taken together, AAV5-mediated gene replacement is beneficial in slowing disease progression in murine XLRS. In addition, we show the effectiveness of rescue efforts even if treatment is delayed until advanced signs of disease have developed. Human XLRS patients might benefit from these findings, which suggest that the effectiveness of treatment appears not to be restricted to the early stages of the disease, and that treatment may prove to be valuable even when administered at more advanced stages.

Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

Science.gov (United States)

Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

2017-04-01

Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

Energy Technology Data Exchange (ETDEWEB)

Karen S. Browning; Marie Petrocek; Bonnie Bartel

2006-06-01

The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

Endophytic Herbaspirillum seropedicae expresses nif genes in gramineous plants.

Science.gov (United States)

Roncato-Maccari, Lauren D B; Ramos, Humberto J O; Pedrosa, Fabio O; Alquini, Yedo; Chubatsu, Leda S; Yates, Marshall G; Rigo, Liu U; Steffens, Maria Berenice R; Souza, Emanuel M

2003-07-01

Abstract The interactions between maize, sorghum, wheat and rice plants and Herbaspirillum seropedicae were examined microscopically following inoculation with the H. seropedicae LR15 strain, a Nif(+) (Pnif::gusA) mutant obtained by the insertion of a gusA-kanamycin cassette into the nifH gene of the H. seropedicae wild-type strain. The expression of the Pnif::gusA fusion was followed during the association of the diazotroph with the gramineous species. Histochemical analysis of seedlings of maize, sorghum, wheat and rice grown in vermiculite showed that strain LR15 colonized root surfaces and inner tissues. In early steps of the endophytic association, H. seropedicae colonized root exudation sites, such as axils of secondary roots and intercellular spaces of the root cortex; it then occupied the vascular tissue and there expressed nif genes. The expression of nif genes occurred in roots, stems and leaves as detected by the GUS reporter system. The expression of nif genes was also observed in bacterial colonies located in the external mucilaginous root material, 8 days after inoculation. Moreover, the colonization of plant tissue by H. seropedicae did not depend on the nitrogen-fixing ability, since similar numbers of cells were isolated from roots or shoots of the plants inoculated with Nif(+) or Nif(-) strains.

New insights on the evolution of Leafy cotyledon1 (LEC1) type genes in vascular plants.

Science.gov (United States)

Cagliari, Alexandro; Turchetto-Zolet, Andreia Carina; Korbes, Ana Paula; Maraschin, Felipe Dos Santos; Margis, Rogerio; Margis-Pinheiro, Marcia

2014-01-01

NF-Y is a conserved oligomeric transcription factor found in all eukaryotes. In plants, this regulator evolved with a broad diversification of the genes coding for its three subunits (NF-YA, NF-YB and NF-YC). The NF-YB members can be divided into Leafy Cotyledon1 (LEC1) and non-LEC1 types. Here we presented a comparative genomic study using phylogenetic analyses to validate an evolutionary model for the origin of LEC-type genes in plants and their emergence from non-LEC1-type genes. We identified LEC1-type members in all vascular plant genomes, but not in amoebozoa, algae, fungi, metazoa and non-vascular plant representatives, which present exclusively non-LEC1-type genes as constituents of their NF-YB subunits. The non-synonymous to synonymous nucleotide substitution rates (Ka/Ks) between LEC1 and non-LEC1-type genes indicate the presence of positive selection acting on LEC1-type members to the fixation of LEC1-specific amino acid residues. The phylogenetic analyses demonstrated that plant LEC1-type genes are evolutionary divergent from the non-LEC1-type genes of plants, fungi, amoebozoa, algae and animals. Our results point to a scenario in which LEC1-type genes have originated in vascular plants after gene expansion in plants. We suggest that processes of neofunctionalization and/or subfunctionalization were responsible for the emergence of a versatile role for LEC1-type genes in vascular plants, especially in seed plants. LEC1-type genes besides being phylogenetic divergent also present different expression profile when compared with non-LEC1-type genes. Altogether, our data provide new insights about the LEC1 and non-LEC1 evolutionary relationship during the vascular plant evolution. Copyright © 2014 Elsevier Inc. All rights reserved.

Circulating Reactive Oxidant Causes Apoptosis of Retinal Pigment Epithelium and Cone Photoreceptors in the Mouse Central Retina

Directory of Open Access Journals (Sweden)

Wei Wang

2011-01-01

Full Text Available Reactive oxidants damage the retinal pigment epithelium (RPE, which is required for viability of overlying photoreceptors. Smoking which leads to chronic accumulation of reactive oxidants in the circulation is linked to age-related macular degeneration (AMD where RPE death is seen along with photoreceptor loss in the central macular region of the retina. It is unclear why this damage is concentrated in the central retina. We asked whether circulating oxidant might specifically target the central retina. Mice were administered the classic reactive oxidant iodate through tail vein injection, and visual acuity was followed by optokinetic response. Histology and apoptosis was examined by H&E and immunostaining. Iodate indeed selectively damaged the central retina, and this damage was highlighted by early apoptosis of RPE in the central retina followed by apoptosis of photoreceptors adjacent to the region of RPE loss–-cones were lost preferentially. The pattern and extent of this damage was independent of exposure to light. We then conclude that circulating oxidant is sufficient to selectively damage the central retina highlighted by sequential apoptosis of RPE and photoreceptors, with cones being the most sensitivity to this RPE loss.

Immunomodulation-accelerated neuronal regeneration following selective rod photoreceptor cell ablation in the zebrafish retina.

Science.gov (United States)

White, David T; Sengupta, Sumitra; Saxena, Meera T; Xu, Qingguo; Hanes, Justin; Ding, Ding; Ji, Hongkai; Mumm, Jeff S

2017-05-02

Müller glia (MG) function as inducible retinal stem cells in zebrafish, completely repairing the eye after damage. The innate immune system has recently been shown to promote tissue regeneration in which classic wound-healing responses predominate. However, regulatory roles for leukocytes during cellular regeneration-i.e., selective cell-loss paradigms akin to degenerative disease-are less well defined. To investigate possible roles innate immune cells play during retinal cell regeneration, we used intravital microscopy to visualize neutrophil, macrophage, and retinal microglia responses to induced rod photoreceptor apoptosis. Neutrophils displayed no reactivity to rod cell loss. Peripheral macrophage cells responded to rod cell loss, as evidenced by morphological transitions and increased migration, but did not enter the retina. Retinal microglia displayed multiple hallmarks of immune cell activation: increased migration, translocation to the photoreceptor cell layer, proliferation, and phagocytosis of dying cells. To test function during rod cell regeneration, we coablated microglia and rod cells or applied immune suppression and quantified the kinetics of ( i ) rod cell clearance, ( ii ) MG/progenitor cell proliferation, and ( iii ) rod cell replacement. Coablation and immune suppressants applied before cell loss caused delays in MG/progenitor proliferation rates and slowed the rate of rod cell replacement. Conversely, immune suppressants applied after cell loss had been initiated led to accelerated photoreceptor regeneration kinetics, possibly by promoting rapid resolution of an acute immune response. Our findings suggest that microglia control MG responsiveness to photoreceptor loss and support the development of immune-targeted therapeutic strategies for reversing cell loss associated with degenerative retinal conditions.

A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

Science.gov (United States)

Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

2018-02-07

Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

Is the photoactive yellow protein a UV-B/blue light photoreceptor?

NARCIS (Netherlands)

Carroll, E. C.; Hospes, M.; Valladares, C.; Hellingwerf, K.J.; Larsen, D.S.

2011-01-01

UV light below 300 nm is shown to generate the first photocycle intermediate in the blue light photoreceptor Photoactive Yellow Protein. Fluorescence and ultrafast transient absorption measurements indicate two excitation pathways: UV-B absorption by the chromophore and Fluorescence Resonant Energy

Retinitis pigmentosa: genes and disease mechanisms.

Science.gov (United States)

Ferrari, Stefano; Di Iorio, Enzo; Barbaro, Vanessa; Ponzin, Diego; Sorrentino, Francesco S; Parmeggiani, Francesco

2011-06-01

Retinitis pigmentosa (RP) is a group of inherited disorders affecting 1 in 3000-7000 people and characterized by abnormalities of the photoreceptors (rods and cones) or the retinal pigment epithelium of the retina which lead to progressive visual loss. RP can be inherited in an autosomal dominant, autosomal recessive or X-linked manner. While usually limited to the eye, RP may also occur as part of a syndrome as in the Usher syndrome and Bardet-Biedl syndrome. Over 40 genes have been associated with RP so far, with the majority of them expressed in either the photoreceptors or the retinal pigment epithelium. The tremendous heterogeneity of the disease makes the genetics of RP complicated, thus rendering genotype-phenotype correlations not fully applicable yet. In addition to the multiplicity of mutations, in fact, different mutations in the same gene may cause different diseases. We will here review which genes are involved in the genesis of RP and how mutations can lead to retinal degeneration. In the future, a more thorough analysis of genetic and clinical data together with a better understanding of the genotype-phenotype correlation might allow to reveal important information with respect to the likelihood of disease development and choices of therapy.

Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

Science.gov (United States)

Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

1996-04-01

We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

Does Apoptosis Regulate the Function of Retinal Photoreceptors?

OpenAIRE

Halaby, Reginald

2012-01-01

Apoptosis, or programmed cell death, is an integral component of developmental biology, embryology, and anatomy. All eukaryotic cells possess the molecular machinery necessary to execute apoptosis. However, dysregulated apoptosis in the form of too much or too little cell death results in diseases such as Alzheimer’s disease, autoimmune disorders, and cancer. It is postulated that apoptosis of the photoreceptors in the retina plays a vital role in mediating vision, and evidence is presented h...

The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

NARCIS (Netherlands)

Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

2004-01-01

Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

Major intrinsic proteins (MIPs) in plants: a complex gene family with major impacts on plant phenotype.

Science.gov (United States)

Forrest, Kerrie L; Bhave, Mrinal

2007-10-01

The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.

Gene expression in mycorrhizal orchid protocorms suggests a friendly plant-fungus relationship.

Science.gov (United States)

Perotto, Silvia; Rodda, Marco; Benetti, Alex; Sillo, Fabiano; Ercole, Enrico; Rodda, Michele; Girlanda, Mariangela; Murat, Claude; Balestrini, Raffaella

2014-06-01

Orchids fully depend on symbiotic interactions with specific soil fungi for seed germination and early development. Germinated seeds give rise to a protocorm, a heterotrophic organ that acquires nutrients, including organic carbon, from the mycorrhizal partner. It has long been debated if this interaction is mutualistic or antagonistic. To investigate the molecular bases of the orchid response to mycorrhizal invasion, we developed a symbiotic in vitro system between Serapias vomeracea, a Mediterranean green meadow orchid, and the rhizoctonia-like fungus Tulasnella calospora. 454 pyrosequencing was used to generate an inventory of plant and fungal genes expressed in mycorrhizal protocorms, and plant genes could be reliably identified with a customized bioinformatic pipeline. A small panel of plant genes was selected and expression was assessed by real-time quantitative PCR in mycorrhizal and non-mycorrhizal protocorm tissues. Among these genes were some markers of mutualistic (e.g. nodulins) as well as antagonistic (e.g. pathogenesis-related and wound/stress-induced) genes. None of the pathogenesis or wound/stress-related genes were significantly up-regulated in mycorrhizal tissues, suggesting that fungal colonization does not trigger strong plant defence responses. In addition, the highest expression fold change in mycorrhizal tissues was found for a nodulin-like gene similar to the plastocyanin domain-containing ENOD55. Another nodulin-like gene significantly more expressed in the symbiotic tissues of mycorrhizal protocorms was similar to a sugar transporter of the SWEET family. Two genes coding for mannose-binding lectins were significantly up-regulated in the presence of the mycorrhizal fungus, but their role in the symbiosis is unclear.

Plant Genes Involved in Symbiotic Sinal Perception/Signal Transduction

DEFF Research Database (Denmark)

Binder, A; Soyano, T; Hayashi, H

2014-01-01

to nodule primordia formation, and the infection thread initiation in the root hairs guiding bacteria towards dividing cortical cells. This chapter focuses on the plant genes involved in the recognition of the symbiotic signal produced by rhizobia, and the downstream genes, which are part of a complex...... symbiotic signalling pathway that leads to the generation of calcium spiking in the nuclear regions and activation of transcription factors controlling symbiotic genes induction...

Phytochrome-dependent coordinate control of distinct aspects of nuclear and plastid gene expression during anterograde signalling and photomorphogenesis

Directory of Open Access Journals (Sweden)

Sookyung eOh

2014-04-01

Full Text Available Light perception by photoreceptors impacts plastid transcription, development, and differentiation. This photoreceptor-dependent activity suggests a mechanism for photoregulation of gene expression in the nucleus and plastid that serves to coordinate expression of critical genes of these two organelles. This coordinate expression is required for proper stoichiometric accumulation of components needed for assembly of plastids, photosynthetic light-harvesting complexes and components such as phytochromes. Chloroplast-targeted sigma factors, which function together with the plastid-encoded RNA polymerase to regulate expression of plastid-encoded genes, and nuclear-encoded plastid development factors, such as GLK1 and GLK2, are targets of phytochrome regulation. Such phytochrome-dependent functions are hypothesized to allow light-dependent regulation, and feasibly tuning, of plastid components and function in response to changes in the external environment, which directly affects photosynthesis and the potential for light-induced damage. When the size and protein composition of the light-harvesting complexes are not tuned to the external environment, imbalances in electron transport can impact the cellular redox state and cause cellular damage. We show that phytochromes specifically regulate the expression of multiple factors that function to modulate plastid transcription and, thus, provide a paradigm for coordinate expression of the nuclear and plastid genomes in response to changes in external light conditions. As phytochromes respond to changes in the prevalent wavelengths of light and light intensity, we propose that specific phytochrome-dependent molecular mechanisms are used during light-dependent signaling between the nucleus and chloroplast during photomorphogenesis to coordinate chloroplast development with plant developmental stage and the external environment.

[Viability of 7 kinds of medicinal plant seeds stored in medium-term gene bank of the National Medicinal Plant Gene Bank].

Science.gov (United States)

Jin, Yue; Yang, Cheng-Min; Wei, Jian-He

2016-05-01

In order to evaluate seed viability of Platycodon grandiflorum, Schizonepeta tenuifolia, Andrographis paniculat, Codonopsis pilosula, Scutellaria baicalensis, Leonurus japonicus, Rabdosia rubescens, stored in the medium-term gene bank of the National Medicinal Plant Gene Bank for 4 years, we tested seed germination rate of 7 species of medicinal plant and analyzed the change of significance of levels of the germination rate in pre and post store. Seed germination rates of 7 species of medicinal plants were all decreased after 4 years, and the decrease of S. tenuifolia and S. baicalensis germination rates were much smaller than other species. The higher initial germination rate of P. grandiflorum, C. pilosula, R. rubescens seed has the smaller decline of germination rate, but the data of A. paniculata showed the opposite trend. The rate decline of the germination of S. tenuifolia and S. baicalensis was roughly the same in different germination rate interval. The results showed that low temperature storage could effectively prolong the seed longevity, and maintain the seed vigor. Moreover, it is necessary to study on the storage characteristics of the main medicinal plant seeds, and establish the monitoring plan and regeneration standard. Copyright© by the Chinese Pharmaceutical Association.

Transplantation of adult mouse iPS cell-derived photoreceptor precursors restores retinal structure and function in degenerative mice.

Directory of Open Access Journals (Sweden)

Budd A Tucker

2011-04-01

Full Text Available This study was designed to determine whether adult mouse induced pluripotent stem cells (iPSCs, could be used to produce retinal precursors and subsequently photoreceptor cells for retinal transplantation to restore retinal function in degenerative hosts. iPSCs were generated using adult dsRed mouse dermal fibroblasts via retroviral induction of the transcription factors Oct4, Sox2, KLF4 and c-Myc. As with normal mouse ES cells, adult dsRed iPSCs expressed the pluripotency genes SSEA1, Oct4, Sox2, KLF4, c-Myc and Nanog. Following transplantation into the eye of immune-compromised retinal degenerative mice these cells proceeded to form teratomas containing tissue comprising all three germ layers. At 33 days post-differentiation a large proportion of the cells expressed the retinal progenitor cell marker Pax6 and went on to express the photoreceptor markers, CRX, recoverin, and rhodopsin. When tested using calcium imaging these cells were shown to exhibit characteristics of normal retinal physiology, responding to delivery of neurotransmitters. Following subretinal transplantation into degenerative hosts differentiated iPSCs took up residence in the retinal outer nuclear layer and gave rise to increased electro retinal function as determined by ERG and functional anatomy. As such, adult fibroblast-derived iPSCs provide a viable source for the production of retinal precursors to be used for transplantation and treatment of retinal degenerative disease.

PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.

Science.gov (United States)

Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R

2018-01-04

The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

Science.gov (United States)

Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

2017-09-30

Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

Coordinations between gene modules control the operation of plant amino acid metabolic networks

Directory of Open Access Journals (Sweden)

Galili Gad

2009-01-01

Full Text Available Abstract Background Being sessile organisms, plants should adjust their metabolism to dynamic changes in their environment. Such adjustments need particular coordination in branched metabolic networks in which a given metabolite can be converted into multiple other metabolites via different enzymatic chains. In the present report, we developed a novel "Gene Coordination" bioinformatics approach and use it to elucidate adjustable transcriptional interactions of two branched amino acid metabolic networks in plants in response to environmental stresses, using publicly available microarray results. Results Using our "Gene Coordination" approach, we have identified in Arabidopsis plants two oppositely regulated groups of "highly coordinated" genes within the branched Asp-family network of Arabidopsis plants, which metabolizes the amino acids Lys, Met, Thr, Ile and Gly, as well as a single group of "highly coordinated" genes within the branched aromatic amino acid metabolic network, which metabolizes the amino acids Trp, Phe and Tyr. These genes possess highly coordinated adjustable negative and positive expression responses to various stress cues, which apparently regulate adjustable metabolic shifts between competing branches of these networks. We also provide evidence implying that these highly coordinated genes are central to impose intra- and inter-network interactions between the Asp-family and aromatic amino acid metabolic networks as well as differential system interactions with other growth promoting and stress-associated genome-wide genes. Conclusion Our novel Gene Coordination elucidates that branched amino acid metabolic networks in plants are regulated by specific groups of highly coordinated genes that possess adjustable intra-network, inter-network and genome-wide transcriptional interactions. We also hypothesize that such transcriptional interactions enable regulatory metabolic adjustments needed for adaptation to the stresses.

UV-C-Induced alleviation of transcriptional gene silencing through plant-plant communication: Key roles of jasmonic acid and salicylic acid pathways.

Science.gov (United States)

Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

2016-08-01

Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.

Lack of protein-tyrosine sulfation disrupts photoreceptor outer segment morphogenesis, retinal function and retinal anatomy.

Science.gov (United States)

Sherry, David M; Murray, Anne R; Kanan, Yogita; Arbogast, Kelsey L; Hamilton, Robert A; Fliesler, Steven J; Burns, Marie E; Moore, Kevin L; Al-Ubaidi, Muayyad R

2010-11-01

To investigate the role(s) of protein-tyrosine sulfation in the retina, we examined retinal function and structure in mice lacking tyrosylprotein sulfotransferases (TPST) 1 and 2. Tpst double knockout (DKO; Tpst1(-/-) /Tpst2 (-/-) ) retinas had drastically reduced electroretinographic responses, although their photoreceptors exhibited normal responses in single cell recordings. These retinas appeared normal histologically; however, the rod photoreceptors had ultrastructurally abnormal outer segments, with membrane evulsions into the extracellular space, irregular disc membrane spacing and expanded intradiscal space. Photoreceptor synaptic terminals were disorganized in Tpst DKO retinas, but established ultrastructurally normal synapses, as did bipolar and amacrine cells; however, the morphology and organization of neuronal processes in the inner retina were abnormal. These results indicate that protein-tyrosine sulfation is essential for proper outer segment morphogenesis and synaptic function, but is not critical for overall retinal structure or synapse formation, and may serve broader functions in neuronal development and maintenance. © 2010 The Authors. European Journal of Neuroscience © 2010 Federation of European Neuroscience Societies and Blackwell Publishing Ltd.

Localization of Usher 1 proteins to the photoreceptor calyceal processes, which are absent from mice

Science.gov (United States)

Sahly, Iman; Dufour, Eric; Schietroma, Cataldo; Michel, Vincent; Bahloul, Amel; Perfettini, Isabelle; Pepermans, Elise; Estivalet, Amrit; Carette, Diane; Aghaie, Asadollah; Ebermann, Inga; Lelli, Andrea; Iribarne, Maria; Hardelin, Jean-Pierre; Weil, Dominique; Sahel, José-Alain

2012-01-01

The mechanisms underlying retinal dystrophy in Usher syndrome type I (USH1) remain unknown because mutant mice lacking any of the USH1 proteins—myosin VIIa, harmonin, cadherin-23, protocadherin-15, sans—do not display retinal degeneration. We found here that, in macaque photoreceptor cells, all USH1 proteins colocalized at membrane interfaces (i) between the inner and outer segments in rods and (ii) between the microvillus-like calyceal processes and the outer segment basolateral region in rods and cones. This pattern, conserved in humans and frogs, was mediated by the formation of an USH1 protein network, which was associated with the calyceal processes from the early embryonic stages of outer segment growth onwards. By contrast, mouse photoreceptors lacked calyceal processes and had no USH1 proteins at the inner–outer segment interface. We suggest that USH1 proteins form an adhesion belt around the basolateral region of the photoreceptor outer segment in humans, and that defects in this structure cause the retinal degeneration in USH1 patients. PMID:23045546

Response Function of the Crayfish Caudal Photoreceptor to Hydrodynamic Stimuli

Science.gov (United States)

Breite, Sally; Bahar, Sonya; Neiman, Alexander; Moss, Frank

2002-03-01

In its abdominal 6th ganglion the crayfish houses 2 light-sensitive neurons (caudal photoreceptors, or CPRs). It is known that these neurons work in tandem with a mechanosensory system of tiny hairs spread across the tailfan, which make synaptic contact with the photoreceptors. A stochastic resonance effect has been shown in this system in which light enhances the transduction of a weak, periodic mechanosensory (hydrodynamic) stimulus. It is not known, however, whether an optimal response from the CPR is induced by a single sine wave cycle or some other waveform. We have experimentally investigated this favorable waveform by driving a tailfan preparation with mechanical 10 Hz correlated Ornstein-Uhlenbeck noise and calculating the response function from the spike-triggered average of the applied noise waveform. We will discuss differences in the shape of the optimal waveform under dark and light conditions, as well as what seems to be a noticeable difference in the magnitude of the animals' response to a noisy stimulus in comparison with a periodic stimulus.

[Expression of plant antimicrobial peptide pro-SmAMP2 gene increases resistance of transgenic potato plants to Alternaria and Fusarium pathogens].

Science.gov (United States)

Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A

2016-09-01

The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.

MADS goes genomic in conifers: towards determining the ancestral set of MADS-box genes in seed plants.

Science.gov (United States)

Gramzow, Lydia; Weilandt, Lisa; Theißen, Günter

2014-11-01

MADS-box genes comprise a gene family coding for transcription factors. This gene family expanded greatly during land plant evolution such that the number of MADS-box genes ranges from one or two in green algae to around 100 in angiosperms. Given the crucial functions of MADS-box genes for nearly all aspects of plant development, the expansion of this gene family probably contributed to the increasing complexity of plants. However, the expansion of MADS-box genes during one important step of land plant evolution, namely the origin of seed plants, remains poorly understood due to the previous lack of whole-genome data for gymnosperms. The newly available genome sequences of Picea abies, Picea glauca and Pinus taeda were used to identify the complete set of MADS-box genes in these conifers. In addition, MADS-box genes were identified in the growing number of transcriptomes available for gymnosperms. With these datasets, phylogenies were constructed to determine the ancestral set of MADS-box genes of seed plants and to infer the ancestral functions of these genes. Type I MADS-box genes are under-represented in gymnosperms and only a minimum of two Type I MADS-box genes have been present in the most recent common ancestor (MRCA) of seed plants. In contrast, a large number of Type II MADS-box genes were found in gymnosperms. The MRCA of extant seed plants probably possessed at least 11-14 Type II MADS-box genes. In gymnosperms two duplications of Type II MADS-box genes were found, such that the MRCA of extant gymnosperms had at least 14-16 Type II MADS-box genes. The implied ancestral set of MADS-box genes for seed plants shows simplicity for Type I MADS-box genes and remarkable complexity for Type II MADS-box genes in terms of phylogeny and putative functions. The analysis of transcriptome data reveals that gymnosperm MADS-box genes are expressed in a great variety of tissues, indicating diverse roles of MADS-box genes for the development of gymnosperms. This study is

Implication of the changing concept of genes on plant breeder’s work

Directory of Open Access Journals (Sweden)

Marco Aurélio D. Dias

2011-01-01

Full Text Available The recent genome sequencing of some species has accumulated evidence that for a large number of traits, thecontrol and action of genes are far more complex than previously thought. This article discusses possible implications of newinsights into the gene concept on the work of plant breeders. Apparently, the successful application of biotechnological techniques is not as simple as once assumed. The evident changes in the available concept of genes confirmed what the past experience had shown,i.e, selection should focus on the phenotype, under the same conditions as the plant is to be cultivated in. Advanced vocationaltraining of plant breeders must be continuously maintained, focusing on phenotype-based selection in as accurate as possibleexperiments.

Elucidating gene function and function evolution through comparison of co-expression networks in plants

Directory of Open Access Journals (Sweden)

Marek eMutwil

2014-08-01

Full Text Available The analysis of gene expression data has shown that transcriptionally coordinated (co-expressed genes are often functionally related, enabling scientists to use expression data in gene function prediction. This Focused Review discusses our original paper (Large-scale co-expression approach to dissect secondary cell wall formation across plant species, Frontiers in Plant Science 2:23. In this paper we applied cross-species analysis to co-expression networks of genes involved in cellulose biosynthesis. We show that the co-expression networks from different species are highly similar, indicating that whole biological pathways are conserved across species. This finding has two important implications. First, the analysis can transfer gene function annotation from well-studied plants, such as Arabidopsis, to other, uncharacterized plant species. As the analysis finds genes that have similar sequence and similar expression pattern across different organisms, functionally equivalent genes can be identified. Second, since co-expression analyses are often noisy, a comparative analysis should have higher performance, as parts of co-expression networks that are conserved are more likely to be functionally relevant. In this Focused Review, we outline the comparative analysis done in the original paper and comment on the recent advances and approaches that allow comparative analyses of co-function networks. We hypothesize that, in comparison to simple co-expression analysis, comparative analysis would yield more accurate gene function predictions. Finally, by combining comparative analysis with genomic information of green plants, we propose a possible composition of cellulose biosynthesis machinery during earlier stages of plant evolution.

The Ste20 kinase misshapen regulates both photoreceptor axon targeting and dorsal closure, acting downstream of distinct signals.

Science.gov (United States)

Su, Y C; Maurel-Zaffran, C; Treisman, J E; Skolnik, E Y

2000-07-01

We have previously shown that the Ste20 kinase encoded by misshapen (msn) functions upstream of the c-Jun N-terminal kinase (JNK) mitogen-activated protein kinase module in Drosophila. msn is required to activate the Drosophila JNK, Basket (Bsk), to promote dorsal closure of the embryo. A mammalian homolog of Msn, Nck interacting kinase, interacts with the SH3 domains of the SH2-SH3 adapter protein Nck. We now show that Msn likewise interacts with Dreadlocks (Dock), the Drosophila homolog of Nck. dock is required for the correct targeting of photoreceptor axons. We have performed a structure-function analysis of Msn in vivo in Drosophila in order to elucidate the mechanism whereby Msn regulates JNK and to determine whether msn, like dock, is required for the correct targeting of photoreceptor axons. We show that Msn requires both a functional kinase and a C-terminal regulatory domain to activate JNK in vivo in Drosophila. A mutation in a PXXP motif on Msn that prevents it from binding to the SH3 domains of Dock does not affect its ability to rescue the dorsal closure defect in msn embryos, suggesting that Dock is not an upstream regulator of msn in dorsal closure. Larvae with only this mutated form of Msn show a marked disruption in photoreceptor axon targeting, implicating an SH3 domain protein in this process; however, an activated form of Msn is not sufficient to rescue the dock mutant phenotype. Mosaic analysis reveals that msn expression is required in photoreceptors in order for their axons to project correctly. The data presented here genetically link msn to two distinct biological events, dorsal closure and photoreceptor axon pathfinding, and thus provide the first evidence that Ste20 kinases of the germinal center kinase family play a role in axonal pathfinding. The ability of Msn to interact with distinct classes of adapter molecules in dorsal closure and photoreceptor axon pathfinding may provide the flexibility that allows it to link to distinct

Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

Directory of Open Access Journals (Sweden)

Jie Luo

2018-01-01

Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

Variation in LOV Photoreceptor Activation Dynamics Probed by Time Resolved Infrared Spectroscopy

KAUST Repository

Iuliano, James N.; Gil, Agnieszka A.; Laptenok, Sergey P.; Hall, Christopher R.; Tolentino Collado, Jinnette; Lukacs, Andras; Hag Ahmed, Safaa A; Abyad, Jenna; Daryaee, Taraneh; Greetham, Gregory M.; Sazanovich, Igor V.; Illarionov, Boris; Bacher, Adelbert; Fischer, Markus; Towrie, Michael; French, Jarrod B.; Meech, Stephen R.; Tonge, Peter J

2017-01-01

The light, oxygen, voltage (LOV) domain proteins are blue light photoreceptors that utilize a non-covalently bound flavin mononucleotide (FMN) cofactor as the chromophore. The modular nature of these proteins has led to their wide adoption in the emerging fields of optogenetics and optobiology, where the LOV domain has been fused to a variety of output domains leading to novel light-controlled applications. In the present work, we extend our studies of the sub-picosecond to several hundred microsecond transient infrared spectroscopy of the isolated LOV domain AsLOV2 to three full-length photoreceptors in which the LOV domain is fused to an output domain: the LOV-STAS protein, YtvA, the LOV-HTH transcription factor, EL222, and the LOV-histidine kinase, LovK. Despite differences in tertiary structure, the overall pathway leading to cysteine adduct formation from the FMN triplet state is highly conserved, although there are slight variations in rate. However significant differences are observed in the vibrational spectra and kinetics after adduct formation, which are directly linked to the specific output function of the LOV domain. While the rate of adduct formation varies by only 3.6-fold amongst the proteins, the subsequent large-scale structural changes in the full-length LOV photoreceptors occur over the micro- to sub-millisecond timescales and vary by orders of magnitude depending on the different output function of each LOV domain.

Variation in LOV Photoreceptor Activation Dynamics Probed by Time Resolved Infrared Spectroscopy

KAUST Repository

Iuliano, James N.

2017-12-14

The light, oxygen, voltage (LOV) domain proteins are blue light photoreceptors that utilize a non-covalently bound flavin mononucleotide (FMN) cofactor as the chromophore. The modular nature of these proteins has led to their wide adoption in the emerging fields of optogenetics and optobiology, where the LOV domain has been fused to a variety of output domains leading to novel light-controlled applications. In the present work, we extend our studies of the sub-picosecond to several hundred microsecond transient infrared spectroscopy of the isolated LOV domain AsLOV2 to three full-length photoreceptors in which the LOV domain is fused to an output domain: the LOV-STAS protein, YtvA, the LOV-HTH transcription factor, EL222, and the LOV-histidine kinase, LovK. Despite differences in tertiary structure, the overall pathway leading to cysteine adduct formation from the FMN triplet state is highly conserved, although there are slight variations in rate. However significant differences are observed in the vibrational spectra and kinetics after adduct formation, which are directly linked to the specific output function of the LOV domain. While the rate of adduct formation varies by only 3.6-fold amongst the proteins, the subsequent large-scale structural changes in the full-length LOV photoreceptors occur over the micro- to sub-millisecond timescales and vary by orders of magnitude depending on the different output function of each LOV domain.

An ant-plant mutualism through the lens of cGMP-dependent kinase genes.

Science.gov (United States)

Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E

2017-09-13

In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).

QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD

Science.gov (United States)

Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...

ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

Directory of Open Access Journals (Sweden)

Dominika Ďurechová

2013-02-01

Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

Directory of Open Access Journals (Sweden)

Sheng-Rui Liu

2017-09-01

Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

Signal Network Analysis of Plant Genes Responding to Ionizing Radiation

International Nuclear Information System (INIS)

Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon

2012-12-01

In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication

Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

International Nuclear Information System (INIS)

Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

2016-01-01

Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

Energy Technology Data Exchange (ETDEWEB)

Wang, Zhenyu, E-mail: wzy72609@163.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Wang, Bing, E-mail: wangbing@ibcas.ac.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Liu, Erlong, E-mail: liuel14@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Chen, Ni, E-mail: 63710156@qq.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhang, Wei, E-mail: wzhang1216@yahoo.com [Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444 (China); Liu, Heng, E-mail: hengliu@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China)

2016-04-01

Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants

Science.gov (United States)

Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.

2005-04-01

This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.

Restoration of outer segments of foveal photoreceptors after resolution of central serous chorioretinopathy.

Science.gov (United States)

Ojima, Yumiko; Tsujikawa, Akitaka; Yamashiro, Kenji; Ooto, Sotaro; Tamura, Hiroshi; Yoshimura, Nagahisa

2010-01-01

To study morphologically and functionally the prognosis of damaged outer segments of the foveal photoreceptor layer in eyes with resolved central serous chorioretinopathy (CSC). We studied retrospectively the medical records of 70 patients (74 eyes) with resolved CSC. Optical coherence tomography was used to detect the junctions between inner and outer segments of the photoreceptors (IS/OS) as a hallmark of the integrity of the outer photoreceptor layer. In 53 eyes (71.6%), the IS/OS line was clearly detected beneath the fovea immediately after resolution of the retinal detachment, with good visual acuity (VA). In the remaining 21 eyes (28.4%), however, the foveal IS/OS line could not be detected shortly after resolution of CSC, and VA was variable, ranging from 0.1 to 1.5 (median, 0.9). Of these 21 eyes, 15 had a follow-up examination with OCT, and in four the foveal IS/OS line was not detected at the follow-up and vision in these eyes remained poor. However, nine eyes showed recovery of the foveal IS/OS line during follow-up, and these eyes had substantial visual recovery. Immediately after resolution of active CSC, although the IS/OS line cannot be detected beneath the fovea, it often shows restoration over time, with visual recovery, though in some eyes no restoration takes place and the prognosis remains poor.

Myosin7a deficiency results in reduced retinal activity which is improved by gene therapy.

Directory of Open Access Journals (Sweden)

Pasqualina Colella

Full Text Available Mutations in MYO7A cause autosomal recessive Usher syndrome type IB (USH1B, one of the most frequent conditions that combine severe congenital hearing impairment and retinitis pigmentosa. A promising therapeutic strategy for retinitis pigmentosa is gene therapy, however its pre-clinical development is limited by the mild retinal phenotype of the shaker1 (sh1(-/- murine model of USH1B which lacks both retinal functional abnormalities and degeneration. Here we report a significant, early-onset delay of sh1(-/- photoreceptor ability to recover from light desensitization as well as a progressive reduction of both b-wave electroretinogram amplitude and light sensitivity, in the absence of significant loss of photoreceptors up to 12 months of age. We additionally show that subretinal delivery to the sh1(-/- retina of AAV vectors encoding the large MYO7A protein results in significant improvement of sh1(-/- photoreceptor and retinal pigment epithelium ultrastructural anomalies which is associated with improvement of recovery from light desensitization. These findings provide new tools to evaluate the efficacy of experimental therapies for USH1B. In addition, although AAV vectors expressing large genes might have limited clinical applications due to their genome heterogeneity, our data show that AAV-mediated MYO7A gene transfer to the sh1(-/- retina is effective.

Expression of TLP-3 gene without signal peptide in tobacco plants ...

African Journals Online (AJOL)

Expression of TLP-3 gene without signal peptide in tobacco plants using Agrobacterium mediated transformation. ... Plants are exploited as a source of food by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. So paying attention to their protection is very important.

Two types of Tet-On transgenic lines for doxycycline-inducible gene expression in zebrafish rod photoreceptors and a gateway-based tet-on toolkit.

Directory of Open Access Journals (Sweden)

Leah J Campbell

Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.

Leber’s congenital amaurosis and the role of gene therapy in congenital retinal disorders

Directory of Open Access Journals (Sweden)

Walid Sharif

2017-03-01

Full Text Available Leber’s congenital amaurosis (LCA and recent gene therapy advancement for treating inherited retinopathies were extensive literature reviewed using MEDLINE, PubMed and EMBASE. Adeno-associated viral vectors were the most utilised vectors for ocular gene therapy. Cone photoreceptor cells might use an alternate pathway which was not reliant of the retinal pigment epithelium (RPE derived retinoid isomerohydrolase (RPE65 to access the 11-cis retinal dehydechromophore. Research efforts dedicated on the progression of a gene-based therapy for the treatment of LCA2. Such gene therapy approaches were extremely successful in canine, porcine and rodent LCA2 models. The recombinant AAV2.hRPE65v2 adeno-associated vector contained the RPE65 cDNA and was replication deficient. Its in vitro injection in target cells induced RPE65 protein production. The gene therapy trials that were so far conducted for inherited retinopathies have generated promising results. Phase I clinical trials to cure LCA and choroideremia demonstrated that adeno-associated viral vectors containing RPE genes and photoreceptors respectively, could be successfully administered to inherited retinopathy patients. A phase III trial is presently ongoing and if successful, it will lead the way to additional gene therapy attempts to cure monogenic, inherited retinopathies.

Leber’s congenital amaurosis and the role of gene therapy in congenital retinal disorders

Institute of Scientific and Technical Information of China (English)

Walid; Sharif; Zuhair; Sharif

2017-01-01

Leber’s congenital amaurosis(LCA)and recent gene therapy advancement for treating inherited retinopathies were extensive literature reviewed using MEDLINE,Pub Med and EMBASE. Adeno-associated viral vectors were the most utilised vectors for ocular gene therapy. Cone photoreceptor cells might use an alternate pathway which was not reliant of the retinal pigment epithelium(RPE)derived retinoid isomerohydrolase(RPE65)to access the 11-cis retinal dehydechromophore. Research efforts dedicated on the progression of a gene-based therapy for the treatment of LCA2. Such gene therapy approaches were extremely successful in canine,porcine and rodent LCA2 models. The recombinant AAV2.h RPE65v2 adenoassociated vector contained the RPE65 cDNA and was replication deficient. Its in vitro injection in target cells induced RPE65 protein production. The gene therapy trials that were so far conducted for inherited retinopathies have generated promising results. Phase I clinical trials to cure LCA and choroideremia demonstrated that adeno-associated viral vectors containing RPE genes and photoreceptors respectively,could be successfully administered to inherited retinopathy patients. A phase III trial is presently ongoing and if successful,it will lead the way to additional gene therapy attempts to cure monogenic,inherited retinopathies.

Divergence of gene body DNA methylation and evolution of plant duplicate genes.

Directory of Open Access Journals (Sweden)

Jun Wang

Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

The LOV protein of Xanthomonas citri subsp. citri plays a significant role in the counteraction of plant immune responses during citrus canker.

Directory of Open Access Journals (Sweden)

Ivana Kraiselburd

Full Text Available Pathogens interaction with a host plant starts a set of immune responses that result in complex changes in gene expression and plant physiology. Light is an important modulator of plant defense response and recent studies have evidenced the novel influence of this environmental stimulus in the virulence of several bacterial pathogens. Xanthomonas citri subsp. citri is the bacterium responsible for citrus canker disease, which affects most citrus cultivars. The ability of this bacterium to colonize host plants is influenced by bacterial blue-light sensing through a LOV-domain protein and disease symptoms are considerably altered upon deletion of this protein. In this work we aimed to unravel the role of this photoreceptor during the bacterial counteraction of plant immune responses leading to citrus canker development. We performed a transcriptomic analysis in Citrus sinensis leaves inoculated with the wild type X. citri subsp. citri and with a mutant strain lacking the LOV protein by a cDNA microarray and evaluated the differentially regulated genes corresponding to specific biological processes. A down-regulation of photosynthesis-related genes (together with a corresponding decrease in photosynthesis rates was observed upon bacterial infection, this effect being more pronounced in plants infected with the lov-mutant bacterial strain. Infection with this strain was also accompanied with the up-regulation of several secondary metabolism- and defense response-related genes. Moreover, we found that relevant plant physiological alterations triggered by pathogen attack such as cell wall fortification and tissue disruption were amplified during the lov-mutant strain infection. These results suggest the participation of the LOV-domain protein from X. citri subsp. citri in the bacterial counteraction of host plant defense response, contributing in this way to disease development.

The LOV Protein of Xanthomonas citri subsp. citri Plays a Significant Role in the Counteraction of Plant Immune Responses during Citrus Canker

Science.gov (United States)

Kraiselburd, Ivana; Daurelio, Lucas D.; Tondo, María Laura; Merelo, Paz; Cortadi, Adriana A.; Talón, Manuel; Tadeo, Francisco R.; Orellano, Elena G.

2013-01-01

Pathogens interaction with a host plant starts a set of immune responses that result in complex changes in gene expression and plant physiology. Light is an important modulator of plant defense response and recent studies have evidenced the novel influence of this environmental stimulus in the virulence of several bacterial pathogens. Xanthomonas citri subsp. citri is the bacterium responsible for citrus canker disease, which affects most citrus cultivars. The ability of this bacterium to colonize host plants is influenced by bacterial blue-light sensing through a LOV-domain protein and disease symptoms are considerably altered upon deletion of this protein. In this work we aimed to unravel the role of this photoreceptor during the bacterial counteraction of plant immune responses leading to citrus canker development. We performed a transcriptomic analysis in Citrus sinensis leaves inoculated with the wild type X. citri subsp. citri and with a mutant strain lacking the LOV protein by a cDNA microarray and evaluated the differentially regulated genes corresponding to specific biological processes. A down-regulation of photosynthesis-related genes (together with a corresponding decrease in photosynthesis rates) was observed upon bacterial infection, this effect being more pronounced in plants infected with the lov-mutant bacterial strain. Infection with this strain was also accompanied with the up-regulation of several secondary metabolism- and defense response-related genes. Moreover, we found that relevant plant physiological alterations triggered by pathogen attack such as cell wall fortification and tissue disruption were amplified during the lov-mutant strain infection. These results suggest the participation of the LOV-domain protein from X. citri subsp. citri in the bacterial counteraction of host plant defense response, contributing in this way to disease development. PMID:24260514

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

Directory of Open Access Journals (Sweden)

Jill Christine Preston

2013-04-01

Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

Integrity of the cone photoreceptor mosaic in oligocone trichromacy

DEFF Research Database (Denmark)

Michaelides, Michel; Rha, Jungtae; Dees, Elise W

2011-01-01

Oligocone trichromacy (OT) is an unusual cone dysfunction syndrome characterized by reduced visual acuity, mild photophobia, reduced amplitude of the cone electroretinogram with normal rod responses, normal fundus appearance, and normal or near-normal color vision. It has been proposed that these...... that these patients have a reduced number of normal functioning cones (oligocone). This paper has sought to evaluate the integrity of the cone photoreceptor mosaic in four patients previously described as having OT....

Luminescence- and nanoparticle-mediated increase of light absorption by photoreceptor cells: Converting UV light to visible light.

Science.gov (United States)

Li, Lei; Sahi, Sunil K; Peng, Mingying; Lee, Eric B; Ma, Lun; Wojtowicz, Jennifer L; Malin, John H; Chen, Wei

2016-02-10

We developed new optic devices - singly-doped luminescence glasses and nanoparticle-coated lenses that convert UV light to visible light - for improvement of visual system functions. Tb(3+) or Eu(3+) singly-doped borate glasses or CdS-quantum dot (CdS-QD) coated lenses efficiently convert UV light to 542 nm or 613 nm wavelength narrow-band green or red light, or wide-spectrum white light, and thereby provide extra visible light to the eye. In zebrafish (wild-type larvae and adult control animals, retinal degeneration mutants, and light-induced photoreceptor cell degeneration models), the use of Tb(3+) or Eu(3+) doped luminescence glass or CdS-QD coated glass lenses provide additional visible light to the rod and cone photoreceptor cells, and thereby improve the visual system functions. The data provide proof-of-concept for the future development of optic devices for improvement of visual system functions in patients who suffer from photoreceptor cell degeneration or related retinal diseases.

A Comprehensive Classification and Evolutionary Analysis of Plant Homeobox Genes

OpenAIRE

Mukherjee, Krishanu; Brocchieri, Luciano; B?rglin, Thomas R.

2009-01-01

The full complement of homeobox transcription factor sequences, including genes and pseudogenes, was determined from the analysis of 10 complete genomes from flowering plants, moss, Selaginella, unicellular green algae, and red algae. Our exhaustive genome-wide searches resulted in the discovery in each class of a greater number of homeobox genes than previously reported. All homeobox genes can be unambiguously classified by sequence evolutionary analysis into 14 distinct classes also charact...

Applications of hydrogen deuterium exchange (HDX for the characterization of conformational dynamics in light-activated photoreceptors

Directory of Open Access Journals (Sweden)

Robert eLindner

2015-06-01

Full Text Available Rational design of optogenetic tools is inherently linked to the understanding of photoreceptor function. Structural analysis of elements involved in signal integration in individual sensor domains provides an initial idea of their mode of operation, but understanding how local structural rearrangements eventually affect signal transmission to output domains requires inclusion of the effector regions in the characterization. However, the dynamic nature of these assemblies renders their structural analysis challenging and therefore a combination of high- and low-resolution techniques is required to appreciate functional aspects of photoreceptors.This review focuses on the potential of Hydrogen-Deuterium exchange coupled to mass spectrometry (HDX-MS for complementing the structural characterization of photoreceptors. In this respect, the ability of HDX-MS to provide information on the conformational dynamics and the possibility to address multiple functionally relevant states in solution render this methodology ideally suitable. We highlight recent examples demonstrating the potential of HDX-MS and discuss how these results can help to improve existing optogenetic systems or guide the design of novel optogenetic tools.

Phylogenomic analysis demonstrates a pattern of rare and ancient horizontal gene transfer between plants and fungi.

Science.gov (United States)

Richards, Thomas A; Soanes, Darren M; Foster, Peter G; Leonard, Guy; Thornton, Christopher R; Talbot, Nicholas J

2009-07-01

Horizontal gene transfer (HGT) describes the transmission of genetic material across species boundaries and is an important evolutionary phenomenon in the ancestry of many microbes. The role of HGT in plant evolutionary history is, however, largely unexplored. Here, we compare the genomes of six plant species with those of 159 prokaryotic and eukaryotic species and identify 1689 genes that show the highest similarity to corresponding genes from fungi. We constructed a phylogeny for all 1689 genes identified and all homolog groups available from the rice (Oryza sativa) genome (3177 gene families) and used these to define 14 candidate plant-fungi HGT events. Comprehensive phylogenetic analyses of these 14 data sets, using methods that account for site rate heterogeneity, demonstrated support for nine HGT events, demonstrating an infrequent pattern of HGT between plants and fungi. Five HGTs were fungi-to-plant transfers and four were plant-to-fungi HGTs. None of the fungal-to-plant HGTs involved angiosperm recipients. These results alter the current view of organismal barriers to HGT, suggesting that phagotrophy, the consumption of a whole cell by another, is not necessarily a prerequisite for HGT between eukaryotes. Putative functional annotation of the HGT candidate genes suggests that two fungi-to-plant transfers have added phenotypes important for life in a soil environment. Our study suggests that genetic exchange between plants and fungi is exceedingly rare, particularly among the angiosperms, but has occurred during their evolutionary history and added important metabolic traits to plant lineages.

Avian cone photoreceptors tile the retina as five independent, self-organizing mosaics.

Directory of Open Access Journals (Sweden)

Yoseph A Kram

2010-02-01

Full Text Available The avian retina possesses one of the most sophisticated cone photoreceptor systems among vertebrates. Birds have five types of cones including four single cones, which support tetrachromatic color vision and a double cone, which is thought to mediate achromatic motion perception. Despite this richness, very little is known about the spatial organization of avian cones and its adaptive significance. Here we show that the five cone types of the chicken independently tile the retina as highly ordered mosaics with a characteristic spacing between cones of the same type. Measures of topological order indicate that double cones are more highly ordered than single cones, possibly reflecting their posited role in motion detection. Although cones show spacing interactions that are cell type-specific, all cone types use the same density-dependent yardstick to measure intercone distance. We propose a simple developmental model that can account for these observations. We also show that a single parameter, the global regularity index, defines the regularity of all five cone mosaics. Lastly, we demonstrate similar cone distributions in three additional avian species, suggesting that these patterning principles are universal among birds. Since regular photoreceptor spacing is critical for uniform sampling of visual space, the cone mosaics of the avian retina represent an elegant example of the emergence of adaptive global patterning secondary to simple local interactions between individual photoreceptors. Our results indicate that the evolutionary pressures that gave rise to the avian retina's various adaptations for enhanced color discrimination also acted to fine-tune its spatial sampling of color and luminance.

Light- and GTP-activated hydrolysis of phosphatidylinositol bisphosphate in squid photoreceptor membranes

International Nuclear Information System (INIS)

Baer, K.M.; Saibil, H.R.

1988-01-01

Light stimulates the hydrolysis of exogenous, [ 3 H]inositol-labeled phosphatidylinositol bisphosphate (PtdInsP2) added to squid photoreceptor membranes, releasing inositol trisphosphate (InsP3). At free calcium levels of 0.05 microM or greater, hydrolysis of the labeled lipid is stimulated up to 4-fold by GTP and light together, but not separately. This activity is the biochemical counterpart of observations on intact retina showing that a rhodopsin-activated GTP-binding protein is involved in visual transduction in invertebrates, and that InsP3 release is correlated with visual excitation and adaptation. Using an in vitro assay, we investigated the calcium and GTP dependence of the phospholipase activity. At calcium concentrations between 0.1 and 0.5 microM, some hydrolysis occurs independently of GTP and light, with a light- and GTP-activated component superimposed. At 1 microM calcium there is no background activity, and hydrolysis absolutely requires both GTP and light. Ion exchange chromatography on Dowex 1 (formate form) of the water-soluble products released at 1 microM calcium reveals that the product is almost entirely InsP3. Invertebrate rhodopsin is homologous in sequence and function to vertebrate visual pigment, which modulates the concentration of cyclic GMP through the mediation of the GTP-binding protein transducin. While there is some evidence that light also modulates PtdInsP2 content in vertebrate photoreceptors, the case for its involvement in phototransduction is stronger for the invertebrate systems. The results reported here support the scheme of rhodopsin----GTP-binding protein----phospholipase C activation in invertebrate photoreceptors

Macro optical projection tomography for large scale 3D imaging of plant structures and gene activity.

Science.gov (United States)

Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S

2017-01-01

Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

Directory of Open Access Journals (Sweden)

O.I. Grabelnych

2017-02-01

Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

Random Photon Absorption Model Elucidates How Early Gain Control in Fly Photoreceptors Arises from Quantal Sampling

Science.gov (United States)

Song, Zhuoyi; Zhou, Yu; Juusola, Mikko

2016-01-01

Many diurnal photoreceptors encode vast real-world light changes effectively, but how this performance originates from photon sampling is unclear. A 4-module biophysically-realistic fly photoreceptor model, in which information capture is limited by the number of its sampling units (microvilli) and their photon-hit recovery time (refractoriness), can accurately simulate real recordings and their information content. However, sublinear summation in quantum bump production (quantum-gain-nonlinearity) may also cause adaptation by reducing the bump/photon gain when multiple photons hit the same microvillus simultaneously. Here, we use a Random Photon Absorption Model (RandPAM), which is the 1st module of the 4-module fly photoreceptor model, to quantify the contribution of quantum-gain-nonlinearity in light adaptation. We show how quantum-gain-nonlinearity already results from photon sampling alone. In the extreme case, when two or more simultaneous photon-hits reduce to a single sublinear value, quantum-gain-nonlinearity is preset before the phototransduction reactions adapt the quantum bump waveform. However, the contribution of quantum-gain-nonlinearity in light adaptation depends upon the likelihood of multi-photon-hits, which is strictly determined by the number of microvilli and light intensity. Specifically, its contribution to light-adaptation is marginal (≤ 1%) in fly photoreceptors with many thousands of microvilli, because the probability of simultaneous multi-photon-hits on any one microvillus is low even during daylight conditions. However, in cells with fewer sampling units, the impact of quantum-gain-nonlinearity increases with brightening light. PMID:27445779

Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

Directory of Open Access Journals (Sweden)

Masayoshi Hashimoto

2016-10-01

Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

Viral vectors for gene modification of plants as chem/bio sensors.

Energy Technology Data Exchange (ETDEWEB)

Manginell, Monica; Harper, Jason C.; Arango, Dulce C.; Brozik, Susan Marie; Dolan, Patricia L.

2006-11-01

Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport. We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing

Automated detection of photoreceptor disruption in mild diabetic retinopathy on volumetric optical coherence tomography.

Science.gov (United States)

Wang, Zhuo; Camino, Acner; Zhang, Miao; Wang, Jie; Hwang, Thomas S; Wilson, David J; Huang, David; Li, Dengwang; Jia, Yali

2017-12-01

Diabetic retinopathy is a pathology where microvascular circulation abnormalities ultimately result in photoreceptor disruption and, consequently, permanent loss of vision. Here, we developed a method that automatically detects photoreceptor disruption in mild diabetic retinopathy by mapping ellipsoid zone reflectance abnormalities from en face optical coherence tomography images. The algorithm uses a fuzzy c-means scheme with a redefined membership function to assign a defect severity level on each pixel and generate a probability map of defect category affiliation. A novel scheme of unsupervised clustering optimization allows accurate detection of the affected area. The achieved accuracy, sensitivity and specificity were about 90% on a population of thirteen diseased subjects. This method shows potential for accurate and fast detection of early biomarkers in diabetic retinopathy evolution.

Rod photoreceptors express GPR55 in the adult vervet monkey retina

DEFF Research Database (Denmark)

Bouskila, Joseph; Javadi, Pasha; Casanova, Christian

2013-01-01

. Yet, its formal classification is still a matter of debate. CB1R and CB2R expression patterns are well described for rodent and monkey retinas. In the monkey retina, CB1R has been localized in its neural (cone photoreceptor, horizontal, bipolar, amacrine and ganglion cells) and CB2R in glial...

The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses

Directory of Open Access Journals (Sweden)

Yuling Bai

2018-06-01

Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.

Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

Science.gov (United States)

Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

2013-01-01

The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

Assessment of different virus-mediated approaches for retinal gene therapy of Usher 1B.

Science.gov (United States)

Lopes, Vanda S; Diemer, Tanja; Williams, David S

2014-01-01

Usher syndrome type 1B, which is characterized by congenital deafness and progressive retinal degeneration, is caused by the loss of the function of MYO7A. Prevention of the retinal degeneration should be possible by delivering functional MYO7A to retinal cells. Although this approach has been used successfully in clinical trials for Leber congenital amaurosis (LCA2), it remains a challenge for Usher 1B because of the large size of the MYO7A cDNA. Different viral vectors have been tested for use in MYO7A gene therapy. Here, we review approaches with lentiviruses, which can accommodate larger genes, as well as attempts to use adeno-associated virus (AAV), which has a smaller packaging capacity. In conclusion, both types of viral vector appear to be effective. Despite concerns about the ability of lentiviruses to access the photoreceptor cells, a phenotype of the photoreceptors of Myo7a-mutant mice can be corrected. And although MYO7A cDNA is significantly larger than the nominal carrying capacity of AAV, AAV-MYO7A in single vectors also corrected Myo7a-mutant phenotypes in photoreceptor and RPE cells. Interestingly, however, a dual AAV vector approach was found to be much less effective.

Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

Science.gov (United States)

Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

2016-01-01

In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

Directory of Open Access Journals (Sweden)

Aaron E Walworth

Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of

Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

Science.gov (United States)

Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

2016-01-01

In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

Morphological characterization and topographic analysis of multiple photoreceptor types in the retinae of mesopelagic hatchetfishes with tubular eyes

Directory of Open Access Journals (Sweden)

Lauren Michelle Biagioni

2016-03-01

Full Text Available Marine hatchetfishes, Argyropelecus spp., are one of the 14 genera of mesopelagic teleosts, which possess tubular eyes. The tubular eyes are positioned dorsally on the head and consist of a main retina, which subtends a large dorsal binocular field, and an accessory retina, which subtends the lateral monocular visual field. The topographic distribution of photoreceptors in the retina of Argyropelecus sladeni, A. affinis and A. aculeatus was determined using a random, unbiased and systematic stereological approach, which consistently revealed a region of high density (area centralis in the central region of the main retina (up to a peak of 96,000 receptors per mm2 and a relatively homogeneous density of photoreceptors in the accessory retina (of approximately 20,000 receptors per mm2. The position of the area centralis in the main retina indicates this retinal region subserves greater spatial resolution in the centre of the dorsal binocular visual field. Light microscopy and transmission electron microscopy also revealed the presence of multiple photoreceptor types (two rod-like and one cone-like based on the size and shape of the inner and outer segments and ultrastructural differences in the ellipsoidal region. The presence of multiple photoreceptor types in these tubular-eyed, mesopelagic hatchetfishes may reflect the need for the visual system to function under different lighting conditions during vertical migratory behavior, especially given their unique dorsally-facing eyes.

Use of NAP gene to manipulate leaf senescence in plants

Science.gov (United States)

Gan, Susheng; Guo, Yongfeng

2013-04-16

The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.

Optical coherence tomography of the photoreceptor layer in the healthy eye and in eyes with hereditary macular dystrophy

International Nuclear Information System (INIS)

Stur, M.; Hermann, B.; Drexler, W.; Unterhuber, A.; Sattmann, H.; Ergun, E.; Wirtitsch, M.

2007-01-01

Optical coherence tomography is primarily used for the evaluation of pronounced alterations of the retinal architecture, such as in macular holes, epiretinal gliosis, intra- and subretinal fluid accumulation as well as retinal atrophy. Ultrahigh resolution OCT devices also allow the assessment of discrete alterations of the photoreceptor layer and the retinal pigment epithelium. On the basis of cases from two different macular dystrophies, the importance of the evaluation of the photoreceptor layer and its correlation with visual acuity is demonstrated.(author) [de

A nucleotide metabolite controls stress-responsive gene expression and plant development.

Directory of Open Access Journals (Sweden)

Hao Chen

Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt

A nucleotide metabolite controls stress-responsive gene expression and plant development

KAUST Repository

Chen, Hao

2011-10-19

Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target

Transcriptomic Analysis Using Olive Varieties and Breeding Progenies Identifies Candidate Genes Involved in Plant Architecture.

Science.gov (United States)

González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R

2016-01-01

Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Evolution of melanopsin photoreceptors: discovery and characterization of a new melanopsin in nonmammalian vertebrates.

Directory of Open Access Journals (Sweden)

James Bellingham

2006-07-01

Full Text Available In mammals, the melanopsin gene (Opn4 encodes a sensory photopigment that underpins newly discovered inner retinal photoreceptors. Since its first discovery in Xenopus laevis and subsequent description in humans and mice, melanopsin genes have been described in all vertebrate classes. Until now, all of these sequences have been considered representatives of a single orthologous gene (albeit with duplications in the teleost fish. Here, we describe the discovery and functional characterisation of a new melanopsin gene in fish, bird, and amphibian genomes, demonstrating that, in fact, the vertebrates have evolved two quite separate melanopsins. On the basis of sequence similarity, chromosomal localisation, and phylogeny, we identify our new melanopsins as the true orthologs of the melanopsin gene previously described in mammals and term this grouping Opn4m. By contrast, the previously published melanopsin genes in nonmammalian vertebrates represent a separate branch of the melanopsin family which we term Opn4x. RT-PCR analysis in chicken, zebrafish, and Xenopus identifies expression of both Opn4m and Opn4x genes in tissues known to be photosensitive (eye, brain, and skin. In the day-14 chicken eye, Opn4m mRNA is found in a subset of cells in the outer nuclear, inner nuclear, and ganglion cell layers, the vast majority of which also express Opn4x. Importantly, we show that a representative of the new melanopsins (chicken Opn4m encodes a photosensory pigment capable of activating G protein signalling cascades in a light- and retinaldehyde-dependent manner under heterologous expression in Neuro-2a cells. A comprehensive in silico analysis of vertebrate genomes indicates that while most vertebrate species have both Opn4m and Opn4x genes, the latter is absent from eutherian and, possibly, marsupial mammals, lost in the course of their evolution as a result of chromosomal reorganisation. Thus, our findings show for the first time that nonmammalian

The sieve element occlusion gene family in dicotyledonous plants.

Science.gov (United States)

Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

2011-01-01

Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

Controversy Associated With the Common Component of Most Transgenic Plants – Kanamycin Resistance Marker Gene

Directory of Open Access Journals (Sweden)

Srećko Jelenić

2003-01-01

Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.

Silencing of meiosis-critical genes for engineering male sterility in plants

Science.gov (United States)

Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

OpenAIRE

Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng

2017-01-01

Background Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution...

Functional network analysis of genes differentially expressed during xylogenesis in soc1ful woody Arabidopsis plants.

Science.gov (United States)

Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic

2016-06-01

Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

Construction and comparison of gene co-expression networks shows complex plant immune responses

Directory of Open Access Journals (Sweden)

Luis Guillermo Leal

2014-10-01

Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.

Quantitative analysis of cone photoreceptor distribution and its relationship with axial length, age, and early age-related macular degeneration.

Directory of Open Access Journals (Sweden)

Ryo Obata

Full Text Available PURPOSE: It has not been clarified whether early age-related macular degeneration (AMD is associated with cone photoreceptor distribution. We used adaptive optics fundus camera to examine cone photoreceptors in the macular area of aged patients and quantitatively analyzed its relationship between the presence of early AMD and cone distribution. METHODS: Sixty cases aged 50 or older were studied. The eyes were examined with funduscopy and spectral-domain optical coherence tomography to exclude the eyes with any abnormalities at two sites of measurement, 2° superior and 5° temporal to the fovea. High-resolution retinal images with cone photoreceptor mosaic were obtained with adaptive optics fundus camera (rtx1, Imagine Eyes, France. After adjusting for axial length, cone packing density was calculated and the relationship with age, axial length, or severity of early AMD based on the age-related eye disease study (AREDS classification was analyzed. RESULTS: Patient's age ranged from 50 to 77, and axial length from 21.7 to 27.5 mm. Mean density in metric units and that in angular units were 24,900 cells/mm2, 2,170 cells/deg2 at 2° superior, and 18,500 cells/mm2, 1,570 cels/deg2 at 5° temporal, respectively. Axial length was significantly correlated with the density calculated in metric units, but not with that in angular units. Age was significantly correlated with the density both in metric and angular units at 2° superior. There was no significant difference in the density in metric and angular units between the eyes with AREDS category one and those with categories two or three. CONCLUSION: Axial length and age were significantly correlated with parafoveal cone photoreceptor distribution. The results do not support that early AMD might influence cone photoreceptor density in the area without drusen or pigment abnormalities.

Multiple episodes of convergence in genes of the dim light vision pathway in bats.

Directory of Open Access Journals (Sweden)

Yong-Yi Shen

Full Text Available The molecular basis of the evolution of phenotypic characters is very complex and is poorly understood with few examples documenting the roles of multiple genes. Considering that a single gene cannot fully explain the convergence of phenotypic characters, we choose to study the convergent evolution of rod vision in two divergent bats from a network perspective. The Old World fruit bats (Pteropodidae are non-echolocating and have binocular vision, whereas the sheath-tailed bats (Emballonuridae are echolocating and have monocular vision; however, they both have relatively large eyes and rely more on rod vision to find food and navigate in the night. We found that the genes CRX, which plays an essential role in the differentiation of photoreceptor cells, SAG, which is involved in the desensitization of the photoactivated transduction cascade, and the photoreceptor gene RH, which is directly responsible for the perception of dim light, have undergone parallel sequence evolution in two divergent lineages of bats with larger eyes (Pteropodidae and Emballonuroidea. The multiple convergent events in the network of genes essential for rod vision is a rare phenomenon that illustrates the importance of investigating pathways and networks in the evolution of the molecular basis of phenotypic convergence.

Genome-Wide Identification of the Alba Gene Family in Plants and Stress-Responsive Expression of the Rice Alba Genes.

Science.gov (United States)

Verma, Jitendra Kumar; Wardhan, Vijay; Singh, Deepali; Chakraborty, Subhra; Chakraborty, Niranjan

2018-03-28

Architectural proteins play key roles in genome construction and regulate the expression of many genes, albeit the modulation of genome plasticity by these proteins is largely unknown. A critical screening of the architectural proteins in five crop species, viz., Oryza sativa , Zea mays , Sorghum bicolor , Cicer arietinum , and Vitis vinifera , and in the model plant Arabidopsis thaliana along with evolutionary relevant species such as Chlamydomonas reinhardtii , Physcomitrella patens , and Amborella trichopoda , revealed 9, 20, 10, 7, 7, 6, 1, 4, and 4 Alba (acetylation lowers binding affinity) genes, respectively. A phylogenetic analysis of the genes and of their counterparts in other plant species indicated evolutionary conservation and diversification. In each group, the structural components of the genes and motifs showed significant conservation. The chromosomal location of the Alba genes of rice ( OsAlba ), showed an unequal distribution on 8 of its 12 chromosomes. The expression profiles of the OsAlba genes indicated a distinct tissue-specific expression in the seedling, vegetative, and reproductive stages. The quantitative real-time PCR (qRT-PCR) analysis of the OsAlba genes confirmed their stress-inducible expression under multivariate environmental conditions and phytohormone treatments. The evaluation of the regulatory elements in 68 Alba genes from the 9 species studied led to the identification of conserved motifs and overlapping microRNA (miRNA) target sites, suggesting the conservation of their function in related proteins and a divergence in their biological roles across species. The 3D structure and the prediction of putative ligands and their binding sites for OsAlba proteins offered a key insight into the structure-function relationship. These results provide a comprehensive overview of the subtle genetic diversification of the OsAlba genes, which will help in elucidating their functional role in plants.

Using a periclinal chimera to unravel layer-specific gene expression in plants.

Science.gov (United States)

Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

2013-09-01

Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.

Silicon Regulates Potential Genes Involved in Major Physiological Processes in Plants to Combat Stress

Directory of Open Access Journals (Sweden)

Abinaya Manivannan

2017-08-01

Full Text Available Silicon (Si, the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.

Role of ethylene and related gene expression in the interaction between strawberry plants and the plant growth-promoting bacterium Azospirillum brasilense.

Science.gov (United States)

Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O

2018-05-01

Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society

Integrating Topographic Measures to Explore the Protective Effects of Peonidin Against the N-Methyl-N-Nitrosourea Induced Photoreceptor Degeneration

Directory of Open Access Journals (Sweden)

Ye Tao

2016-02-01

Full Text Available Background/Aims: The pathphysiological properties of N-Methyl -N -nitrosourea (MNU induced photoreceptor degeneration are similar to the hereditary retinitis pigmentosa (RP. The present study sought to explore the beneficial effects of the peonidin, a common aglycone form of anthocyanin, on the MNU induced photoreceptor degeneration via topographic measurements. Methods: The MNU administrated mouse received peonidin or vehicle injections, and then they were examined by electroretinography (ERG, multi electrode array (MEA, histological and immunohistochemistry studies. Results: The protective effects of peonidin on the MNU administrated retinas were systematically verified and quantified by topographic measures. The peonidin treatment could protect the photoreceptor against the MNU toxicity both functionally and morphologicaly. The most sensitive zone to peonidin therapy was sorted out, indicating that different rescuing kinetics existed between the retinal hemispheres and retinal quadrants. Moreover, the hyperactive spontaneous firing response and the debilitated light induced response in MNU administrated retinas could be partially reversed by peonidin treatment. To our knowledge, this was the first study to explore the pharmacological effects of peonidin on the electrophysiological properties of inner visual signal pathways. Conclusion: The peonidin could ameliorate the MNU induced photoreceptors degeneration and rectify the abnormities in the inner visual signal pathways. Future refinements of the knowledge cast insights into the discovery of a novel treatment for human RP.

Cadmium resistance in tobacco plants expressing the MuSI gene

OpenAIRE

Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

2011-01-01

MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI t...

Expression of kenaf mitochondrial chimeric genes HM184 causes male sterility in transgenic tobacco plants.

Science.gov (United States)

Zhao, Yanhong; Liao, Xiaofang; Huang, Zhipeng; Chen, Peng; Zhou, Bujin; Liu, Dongmei; Kong, Xiangjun; Zhou, Ruiyang

2015-08-01

Chimeric genes resulting from the rearrangement of a mitochondrial genome were generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS). In the study, earlier we reported that identifying a 47 bp deletion at 3'- flanking of atp9 that was linked to male sterile cytoplasm in kenaf. The truncated fragment was fused with atp9, a mitochondrial transit signal (MTS) and/or GFP, comprised two chimeric genes MTS-HM184-GFP and MTS-HM184. The plant expression vector pBI121 containing chimeric genes were then introduced to tobacco plants by Agrobacterium-mediated T-DNA transformation. The result showed that certain transgenic plants were male sterility or semi-sterility, while some were not. The expression analysis further demonstrated that higher level of expression were showed in the sterility plants, while no expression or less expression in fertility plants, the levels of expression of semi-sterility were in between. And the sterile plant (containing MTS-HM184-GFP) had abnormal anther produced malformed/shriveled pollen grains stained negative that failed to germinate (0%), the corresponding fruits was shrunken, the semi-sterile plants having normal anther shape produced about 10-50% normal pollen grains, the corresponding fruits were not full, and the germination rate was 58%. Meanwhile these transgenic plants which altered on fertility were further analyzed in phenotype. As a result, the metamorphosis leaves were observed in the seedling stage, the plant height of transgenic plants was shorter than wild type. The growth duration of transgenic tobacco was delayed 30-45 days compared to the wild type. The copy numbers of target genes of transgenic tobacco were analyzed using the real-time quantitative method. The results showed that these transgenic plants targeting-expression in mitochondrial containing MTS-HM184-GFP had 1 copy and 2 copies, the other two plants containing MTS-HM184 both had 3 copies, but 0 copy in wild type. In

Optical imaging of human cone photoreceptors directly following the capture of light.

Directory of Open Access Journals (Sweden)

Phillip Bedggood

Full Text Available Capture of light in the photoreceptor outer segment initiates a cascade of chemical events that inhibit neurotransmitter release, ultimately resulting in vision. The massed response of the photoreceptor population can be measured non-invasively by electrical recordings, but responses from individual cells cannot be measured without dissecting the retina. Here we used optical imaging to observe individual human cones in the living eye as they underwent bleaching of photopigment and associated phototransduction. The retina was simultaneously stimulated and observed with high intensity visible light at 1 kHz, using adaptive optics. There was marked variability between individual cones in both photosensitivity and pigment optical density, challenging the conventional assumption that photoreceptors act as identical subunits (coefficient of variation in rate of photoisomerization = 23%. There was also a pronounced inverse correlation between these two parameters (p<10(-7; the temporal evolution of image statistics revealed this to be a dynamic relationship, with cone waveguiding efficiency beginning a dramatic increase within 3 ms of light onset. Beginning as early as 2 ms after light onset and including half of cells by ∼7 ms, cone intensity showed reversals characteristic of interference phenomena, with greater delays in reversal corresponding to cones with more photopigment (p<10(-3. The timing of these changes is argued to best correspond with either the cessation of dark current, or to related events such as changes in intracellular cGMP. Cone intensity also showed fluctuations of high frequency (332±25 Hz and low amplitude (3.0±0.85%. Other groups have shown similar fluctuations that were directly evoked by light; if this corresponds to the same phenomenon, we propose that the amplitude of fluctuation may be increased by the use of a bright flash followed by a brief pause, to allow recovery of cone circulating current.

Advances in plant gene-targeted and functional markers: a review

Directory of Open Access Journals (Sweden)

Poczai Péter

2013-02-01

Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information

Advances in plant gene-targeted and functional markers: a review

Science.gov (United States)

2013-01-01

Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the

Chemical Excitation and Inactivation in Photoreceptors of the Fly Mutants trp and nss

NARCIS (Netherlands)

Suss, E.; Barash, S.; Stavenga, D.G.; Stieve, H.; Selinger, Z.; Minke, B.

1989-01-01

The Drosophila and Lucilia photoreceptor mutants, trp and nss, respond like wild-type flies to a short pulse of intense light or prolonged dim light; however, upon continuous intense illumination, the trp and nss mutants are unable to maintain persistent excitation. This defect manifests itself by a

plantiSMASH: automated identification, annotation and expression analysis of plant biosynthetic gene clusters

DEFF Research Database (Denmark)

Kautsar, Satria A.; Suarez Duran, Hernando G.; Blin, Kai

2017-01-01

exploration of the nature and dynamics of gene clustering in plant metabolism. Moreover, spurred by the continuing decrease in costs of plant genome sequencing, they will allow genome mining technologies to be applied to plant natural product discovery. The plantiSMASH web server, precalculated results...

Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

Science.gov (United States)

Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K

2014-01-01

Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

Directory of Open Access Journals (Sweden)

Nidhi Thakur

Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

Candidacy of a chitin-inducible gibberellin-responsive gene for a major locus affecting plant height in rice that is closely linked to Green Revolution gene sd1.

Science.gov (United States)

Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong

2011-09-01

Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.

Low-resolution characterization of the 3D structure of the Euglena gracilis photoreceptor

International Nuclear Information System (INIS)

Barsanti, Laura; Coltelli, Primo; Evangelista, Valtere; Passarelli, Vincenzo; Frassanito, Anna Maria; Vesentini, Nicoletta; Gualtieri, Paolo

2008-01-01

This paper deals with the first characterization of the structure of the photoreceptive organelle of the unicellular alga Euglena gracilis (Euglenophyta). This organelle has a three-dimensional organization consisting of up to 50 closely stacked membrane lamellae. Ionically induced unstacking of the photoreceptor lamellae revealed ordered arrays well suited to structural analysis by electron microscopy and image analysis, which ultimately yielded a low-resolution picture of the structure. Each lamella is formed by the photoreceptive membrane protein of the cell assembled within the membrane layer in a hexagonal lattice. The first order diffraction spots in the calculated Fourier transform reveals the presence of 6-fold symmetrized topography (better resolution about 90 A). The 2D and 3D structural data are very similar with those recently published on proteorodopsin, a membrane protein used by marine bacterio-plankton as light-driven proton pump. In our opinion these similarity indicate that a photoreceptive protein belonging to the same superfamily of proteorodopsin could form the Euglena photoreceptor

Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

Science.gov (United States)

Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

2015-09-01

In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

Structural evolution of the 4/1 genes and proteins in non-vascular and lower vascular plants.

Science.gov (United States)

Morozov, Sergey Y; Milyutina, Irina A; Bobrova, Vera K; Ryazantsev, Dmitry Y; Erokhina, Tatiana N; Zavriev, Sergey K; Agranovsky, Alexey A; Solovyev, Andrey G; Troitsky, Alexey V

2015-12-01

The 4/1 protein of unknown function is encoded by a single-copy gene in most higher plants. The 4/1 protein of Nicotiana tabacum (Nt-4/1 protein) has been shown to be alpha-helical and predominantly expressed in conductive tissues. Here, we report the analysis of 4/1 genes and the encoded proteins of lower land plants. Sequences of a number of 4/1 genes from liverworts, lycophytes, ferns and gymnosperms were determined and analyzed together with sequences available in databases. Most of the vascular plants were found to encode Magnoliophyta-like 4/1 proteins exhibiting previously described gene structure and protein properties. Identification of the 4/1-like proteins in hornworts, liverworts and charophyte algae (sister lineage to all land plants) but not in mosses suggests that 4/1 proteins are likely important for plant development but not required for a primary metabolic function of plant cell. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Less is more: strategies to remove marker genes from transgenic plants

Science.gov (United States)

2013-01-01

Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583

Less is more: strategies to remove marker genes from transgenic plants.

Science.gov (United States)

Yau, Yuan-Yeu; Stewart, C Neal

2013-04-23

Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.

Synaptojanin 1 is required for endolysosomal trafficking of synaptic proteins in cone photoreceptor inner segments.

Directory of Open Access Journals (Sweden)

Ashley A George

Full Text Available Highly polarized cells such as photoreceptors require precise and efficient strategies for establishing and maintaining the proper subcellular distribution of proteins. The signals and molecular machinery that regulate trafficking and sorting of synaptic proteins within cone inner segments is mostly unknown. In this study, we show that the polyphosphoinositide phosphatase Synaptojanin 1 (SynJ1 is critical for this process. We used transgenic markers for trafficking pathways, electron microscopy, and immunocytochemistry to characterize trafficking defects in cones of the zebrafish mutant, nrc(a14 , which is deficient in phosphoinositide phosphatase, SynJ1. The outer segments and connecting cilia of nrc(a14 cone photoreceptors are normal, but RibeyeB and VAMP2/synaptobrevin, which normally localize to the synapse, accumulate in the nrc(a14 inner segment. The structure of the Endoplasmic Reticulum in nrc(a14 mutant cones is normal. Golgi develop normally, but later become disordered. Large vesicular structures accumulate within nrc(a14 cone photoreceptor inner segments, particularly after prolonged incubation in darkness. Cone inner segments of nrc (a14 mutants also have enlarged acidic vesicles, abnormal late endosomes, and a disruption in autophagy. This last pathway also appears exacerbated by darkness. Taken altogether, these findings show that SynJ1 is required in cones for normal endolysosomal trafficking of synaptic proteins.

The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool

Directory of Open Access Journals (Sweden)

Nan Zhao

2018-02-01

Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.

Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.

Science.gov (United States)

Kumar, Rahul

2016-01-01

Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.

The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Gutiérrez Rodrigo A

2008-09-01

Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

Science.gov (United States)

Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Sokolova (Guzeeva), Elena; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T.

2017-01-01

Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum. PMID:29065523

The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes.

Science.gov (United States)

Danchin, Etienne G J; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Guzeeva, Elena Sokolova; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T; den Akker, Sebastian Eves-van

2017-10-23

Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus , representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus , respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

Directory of Open Access Journals (Sweden)

Etienne G.J. Danchin

2017-10-01

Full Text Available Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

Phylogenetic Analysis, Lineage-Specific Expansion and Functional Divergence of seed dormancy 4-Like Genes in Plants.

Directory of Open Access Journals (Sweden)

Saminathan Subburaj

Full Text Available The rice gene seed dormancy 4 (OsSdr4 functions in seed dormancy and is a major factor associated with pre-harvest sprouting (PHS. Although previous studies of this protein family were reported for rice and other species, knowledge of the evolution of genes homologous to OsSdr4 in plants remains inadequate. Fifty four Sdr4-like (hereafter designated Sdr4L genes were identified in nine plant lineages including 36 species. Phylogenetic analysis placed these genes in eight subfamilies (I-VIII. Genes from the same lineage clustered together, supported by analysis of conserved motifs and exon-intron patterns. Segmental duplications were present in both dicot and monocot clusters, while tandemly duplicated genes occurred only in monocot clusters indicating that both tandem and segmental duplications contributed to expansion of the grass I and II subfamilies. Estimation of the approximate ages of the duplication events indicated that ancestral Sdr4 genes evolved from a common angiosperm ancestor, about 160 million years ago (MYA. Moreover, diversification of Sdr4L genes in mono and dicot plants was mainly associated with genome-wide duplication and speciation events. Functional divergence was observed in all subfamily pairs, except IV/VIIIa. Further analysis indicated that functional constraints between subfamily pairs I/II, I/VIIIb, II/VI, II/VIIIb, II/IV, and VI/VIIIb were statistically significant. Site and branch-site model analyses of positive selection suggested that these genes were under strong adaptive selection pressure. Critical amino acids detected for both functional divergence and positive selection were mostly located in the loops, pointing to functional importance of these regions in this protein family. In addition, differential expression studies by transcriptome atlas of 11 Sdr4L genes showed that the duplicated genes may have undergone divergence in expression between plant species. Our findings showed that Sdr4L genes are

Phytochrome B mRNA expression enhances biomass yield and ...

African Journals Online (AJOL)

A wide variety of physiological responses, including most light responses, also are modulated by photoreceptor gene such as PHYB. Phytochrome B (PHYB) expression patterns may be significant in the daily regulation of plant physiology and indicate an unexpectedly intimate relationship between the components of the ...

Oxygen-induced retinopathy in mice with retinal photoreceptor cell degeneration.

Science.gov (United States)

Zhang, Qian; Zhang, Zuo-Ming

2014-04-25

It is reported that retinal neovascularization seems to rarely co-exist with retinitis pigmentosa in patients and in some mouse models; however, it is not widely acknowledged as a universal phenomenon in all strains of all animal species. We aimed to further explore this phenomenon with an oxygen-induced retinopathy model in mice with retinal photoreceptor cell degeneration. Oxygen-induced retinopathy of colored and albino mice with rapid retinal degeneration were compared to homologous wild-type mice. The retinas were analyzed using high-molecular-weight FITC-dextran stained flat-mount preparation, hematoxylin and eosin (H&E) stained cross-sections, an immunohistochemical test for vascular endothelial growth factor (VEGF) distribution and Western blotting for VEGF expression after exposure to hyperoxia between postnatal days 17 (P17) and 21. Leakage and areas of non-perfusion of the retinal blood vessels were alleviated in the retinal degeneration mice. The number of preretinal vascular endothelial cell nuclei in the retinal degeneration mice was smaller than that in the homologous wild-type mice after exposure to hyperoxia (Poxygen-induced retinopathy was positively correlated with the VEGF expression level. However, the VEGF expression level was lower in the retinal degeneration mice. Proliferative retinopathy occurred in mice with rapid retinal degeneration, but retinal photoreceptor cell degeneration could partially restrain the retinal neovascularization in this rapid retinal degeneration mouse model. Copyright © 2014 Elsevier Inc. All rights reserved.

Plants, genes and justice : an inquiry into fair and equitable benefit-sharing

NARCIS (Netherlands)

Jonge, de B.

2009-01-01

Since the advent of biotechnology, plant genetic resources have become more valuable as possible sources for new products and inventions. With knowledge about the genetic make-up and functioning of a plant, biotechnologists can identify and isolate genes with interesting traits which, after long

Using The Corngrass1 Gene To Enhance The Biofuel Properties Of Crop Plants

Energy Technology Data Exchange (ETDEWEB)

Hake, Sarah [USDA Agricultural Research Service, Washington DC (United States); Chuck, George [USDA Agricultural Research Service, Washington DC (United States)

2015-10-29

The development of novel plant germplasm is vital to addressing our increasing bioenergy demands. The major hurdle to digesting plant biomass is the complex structure of the cell walls, the substrate of fermentation. Plant cell walls are inaccessible matrices of macromolecules that are polymerized with lignin, making fermentation difficult. Overcoming this hurdle is a major goal toward developing usable bioenergy crop plants. Our project seeks to enhance the biofuel properties of perennial grass species using the Corngrass1 (Cg1) gene and its targets. Dominant maize Cg1 mutants produce increased biomass by continuously initiating extra axillary meristems and leaves. We cloned Cg1 and showed that its phenotype is caused by over expression of a unique miR156 microRNA gene that negatively regulates SPL transcription factors. We transferred the Cg1 phenotype to other plants by expressing the gene behind constitutive promoters in four different species, including the monocots, Brachypodium and switchgrass, and dicots, Arabidopsis and poplar. All transformants displayed a similar range of phenotypes, including increased biomass from extended leaf production, and increased vegetative branching. Field grown switchgrass transformants showed that overall lignin content was reduced, the ratio of glucans to xylans was increased, and surprisingly, that starch levels were greatly increased. The goals of this project are to control the tissue and temporal expression of Cg1 by using different promoters to drive its expression, elucidate the function of the SPL targets of Cg1 by generating gain and loss of function alleles, and isolate downstream targets of select SPL genes using deep sequencing and chromatin immunoprecipitation. We believe it is possible to control biomass accumulation, cell wall properties, and sugar levels through manipulation of either the Cg1 gene and/or its SPL targets.

Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses

Directory of Open Access Journals (Sweden)

Kenneth W. Berendzen

2013-04-01

Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.

Temperature Dependence of Receptor Potential and Noise in Fly (Calliphora erythrocephala) Photoreceptor Cells

NARCIS (Netherlands)

Roebroek, J.G.H.; Tjonger, M. van; Stavenga, D.G.

1990-01-01

We investigated the effect of temperature on the response to light of photoreceptors of the blowfly Calliphora erythrocephala. The latency and the time-to-peak of the responses become shorter as the temperature increases; Q10 = 2.8 ± 0.6. The response amplitude is independent of the temperature in

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Genes under positive selection in a model plant pathogenic fungus, Botrytis.

Science.gov (United States)

Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian

2012-07-01

The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.

Step-wise and lineage-specific diversification of plant RNA polymerase genes and origin of the largest plant-specific subunits.

Science.gov (United States)

Wang, Yaqiong; Ma, Hong

2015-09-01

Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Seeing the forest for the trees: annotating small RNA producing genes in plants.

Science.gov (United States)

Coruh, Ceyda; Shahid, Saima; Axtell, Michael J

2014-04-01

A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.

The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys

Directory of Open Access Journals (Sweden)

Anna V. Shchennikova

2018-01-01

Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.

Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

Science.gov (United States)

Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

2014-01-01

Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

Major gene mutations and domestication of plants

International Nuclear Information System (INIS)

Ashri, A.

1989-01-01

From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

Functional genomics tools applied to plant metabolism: a survey on plant respiration, its connections and the annotation of complex gene functions

Directory of Open Access Journals (Sweden)

Wagner L. Araújo

2012-09-01

Full Text Available The application of post-genomic techniques in plant respiration studies has greatly improved our ability to assign functions to gene products. In addition it has also revealed previously unappreciated interactions between distal elements of metabolism. Such results have reinforced the need to consider plant respiratory metabolism as part of a complex network and making sense of such interactions will ultimately require the construction of predictive and mechanistic models. Transcriptomics, proteomics, metabolomics and the quantification of metabolic flux will be of great value in creating such models both by facilitating the annotation of complex gene function, determining their structure and by furnishing the quantitative data required to test them. In this review we highlight how these experimental approaches have contributed to our current understanding of plant respiratory metabolism and its interplay with associated process (e.g. photosynthesis, photorespiration and nitrogen metabolism. We also discuss how data from these techniques may be integrated, with the ultimate aim of identifying mechanisms that control and regulate plant respiration and discovering novel gene functions with potential biotechnological implications.

Autosomal recessive retinitis pigmentosa caused by mutations in the MAK gene.

Science.gov (United States)

Stone, Edwin M; Luo, Xunda; Héon, Elise; Lam, Byron L; Weleber, Richard G; Halder, Jennifer A; Affatigato, Louisa M; Goldberg, Jacqueline B; Sumaroka, Alexander; Schwartz, Sharon B; Cideciyan, Artur V; Jacobson, Samuel G

2011-12-28

To determine the disease expression in autosomal recessive (ar) retinitis pigmentosa (RP) caused by mutations in the MAK (male germ cell-associated kinase) gene. Patients with RP and MAK gene mutations (n = 24; age, 32-77 years at first visit) were studied by ocular examination, perimetry, and optical coherence tomography (OCT). All but one MAK patient were homozygous for an identical truncating mutation in exon 9 and had Ashkenazi Jewish heritage. The carrier frequency of this mutation among 1207 unrelated Ashkenazi control subjects was 1 in 55, making it the most common cause of heritable retinal disease in this population and MAK-associated RP the sixth most common Mendelian disease overall in this group. Visual acuities could be normal into the eighth decade of life. Kinetic fields showed early loss in the superior-temporal quadrant. With more advanced disease, superior and midperipheral function was lost, but the nasal field remained. Only a central island was present at late stages. Pigmentary retinopathy was less prominent in the superior nasal quadrant. Rod-mediated vision was abnormal but detectable in the residual field; all patients had rod>cone dysfunction. Photoreceptor layer thickness was normal centrally but decreased with eccentricity. At the stages studied, there was no evidence of photoreceptor ciliary elongation. The patterns of disease expression in the MAK form of arRP showed some resemblance to patterns described in autosomal dominant RP, especially the form caused by RP1 mutations. The similarity in phenotypes is of interest, considering that there is experimental evidence of interaction between Mak and RP1 in the photoreceptor cilium.

Agrobacterium rhizogenes rolB gene affects photosynthesis and chlorophyll content in transgenic tomato (Solanum lycopersicum L.) plants.

Science.gov (United States)

Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa

2016-10-01

Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.

Autofluorescence Lifetimes in Patients With Choroideremia Identify Photoreceptors in Areas With Retinal Pigment Epithelium Atrophy.

Science.gov (United States)

Dysli, Chantal; Wolf, Sebastian; Tran, Hoai Viet; Zinkernagel, Martin S

2016-12-01

The purpose of this study was to investigate fundus autofluorescence lifetimes in patients with choroideremia and to identify tissue-specific lifetime characteristics and potential prognostic markers. Autofluorescence lifetimes of the retina were measured in two spectral channels (498-560 nm and 560-720 nm) in patients with choroideremia and age-matched healthy controls. Furthermore, autofluorescence intensities and spectral-domain optical coherence tomography (OCT) data were acquired and compared to fundus autofluorescence lifetime data. Sixteen eyes from 8 patients with advanced choroideremia (mean ± SD age, 55 ± 13 years) were included in this study and compared with 10 age-matched healthy participants. Whereas fundus autofluorescence intensity measurement identified areas of remaining retinal pigment epithelium (RPE), autofluorescence lifetime maps identified areas with remaining photoreceptor layers in OCT but RPE atrophy. In these areas, mean (±SEM) lifetimes were 567 ± 59 ps in the short and 603 ± 49 ps in the long spectral channels (+98% and +88% compared to controls). In areas of combined RPE atrophy and loss of photoreceptors, autofluorescence lifetimes were significantly prolonged by 1116 ± 63 ps (+364%) in the short and by 915 ± 52 ps (+270%) in the long spectral channels compared with controls. Because autofluorescence lifetimes identify areas of remaining photoreceptors in the absence of RPE, this imaging modality may be useful to monitor disease progression in the natural course of disease and in context of potential future therapeutic interventions.

Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

Science.gov (United States)

Vozárová, Z; Žilová, M; Šubr, Z

2015-12-01

Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

Global transcriptome analysis reveals extensive gene remodeling, alternative splicing and differential transcription profiles in non-seed vascular plant Selaginella moellendorffii.

Science.gov (United States)

Zhu, Yan; Chen, Longxian; Zhang, Chengjun; Hao, Pei; Jing, Xinyun; Li, Xuan

2017-01-25

Selaginella moellendorffii, a lycophyte, is a model plant to study the early evolution and development of vascular plants. As the first and only sequenced lycophyte to date, the genome of S. moellendorffii revealed many conserved genes and pathways, as well as specialized genes different from flowering plants. Despite the progress made, little is known about long noncoding RNAs (lncRNA) and the alternative splicing (AS) of coding genes in S. moellendorffii. Its coding gene models have not been fully validated with transcriptome data. Furthermore, it remains important to understand whether the regulatory mechanisms similar to flowering plants are used, and how they operate in a non-seed primitive vascular plant. RNA-sequencing (RNA-seq) was performed for three S. moellendorffii tissues, root, stem, and leaf, by constructing strand-specific RNA-seq libraries from RNA purified using RiboMinus isolation protocol. A total of 176 million reads (44 Gbp) were obtained from three tissue types, and were mapped to S. moellendorffii genome. By comparing with 22,285 existing gene models of S. moellendorffii, we identified 7930 high-confidence novel coding genes (a 35.6% increase), and for the first time reported 4422 lncRNAs in a lycophyte. Further, we refined 2461 (11.0%) of existing gene models, and identified 11,030 AS events (for 5957 coding genes) revealed for the first time for lycophytes. Tissue-specific gene expression with functional implication was analyzed, and 1031, 554, and 269 coding genes, and 174, 39, and 17 lncRNAs were identified in root, stem, and leaf tissues, respectively. The expression of critical genes for vascular development stages, i.e. formation of provascular cells, xylem specification and differentiation, and phloem specification and differentiation, was compared in S. moellendorffii tissues, indicating a less complex regulatory mechanism in lycophytes than in flowering plants. The results were further strengthened by the evolutionary trend of

Remote sensing of gene expression in Planta: transgenic plants as monitors of exogenous stress perception in extraterrestrial environments

Science.gov (United States)

Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.

2002-01-01

Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.

Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

OpenAIRE

Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

2010-01-01

Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

Long-term preservation of retinal function in the RCS rat model of retinitis pigmentosa following lentivirus-mediated gene therapy.

Science.gov (United States)

Tschernutter, M; Schlichtenbrede, F C; Howe, S; Balaggan, K S; Munro, P M; Bainbridge, J W B; Thrasher, A J; Smith, A J; Ali, R R

2005-04-01

The Royal College of Surgeons (RCS) rat is a well-characterized model of autosomal recessive retinitis pigmentosa (RP) due to a defect in the retinal pigment epithelium (RPE). It is homozygous for a null mutation in the gene encoding , a receptor tyrosine kinase found in RPE cells, that is required for phagocytosis of shed photoreceptor outer segments. The absence of Mertk results in accumulation of outer segment debris. This subsequently leads to progressive loss of photoreceptor cells. In order to evaluate the efficacy of lentiviral-mediated gene replacement therapy in the RCS rat, we produced recombinant VSV-G pseudotyped HIV-1-based lentiviruses containing a murine Mertk cDNA driven by a spleen focus forming virus (SFFV) promoter. The vector was subretinally injected into the right eye of 10-day-old RCS rats; the left eye was left untreated as an internal control. Here, we present a detailed assessment of the duration and extent of the morphological rescue and the resulting functional benefits. We examined animals at various time points over a period of 7 months by light and electron microscopy, and electroretinography. We observed correction of the phagocytic defect, slowing of photoreceptor cell loss and preservation of retinal function for up to 7 months. This study demonstrates the potential of gene therapy approaches for the treatment of retinal degenerations caused by defects specific to the RPE and supports the use of lentiviral vectors for the treatment of such disorders.

Material Exchange in Photoreceptor Transplantation: Updating Our Understanding of Donor/Host Communication and the Future of Cell Engraftment Science.

Science.gov (United States)

Nickerson, Philip E B; Ortin-Martinez, Arturo; Wallace, Valerie A

2018-01-01

Considerable research effort has been invested into the transplantation of mammalian photoreceptors into healthy and degenerating mouse eyes. Several platforms of rod and cone fluorescent reporting have been central to refining the isolation, purification and transplantation of photoreceptors. The tracking of engrafted cells, including identifying the position, morphology and degree of donor cell integration post-transplant is highly dependent on the use of fluorescent protein reporters. Improvements in imaging and analysis of transplant recipients have revealed that donor cell fluorescent reporters can transfer into host tissue though a process termed material exchange (ME). This recent discovery has chaperoned a new era of interpretation when reviewing the field's use of dissociated donor cell preparations, and has prompted scientists to re-examine how we use and interpret the information derived from fluorescence-based tracking tools. In this review, we describe the status of our understanding of ME in photoreceptor transplantation. In addition, we discuss the impact of this discovery on several aspects of historical rod and cone transplantation data, and provide insight into future standards and approaches to advance the field of cell engraftment.

Simulating human photoreceptor optics using a liquid-filled photonic crystal fiber.

Science.gov (United States)

Rativa, Diego; Vohnsen, Brian

2011-02-11

We introduce a liquid-filled photonic crystal fiber to simulate a retinal cone photoreceptor mosaic and the directionality selective mechanism broadly known as the Stiles-Crawford effect. Experimental measurements are realized across the visible spectrum to study waveguide coupling and directionality at different managed waveguide parameters. The crystal fiber method is a hybrid tool between theory and a real biological sample and a valuable addition as a retina model for real eye simulations.

Human neural progenitor cells decrease photoreceptor degeneration, normalize opsin distribution and support synapse structure in cultured porcine retina.

Science.gov (United States)

Mollick, Tanzina; Mohlin, Camilla; Johansson, Kjell

2016-09-01

Retinal neurodegenerative disorders like retinitis pigmentosa, age-related macular degeneration, diabetic retinopathy and retinal detachment decrease retinal functionality leading to visual impairment. The pathological events are characterized by photoreceptor degeneration, synaptic disassembly, remodeling of postsynaptic neurons and activation of glial cells. Despite intense research, no effective treatment has been found for these disorders. The current study explores the potential of human neural progenitor cell (hNPC) derived factors to slow the degenerative processes in adult porcine retinal explants. Retinas were cultured for 3 days with or without hNPCs as a feeder layer and investigated by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), immunohistochemical, western blot and quantitative real time-polymerase chain reaction (qRT-PCR) techniques. TUNEL showed that hNPCs had the capacity to limit photoreceptor cell death. Among cone photoreceptors, hNPC coculture resulted in better maintenance of cone outer segments and reduced opsin mislocalization. Additionally, maintained synaptic structural integrity and preservation of second order calbindin positive horizontal cells was also observed. However, Müller cell gliosis only seemed to be alleviated in terms of reduced Müller cell density. Our observations indicate that at 3 days of coculture, hNPC derived factors had the capacity to protect photoreceptors, maintain synaptic integrity and support horizontal cell survival. Human neural progenitor cell applied treatment modalities may be an effective strategy to help maintain retinal functionality in neurodegenerative pathologies. Whether hNPCs can independently hinder Müller cell gliosis by utilizing higher concentrations or by combination with other pharmacological agents still needs to be determined. Copyright © 2016 Elsevier B.V. All rights reserved.

Sexual dimorphism of short-wavelength photoreceptors in the small white butterfly, Pieris rapae crucivora

NARCIS (Netherlands)

Arikawa, K; Wakakuwa, M; Qiu, XD; Kurasawa, M; Stavenga, DG; Qiu, Xudong

2005-01-01

The eyes of the female small white butterfly, Pieris rapae crucivora, are furnished with three classes of short-wavelength photoreceptors, with sensitivity peaks in the ultraviolet (UV) (lambda(max) = 360 nm), violet (V) (lambda max = 425 nm), and blue (B) (lambda(max) = 453 nm) wavelength range.

Cadmium resistance in tobacco plants expressing the MuSI gene.

Science.gov (United States)

Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

2011-10-01

MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI transgenic tobacco plants absorbed less Cd than wild-type plants. Cd translocation from roots to shoots was reduced in the transgenic plants, thereby avoiding Cd toxicity. The number of short trichomes in the leaves of wild-type tobacco plants was increased by Cd treatment, while this was unchanged in MuSI transgenic tobacco. These results suggest that MuSI transgenic tobacco plants have enhanced tolerance to Cd via reduced Cd uptake and/or increased Cd immobilization in the roots, resulting in less Cd translocation to the shoots.

Massive lateral transfer of genes encoding plant cell wall-degrading enzymes to the mycoparasitic fungus Trichoderma from its plant-associated hosts

Science.gov (United States)

Chenthamara, Komal; Zhang, Jian; Atanasova, Lea; Yang, Dongqing; Miao, Youzhi; Grujic, Marica; Pourmehdi, Shadi; Pretzer, Carina; Kopchinskiy, Alexey G.; Hundley, Hope; Wang, Mei; Aerts, Andrea; Salamov, Asaf; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V.; Shen, Qirong; Kubicek, Christian P.

2018-01-01

Unlike most other fungi, molds of the genus Trichoderma (Hypocreales, Ascomycota) are aggressive parasites of other fungi and efficient decomposers of plant biomass. Although nutritional shifts are common among hypocrealean fungi, there are no examples of such broad substrate versatility as that observed in Trichoderma. A phylogenomic analysis of 23 hypocrealean fungi (including nine Trichoderma spp. and the related Escovopsis weberi) revealed that the genus Trichoderma has evolved from an ancestor with limited cellulolytic capability that fed on either fungi or arthropods. The evolutionary analysis of Trichoderma genes encoding plant cell wall-degrading carbohydrate-active enzymes and auxiliary proteins (pcwdCAZome, 122 gene families) based on a gene tree / species tree reconciliation demonstrated that the formation of the genus was accompanied by an unprecedented extent of lateral gene transfer (LGT). Nearly one-half of the genes in Trichoderma pcwdCAZome (41%) were obtained via LGT from plant-associated filamentous fungi belonging to different classes of Ascomycota, while no LGT was observed from other potential donors. In addition to the ability to feed on unrelated fungi (such as Basidiomycota), we also showed that Trichoderma is capable of endoparasitism on a broad range of Ascomycota, including extant LGT donors. This phenomenon was not observed in E. weberi and rarely in other mycoparasitic hypocrealean fungi. Thus, our study suggests that LGT is linked to the ability of Trichoderma to parasitize taxonomically related fungi (up to adelphoparasitism in strict sense). This may have allowed primarily mycotrophic Trichoderma fungi to evolve into decomposers of plant biomass. PMID:29630596

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Photoreceptor spectral sensitivities of the Small White butterfly Pieris rapae crucivora interpreted with optical modeling

NARCIS (Netherlands)

Stavenga, Doekele G.; Arikawa, Kentaro

The compound eye of the Small White butterfly, Pieris rapae crucivora, has four classes of visual pigments, with peak absorption in the ultraviolet, violet, blue and green, but electrophysiological recordings yielded eight photoreceptors classes: an ultraviolet, violet, blue, double-peaked blue,

Zebrafish Lacking Circadian Gene per2 Exhibit Visual Function Deficiency

Directory of Open Access Journals (Sweden)

Deng-feng Huang

2018-03-01

Full Text Available The retina has an intrinsic circadian clock, but the importance of this clock for vision is unknown. Zebrafish offer many advantages for studying vertebrate vision and circadian rhythm. Here, we explored the role of zebrafish per2, a light-regulated gene, in visual behavior and the underlying mechanisms. We observed that per2 mutant zebrafish larvae showed decreased contrast sensitivity and visual acuity using optokinetic response (OKR assays. Using a visual motor response (VMR assay, we observed normal OFF responses but abnormal ON responses in mutant zebrafish larvae. Immunofluorescence showed that mutants had a normal morphology of cone photoreceptor cells and retinal organization. However, electron microscopy showed that per2 mutants displayed abnormal and decreased photoreceptor ribbon synapses with arciform density, which resulted in retinal ON pathway defect. We also examined the expression of three cone opsins by quantitative real-time PCR (qRT-PCR, and the expression of long-wave-sensitive opsin (opn1lw and short-wave-sensitive opsin (opn1sw was reduced in mutant zebrafish larvae. qRT-PCR analyses also showed a down-regulation of the clock genes cry1ba and bmal1b in the adult eye of per2 mutant zebrafish. This study identified a mechanism by which a clock gene affects visual function and defined important roles of per2 in retinal information processing.

Plant nodulation inducers enhance horizontal gene transfer of Azorhizobium caulinodans symbiosis island.

Science.gov (United States)

Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun

2016-11-29

Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.

Photoperiodic regulation of the sucrose transporter StSUT4 affects the expression of circadian-regulated genes and ethylene production

Directory of Open Access Journals (Sweden)

Izabela eChincinska

2013-02-01

Full Text Available Several recent publications report different subcellular localisation of members of the SUT4 subfamily of sucrose transporters. The physiological function of SUT4 sucrose transporters is still not entirely clarified as down-regulation of members of the SUT4 clade had very different effects in rice, poplar and potato. Here, we provide new data on the localization and function of the Solanaceous StSUT4 protein, further elucidating involvement in the onset of flowering, tuberization and in the shade avoidance syndrome of potato plants.Induction of early flowering and tuberization in SUT4-inhibited potato plants correlates with increased sucrose export from leaves and increased sucrose and starch accumulation in terminal sink organs such as developing tubers. SUT4 does not only affect the expression of gibberellin and ethylene biosynthetic enzymes, but also the rate of ethylene synthesis in potato. In SUT4-inhibited plants, the ethylene production no longer follows a diurnal rhythm, leading to the assumption that StSUT4 controls circadian gene expression, potentially by regulating sucrose export from leaves. Furthermore, SUT4 expression affects clock-regulated genes such as StFT, StSOC1 and StCO, which might also be involved in a photoperiod-dependently controlled tuberization. A model is proposed in which StSUT4 controls a phloem-mobile signalling molecule generated in leaves which together with enhanced sucrose export affects developmental switches in apical meristems. SUT4 seems to link photoreceptor-perceived information about the light quality and day length, with phytohormone biosynthesis and the expression of circadian genes.

Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.

Directory of Open Access Journals (Sweden)

Kazuhiro Hayashi

Full Text Available Coenzyme Q (CoQ is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9 that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.

A contribution to the study of plant development evolution based on gene co-expression networks

Directory of Open Access Journals (Sweden)

Francisco J. Romero-Campero

2013-08-01

Full Text Available Phototrophic eukaryotes are among the most successful organisms on Earth due to their unparalleled efficiency at capturing light energy and fixing carbon dioxide to produce organic molecules. A conserved and efficient network of light-dependent regulatory modules could be at the bases of this success. This regulatory system conferred early advantages to phototrophic eukaryotes that allowed for specialization, complex developmental processes and modern plant characteristics. We have studied light-dependent gene regulatory modules from algae to plants employing integrative-omics approaches based on gene co-expression networks. Our study reveals some remarkably conserved ways in which eukaryotic phototrophs deal with day length and light signaling. Here we describe how a family of Arabidopsis transcription factors involved in photoperiod response has evolved from a single algal gene according to the innovation, amplification and divergence theory of gene evolution by duplication. These modifications of the gene co-expression networks from the ancient unicellular green algae Chlamydomonas reinhardtii to the modern brassica Arabidopsis thaliana may hint on the evolution and specialization of plants and other organisms.

Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

Science.gov (United States)

Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

2013-01-01

As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

From Plant Infectivity to Growth Patterns: The Role of Blue-Light Sensing in the Prokaryotic World

Directory of Open Access Journals (Sweden)

Aba Losi

2014-01-01

Full Text Available Flavin-based photoreceptor proteins of the LOV (Light, Oxygen, and Voltage and BLUF (Blue Light sensing Using Flavins superfamilies are ubiquitous among the three life domains and are essential blue-light sensing systems, not only in plants and algae, but also in prokaryotes. Here we review their biological roles in the prokaryotic world and their evolution pathways. An unexpected large number of bacterial species possess flavin-based photosensors, amongst which are important human and plant pathogens. Still, few cases are reported where the activity of blue-light sensors could be correlated to infectivity and/or has been shown to be involved in the activation of specific genes, resulting in selective growth patterns. Metagenomics and bio-informatic analysis have only recently been initiated, but signatures are beginning to emerge that allow definition of a bona fide LOV or BLUF domain, aiming at better selection criteria for novel blue-light sensors. We also present here, for the first time, the phylogenetic tree for archaeal LOV domains that have reached a statistically significant number but have not at all been investigated thus far.

The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.

Science.gov (United States)

Masle, Josette; Gilmore, Scott R; Farquhar, Graham D

2005-08-11

Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.

Planting increases the abundance and structure complexity of soil core functional genes relevant to carbon and nitrogen cycling.

Science.gov (United States)

Wang, Feng; Liang, Yuting; Jiang, Yuji; Yang, Yunfeng; Xue, Kai; Xiong, Jinbo; Zhou, Jizhong; Sun, Bo

2015-09-23

Plants have an important impact on soil microbial communities and their functions. However, how plants determine the microbial composition and network interactions is still poorly understood. During a four-year field experiment, we investigated the functional gene composition of three types of soils (Phaeozem, Cambisols and Acrisol) under maize planting and bare fallow regimes located in cold temperate, warm temperate and subtropical regions, respectively. The core genes were identified using high-throughput functional gene microarray (GeoChip 3.0), and functional molecular ecological networks (fMENs) were subsequently developed with the random matrix theory (RMT)-based conceptual framework. Our results demonstrated that planting significantly (P soils and 83.5% of microbial alpha-diversity can be explained by the plant factor. Moreover, planting had significant impacts on the microbial community structure and the network interactions of the microbial communities. The calculated network complexity was higher under maize planting than under bare fallow regimes. The increase of the functional genes led to an increase in both soil respiration and nitrification potential with maize planting, indicating that changes in the soil microbial communities and network interactions influenced ecological functioning.

Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants

Energy Technology Data Exchange (ETDEWEB)

Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))

1991-10-01

Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.

Correlated evolution of short wavelength sensitive photoreceptor sensitivity and color pattern in Lake Malawi cichlids

Directory of Open Access Journals (Sweden)

Michael J. Pauers

2016-02-01

Full Text Available For evolutionary ecologists, the holy grail of visual ecology is to establish an unambiguous link between photoreceptor sensitivity, the spectral environment, and the perception of specific visual stimuli (e.g., mates, food, predators, etc.. Due to the bright nuptial colors of the males, and the role female mate choice plays in their evolution, the haplochromine cichlid fishes of the African great lakes are favorite research subjects for such investigations. Despite this attention, current evidence is equivocal; while distinct correlations among photoreceptor sensitivity, photic environment, and male coloration exist in Lake Victorian haplochromines, attempts to find such correlations in Lake Malawian cichlids have failed. Lake Malawi haplochromines have a wide variability in their short-wavelength-sensitive photoreceptors, especially compared to their mid- and long-wavelength-sensitive photoreceptors; these cichlids also vary in the degree to which they express one of three basic color patterns (vertical bars, horizontal stripes, and solid patches of colors, each of which is likely used in a different form of communication. Thus, we hypothesize that, in these fishes, spectral sensitivity and color pattern have evolved in a correlated fashion to maximize visual communication; specifically, ultraviolet sensitivity should be found in vertically-barred species to promote ‘private’ communication, while striped species should be less likely to have ultraviolet sensitivity, since their color pattern carries ‘public’ information. Using phylogenetic independent contrasts, we found that barred species had strong sensitivity to ultraviolet wavelengths, but that striped species typically lacked sensitivity to ultraviolet light. Further, the only variable, even when environmental variables were simultaneously considered, that could predict ultraviolet sensitivity was color pattern. We also found that, using models of correlated evolution, color

Arabidopsis Vacuolar Pyrophosphatase gene (AVP1) induces drought and salt tolerance in Nicotiana tabacum plants (abstract)

International Nuclear Information System (INIS)

Arif, A.; Mohsin, A.M.; Shafiq, S.; Zafar, Y.; Hameed, S.M.; Arif, M.; Javed, M.; Gaxiola, R.A.

2005-01-01

Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na

Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

Science.gov (United States)

Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

2009-02-01

Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

Plant gene bank and vegetable varieties biodiversity in Smederevska Palanka

Directory of Open Access Journals (Sweden)

Pavlović Nenad

2011-01-01

Full Text Available Biodiversity protection and preservation of genetic variability is based on the fact that plant varieties are irreplaceable in production process and that they are more and more jeopardized by urban and industrial development. The most common way of preserving and at the same time the safest way is a storage in a gene bank. Prior to storage comes collecting, studying and replanting for Institute Gene Bank, Central State Gene Bank and for Regional Gene Banks. Institute for Vegetable Crops in Smederevska Palanka preserves a wide variety of vegetable germplasm. This is, so called, work collection, used as a gene resource for breeding purposes. Seed samples are stored at 4±2°C and 50% relative humidity. At the moment, the collection has 2265 samples. Almost all samples have the passport data, but only 10% of samples have been further characterized and evaluated.

The ALMT Gene Family Performs Multiple Functions in Plants

Directory of Open Access Journals (Sweden)

Jie Liu

2018-02-01