WorldWideScience

Sample records for plant photoreceptor genes

  1. Gibberellin and auxin influence the diurnal transcription pattern of photoreceptor genes via CRY1a in tomato.

    Directory of Open Access Journals (Sweden)

    Paolo Facella

    Full Text Available Plant photoreceptors, phytochromes and cryptochromes, regulate many aspects of development and growth, such as seed germination, stem elongation, seedling de-etiolation, cotyledon opening, flower induction and circadian rhythms. There are several pieces of evidence of interaction between photoreceptors and phyto-hormones in all of these physiological processes, but little is known about molecular and genetic mechanisms underlying hormone-photoreceptor crosstalk.In this work, we investigated the molecular effects of exogenous phyto-hormones to photoreceptor gene transcripts of tomato wt, as well as transgenic and mutant lines with altered cryptochromes, by monitoring day/night transcript oscillations. GA and auxin alter the diurnal expression level of different photoreceptor genes in tomato, especially in mutants that lack a working form of cryptochrome 1a: in those mutants the expression of some (IAA or most (GA photoreceptor genes is down regulated by these hormones.Our results highlight the presence of molecular relationships among cryptochrome 1a protein, hormones, and photoreceptors' gene expression in tomato, suggesting that manipulation of cryptochromes could represent a good strategy to understand in greater depth the role of phyto-hormones in the plant photoperceptive mechanism.

  2. Efficient photoreceptor-targeted gene expression in vivo by recombinant adeno-associated virus.

    Science.gov (United States)

    Flannery, J G; Zolotukhin, S; Vaquero, M I; LaVail, M M; Muzyczka, N; Hauswirth, W W

    1997-06-24

    We describe a general approach for achieving efficient and cell type-specific expression of exogenous genes in photoreceptor cells of the mammalian retina. Recombinant adeno-associated virus (rAAV) vectors were used to transfer the bacterial lacZ gene or a synthetic green fluorescent protein gene (gfp) to mouse or rat retinas after injection into the subretinal space. Using a proximal murine rod opsin promoter (+86 to -385) to drive expression, reporter gene product was found exclusively in photoreceptors, not in any other retinal cell type or in the adjacent retinal pigment epithelium. GFP-expressing photoreceptors typically encompassed 10-20% of the total retinal area after a single 2-microl injection. Photoreceptors were transduced with nearly 100% efficiency in the region directly surrounding the injection site. We estimate approximately 2.5 million photoreceptors were transduced as a result of the single subretinal inoculation. This level of gene transfer and expression suggests the feasibility of genetic therapy for retinal disease. The gfp-containing rAAV stock was substantially free of both adenovirus and wild-type AAV, as judged by plaque assay and infectious center assay, respectively. Thus, highly purified, helper virus-free rAAV vectors can achieve high-frequency tissue-specific transduction of terminally differentiated, postmitotic photoreceptor cells.

  3. Intraocular gene transfer of ciliary neurotrophic factor rescues photoreceptor degeneration in RCS rats.

    Science.gov (United States)

    Huang, Shun-Ping; Lin, Po-Kang; Liu, Jorn-Hon; Khor, Chin-Ni; Lee, Yih-Jing

    2004-01-01

    Ciliary neurotrophic factor (CNTF) is known as an important factor in the regulation of retinal cell growth. We used both recombinant CNTF and an adenovirus carrying the CNTF gene to regulate retinal photoreceptor expression in a retinal degenerative animal, Royal College of Surgeons (RCS) rats. Cells in the outer nuclear layer of the retinae from recombinant-CNTF-treated, adenoviral-CNTF-treated, saline-operated, and contralateral untreated preparations were examined for those exhibiting CNTF photoreceptor protective effects. Cell apoptosis in the outer nuclear layer of the retinae was also detected. It was found that CNTF had a potent effect on delaying the photoreceptor degeneration process in RCS rats. Furthermore, adenovirus CNTF gene transfer was proven to be better at rescuing photoreceptors than that when using recombinant CNTF, since adenoviral CNTF prolonged the photoreceptor protection effect. The function of the photoreceptors was also examined by taking electroretinograms of different animals. Adenoviral-CNTF-treated eyes showed better retinal function than did the contralateral control eyes. This study indicates that adenoviral CNTF effectively rescues degenerating photoreceptors in RCS rats. Copyright 2004 National Science Council, ROC and S. Karger AG, Basel

  4. Machine learning approaches to supporting the identification of photoreceptor-enriched genes based on expression data

    Directory of Open Access Journals (Sweden)

    Simpson David

    2006-03-01

    Full Text Available Abstract Background Retinal photoreceptors are highly specialised cells, which detect light and are central to mammalian vision. Many retinal diseases occur as a result of inherited dysfunction of the rod and cone photoreceptor cells. Development and maintenance of photoreceptors requires appropriate regulation of the many genes specifically or highly expressed in these cells. Over the last decades, different experimental approaches have been developed to identify photoreceptor enriched genes. Recent progress in RNA analysis technology has generated large amounts of gene expression data relevant to retinal development. This paper assesses a machine learning methodology for supporting the identification of photoreceptor enriched genes based on expression data. Results Based on the analysis of publicly-available gene expression data from the developing mouse retina generated by serial analysis of gene expression (SAGE, this paper presents a predictive methodology comprising several in silico models for detecting key complex features and relationships encoded in the data, which may be useful to distinguish genes in terms of their functional roles. In order to understand temporal patterns of photoreceptor gene expression during retinal development, a two-way cluster analysis was firstly performed. By clustering SAGE libraries, a hierarchical tree reflecting relationships between developmental stages was obtained. By clustering SAGE tags, a more comprehensive expression profile for photoreceptor cells was revealed. To demonstrate the usefulness of machine learning-based models in predicting functional associations from the SAGE data, three supervised classification models were compared. The results indicated that a relatively simple instance-based model (KStar model performed significantly better than relatively more complex algorithms, e.g. neural networks. To deal with the problem of functional class imbalance occurring in the dataset, two data re

  5. Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes

    OpenAIRE

    Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

    2012-01-01

    The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of ...

  6. Photoreceptor dysplasia (pd) in miniature schnauzer dogs: evaluation of candidate genes by molecular genetic analysis.

    Science.gov (United States)

    Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K

    1999-01-01

    Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.

  7. Unravelling the molecular basis for light modulated cellulase gene expression - the role of photoreceptors in Neurospora crassa

    Science.gov (United States)

    2012-01-01

    Background Light represents an important environmental cue, which exerts considerable influence on the metabolism of fungi. Studies with the biotechnological fungal workhorse Trichoderma reesei (Hypocrea jecorina) have revealed an interconnection between transcriptional regulation of cellulolytic enzymes and the light response. Neurospora crassa has been used as a model organism to study light and circadian rhythm biology. We therefore investigated whether light also regulates transcriptional regulation of cellulolytic enzymes in N. crassa. Results We show that the N. crassa photoreceptor genes wc-1, wc-2 and vvd are involved in regulation of cellulase gene expression, indicating that this phenomenon is conserved among filamentous fungi. The negative effect of VVD on production of cellulolytic enzymes is thereby accomplished by its role in photoadaptation and hence its function in White collar complex (WCC) formation. In contrast, the induction of vvd expression by the WCC does not seem to be crucial in this process. Additionally, we found that WC-1 and WC-2 not only act as a complex, but also have individual functions upon growth on cellulose. Conclusions Genome wide transcriptome analysis of photoreceptor mutants and evaluation of results by analysis of mutant strains identified several candidate genes likely to play a role in light modulated cellulase gene expression. Genes with functions in amino acid metabolism, glycogen metabolism, energy supply and protein folding are enriched among genes with decreased expression levels in the wc-1 and wc-2 mutants. The ability to properly respond to amino acid starvation, i. e. up-regulation of the cross pathway control protein cpc-1, was found to be beneficial for cellulase gene expression. Our results further suggest a contribution of oxidative depolymerization of cellulose to plant cell wall degradation in N. crassa. PMID:22462823

  8. Global gene expression analysis in a mouse model for Norrie disease: late involvement of photoreceptor cells.

    Science.gov (United States)

    Lenzner, Steffen; Prietz, Sandra; Feil, Silke; Nuber, Ulrike A; Ropers, H-Hilger; Berger, Wolfgang

    2002-09-01

    Mutations in the NDP gene give rise to a variety of eye diseases, including classic Norrie disease (ND), X-linked exudative vitreoretinopathy (EVRX), retinal telangiectasis (Coats disease), and advanced retinopathy of prematurity (ROP). The gene product is a cystine-knot-containing extracellular signaling molecule of unknown function. In the current study, gene expression was determined in a mouse model of ND, to unravel disease-associated mechanisms at the molecular level. Gene transcription in the eyes of 2-year-old Ndp knockout mice was compared with that in the eyes of age-matched wild-type control animals, by means of cDNA subtraction and microarrays. Clones (n = 3072) from the cDNA subtraction libraries were spotted onto glass slides and hybridized with fluorescently labeled RNA-derived targets. More than 230 differentially expressed clones were sequenced, and their expression patterns were verified by virtual Northern blot analysis. Numerous gene transcripts that are absent or downregulated in the eye of Ndp knockout mice are photoreceptor cell specific. In younger Ndp knockout mice (up to 1 year old), however, all these transcripts were found to be expressed at normal levels. The identification of numerous photoreceptor cell-specific transcripts with a reduced expression in 2-year-old, but not in young, Ndp knockout mice indicates that normal gene expression in these light-sensitive cells of mutant mice is established and maintained over a long period and that rods and cones are affected relatively late in the mouse model of ND. Obviously, the absence of the Ndp gene product is not compatible with long-term survival of photoreceptor cells in the mouse.

  9. Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes.

    Science.gov (United States)

    Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

    2012-07-01

    The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression.

  10. Shifts in Selective Pressures on Snake Phototransduction Genes Associated with Photoreceptor Transmutation and Dim-Light Ancestry.

    Science.gov (United States)

    Schott, Ryan K; Van Nynatten, Alexander; Card, Daren C; Castoe, Todd A; S W Chang, Belinda

    2018-06-01

    The visual systems of snakes are heavily modified relative to other squamates, a condition often thought to reflect their fossorial origins. Further modifications are seen in caenophidian snakes, where evolutionary transitions between rod and cone photoreceptors, termed photoreceptor transmutations, have occurred in many lineages. Little previous work, however, has focused on the molecular evolutionary underpinnings of these morphological changes. To address this, we sequenced seven snake eye transcriptomes and utilized new whole-genome and targeted capture sequencing data. We used these data to analyze gene loss and shifts in selection pressures in phototransduction genes that may be associated with snake evolutionary origins and photoreceptor transmutation. We identified the surprising loss of rhodopsin kinase (GRK1), despite a low degree of gene loss overall and a lack of relaxed selection early during snake evolution. These results provide some of the first evolutionary genomic corroboration for a dim-light ancestor that lacks strong fossorial adaptations. Our results also indicate that snakes with photoreceptor transmutation experienced significantly different selection pressures from other reptiles. Significant positive selection was found primarily in cone-specific genes, but not rod-specific genes, contrary to our expectations. These results reveal potential molecular adaptations associated with photoreceptor transmutation and also highlight unappreciated functional differences between rod- and cone-specific phototransduction proteins. This intriguing example of snake visual system evolution illustrates how the underlying molecular components of a complex system can be reshaped in response to changing selection pressures.

  11. Photocycle of the flavin-binding photoreceptor AppA, a bacterial transcriptional antirepressor of photosynthesis genes

    NARCIS (Netherlands)

    Gauden, M.L.; Yeremenko, S.; Laan, W.; van Stokkum, I.H.M.; Ihalainen, J.A.; van Grondelle, R.; Hellingwerf, K.J.; Kennis, J.T.M.

    2005-01-01

    The flavoprotein AppA from Rhodobacter sphaeroides contains an N-terminal domain belonging to a new class of photoreceptors designated BLUF domains. AppA was shown to control photosynthesis gene expression in response to blue light and oxygen tension. We have investigated the photocycle of the AppA

  12. Multiple rod–cone and cone–rod photoreceptor transmutations in snakes: Evidence from visual opsin gene expression

    Science.gov (United States)

    Simoe, Bruno F; Sampaio, Filipa L.; Loew, Ellis R.; Sanders, Kate L.; Fisher, Robert N.; Hart, Nathan S.; Hunt, David M.; Partridge, Julian C.; Gower, David J.

    2016-01-01

    In 1934, Gordon Walls forwarded his radical theory of retinal photoreceptor ‘transmutation’. This proposed that rods and cones used for scotopic and photopic vision, respectively, were not fixed but could evolve into each other via a series of morphologically distinguishable intermediates. Walls' prime evidence came from series of diurnal and nocturnal geckos and snakes that appeared to have pure-cone or pure-rod retinas (in forms that Walls believed evolved from ancestors with the reverse complement) or which possessed intermediate photoreceptor cells. Walls was limited in testing his theory because the precise identity of visual pigments present in photoreceptors was then unknown. Subsequent molecular research has hitherto neglected this topic but presents new opportunities. We identify three visual opsin genes, rh1, sws1 and lws, in retinal mRNA of an ecologically and taxonomically diverse sample of snakes central to Walls' theory. We conclude that photoreceptors with superficially rod- or cone-like morphology are not limited to containing scotopic or photopic opsins, respectively. Walls' theory is essentially correct, and more research is needed to identify the patterns, processes and functional implications of transmutation. Future research will help to clarify the fundamental properties and physiology of photoreceptors adapted to function in different light levels.

  13. Gene Correction Reverses Ciliopathy and Photoreceptor Loss in iPSC-Derived Retinal Organoids from Retinitis Pigmentosa Patients

    Directory of Open Access Journals (Sweden)

    Wen-Li Deng

    2018-04-01

    Full Text Available Summary: Retinitis pigmentosa (RP is an irreversible, inherited retinopathy in which early-onset nyctalopia is observed. Despite the genetic heterogeneity of RP, RPGR mutations are the most common causes of this disease. Here, we generated induced pluripotent stem cells (iPSCs from three RP patients with different frameshift mutations in the RPGR gene, which were then differentiated into retinal pigment epithelium (RPE cells and well-structured retinal organoids possessing electrophysiological properties. We observed significant defects in photoreceptor in terms of morphology, localization, transcriptional profiling, and electrophysiological activity. Furthermore, shorted cilium was found in patient iPSCs, RPE cells, and three-dimensional retinal organoids. CRISPR-Cas9-mediated correction of RPGR mutation rescued photoreceptor structure and electrophysiological property, reversed the observed ciliopathy, and restored gene expression to a level in accordance with that in the control using transcriptome-based analysis. This study recapitulated the pathogenesis of RPGR using patient-specific organoids and achieved targeted gene therapy of RPGR mutations in a dish as proof-of-concept evidence. : Jin and colleagues demonstrate that patient-specific iPSC-derived 3D retinae can recapitulate disease progress of retinitis pigmentosa through presenting defects in photoreceptor morphology, gene profile, and electrophysiology, as well as the defective ciliogenesis in iPSCs, iPSC-RPE, and 3D retinae. CRISPR/Cas9-mediated gene correction can rescue not only photoreceptor structure and electrophysiological property but also observed ciliopathy. Keywords: RPGR, photoreceptor, electrophysiology, retinitis pigmentosa, patient-derived iPSCs, retinal organoid, RPE cells, cilium, ciliopathy, disease modeling

  14. Analysis of transcriptional regulatory pathways of photoreceptor genes by expression profiling of the Otx2-deficient retina.

    Science.gov (United States)

    Omori, Yoshihiro; Katoh, Kimiko; Sato, Shigeru; Muranishi, Yuki; Chaya, Taro; Onishi, Akishi; Minami, Takashi; Fujikado, Takashi; Furukawa, Takahisa

    2011-01-01

    In the vertebrate retina, the Otx2 transcription factor plays a crucial role in the cell fate determination of both rod and cone photoreceptors. We previously reported that Otx2 conditional knockout (CKO) mice exhibited a total absence of rods and cones in the retina due to their cell fate conversion to amacrine-like cells. In order to investigate the entire transcriptome of the Otx2 CKO retina, we compared expression profile of Otx2 CKO and wild-type retinas at P1 and P12 using microarray. We observed that expression of 101- and 1049-probe sets significantly decreased in the Otx2 CKO retina at P1 and P12, respectively, whereas, expression of 3- and 4149-probe sets increased at P1 and P12, respectively. We found that expression of genes encoding transcription factors involved in photoreceptor development, including Crx, Nrl, Nr2e3, Esrrb, and NeuroD, was markedly down-regulated in the Otx2 CKO at both P1 and P12. Furthermore, we identified three human retinal disease loci mapped in close proximity to certain down-regulated genes in the Otx2 CKO retina including Ccdc126, Tnfsf13 and Pitpnm1, suggesting that these genes are possibly responsible for these diseases. These transcriptome data sets of the Otx2 CKO retina provide a resource on developing rods and cones to further understand the molecular mechanisms underlying photoreceptor development, function and disease.

  15. Analysis of transcriptional regulatory pathways of photoreceptor genes by expression profiling of the Otx2-deficient retina.

    Directory of Open Access Journals (Sweden)

    Yoshihiro Omori

    Full Text Available In the vertebrate retina, the Otx2 transcription factor plays a crucial role in the cell fate determination of both rod and cone photoreceptors. We previously reported that Otx2 conditional knockout (CKO mice exhibited a total absence of rods and cones in the retina due to their cell fate conversion to amacrine-like cells. In order to investigate the entire transcriptome of the Otx2 CKO retina, we compared expression profile of Otx2 CKO and wild-type retinas at P1 and P12 using microarray. We observed that expression of 101- and 1049-probe sets significantly decreased in the Otx2 CKO retina at P1 and P12, respectively, whereas, expression of 3- and 4149-probe sets increased at P1 and P12, respectively. We found that expression of genes encoding transcription factors involved in photoreceptor development, including Crx, Nrl, Nr2e3, Esrrb, and NeuroD, was markedly down-regulated in the Otx2 CKO at both P1 and P12. Furthermore, we identified three human retinal disease loci mapped in close proximity to certain down-regulated genes in the Otx2 CKO retina including Ccdc126, Tnfsf13 and Pitpnm1, suggesting that these genes are possibly responsible for these diseases. These transcriptome data sets of the Otx2 CKO retina provide a resource on developing rods and cones to further understand the molecular mechanisms underlying photoreceptor development, function and disease.

  16. UV-B Perceived by the UVR8 Photoreceptor Inhibits Plant Thermomorphogenesis.

    Science.gov (United States)

    Hayes, Scott; Sharma, Ashutosh; Fraser, Donald P; Trevisan, Martine; Cragg-Barber, C Kester; Tavridou, Eleni; Fankhauser, Christian; Jenkins, Gareth I; Franklin, Keara A

    2017-01-09

    Small increases in ambient temperature can elicit striking effects on plant architecture, collectively termed thermomorphogenesis [1]. In Arabidopsis thaliana, these include marked stem elongation and leaf elevation, responses that have been predicted to enhance leaf cooling [2-5]. Thermomorphogenesis requires increased auxin biosynthesis, mediated by the bHLH transcription factor PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) [6-8], and enhanced stability of the auxin co-receptor TIR1, involving HEAT SHOCK PROTEIN 90 (HSP90) [9]. High-temperature-mediated hypocotyl elongation additionally involves localized changes in auxin metabolism, mediated by the indole-3-acetic acid (IAA)-amido synthetase Gretchen Hagen 3 (GH3).17 [10]. Here we show that ultraviolet-B light (UV-B) perceived by the photoreceptor UV RESISTANCE LOCUS 8 (UVR8) [11] strongly attenuates thermomorphogenesis via multiple mechanisms inhibiting PIF4 activity. Suppression of thermomorphogenesis involves UVR8 and CONSTITUTIVELY PHOTOMORPHOGENIC 1 (COP1)-mediated repression of PIF4 transcript accumulation, reducing PIF4 abundance. UV-B also stabilizes the bHLH protein LONG HYPOCOTYL IN FAR RED (HFR1), which can bind to and inhibit PIF4 function. Collectively, our results demonstrate complex crosstalk between UV-B and high-temperature signaling. As plants grown in sunlight would most likely experience concomitant elevations in UV-B and ambient temperature, elucidating how these pathways are integrated is of key importance to the understanding of plant development in natural environments. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Knock-in strategy at 3'-end of Crx gene by CRISPR/Cas9 system shows the gene expression profiles during human photoreceptor differentiation.

    Science.gov (United States)

    Homma, Kohei; Usui, Sumiko; Kaneda, Makoto

    2017-03-01

    Fluorescent reporter gene knock-in induced pluripotent stem cell (iPSC) lines have been used to evaluate the efficiency of differentiation into specific cell lineages. Here, we report a knock-in strategy for the generation of human iPSC reporter lines in which a 2A peptide sequence and a red fluorescent protein (E2-Crimson) gene were inserted at the termination codon of the cone-rod homeobox (Crx) gene, a photoreceptor-specific transcriptional factor gene. The knock-in iPSC lines were differentiated into fluorescence-expressing cells in 3D retinal differentiation culture, and the fluorescent cells also expressed Crx specifically in the nucleus. We found that the fluorescence intensity was positively correlated with the expression levels of Crx mRNA and that fluorescent cells expressed rod photoreceptor-specific genes in the later stage of differentiation. Finally, we treated the fluorescent cells with DAPT, a Notch inhibitor, and found that DAPT-enhanced retinal differentiation was associated with up-regulation of Crx, Otx2 and NeuroD1, and down-regulation of Hes5 and Ngn2. These suggest that this knock-in strategy at the 3'-end of the target gene, combined with the 2A peptide linked to fluorescent proteins, offers a useful tool for labeling specific cell lineages or monitoring expression of any marker genes without affecting the function of the target gene. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  18. Localization and expression of clarin-1, the Clrn1 gene product, in auditory hair cells and photoreceptors

    Science.gov (United States)

    Zallocchi, Marisa; Meehan, Daniel T.; Delimont, Duane; Askew, Charles; Garrige, Suneetha; Gratton, Michael Anne; Rothermund-Franklin, Christie A.; Cosgrove, Dominic

    2009-01-01

    The Usher syndrome 3A (CLRN1) gene encodes clarin-1, which is a member of the tetraspanin family of transmembrane proteins. Although identified more than 6 years ago, little is known about its localization or function in the eye and ear. We developed a polyclonal antibody that react with all clarin-1 isoforms and used it to characterize protein expression in cochlea and retina. In the cochlea, we observe clarin-1expression in the stereocilia of P0 mice, and in synaptic terminals present at the base of the auditory hair cells from E18 to P6. In the retina, clarin-1 localizes to the connecting cilia, inner segment of photoreceptors and to the ribbon synapses. RT-PCR from P0 cochlea and P28 retina show mRNAs encoding only isoforms 2 and 3. Western-blots show that only isoform 2 is present in protein extracts from these same tissues. We examined clarin-1 expression in the immortomouse-derived hair cell line UB/OC-1. Only isoform 2 is expressed in UB/OC-1 at both mRNA and protein levels, suggesting this isoform is biologically relevant to hair cell function. The protein co-localizes with microtubules and post-transgolgi vesicles. The sub-cellular localization of clarin-1 in hair cells and photoreceptors suggests it functions at both the basal and apical poles of neurosensoriepithelia. PMID:19539019

  19. Abrupt onset of mutations in a developmentally regulated gene during terminal differentiation of post-mitotic photoreceptor neurons in mice.

    Directory of Open Access Journals (Sweden)

    Ivette M Sandoval

    Full Text Available For sensitive detection of rare gene repair events in terminally differentiated photoreceptors, we generated a knockin mouse model by replacing one mouse rhodopsin allele with a form of the human rhodopsin gene that causes a severe, early-onset form of retinitis pigmentosa. The human gene contains a premature stop codon at position 344 (Q344X, cDNA encoding the enhanced green fluorescent protein (EGFP at its 3' end, and a modified 5' untranslated region to reduce translation rate so that the mutant protein does not induce retinal degeneration. Mutations that eliminate the stop codon express a human rhodopsin-EGFP fusion protein (hRho-GFP, which can be readily detected by fluorescence microscopy. Spontaneous mutations were observed at a frequency of about one per retina; in every case, they gave rise to single fluorescent rod cells, indicating that each mutation occurred during or after the last mitotic division. Additionally, the number of fluorescent rods did not increase with age, suggesting that the rhodopsin gene in mature rod cells is less sensitive to mutation than it is in developing rods. Thus, there is a brief developmental window, coinciding with the transcriptional activation of the rhodopsin locus, in which somatic mutations of the rhodopsin gene abruptly begin to appear.

  20. UV-B Perceived by the UVR8 Photoreceptor Inhibits Plant Thermomorphogenesis

    NARCIS (Netherlands)

    Hayes, S.; Sharma, Ashutosh; Fraser, Donald P.; Trevisan, Martine; Cragg-Barber, C. Kester; Tavridou, Eleni; Fankhauser, Christian; Jenkins, Gareth I.; Franklin, Kerry

    2017-01-01

    Small increases in ambient temperature can elicit striking effects on plant architecture, collectively termed thermomorphogenesis. In Arabidopsis thaliana, these include marked stem elongation and leaf elevation, responses that have been predicted to enhance leaf cooling. Thermomorphogenesis

  1. Hindsight regulates photoreceptor axon targeting through transcriptional control of jitterbug/Filamin and multiple genes involved in axon guidance in Drosophila.

    Science.gov (United States)

    Oliva, Carlos; Molina-Fernandez, Claudia; Maureira, Miguel; Candia, Noemi; López, Estefanía; Hassan, Bassem; Aerts, Stein; Cánovas, José; Olguín, Patricio; Sierralta, Jimena

    2015-09-01

    During axon targeting, a stereotyped pattern of connectivity is achieved by the integration of intrinsic genetic programs and the response to extrinsic long and short-range directional cues. How this coordination occurs is the subject of intense study. Transcription factors play a central role due to their ability to regulate the expression of multiple genes required to sense and respond to these cues during development. Here we show that the transcription factor HNT regulates layer-specific photoreceptor axon targeting in Drosophila through transcriptional control of jbug/Filamin and multiple genes involved in axon guidance and cytoskeleton organization.Using a microarray analysis we identified 235 genes whose expression levels were changed by HNT overexpression in the eye primordia. We analyzed nine candidate genes involved in cytoskeleton regulation and axon guidance, six of which displayed significantly altered gene expression levels in hnt mutant retinas. Functional analysis confirmed the role of OTK/PTK7 in photoreceptor axon targeting and uncovered Tiggrin, an integrin ligand, and Jbug/Filamin, a conserved actin- binding protein, as new factors that participate of photoreceptor axon targeting. Moreover, we provided in silico and molecular evidence that supports jbug/Filamin as a direct transcriptional target of HNT and that HNT acts partially through Jbug/Filamin in vivo to regulate axon guidance. Our work broadens the understanding of how HNT regulates the coordinated expression of a group of genes to achieve the correct connectivity pattern in the Drosophila visual system. © 2015 Wiley Periodicals, Inc. Develop Neurobiol 75: 1018-1032, 2015. © 2015 Wiley Periodicals, Inc.

  2. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

  3. Developmental and daily expression of the Pax4 and Pax6 homeobox genes in the rat retina: localization of Pax4 in photoreceptor cells

    DEFF Research Database (Denmark)

    Rath, Martin F; Bailey, Michael J; Kim, Jong-So

    2009-01-01

    Pax4 is a homeobox gene encoding Pax4, a transcription factor that is essential for embryonic development of the endocrine pancreas. In the pancreas, Pax4 counters the effects of the related transcription factor, Pax6, which is known to be essential for eye morphogenesis. In this study, we have...... in the foetal eye. Histological analysis revealed that Pax4 mRNA is exclusively expressed in the retinal photoreceptors, whereas Pax6 mRNA and protein are present in the inner nuclear layer and in the ganglion cell layer of the mature retina. In the adult retina, Pax4 transcripts exhibit a diurnal rhythm...

  4. Plant domestication and gene banks

    International Nuclear Information System (INIS)

    Perrino, P.

    1989-01-01

    At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs

  5. Chemically induced and light-independent cryptochrome photoreceptor activation.

    Science.gov (United States)

    Rosenfeldt, Gesa; Viana, Rafael Muñoz; Mootz, Henning D; von Arnim, Albrecht G; Batschauer, Alfred

    2008-01-01

    The cryptochrome photoreceptors of higher plants are dimeric proteins. Their N-terminal photosensory domain mediates dimerization, and the unique C-terminal extension (CCT) mediates signaling. We made use of the human FK506-binding protein (FKBP) that binds with high affinity to rapamycin or rapamycin analogs (rapalogs). The FKBP-rapamycin complex is recognized by another protein, FRB, thus allowing rapamycin-induced dimerization of two target proteins. Here we demonstrate by bioluminescence resonance energy transfer (BRET) assays the applicability of this regulated dimerization system to plants. Furthermore, we show that fusion proteins consisting of the C-terminal domain of Arabidopsis cryptochrome 2 fused to FKBP and FRB and coexpressed in Arabidopsis cells specifically induce the expression of cryptochrome-controlled reporter and endogenous genes in darkness upon incubation with the rapalog. These results demonstrate that the activation of cryptochrome signal transduction can be chemically induced in a dose-dependent fashion and uncoupled from the light signal, and provide the groundwork for gain-of-function experiments to study specifically the role of photoreceptors in darkness or in signaling cross-talk even under light conditions that activate members of all photoreceptor families.

  6. Dynamical adaptation in photoreceptors.

    Directory of Open Access Journals (Sweden)

    Damon A Clark

    Full Text Available Adaptation is at the heart of sensation and nowhere is it more salient than in early visual processing. Light adaptation in photoreceptors is doubly dynamical: it depends upon the temporal structure of the input and it affects the temporal structure of the response. We introduce a non-linear dynamical adaptation model of photoreceptors. It is simple enough that it can be solved exactly and simulated with ease; analytical and numerical approaches combined provide both intuition on the behavior of dynamical adaptation and quantitative results to be compared with data. Yet the model is rich enough to capture intricate phenomenology. First, we show that it reproduces the known phenomenology of light response and short-term adaptation. Second, we present new recordings and demonstrate that the model reproduces cone response with great precision. Third, we derive a number of predictions on the response of photoreceptors to sophisticated stimuli such as periodic inputs, various forms of flickering inputs, and natural inputs. In particular, we demonstrate that photoreceptors undergo rapid adaptation of response gain and time scale, over ∼ 300[Formula: see text] ms-i. e., over the time scale of the response itself-and we confirm this prediction with data. For natural inputs, this fast adaptation can modulate the response gain more than tenfold and is hence physiologically relevant.

  7. Diurnal and circadian rhythms in the tomato transcriptome and their modulation by cryptochrome photoreceptors.

    Directory of Open Access Journals (Sweden)

    Paolo Facella

    Full Text Available BACKGROUND: Circadian clocks are internal molecular time-keeping mechanisms that provide living organisms with the ability to adjust their growth and physiology and to anticipate diurnal environmental changes. Circadian clocks, without exception, respond to light and, in plants, light is the most potent and best characterized entraining stimulus. The capacity of plants to respond to light is achieved through a number of photo-perceptive proteins including cryptochromes and phytochromes. There is considerable experimental evidence demonstrating the roles of photoreceptors in providing light input to the clock. METHODOLOGY: In order to identify genes regulated by diurnal and circadian rhythms, and to establish possible functional relations between photoreceptors and the circadian clock in tomato, we monitored the temporal transcription pattern in plants entrained to long-day conditions, either by large scale comparative profiling, or using a focused approach over a number of photosensory and clock-related genes by QRT-PCR. In parallel, focused transcription analyses were performed in cry1a- and in CRY2-OX tomato genotypes. CONCLUSIONS: We report a large series of transcript oscillations that shed light on the complex network of interactions among tomato photoreceptors and clock-related genes. Alteration of cryptochrome gene expression induced major changes in the rhythmic oscillations of several other gene transcripts. In particular, over-expression of CRY2 had an impact not only on day/night fluctuations but also on rhythmicity under constant light conditions. Evidence was found for widespread diurnal oscillations of transcripts encoding specific enzyme classes (e.g. carotenoid biosynthesis enzymes as well as for post-transcriptional diurnal and circadian regulation of the CRY2 transcript.

  8. JGI Plant Genomics Gene Annotation Pipeline

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese

    2014-07-14

    Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.

  9. The Retinal Pigment Epithelium: a Convenient Source of New Photoreceptor cells?

    Directory of Open Access Journals (Sweden)

    Shu-Zhen Wang

    2014-01-01

    Full Text Available Recent success in restoring visual function through photoreceptor replacement in mouse models of photoreceptor degeneration intensifies the need to generate or regenerate photoreceptor cells for the ultimate goal of using cell replacement therapy for blindness caused by photoreceptor degeneration. Current research on deriving new photoreceptors for replacement, as regenerative medicine in general, focuses on the use of embryonic stem cells and induced pluripotent stem (iPS cells to generate transplantable cells. Nonetheless, naturally occurring regeneration, such as wound healing, involves awakening cells at or near a wound site to produce new cells needed to heal the wound. Here we discuss the possibility of tweaking an ocular tissue, the retinal pigment epithelium (RPE, to produce photoreceptor cells in situ in the eye. Unlike the neural retina, the RPE in adult mammals maintains cell proliferation capability. Furthermore, progeny cells from RPE proliferation may differentiate into cells other than RPE. The combination of proliferation and plasticity opens a question of whether they could be channeled by a regulatory gene with pro-photoreceptor activity towards photoreceptor production. Studies using embryonic chick and transgenic mouse showed that indeed photoreceptor-like cells were produced in culture and in vivo in the eye using genedirected reprogramming of RPE cells, supporting the feasibility of using the RPE as a convenient source of new photoreceptor cells for in situ retinal repair without involving cell transplantation.

  10. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  11. Two types of Tet-On transgenic lines for doxycycline-inducible gene expression in zebrafish rod photoreceptors and a gateway-based tet-on toolkit.

    Directory of Open Access Journals (Sweden)

    Leah J Campbell

    Full Text Available The ability to control transgene expression within specific tissues is an important tool for studying the molecular and cellular mechanisms of development, physiology, and disease. We developed a Tet-On system for spatial and temporal control of transgene expression in zebrafish rod photoreceptors. We generated two transgenic lines using the Xenopus rhodopsin promoter to drive the reverse tetracycline-controlled transcriptional transactivator (rtTA, one with self-reporting GFP activity and one with an epitope tagged rtTA. The self-reporting line includes a tetracycline response element (TRE-driven GFP and, in the presence of doxycycline, expresses GFP in larval and adult rods. A time-course of doxycycline treatment demonstrates that maximal induction of GFP expression, as determined by the number of GFP-positive rods, is reached within approximately 24 hours of drug treatment. The epitope-tagged transgenic line eliminates the need for the self-reporting GFP activity by expressing a FLAG-tagged rtTA protein. Both lines demonstrate strong induction of TRE-driven transgenes from plasmids microinjected into one-cell embryos. These results show that spatial and temporal control of transgene expression can be achieved in rod photoreceptors. Additionally, system components are constructed in Gateway compatible vectors for the rapid cloning of doxycycline-inducible transgenes and use in other areas of zebrafish research.

  12. Plant responses to UV and blue light: biochemical and genetic approaches

    International Nuclear Information System (INIS)

    Jenkins, G.I.; Christie, J.M.; Fuglevand, G.; Long, J.C.; Jackson, J.A.

    1995-01-01

    UV and blue light control many aspects of plant growth and development. It is evident that several different photoreceptors mediate responses to UV and blue light, and there are reports of the functional and biochemical characterisation of a putative photoreceptor for phototropism and of the functional and molecular characterisation of the CRY1 photoreceptor, encoded by the Arabidopsis HY4 gene. The CRY1 photoreceptor mediates extension growth and gene expression responses to UV-A/blue light presumably through different or branching signal transduction pathways. Progress has been made in cell physiological and biochemical studies of UV/blue light signal transduction, but much remains to be done to relate candidate UV/blue signal transduction events to particular photoreceptors and responses. The application of a genetic approach in Arabidopsis has been responsible for many advances in understanding UV/blue responses, but further UV-B, UV-A and blue light response mutants need to be isolated. (author)

  13. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  14. The biochemistry of photoreceptor cells

    International Nuclear Information System (INIS)

    Voaden, M.J.; Marshall, J.; Oraedu, A.C.I.

    1981-01-01

    Photoreceptor cells have high rates of metabolism, and enzyme distributions suggest considerable substrate movement. The authors have used tracer techniques to study the effects of light on photoreceptor metabolism. In vitro, glutamine is metabolized alongside glucose by rat photoreceptors, and is, potentially, a major precursor of the neuroactive amino acids glutamate, aspartate and γ-aminobutyrate (GABA). The utilization of both substrates is decreased by light, as is the turnover of glutamate and aspartate. Tritiated glutamic and aspartic acids are taken up by photoreceptor cells. In the primates all rods but only some cones are labelled, whereas in the guinea pig the picture is reversed. The observations support the premise that glutamate and/or aspartate are photoreceptor neurotransmitters but show that cell and species differences may exist. The authors have been unable to find evidence for the involvement of free radical mechanisms in high light-induced photoreceptor damage but the initial results suggest a reduced metabolism of glutamine and GABA in damaged cells. (Auth.)

  15. Multimodal Imaging of Photoreceptor Structure in Choroideremia.

    Science.gov (United States)

    Sun, Lynn W; Johnson, Ryan D; Williams, Vesper; Summerfelt, Phyllis; Dubra, Alfredo; Weinberg, David V; Stepien, Kimberly E; Fishman, Gerald A; Carroll, Joseph

    2016-01-01

    Choroideremia is a progressive X-linked recessive dystrophy, characterized by degeneration of the retinal pigment epithelium (RPE), choroid, choriocapillaris, and photoreceptors. We examined photoreceptor structure in a series of subjects with choroideremia with particular attention to areas bordering atrophic lesions. Twelve males with clinically-diagnosed choroideremia and confirmed hemizygous mutations in the CHM gene were examined. High-resolution images of the retina were obtained using spectral domain optical coherence tomography (SD-OCT) and both confocal and non-confocal split-detector adaptive optics scanning light ophthalmoscope (AOSLO) techniques. Eleven CHM gene mutations (3 novel) were identified; three subjects had the same mutation and one subject had two mutations. SD-OCT findings included interdigitation zone (IZ) attenuation or loss in 10/12 subjects, often in areas with intact ellipsoid zones; RPE thinning in all subjects; interlaminar bridges in the imaged areas of 10/12 subjects; and outer retinal tubulations (ORTs) in 10/12 subjects. Only split-detector AOSLO could reliably resolve cones near lesion borders, and such cones were abnormally heterogeneous in morphology, diameter and density. On split-detector imaging, the cone mosaic terminated sharply at lesion borders in 5/5 cases examined. Split-detector imaging detected remnant cone inner segments within ORTs, which were generally contiguous with a central patch of preserved retina. Early IZ dropout and RPE thinning on SD-OCT are consistent with previously published results. Evidence of remnant cone inner segments within ORTs and the continuity of the ORTs with preserved retina suggests that these may represent an intermediate state of retinal degeneration prior to complete atrophy. Taken together, these results supports a model of choroideremia in which the RPE degenerates before photoreceptors.

  16. Apigenin-7-diglucuronide protects retinas against bright light-induced photoreceptor degeneration through the inhibition of retinal oxidative stress and inflammation.

    Science.gov (United States)

    Bian, Minjuan; Zhang, Yong; Du, Xiaoye; Xu, Jing; Cui, Jingang; Gu, Jiangping; Zhu, Weiliang; Zhang, Teng; Chen, Yu

    2017-05-15

    Vision impairment in retinal degenerative diseases such as age-related macular degeneration is primarily associated with photoreceptor degeneration, in which oxidative stress and inflammatory responses are mechanistically involved as central players. Therapies with photoreceptor protective properties remain to be developed. Apigenin-7-diglucuronide (A7DG), a flavonoid glycoside, is present in an assortment of medicinal plants with anti-inflammatory or ant-oxidant activities. However, the pharmacological significance of A7DG remains unknown in vivo. The current study isolated A7DG from Glechoma longituba (Nakai) Kuprian and investigated the retinal protective effect A7DG in mice characterized by bright light-induced photoreceptor degeneration. The results showed that A7DG treatment led to remarkable photoreceptor protection in bright light-exposed BALB/c mice. Moreover, A7DG treatment alleviated photoreceptor apoptosis, mitigated oxidative stress, suppressed reactive gliosis and microglial activation and attenuated the expression of proinflammatory genes in bright light-exposed retinas. The results demonstrated for the first time remarkable photoreceptor protective activities of A7DG in vivo. Inhibition of bright light-induced retinal oxidative stress and retinal inflammatory responses was associated with the retinal protection conferred by A7DG. The work here warrants further evaluation of A7DG as a pharmacological candidate for the treatment of vision-threatening retinal degenerative disorders. Moreover, given the general implication of oxidative stress and inflammation in the pathogenesis of neurodegeneration, A7DG could be further tested for the treatment of other neurodegenerative disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Responses of photoreceptors in Hermissenda.

    Science.gov (United States)

    Akon, D L; Fuortes, M G

    1972-12-01

    The five photoreceptors in the eye of the mollusc Hermissenda crassicornis respond to light with depolarization and firing of impulses. The impulses of any one cell inhibit other cells, but the degree of inhibition differs in different pairs. Evidence is presented to show that the interactions occur at terminal branches of the photoreceptor axons, inside the cerebropleural ganglion. Properties of the generator potential are examined and it is shown that the depolarization develops in two phases which are affected differently by extrinsic currents. Finally, it is shown that by enhancing the differences in the responses of individual cells to a variety of stimuli, the interactions may facilitate a number of simple discriminations.

  18. Role of kinesin heavy chain in Crumbs localization along the rhabdomere elongation in Drosophila photoreceptor.

    Directory of Open Access Journals (Sweden)

    Garrett P League

    Full Text Available BACKGROUND: Crumbs (Crb, a cell polarity gene, has been shown to provide a positional cue for the extension of the apical membrane domain, adherens junction (AJ, and rhabdomere along the growing proximal-distal axis during Drosophila photoreceptor morphogenesis. In developing Drosophila photoreceptors, a stabilized microtubule structure was discovered and its presence was linked to polarity protein localization. It was therefore hypothesized that the microtubules may provide trafficking routes for the polarity proteins during photoreceptor morphogenesis. This study has examined whether Kinesin heavy chain (Khc, a subunit of the microtubule-based motor Kinesin-1, is essential in polarity protein localization in developing photoreceptors. METHODOLOGY/PRINCIPAL FINDINGS: Because a genetic interaction was found between crb and khc, Crb localization was examined in the developing photoreceptors of khc mutants. khc was dispensable during early eye differentiation and development. However, khc mutant photoreceptors showed a range of abnormalities in the apical membrane domain depending on the position along the proximal-distal axis in pupal photoreceptors. The khc mutant showed a progressive mislocalization in the apical domain along the distal-proximal axis during rhabdomere elongation. The khc mutation also led to a similar progressive defect in the stabilized microtubule structures, strongly suggesting that Khc is essential for microtubule structure and Crb localization during distal to proximal rhabdomere elongation in pupal morphogenesis. This role of Khc in apical domain control was further supported by khc's gain-of-function phenotype. Khc overexpression in photoreceptors caused disruption of the apical membrane domain and the stabilized microtubules in the developing photoreceptors. CONCLUSIONS/SIGNIFICANCE: In summary, we examined the role of khc in the regulation of the apical Crb domain in developing photoreceptors. Since the rhabdomeres in

  19. Major gene mutations and domestication of plants

    International Nuclear Information System (INIS)

    Ashri, A.

    1989-01-01

    From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

  20. Rax Homeoprotein Regulates Photoreceptor Cell Maturation and Survival in Association with Crx in the Postnatal Mouse Retina.

    Science.gov (United States)

    Irie, Shoichi; Sanuki, Rikako; Muranishi, Yuki; Kato, Kimiko; Chaya, Taro; Furukawa, Takahisa

    2015-08-01

    The Rax homeobox gene plays essential roles in multiple processes of vertebrate retina development. Many vertebrate species possess Rax and Rax2 genes, and different functions have been suggested. In contrast, mice contain a single Rax gene, and its functional roles in late retinal development are still unclear. To clarify mouse Rax function in postnatal photoreceptor development and maintenance, we generated conditional knockout mice in which Rax in maturing or mature photoreceptor cells was inactivated by tamoxifen treatment (Rax iCKO mice). When Rax was inactivated in postnatal Rax iCKO mice, developing photoreceptor cells showed a significant decrease in the level of the expression of rod and cone photoreceptor genes and mature adult photoreceptors exhibited a specific decrease in cone cell numbers. In luciferase assays, we found that Rax and Crx cooperatively transactivate Rhodopsin and cone opsin promoters and that an optimum Rax expression level to transactivate photoreceptor gene expression exists. Furthermore, Rax and Crx colocalized in maturing photoreceptor cells, and their coimmunoprecipitation was observed in cultured cells. Taken together, these results suggest that Rax plays essential roles in the maturation of both cones and rods and in the survival of cones by regulating photoreceptor gene expression with Crx in the postnatal mouse retina. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Ultrafast spectroscopy of biological photoreceptors

    NARCIS (Netherlands)

    Kennis, J.T.M.; Groot, M.L.

    2007-01-01

    We review recent new insights on reaction dynamics of photoreceptors proteins gained from ultrafast spectroscopy. In Blue Light sensing Using FAD (BLUF) domains, a hydrogen-bond rearrangement around the flavin chromophore proceeds through a radical-pair mechanism, by which light-induced electron and

  2. On Dispersion in Visual Photoreceptors

    NARCIS (Netherlands)

    Stavenga, D.G.; Barneveld, H.H. van

    1975-01-01

    An idealized visual pigment absorbance spectrum is used together with a Kramers-Kronig dispersion relation to calculate the contribution of the visual pigment to the refractive index of the fly photoreceptor. It appears that an absorption coefficient of 0.010 µm-1 results in a refractive index

  3. Usher protein functions in hair cells and photoreceptors.

    Science.gov (United States)

    Cosgrove, Dominic; Zallocchi, Marisa

    2014-01-01

    The 10 different genes associated with the deaf/blind disorder, Usher syndrome, encode a number of structurally and functionally distinct proteins, most expressed as multiple isoforms/protein variants. Functional characterization of these proteins suggests a role in stereocilia development in cochlear hair cells, likely owing to adhesive interactions in hair bundles. In mature hair cells, homodimers of the Usher cadherins, cadherin 23 and protocadherin 15, interact to form a structural fiber, the tip link, and the linkages that anchor the taller stereocilia's actin cytoskeleton core to the shorter adjacent stereocilia and the elusive mechanotransduction channels, explaining the deafness phenotype when these molecular interactions are perturbed. The conundrum is that photoreceptors lack a synonymous mechanotransduction apparatus, and so a common theory for Usher protein function in the two neurosensory cell types affected in Usher syndrome is lacking. Recent evidence linking photoreceptor cell dysfunction in the shaker 1 mouse model for Usher syndrome to light-induced protein translocation defects, combined with localization of an Usher protein interactome at the periciliary region of the photoreceptors suggests Usher proteins might regulate protein trafficking between the inner and outer segments of photoreceptors. A distinct Usher protein complex is trafficked to the ribbon synapses of hair cells, and synaptic defects have been reported in Usher mutants in both hair cells and photoreceptors. This review aims to clarify what is known about Usher protein function at the synaptic and apical poles of hair cells and photoreceptors and the prospects for identifying a unifying pathobiological mechanism to explain deaf/blindness in Usher syndrome. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Nuclear Import of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Phytochrome Photoreceptors

    Science.gov (United States)

    Kircher, Stefan; Wellmer, Frank; Nick, Peter; Rügner, Alexander; Schäfer, Eberhard; Harter, Klaus

    1999-01-01

    In plants, light perception by photoreceptors leads to differential expression of an enormous number of genes. An important step for differential gene expression is the regulation of transcription factor activities. To understand these processes in light signal transduction we analyzed the three well-known members of the common plant regulatory factor (CPRF) family from parsley (Petroselinum crispum). Here, we demonstrate that these CPRFs, which belong to the basic- region leucine-zipper (bZIP) domain-containing transcription factors, are differentially distributed within parsley cells, indicating different regulatory functions within the regulatory networks of the plant cell. In particular, we show by cell fractionation and immunolocalization approaches that CPRF2 is transported from the cytosol into the nucleus upon irradiation due to action of phytochrome photoreceptors. Two NH2-terminal domains responsible for cytoplasmic localization of CPRF2 in the dark were characterized by deletion analysis using a set of CPRF2-green fluorescent protein (GFP) gene fusion constructs transiently expressed in parsley protoplasts. We suggest that light-induced nuclear import of CPRF2 is an essential step in phytochrome signal transduction. PMID:9922448

  5. Photoreceptor PhyB Involved in Arabidopsis Temperature Perception and Heat-Tolerance Formation.

    Science.gov (United States)

    Song, Junyi; Liu, Qijun; Hu, Biru; Wu, Wenjian

    2017-06-05

    The influence of temperature on plants is essential. However, our knowledge on the intricate regulation process underlying heat stress (HS) response in plants is limited. Recently, information about thermal sensors in vivo has begun to emerge. In this study, another primary environmental stimulus, light, was verified once again to work with temperature synergistically on plants, through the modulation of numerous biological processes. With the application of transcriptomic analysis, a substantial number of heat-responsive genes were detected involved in both light- and phytohormone-mediated pathways in Arabidopsis. During this process, phytoreceptor phyB acts as a molecular switch to turn on or turn off several other genes HS response, under different light conditions. Furthermore, a morphological study showed the afunction of phyB enhanced plants thermal tolerance, confirming the important role of this phytochrome in temperature perception and response in plants. This study adds data to the picture of light and temperature signaling cross-talk in plants, which is important for the exploration of complicated HS responses or light-mediated mechanisms. Furthermore, based on its influence on Arabidopsis thermal response in both morphological and physiological levels, phyB is a photoreceptor, as revealed before, as well as an essential thermal sensor in plants.

  6. The UV-B Photoreceptor UVR8: From Structure to Physiology

    Science.gov (United States)

    Jenkins, Gareth I.

    2014-01-01

    Low doses of UV-B light (280 to 315 nm) elicit photomorphogenic responses in plants that modify biochemical composition, photosynthetic competence, morphogenesis, and defense. UV RESISTANCE LOCUS8 (UVR8) mediates photomorphogenic responses to UV-B by regulating transcription of a set of target genes. UVR8 differs from other known photoreceptors in that it uses specific Trp amino acids instead of a prosthetic chromophore for light absorption during UV-B photoreception. Absorption of UV-B dissociates the UVR8 dimer into monomers, initiating signal transduction through interaction with CONSTITUTIVELY PHOTOMORPHOGENIC1. However, much remains to be learned about the physiological role of UVR8 and its interaction with other signaling pathways, the molecular mechanism of UVR8 photoreception, how the UVR8 protein initiates signaling, how it is regulated, and how UVR8 regulates transcription of its target genes. PMID:24481075

  7. Transfer of engineered genes from crop to wild plants

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.

    1996-01-01

    The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...

  8. Use of NAP gene to manipulate leaf senescence in plants

    Science.gov (United States)

    Gan, Susheng; Guo, Yongfeng

    2013-04-16

    The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.

  9. Excessive Myosin Activity in Mbs Mutants Causes Photoreceptor Movement Out of the Drosophila Eye Disc Epithelium

    OpenAIRE

    Lee, Arnold; Treisman, Jessica E.

    2004-01-01

    Neuronal cells must extend a motile growth cone while maintaining the cell body in its original position. In migrating cells, myosin contraction provides the driving force that pulls the rear of the cell toward the leading edge. We have characterized the function of myosin light chain phosphatase, which down-regulates myosin activity, in Drosophila photoreceptor neurons. Mutations in the gene encoding the myosin binding subunit of this enzyme cause photoreceptors to drop out of the eye disc e...

  10. Samd7 is a cell type-specific PRC1 component essential for establishing retinal rod photoreceptor identity.

    Science.gov (United States)

    Omori, Yoshihiro; Kubo, Shun; Kon, Tetsuo; Furuhashi, Mayu; Narita, Hirotaka; Kominami, Taro; Ueno, Akiko; Tsutsumi, Ryotaro; Chaya, Taro; Yamamoto, Haruka; Suetake, Isao; Ueno, Shinji; Koseki, Haruhiko; Nakagawa, Atsushi; Furukawa, Takahisa

    2017-09-26

    Precise transcriptional regulation controlled by a transcription factor network is known to be crucial for establishing correct neuronal cell identities and functions in the CNS. In the retina, the expression of various cone and rod photoreceptor cell genes is regulated by multiple transcription factors; however, the role of epigenetic regulation in photoreceptor cell gene expression has been poorly understood. Here, we found that Samd7, a rod-enriched sterile alpha domain (SAM) domain protein, is essential for silencing nonrod gene expression through H3K27me3 regulation in rod photoreceptor cells. Samd7- null mutant mice showed ectopic expression of nonrod genes including S-opsin in rod photoreceptor cells and rod photoreceptor cell dysfunction. Samd7 physically interacts with Polyhomeotic homologs (Phc proteins), components of the Polycomb repressive complex 1 (PRC1), and colocalizes with Phc2 and Ring1B in Polycomb bodies. ChIP assays showed a significant decrease of H3K27me3 in the genes up-regulated in the Samd7 -deficient retina, showing that Samd7 deficiency causes the derepression of nonrod gene expression in rod photoreceptor cells. The current study suggests that Samd7 is a cell type-specific PRC1 component epigenetically defining rod photoreceptor cell identity.

  11. Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2013-12-01

    Full Text Available Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules and/or by the plant roots (e.g. flavonoids, ethanol and methanol, respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones and plant exudates (including ethanol in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF, adaptation to stressful environment (crtI, phoU and sss, to interactions with plant metabolism compounds (acdS and pathogenicity (patatin and phoU. Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization, which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction.

  12. Fungal and plant gene expression in arbuscular mycorrhizal symbiosis.

    Science.gov (United States)

    Balestrini, Raffaella; Lanfranco, Luisa

    2006-11-01

    Arbuscular mycorrhizas (AMs) are a unique example of symbiosis between two eukaryotes, soil fungi and plants. This association induces important physiological changes in each partner that lead to reciprocal benefits, mainly in nutrient supply. The symbiosis results from modifications in plant and fungal cell organization caused by specific changes in gene expression. Recently, much effort has gone into studying these gene expression patterns to identify a wider spectrum of genes involved. We aim in this review to describe AM symbiosis in terms of current knowledge on plant and fungal gene expression profiles.

  13. No evidence for a genetic blueprint: The case of the "complex" mammalian photoreceptor

    Directory of Open Access Journals (Sweden)

    G Kumaramanickavel

    2015-01-01

    Full Text Available Despite the intensity of the search for genes causing inherited retinal degenerations over the past 3 decades, of the approximately 200 disease genes identified to date, all appear to be ordinary housekeeping genes specifying proteins playing basic structural and functional roles in the mature photoreceptor cells. No genes or genetic elements have been identified which can be construed as having a specific morphogenic role, directing the development of the cytoarchitecture of any particular retinal cell. The evidence suggests that the cytoarchitecture of the retinal photoreceptors, although enormously complex, arises from the self-organization of the cells constituents without any regulation or direction from an external genetic blueprint.

  14. Diversification of Root Hair Development Genes in Vascular Plants.

    Science.gov (United States)

    Huang, Ling; Shi, Xinhui; Wang, Wenjia; Ryu, Kook Hui; Schiefelbein, John

    2017-07-01

    The molecular genetic program for root hair development has been studied intensively in Arabidopsis ( Arabidopsis thaliana ). To understand the extent to which this program might operate in other plants, we conducted a large-scale comparative analysis of root hair development genes from diverse vascular plants, including eudicots, monocots, and a lycophyte. Combining phylogenetics and transcriptomics, we discovered conservation of a core set of root hair genes across all vascular plants, which may derive from an ancient program for unidirectional cell growth coopted for root hair development during vascular plant evolution. Interestingly, we also discovered preferential diversification in the structure and expression of root hair development genes, relative to other root hair- and root-expressed genes, among these species. These differences enabled the definition of sets of genes and gene functions that were acquired or lost in specific lineages during vascular plant evolution. In particular, we found substantial divergence in the structure and expression of genes used for root hair patterning, suggesting that the Arabidopsis transcriptional regulatory mechanism is not shared by other species. To our knowledge, this study provides the first comprehensive view of gene expression in a single plant cell type across multiple species. © 2017 American Society of Plant Biologists. All Rights Reserved.

  15. The Vitamin B12-Dependent Photoreceptor AerR Relieves Photosystem Gene Repression by Extending the Interaction of CrtJ with Photosystem Promoters

    Directory of Open Access Journals (Sweden)

    Mingxu Fang

    2017-03-01

    Full Text Available Purple nonsulfur bacteria adapt their physiology to a wide variety of environmental conditions often through the control of transcription. One of the main transcription factors involved in controlling expression of the Rhodobacter capsulatus photosystem is CrtJ, which functions as an aerobic repressor of photosystem genes. Recently, we reported that a vitamin B12 binding antirepressor of CrtJ called AerR is required for anaerobic expression of the photosystem. However, the mechanism whereby AerR regulates CrtJ activity is unclear. In this study, we used a combination of next-generation sequencing and biochemical methods to globally identify genes under control of CrtJ and the role of AerR in controlling this regulation. Our results indicate that CrtJ has a much larger regulon than previously known, with a surprising regulatory function under both aerobic and anaerobic photosynthetic growth conditions. A combination of in vivo chromatin immunoprecipitation-DNA sequencing (ChIP-seq and ChIP-seq and exonuclease digestion (ChIP-exo studies and in vitro biochemical studies demonstrate that AerR forms a 1:2 complex with CrtJ (AerR-CrtJ2 and that this complex binds to many promoters under photosynthetic conditions. The results of in vitro and in vivo DNA binding studies indicate that AerR-CrtJ2 anaerobically forms an extended interaction with the bacteriochlorophyll bchC promoter to relieve repression by CrtJ. This is contrasted by aerobic growth conditions where CrtJ alone functions as an aerobic repressor of bchC expression. These results indicate that the DNA binding activity of CrtJ is modified by interacting with AerR in a redox-regulated manner and that this interaction alters CrtJ’s function.

  16. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  17. Divergence and Conservative Evolution of XTNX Genes in Land Plants

    Directory of Open Access Journals (Sweden)

    Yan-Mei Zhang

    2017-10-01

    Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.

  18. Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

    International Nuclear Information System (INIS)

    Yousaf, Sohail; Afzal, Muhammad; Reichenauer, Thomas G.; Brady, Carrie L.; Sessitsch, Angela

    2011-01-01

    The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: → E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. → E. ludwigii strains efficiently expressed alkane degradation genes in plants. → E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. → E. ludwigii interacted more effectively with Italian ryegrass than with other plants. → Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

  19. Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

    Energy Technology Data Exchange (ETDEWEB)

    Yousaf, Sohail [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); Afzal, Muhammad [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad (Pakistan); Reichenauer, Thomas G. [AIT Austrian Institute of Technology GmbH, Environmental Resources and Technologies Unit, A-2444 Seibersdorf (Austria); Brady, Carrie L. [Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria (South Africa); Sessitsch, Angela, E-mail: angela.sessitsch@ait.ac.at [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria)

    2011-10-15

    The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: > E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. > E. ludwigii strains efficiently expressed alkane degradation genes in plants. > E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. > E. ludwigii interacted more effectively with Italian ryegrass than with other plants. > Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

  20. Plant isoflavone and isoflavanone O-methyltransferase genes

    Science.gov (United States)

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  1. The UVR8 UV-B Photoreceptor: Perception, Signaling and Response

    Science.gov (United States)

    Tilbrook, Kimberley; Arongaus, Adriana B.; Binkert, Melanie; Heijde, Marc; Yin, Ruohe; Ulm, Roman

    2013-01-01

    Ultraviolet-B radiation (UV-B) is an intrinsic part of sunlight that is accompanied by significant biological effects. Plants are able to perceive UV-B using the UV-B photoreceptor UVR8 which is linked to a specific molecular signaling pathway and leads to UV-B acclimation. Herein we review the biological process in plants from initial UV-B perception and signal transduction through to the known UV-B responses that promote survival in sunlight. The UVR8 UV-B photoreceptor exists as a homodimer that instantly monomerises upon UV-B absorption via specific intrinsic tryptophans which act as UV-B chromophores. The UVR8 monomer interacts with COP1, an E3 ubiquitin ligase, initiating a molecular signaling pathway that leads to gene expression changes. This signaling output leads to UVR8-dependent responses including UV-B-induced photomorphogenesis and the accumulation of UV-B-absorbing flavonols. Negative feedback regulation of the pathway is provided by the WD40-repeat proteins RUP1 and RUP2, which facilitate UVR8 redimerization, disrupting the UVR8-COP1 interaction. Despite rapid advancements in the field of recent years, further components of UVR8 UV-B signaling are constantly emerging, and the precise interplay of these and the established players UVR8, COP1, RUP1, RUP2 and HY5 needs to be defined. UVR8 UV-B signaling represents our further understanding of how plants are able to sense their light environment and adjust their growth accordingly. PMID:23864838

  2. Mef2d is essential for the maturation and integrity of retinal photoreceptor and bipolar cells.

    Science.gov (United States)

    Omori, Yoshihiro; Kitamura, Tamiki; Yoshida, Satoyo; Kuwahara, Ryusuke; Chaya, Taro; Irie, Shoichi; Furukawa, Takahisa

    2015-05-01

    Mef2 transcription factors play a crucial role in cardiac and skeletal muscle differentiation. We found that Mef2d is highly expressed in the mouse retina and its loss causes photoreceptor degeneration similar to that observed in human retinitis pigmentosa patients. Electroretinograms (ERGs) were severely impaired in Mef2d-/- mice. Immunohistochemistry showed that photoreceptor and bipolar cell synapse protein levels severely decreased in the Mef2d-/- retina. Expression profiling by microarray analysis showed that Mef2d is required for the expression of various genes in photoreceptor and bipolar cells, including cone arrestin, Guca1b, Pde6h and Cacna1s, which encode outer segment and synapse proteins. We also observed that Mef2d synergistically activates the cone arrestin (Arr3) promoter with Crx, suggesting that functional cooperation between Mef2d and Crx is important for photoreceptor cell gene regulation. Taken together, our results show that Mef2d is essential for photoreceptor and bipolar cell gene expression, either independently or cooperatively with Crx. © 2015 Institution for Protein Research. Genes to Cells published by Wiley Publishing Asia Pty Ltd and the Molecular Biology Society of Japan.

  3. Expression of streptavidin gene in bacteria and plants

    International Nuclear Information System (INIS)

    Guan, Xueni; Wurtele, E.S.; Nikolau, B.J.

    1990-01-01

    Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot

  4. Restoration of vision after transplantation of photoreceptors.

    Science.gov (United States)

    Pearson, R A; Barber, A C; Rizzi, M; Hippert, C; Xue, T; West, E L; Duran, Y; Smith, A J; Chuang, J Z; Azam, S A; Luhmann, U F O; Benucci, A; Sung, C H; Bainbridge, J W; Carandini, M; Yau, K-W; Sowden, J C; Ali, R R

    2012-05-03

    Cell transplantation is a potential strategy for treating blindness caused by the loss of photoreceptors. Although transplanted rod-precursor cells are able to migrate into the adult retina and differentiate to acquire the specialized morphological features of mature photoreceptor cells, the fundamental question remains whether transplantation of photoreceptor cells can actually improve vision. Here we provide evidence of functional rod-mediated vision after photoreceptor transplantation in adult Gnat1−/− mice, which lack rod function and are a model of congenital stationary night blindness. We show that transplanted rod precursors form classic triad synaptic connections with second-order bipolar and horizontal cells in the recipient retina. The newly integrated photoreceptor cells are light-responsive with dim-flash kinetics similar to adult wild-type photoreceptors. By using intrinsic imaging under scotopic conditions we demonstrate that visual signals generated by transplanted rods are projected to higher visual areas, including V1. Moreover, these cells are capable of driving optokinetic head tracking and visually guided behaviour in the Gnat1−/− mouse under scotopic conditions. Together, these results demonstrate the feasibility of photoreceptor transplantation as a therapeutic strategy for restoring vision after retinal degeneration.

  5. Localizing genes using linkage disequilibrium in plants: integrating ...

    African Journals Online (AJOL)

    GREGO

    2007-03-19

    Mar 19, 2007 ... Localizing genes using linkage disequilibrium in plants: integrating lessons ... reduce that association as a function of the marker distance from the QTL. ..... the gene locus enhanced the resolution power of asso- ciation tests .... agents, such as insects, birds, water and wind, so mating is determined by a ...

  6. Alteration of plant meristem function by manipulation of the Retinoblastoma-like plant RRB gene

    Science.gov (United States)

    Durfee, Tim [Madison, WI; Feiler, Heidi [Albany, CA; Gruissem, Wilhelm [Forch, CH; Jenkins, Susan [Martinez, CA; Roe, Judith [Manhattan, KS; Zambryski, Patricia [Berkeley, CA

    2007-01-16

    This invention provides methods and compositions for altering the growth, organization, and differentiation of plant tissues. The invention is based on the discovery that, in plants, genetically altering the levels of Retinoblastoma-related gene (RRB) activity produces dramatic effects on the growth, proliferation, organization, and differentiation of plant meristem.

  7. QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD

    Science.gov (United States)

    Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...

  8. Plant improvement by known-function genes

    Directory of Open Access Journals (Sweden)

    Jesús Quiroz Chávez

    2012-09-01

    Full Text Available Plant molecular improvement by recombinant DNA technology represents an advantage to obtain new varieties or traits. This technique is promised for genetic improvement of crop plants. Lines with increased yield, quality, disease resistance, or tolerant to abiotic stress have been obtained, with clear advantages for producers, marketers and consumers. However, they have several limitations in its application to agriculture because of its risk and hazards. The aim of the document is to show the advantages and disadvantages of GM crop plant, to develop represent an opportunity to have new exotic traits.

  9. Plant Genes Involved in Symbiotic Sinal Perception/Signal Transduction

    DEFF Research Database (Denmark)

    Binder, A; Soyano, T; Hayashi, H

    2014-01-01

    to nodule primordia formation, and the infection thread initiation in the root hairs guiding bacteria towards dividing cortical cells. This chapter focuses on the plant genes involved in the recognition of the symbiotic signal produced by rhizobia, and the downstream genes, which are part of a complex...... symbiotic signalling pathway that leads to the generation of calcium spiking in the nuclear regions and activation of transcription factors controlling symbiotic genes induction...

  10. A Comprehensive Classification and Evolutionary Analysis of Plant Homeobox Genes

    OpenAIRE

    Mukherjee, Krishanu; Brocchieri, Luciano; B?rglin, Thomas R.

    2009-01-01

    The full complement of homeobox transcription factor sequences, including genes and pseudogenes, was determined from the analysis of 10 complete genomes from flowering plants, moss, Selaginella, unicellular green algae, and red algae. Our exhaustive genome-wide searches resulted in the discovery in each class of a greater number of homeobox genes than previously reported. All homeobox genes can be unambiguously classified by sequence evolutionary analysis into 14 distinct classes also charact...

  11. Emerging use of gene expression microarrays in plant physiology.

    Science.gov (United States)

    Wullschleger, Stan D; Difazio, Stephen P

    2003-01-01

    Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

  12. Emerging Use of Gene Expression Microarrays in Plant Physiology

    Directory of Open Access Journals (Sweden)

    Stephen P. Difazio

    2006-04-01

    Full Text Available Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

  13. In vitro transdifferentiation of human peripheral blood mononuclear cells to photoreceptor-like cells

    Directory of Open Access Journals (Sweden)

    Yukari Komuta

    2016-06-01

    Full Text Available Direct reprogramming is a promising, simple and low-cost approach to generate target cells from somatic cells without using induced pluripotent stem cells. Recently, peripheral blood mononuclear cells (PBMCs have attracted considerable attention as a somatic cell source for reprogramming. As a cell source, PBMCs have an advantage over dermal fibroblasts with respect to the ease of collecting tissues. Based on our studies involving generation of photosensitive photoreceptor cells from human iris cells and human dermal fibroblasts by transduction of photoreceptor-related transcription factors via retrovirus vectors, we transduced these transcription factors into PBMCs via Sendai virus vectors. We found that retinal disease-related genes were efficiently detected in CRX-transduced cells, most of which are crucial to photoreceptor functions. In functional studies, a light-induced inward current was detected in some CRX-transduced cells. Moreover, by modification of the culture conditions including additional transduction of RAX1 and NEUROD1, we found a greater variety of retinal disease-related genes than that observed in CRX-transduced PBMCs. These data suggest that CRX acts as a master control gene for reprogramming PBMCs into photoreceptor-like cells and that our induced photoreceptor-like cells might contribute to individualized drug screening and disease modeling of inherited retinal degeneration.

  14. Photoreceptor Sensory Cilium: Traversing the Ciliary Gate

    Directory of Open Access Journals (Sweden)

    Hemant Khanna

    2015-10-01

    Full Text Available Cilia are antenna-like extensions of the plasma membrane found in nearly all cell types. In the retina of the eye, photoreceptors develop unique sensory cilia. Not much was known about the mechanisms underlying the formation and function of photoreceptor cilia, largely because of technical limitations and the specific structural and functional modifications that cannot be modeled in vitro. With recent advances in microscopy techniques and molecular and biochemical approaches, we are now beginning to understand the molecular basis of photoreceptor ciliary architecture, ciliary function and its involvement in human diseases. Here, I will discuss the studies that have revealed new knowledge of how photoreceptor cilia regulate their identity and function while coping with high metabolic and trafficking demands associated with processing light signal.

  15. Repressor-mediated tissue-specific gene expression in plants

    Science.gov (United States)

    Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

    2009-02-17

    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  16. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  17. Transcriptional regulation of rod photoreceptor homeostasis revealed by in vivo NRL targetome analysis.

    Directory of Open Access Journals (Sweden)

    Hong Hao

    Full Text Available A stringent control of homeostasis is critical for functional maintenance and survival of neurons. In the mammalian retina, the basic motif leucine zipper transcription factor NRL determines rod versus cone photoreceptor cell fate and activates the expression of many rod-specific genes. Here, we report an integrated analysis of NRL-centered gene regulatory network by coupling chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-Seq data from Illumina and ABI platforms with global expression profiling and in vivo knockdown studies. We identified approximately 300 direct NRL target genes. Of these, 22 NRL targets are associated with human retinal dystrophies, whereas 95 mapped to regions of as yet uncloned retinal disease loci. In silico analysis of NRL ChIP-Seq peak sequences revealed an enrichment of distinct sets of transcription factor binding sites. Specifically, we discovered that genes involved in photoreceptor function include binding sites for both NRL and homeodomain protein CRX. Evaluation of 26 ChIP-Seq regions validated their enhancer functions in reporter assays. In vivo knockdown of 16 NRL target genes resulted in death or abnormal morphology of rod photoreceptors, suggesting their importance in maintaining retinal function. We also identified histone demethylase Kdm5b as a novel secondary node in NRL transcriptional hierarchy. Exon array analysis of flow-sorted photoreceptors in which Kdm5b was knocked down by shRNA indicated its role in regulating rod-expressed genes. Our studies identify candidate genes for retinal dystrophies, define cis-regulatory module(s for photoreceptor-expressed genes and provide a framework for decoding transcriptional regulatory networks that dictate rod homeostasis.

  18. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  19. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  20. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  1. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  2. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  3. Rip3 knockdown rescues photoreceptor cell death in blind pde6c zebrafish.

    Science.gov (United States)

    Viringipurampeer, I A; Shan, X; Gregory-Evans, K; Zhang, J P; Mohammadi, Z; Gregory-Evans, C Y

    2014-05-01

    Achromatopsia is a progressive autosomal recessive retinal disease characterized by early loss of cone photoreceptors and later rod photoreceptor loss. In most cases, mutations have been identified in CNGA3, CNGB3, GNAT2, PDE6C or PDE6H genes. Owing to this genetic heterogeneity, mutation-independent therapeutic schemes aimed at preventing cone cell death are very attractive treatment strategies. In pde6c(w59) mutant zebrafish, cone photoreceptors expressed high levels of receptor-interacting protein kinase 1 (RIP1) and receptor-interacting protein kinase 3 (RIP3) kinases, key regulators of necroptotic cell death. In contrast, rod photoreceptor cells were alternatively immunopositive for caspase-3 indicating activation of caspase-dependent apoptosis in these cells. Morpholino gene knockdown of rip3 in pde6c(w59) embryos rescued the dying cone photoreceptors by inhibiting the formation of reactive oxygen species and by inhibiting second-order neuron remodelling in the inner retina. In rip3 morphant larvae, visual function was restored in the cones by upregulation of the rod phosphodiesterase genes (pde6a and pde6b), compensating for the lack of cone pde6c suggesting that cones are able to adapt to their local environment. Furthermore, we demonstrated through pharmacological inhibition of RIP1 and RIP3 activity that cone cell death was also delayed. Collectively, these results demonstrate that the underlying mechanism of cone cell death in the pde6c(w59) mutant retina is through necroptosis, whereas rod photoreceptor bystander death occurs through a caspase-dependent mechanism. This suggests that targeting the RIP kinase signalling pathway could be an effective therapeutic intervention in retinal degeneration patients. As bystander cell death is an important feature of many retinal diseases, combinatorial approaches targeting different cell death pathways may evolve as an important general principle in treatment.

  4. Retinal neuroprotection by hypoxic preconditioning is independent of hypoxia-inducible factor-1 alpha expression in photoreceptors.

    Science.gov (United States)

    Thiersch, Markus; Lange, Christina; Joly, Sandrine; Heynen, Severin; Le, Yun Zheng; Samardzija, Marijana; Grimm, Christian

    2009-06-01

    Hypoxic preconditioning stabilizes hypoxia-inducible factor (HIF) 1 alpha in the retina and protects photoreceptors against light-induced cell death. HIF-1 alpha is one of the major transcription factors responding to low oxygen tension and can differentially regulate a large number of target genes. To analyse whether photoreceptor-specific expression of HIF-1 alpha is essential to protect photoreceptors by hypoxic preconditioning, we knocked down expression of HIF-1 alpha specifically in photoreceptor cells, using the cyclization recombinase (Cre)-lox system. The Cre-mediated knockdown caused a 20-fold reduced expression of Hif-1 alpha in the photoreceptor cell layer. In the total retina, RNA expression was reduced by 65%, and hypoxic preconditioning led to only a small increase in HIF-1 alpha protein levels. Accordingly, HIF-1 target gene expression after hypoxia was significantly diminished. Retinas of Hif-1 alpha knockdown animals did not show any pathological alterations, and tolerated hypoxic exposure in a comparable way to wild-type retinas. Importantly, the strong neuroprotective effect of hypoxic preconditioning against light-induced photoreceptor degeneration persisted in knockdown mice, suggesting that hypoxia-mediated survival of light exposure does not depend on an autocrine action of HIF-1 alpha in photoreceptor cells. Hypoxia-mediated stabilization of HIF-2 alpha and phosphorylation of signal transducer and activator of transcription 3 (STAT 3) were not affected in the retinas of Hif-1 alpha knockdown mice. Thus, these factors are candidates for regulating the resistance of photoreceptors to light damage after hypoxic preconditioning, along with several potentially neuroprotective genes that were similarly induced in hypoxic knockdown and control mice.

  5. Plant gene bank and vegetable varieties biodiversity in Smederevska Palanka

    Directory of Open Access Journals (Sweden)

    Pavlović Nenad

    2011-01-01

    Full Text Available Biodiversity protection and preservation of genetic variability is based on the fact that plant varieties are irreplaceable in production process and that they are more and more jeopardized by urban and industrial development. The most common way of preserving and at the same time the safest way is a storage in a gene bank. Prior to storage comes collecting, studying and replanting for Institute Gene Bank, Central State Gene Bank and for Regional Gene Banks. Institute for Vegetable Crops in Smederevska Palanka preserves a wide variety of vegetable germplasm. This is, so called, work collection, used as a gene resource for breeding purposes. Seed samples are stored at 4±2°C and 50% relative humidity. At the moment, the collection has 2265 samples. Almost all samples have the passport data, but only 10% of samples have been further characterized and evaluated.

  6. The genetics of some planthormones and photoreceptors in Arabidopsis thaliana (L.) Heynh.

    NARCIS (Netherlands)

    Koornneef, M.

    1982-01-01

    This thesis describes the isolation and characterization in Arabidopsis thaliana (L.) Heynh. of induced mutants, deficient for gibberellins (GA's), abscisic acid (ABA) and photoreceptors.

    These compounds are known to regulate various facets of plant growth and

  7. Loss and gain of cone types in vertebrate ciliary photoreceptor evolution.

    Science.gov (United States)

    Musser, Jacob M; Arendt, Detlev

    2017-11-01

    Ciliary photoreceptors are a diverse cell type family that comprises the rods and cones of the retina and other related cell types such as pineal photoreceptors. Ciliary photoreceptor evolution has been dynamic during vertebrate evolution with numerous gains and losses of opsin and phototransduction genes, and changes in their expression. For example, early mammals lost all but two cone opsins, indicating loss of cone receptor types in response to nocturnal lifestyle. Our review focuses on the comparison of specifying transcription factors and cell type-specific transcriptome data in vertebrate retinae to build and test hypotheses on ciliary photoreceptor evolution. Regarding cones, recent data reveal that a combination of factors specific for long-wavelength sensitive opsin (Lws)- cones in non-mammalian vertebrates (Thrb and Rxrg) is found across all differentiating cone photoreceptors in mice. This suggests that mammalian ancestors lost all but one ancestral cone type, the Lws-cone. We test this hypothesis by a correlation analysis of cone transcriptomes in mouse and chick, and find that, indeed, transcriptomes of all mouse cones are most highly correlated to avian Lws-cones. These findings underscore the importance of specifying transcription factors in tracking cell type evolution, and shed new light on the mechanisms of cell type loss and gain in retina evolution. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  8. PAR-Complex and Crumbs Function During Photoreceptor Morphogenesis and Retinal Degeneration.

    Science.gov (United States)

    Pichaud, Franck

    2018-01-01

    The fly photoreceptor has long been used as a model to study sensory neuron morphogenesis and retinal degeneration. In particular, elucidating how these cells are built continues to help further our understanding of the mechanisms of polarized cell morphogenesis, intracellular trafficking and the causes of human retinal pathologies. The conserved PAR complex, which in flies consists of Cdc42-PAR6-aPKC-Bazooka, and the transmembrane protein Crumbs (Crb) are key players during photoreceptor morphogenesis. While the PAR complex regulates polarity in many cell types, Crb function in polarity is relatively specific to epithelial cells. Together Cdc42-PAR6-aPKC-Bazooka and Crb orchestrate the differentiation of the photoreceptor apical membrane (AM) and zonula adherens (ZA) , thus allowing these cells to assemble into a neuro-epithelial lattice. In addition to its function in epithelial polarity, Crb has also been shown to protect fly photoreceptors from light-induced degeneration, a process linked to Rhodopsin expression and trafficking. Remarkably, mutations in the human Crumbs1 (CRB1) gene lead to retinal degeneration, making the fly photoreceptor a powerful disease model system.

  9. PAR-Complex and Crumbs Function During Photoreceptor Morphogenesis and Retinal Degeneration

    Directory of Open Access Journals (Sweden)

    Franck Pichaud

    2018-03-01

    Full Text Available The fly photoreceptor has long been used as a model to study sensory neuron morphogenesis and retinal degeneration. In particular, elucidating how these cells are built continues to help further our understanding of the mechanisms of polarized cell morphogenesis, intracellular trafficking and the causes of human retinal pathologies. The conserved PAR complex, which in flies consists of Cdc42-PAR6-aPKC-Bazooka, and the transmembrane protein Crumbs (Crb are key players during photoreceptor morphogenesis. While the PAR complex regulates polarity in many cell types, Crb function in polarity is relatively specific to epithelial cells. Together Cdc42-PAR6-aPKC-Bazooka and Crb orchestrate the differentiation of the photoreceptor apical membrane (AM and zonula adherens (ZA, thus allowing these cells to assemble into a neuro-epithelial lattice. In addition to its function in epithelial polarity, Crb has also been shown to protect fly photoreceptors from light-induced degeneration, a process linked to Rhodopsin expression and trafficking. Remarkably, mutations in the human Crumbs1 (CRB1 gene lead to retinal degeneration, making the fly photoreceptor a powerful disease model system.

  10. Gene Discovery and Functional Analyses in the Model Plant Arabidopsis

    DEFF Research Database (Denmark)

    Feng, Cai-ping; Mundy, J.

    2006-01-01

    The present mini-review describes newer methods and strategies, including transposon and T-DNA insertions, TILLING, Deleteagene, and RNA interference, to functionally analyze genes of interest in the model plant Arabidopsis. The relative advantages and disadvantages of the systems are also discus...

  11. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Science.gov (United States)

    2010-01-01

    Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests

  12. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

  13. Activin Signals through SMAD2/3 to Increase Photoreceptor Precursor Yield during Embryonic Stem Cell Differentiation.

    Science.gov (United States)

    Lu, Amy Q; Popova, Evgenya Y; Barnstable, Colin J

    2017-09-12

    In vitro differentiation of mouse embryonic stem cells (ESCs) into retinal fates can be used to study the roles of exogenous factors acting through multiple signaling pathways during retina development. Application of activin A during a specific time frame that corresponds to early embryonic retinogenesis caused increased generation of CRX + photoreceptor precursors and decreased PAX6 + retinal progenitor cells (RPCs). Following activin A treatment, SMAD2/3 was activated in RPCs and bound to promoter regions of key RPC and photoreceptor genes. The effect of activin on CRX expression was repressed by pharmacological inhibition of SMAD2/3 phosphorylation. Activin signaling through SMAD2/3 in RPCs regulates expression of transcription factors involved in cell type determination and promotes photoreceptor lineage specification. Our findings can contribute to the production of photoreceptors for cell replacement therapy. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Derivation of human differential photoreceptor-like cells from the iris by defined combinations of CRX, RX and NEUROD.

    Directory of Open Access Journals (Sweden)

    Yuko Seko

    Full Text Available Examples of direct differentiation by defined transcription factors have been provided for beta-cells, cardiomyocytes and neurons. In the human visual system, there are four kinds of photoreceptors in the retina. Neural retina and iris-pigmented epithelium (IPE share a common developmental origin, leading us to test whether human iris cells could differentiate to retinal neurons. We here define the transcription factor combinations that can determine human photoreceptor cell fate. Expression of rhodopsin, blue opsin and green/red opsin in induced photoreceptor cells were dependent on combinations of transcription factors: A combination of CRX and NEUROD induced rhodopsin and blue opsin, but did not induce green opsin; a combination of CRX and RX induced blue opsin and green/red opsin, but did not induce rhodopsin. Phototransduction-related genes as well as opsin genes were up-regulated in those cells. Functional analysis; i.e. patch clamp recordings, clearly revealed that generated photoreceptor cells, induced by CRX, RX and NEUROD, responded to light. The response was an inward current instead of the typical outward current. These data suggest that photosensitive photoreceptor cells can be generated by combinations of transcription factors. The combination of CRX and RX generate immature photoreceptors: and additional NEUROD promotes maturation. These findings contribute substantially to a major advance toward eventual cell-based therapy for retinal degenerative diseases.

  15. Gene expression from plants grown on the International Space Station

    Science.gov (United States)

    Stimpson, Alexander; Pereira, Rhea; Kiss, John Z.; Correll, Melanie

    Three experiments were performed on the International Space Station (ISS) in 2006 as part of the TROPI experiments. These experiments were performed to study graviTROPIsm and photoTROPIsm responses of Arabidopsis in microgravity (µg). Seedlings were grown with a variety of light and gravitational treatments for approximately five days. The frozen samples were returned to Earth during three space shuttle missions in 2007 and stored at -80° C. Due to the limited amount of plant biomass returned, new protocols were developed to minimize the amount of material needed for RNA extraction as a preparation for microarray analysis. Using these new protocols, RNA was extracted from several sets of seedlings grown in red light followed by blue light with one sample from 1.0g treatment and the other at µg. Using a 2-fold change criterion, microarray (Affymetrix, GeneChip) results showed that 613 genes were upregulated in the µg sample while 757 genes were downregulated. Upregulated genes in response to µg included transcription factors from the WRKY (15 genes), MYB (3) and ZF (8) families as well as those that are involved in auxin responses (10). Downregulated genes also included transcription factors such as MYB (5) and Zinc finger (10) but interestingly only two WRKY family genes were down-regulated during the µg treatment. Studies are underway to compare these results with other samples to identify the genes involved in the gravity and light signal transduction pathways (this project is Supported By: NASA NCC2-1200).

  16. Agrobacterium-mediated gene transfer in plants and biosafety considerations.

    Science.gov (United States)

    Mehrotra, Shweta; Goyal, Vinod

    2012-12-01

    Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.

  17. pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature

    Science.gov (United States)

    Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.

    2015-01-01

    Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475

  18. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  19. Endophytic Herbaspirillum seropedicae expresses nif genes in gramineous plants.

    Science.gov (United States)

    Roncato-Maccari, Lauren D B; Ramos, Humberto J O; Pedrosa, Fabio O; Alquini, Yedo; Chubatsu, Leda S; Yates, Marshall G; Rigo, Liu U; Steffens, Maria Berenice R; Souza, Emanuel M

    2003-07-01

    Abstract The interactions between maize, sorghum, wheat and rice plants and Herbaspirillum seropedicae were examined microscopically following inoculation with the H. seropedicae LR15 strain, a Nif(+) (Pnif::gusA) mutant obtained by the insertion of a gusA-kanamycin cassette into the nifH gene of the H. seropedicae wild-type strain. The expression of the Pnif::gusA fusion was followed during the association of the diazotroph with the gramineous species. Histochemical analysis of seedlings of maize, sorghum, wheat and rice grown in vermiculite showed that strain LR15 colonized root surfaces and inner tissues. In early steps of the endophytic association, H. seropedicae colonized root exudation sites, such as axils of secondary roots and intercellular spaces of the root cortex; it then occupied the vascular tissue and there expressed nif genes. The expression of nif genes occurred in roots, stems and leaves as detected by the GUS reporter system. The expression of nif genes was also observed in bacterial colonies located in the external mucilaginous root material, 8 days after inoculation. Moreover, the colonization of plant tissue by H. seropedicae did not depend on the nitrogen-fixing ability, since similar numbers of cells were isolated from roots or shoots of the plants inoculated with Nif(+) or Nif(-) strains.

  20. Effector gene birth in plant parasitic nematodes: Neofunctionalization of a housekeeping glutathione synthetase gene

    Science.gov (United States)

    Lilley, Catherine J.; Maqbool, Abbas; Wu, Duqing; Yusup, Hazijah B.; Jones, Laura M.; Birch, Paul R. J.; Urwin, Peter E.

    2018-01-01

    Plant pathogens and parasites are a major threat to global food security. Plant parasitism has arisen four times independently within the phylum Nematoda, resulting in at least one parasite of every major food crop in the world. Some species within the most economically important order (Tylenchida) secrete proteins termed effectors into their host during infection to re-programme host development and immunity. The precise detail of how nematodes evolve new effectors is not clear. Here we reconstruct the evolutionary history of a novel effector gene family. We show that during the evolution of plant parasitism in the Tylenchida, the housekeeping glutathione synthetase (GS) gene was extensively replicated. New GS paralogues acquired multiple dorsal gland promoter elements, altered spatial expression to the secretory dorsal gland, altered temporal expression to primarily parasitic stages, and gained a signal peptide for secretion. The gene products are delivered into the host plant cell during infection, giving rise to “GS-like effectors”. Remarkably, by solving the structure of GS-like effectors we show that during this process they have also diversified in biochemical activity, and likely represent the founding members of a novel class of GS-like enzyme. Our results demonstrate the re-purposing of an endogenous housekeeping gene to form a family of effectors with modified functions. We anticipate that our discovery will be a blueprint to understand the evolution of other plant-parasitic nematode effectors, and the foundation to uncover a novel enzymatic function. PMID:29641602

  1. Signal Network Analysis of Plant Genes Responding to Ionizing Radiation

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon

    2012-12-01

    In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication

  2. Gene Delivery into Plant Cells for Recombinant Protein Production

    Directory of Open Access Journals (Sweden)

    Qiang Chen

    2015-01-01

    Full Text Available Recombinant proteins are primarily produced from cultures of mammalian, insect, and bacteria cells. In recent years, the development of deconstructed virus-based vectors has allowed plants to become a viable platform for recombinant protein production, with advantages in versatility, speed, cost, scalability, and safety over the current production paradigms. In this paper, we review the recent progress in the methodology of agroinfiltration, a solution to overcome the challenge of transgene delivery into plant cells for large-scale manufacturing of recombinant proteins. General gene delivery methodologies in plants are first summarized, followed by extensive discussion on the application and scalability of each agroinfiltration method. New development of a spray-based agroinfiltration and its application on field-grown plants is highlighted. The discussion of agroinfiltration vectors focuses on their applications for producing complex and heteromultimeric proteins and is updated with the development of bridge vectors. Progress on agroinfiltration in Nicotiana and non-Nicotiana plant hosts is subsequently showcased in context of their applications for producing high-value human biologics and low-cost and high-volume industrial enzymes. These new advancements in agroinfiltration greatly enhance the robustness and scalability of transgene delivery in plants, facilitating the adoption of plant transient expression systems for manufacturing recombinant proteins with a broad range of applications.

  3. Calcium homeostasis in fly photoreceptor cells

    NARCIS (Netherlands)

    Oberwinkler, J

    2002-01-01

    In fly photoreceptor cells, two processes dominate the Ca2+ homeostasis: light-induced Ca2+ influx through members of the TRP family of ion channels, and Ca2+ extrusion by Na+/Ca2+ exchange.Ca2+ release from intracellular stores is quantitatively insignificant. Both, the light-activated channels and

  4. Major intrinsic proteins (MIPs) in plants: a complex gene family with major impacts on plant phenotype.

    Science.gov (United States)

    Forrest, Kerrie L; Bhave, Mrinal

    2007-10-01

    The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.

  5. Actin gene identification from selected medicinal plants for their use as internal controls for gene expression studies

    International Nuclear Information System (INIS)

    Mufti, F.U.D.; Banaras, S.

    2015-01-01

    Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)

  6. Coping with 'Dark Sides of the Sun' through Photoreceptor Signaling.

    Science.gov (United States)

    Demarsy, Emilie; Goldschmidt-Clermont, Michel; Ulm, Roman

    2018-03-01

    Plants grow in constantly changing environments, including highly variable light intensities. Sunlight provides the energy that drives photosynthesis and is thus of the utmost importance for plant growth and the generation of oxygen, which the majority of life on Earth depends on. However, exposure to either insufficient or excess levels of light can have detrimental effects and cause light stress. Whereas exposure to insufficient light limits photosynthetic activity, resulting in 'energy starvation', exposure to excess light can damage the photosynthetic apparatus. Furthermore, strong sunlight is associated with high levels of potentially damaging UV-B radiation. Different classes of photoreceptors play important roles in coping with the negative aspects of sunlight, for which specific mechanisms are emerging that are reviewed here. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  8. Hypoxic preconditioning protects photoreceptors against light damage independently of hypoxia inducible transcription factors in rods.

    Science.gov (United States)

    Kast, Brigitte; Schori, Christian; Grimm, Christian

    2016-05-01

    Hypoxic preconditioning protects photoreceptors against light-induced degeneration preserving retinal morphology and function. Although hypoxia inducible transcription factors 1 and 2 (HIF1, HIF2) are the main regulators of the hypoxic response, photoreceptor protection does not depend on HIF1 in rods. Here we used rod-specific Hif2a single and Hif1a;Hif2a double knockout mice to investigate the potential involvement of HIF2 in rods for protection after hypoxic preconditioning. To identify potential HIF2 target genes in rods we determined the retinal transcriptome of hypoxic control and rod-specific Hif2a knockouts by RNA sequencing. We show that rods do not need HIF2 for hypoxia-induced increased survival after light exposure. The transcriptomic analysis revealed a number of genes that are potentially regulated by HIF2 in rods; among those were Htra1, Timp3 and Hmox1, candidates that are interesting due to their connection to human degenerative diseases of the retina. We conclude that neither HIF1 nor HIF2 are required in photoreceptors for protection by hypoxic preconditioning. We hypothesize that HIF transcription factors may be needed in other cells to produce protective factors acting in a paracrine fashion on photoreceptor cells. Alternatively, hypoxic preconditioning induces a rod-intrinsic response that is independent of HIF transcription factors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.

    Science.gov (United States)

    Masle, Josette; Gilmore, Scott R; Farquhar, Graham D

    2005-08-11

    Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.

  10. Blue light alters miR167 expression and microRNA-targeted auxin response factor genes in Arabidopsis thaliana plants.

    Science.gov (United States)

    Pashkovskiy, Pavel P; Kartashov, Alexander V; Zlobin, Ilya E; Pogosyan, Sergei I; Kuznetsov, Vladimir V

    2016-07-01

    The effect of blue LED (450 nm) on the photomorphogenesis of Arabidopsis thaliana Col-0 plants and the transcript levels of several genes, including miRNAs, photoreceptors and auxin response factors (ARF) was investigated. It was observed that blue light accelerated the generative development, reduced the rosette leaf number, significantly reduced the leaf area, dry biomass and led to the disruption of conductive tissue formation. The blue LED differentially influenced the transcript levels of several phytochromes (PHY a, b, c, d, and e), cryptochromes (CRY 1 and 2) and phototropins (PHOT 1 and 2). At the same time, the blue LED significantly increased miR167 expression compared to a fluorescent lamp or white LEDs. This increase likely resulted in the enhanced transcription of the auxin response factor genes ARF4 and ARF8, which are regulated by this miRNA. These findings support the hypothesis that the effects of blue light on A. thaliana are mediated by auxin signalling pathway involving miRNA-dependent regulation of ARF gene expression. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  11. Roles of glucose in photoreceptor survival.

    Science.gov (United States)

    Chertov, Andrei O; Holzhausen, Lars; Kuok, Iok Teng; Couron, Drew; Parker, Ed; Linton, Jonathan D; Sadilek, Martin; Sweet, Ian R; Hurley, James B

    2011-10-07

    Vertebrate photoreceptor neurons have a high demand for metabolic energy, and their viability is very sensitive to genetic and environmental perturbations. We investigated the relationship between energy metabolism and cell death by evaluating the metabolic effects of glucose deprivation on mouse photoreceptors. Oxygen consumption, lactate production, ATP, NADH/NAD(+), TCA cycle intermediates, morphological changes, autophagy, and viability were evaluated. We compared retinas incubated with glucose to retinas deprived of glucose or retinas treated with a mixture of mitochondrion-specific fuels. Rapid and slow phases of cell death were identified. The rapid phase is linked to reduced mitochondrial activity, and the slower phase reflects a need for substrates for cell maintenance and repair.

  12. Moderate Light-Induced Degeneration of Rod Photoreceptors with Delayed Transducin Translocation in shaker1 Mice

    Science.gov (United States)

    Zallocchi, Marisa; Wang, Wei-Min; Delimont, Duane; Cosgrove, Dominic

    2011-01-01

    Purpose. Usher syndrome is characterized by congenital deafness associated with retinitis pigmentosa (RP). Mutations in the myosin VIIa gene (MYO7A) cause a common and severe subtype of Usher syndrome (USH1B). Shaker1 mice have mutant MYO7A. They are deaf and have vestibular dysfunction but do not develop photoreceptor degeneration. The goal of this study was to investigate abnormalities of photoreceptors in shaker1 mice. Methods. Immunocytochemistry and hydroethidine-based detection of intracellular superoxide production were used. Photoreceptor cell densities under various conditions of light/dark exposures were evaluated. Results. In shaker1 mice, the rod transducin translocation is delayed because of a shift of its light activation threshold to a higher level. Even moderate light exposure can induce oxidative damage and significant rod degeneration in shaker1 mice. Shaker1 mice reared under a moderate light/dark cycle develop severe retinal degeneration in less than 6 months. Conclusions. These findings show that, contrary to earlier studies, shaker1 mice possess a robust retinal phenotype that may link to defective rod protein translocation. Importantly, USH1B animal models are likely vulnerable to light-induced photoreceptor damage, even under moderate light. PMID:21447681

  13. Characterization of photoreceptor cell types in the little brown bat Myotis lucifugus (Vespertilionidae).

    Science.gov (United States)

    Feller, K D; Lagerholm, S; Clubwala, R; Silver, M T; Haughey, D; Ryan, J M; Loew, E R; Deutschlander, M E; Kenyon, K L

    2009-12-01

    We report the expression of three visual opsins in the retina of the little brown bat (Myotis lucifugus, Vespertilionidae). Gene sequences for a rod-specific opsin and two cone-specific opsins were cloned from cDNA derived from bat eyes. Comparative sequence analyses indicate that the two cone opsins correspond to an ultraviolet short-wavelength opsin (SWS1) and a long-wavelength opsin (LWS). Immunocytochemistry using antisera to visual opsins revealed that the little brown bat retina contains two types of cone photoreceptors within a rod-dominated background. However, unlike other mammalian photoreceptors, M. lucifugus cones and rods are morphologically indistinguishable by light microscopy. Both photoreceptor types have a thin, elongated outer segment. Using microspectrophotometry we classified the absorption spectrum for the ubiquitous rods. Similar to other mammals, bat rhodopsin has an absorption peak near 500 nm. Although we were unable to confirm a spectral range, cellular and molecular analyses indicate that M. lucifugus expresses two types of cone visual pigments located within the photoreceptor layer. This study provides important insights into the visual capacity of a nocturnal microchiropteran species.

  14. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  15. Plant responses to environmental stresses-from gene to biotechnology.

    Science.gov (United States)

    Ahanger, Mohammad Abass; Akram, Nudrat Aisha; Ashraf, Muhammad; Alyemeni, Mohammed Nasser; Wijaya, Leonard; Ahmad, Parvaiz

    2017-07-01

    Increasing global population, urbanization and industrialization are increasing the rate of conversion of arable land into wasteland. Supplying food to an ever-increasing population is one of the biggest challenges that agriculturalists and plant scientists are currently confronting. Environmental stresses make this situation even graver. Despite the induction of several tolerance mechanisms, sensitive plants often fail to survive under environmental extremes. New technological approaches are imperative. Conventional breeding methods have a limited potential to improve plant genomes against environmental stress. Recently, genetic engineering has contributed enormously to the development of genetically modified varieties of different crops such as cotton, maize, rice, canola and soybean. The identification of stress-responsive genes and their subsequent introgression or overexpression within sensitive crop species are now being widely carried out by plant scientists. Engineering of important tolerance pathways, like antioxidant enzymes, osmolyte accumulation, membrane-localized transporters for efficient compartmentation of deleterious ions and accumulation of essential elements and resistance against pests or pathogens is also an area that has been intensively researched. In this review, the role of biotechnology and its successes, prospects and challenges in developing stress-tolerant crop cultivars are discussed.

  16. Acute Zonal Cone Photoreceptor Outer Segment Loss.

    Science.gov (United States)

    Aleman, Tomas S; Sandhu, Harpal S; Serrano, Leona W; Traband, Anastasia; Lau, Marisa K; Adamus, Grazyna; Avery, Robert A

    2017-05-01

    The diagnostic path presented narrows down the cause of acute vision loss to the cone photoreceptor outer segment and will refocus the search for the cause of similar currently idiopathic conditions. To describe the structural and functional associations found in a patient with acute zonal occult photoreceptor loss. A case report of an adolescent boy with acute visual field loss despite a normal fundus examination performed at a university teaching hospital. Results of a complete ophthalmic examination, full-field flash electroretinography (ERG) and multifocal ERG, light-adapted achromatic and 2-color dark-adapted perimetry, and microperimetry. Imaging was performed with spectral-domain optical coherence tomography (SD-OCT), near-infrared (NIR) and short-wavelength (SW) fundus autofluorescence (FAF), and NIR reflectance (REF). The patient was evaluated within a week of the onset of a scotoma in the nasal field of his left eye. Visual acuity was 20/20 OU, and color vision was normal in both eyes. Results of the fundus examination and of SW-FAF and NIR-FAF imaging were normal in both eyes, whereas NIR-REF imaging showed a region of hyporeflectance temporal to the fovea that corresponded with a dense relative scotoma noted on light-adapted static perimetry in the left eye. Loss in the photoreceptor outer segment detected by SD-OCT co-localized with an area of dense cone dysfunction detected on light-adapted perimetry and multifocal ERG but with near-normal rod-mediated vision according to results of 2-color dark-adapted perimetry. Full-field flash ERG findings were normal in both eyes. The outer nuclear layer and inner retinal thicknesses were normal. Localized, isolated cone dysfunction may represent the earliest photoreceptor abnormality or a distinct entity within the acute zonal occult outer retinopathy complex. Acute zonal occult outer retinopathy should be considered in patients with acute vision loss and abnormalities on NIR-REF imaging, especially if

  17. OFD1, as a Ciliary Protein, Exhibits Neuroprotective Function in Photoreceptor Degeneration Models.

    Directory of Open Access Journals (Sweden)

    Juan Wang

    Full Text Available Ofd1 is a newly identified causative gene for Retinitis pigmentosa (RP, a photoreceptor degenerative disease. This study aimed to examine Ofd1 localization in retina and further to investigate its function in photoreceptor degeneration models. Ofd1 localization in rat retina was examined using immunofluorescence. N-methyl-N-nitrosourea (MNU-induced rats and Royal College of Surgeons (RCS rats were used as photoreceptor degeneration models. The expression pattern of Ofd1, other ciliary associated genes and Wnt signaling pathway genes were examined in rat models. Furthermore, pEGFP-Ofd1-CDS and pSUPER-Ofd1-shRNA were constructed to overexpress and knockdown the expression level in 661W and R28 cells. MNU was also used to induce cell death. Cilia formation was observed using immunocytochemistry (ICC. Reactive oxygen species (ROS were detected using the 2', 7'-Dichlorofluorescin diacetate (DCFH-DA assay. Apoptosis genes expression was examined using qRT-PCR, Western blotting and fluorescence-activated cell sorting (FACS. Ofd1 localized to outer segments of rat retina photoreceptors. Ofd1 and other ciliary proteins expression levels increased from the 1st and 4th postnatal weeks and decreased until the 6th week in the RCS rats, while their expression consistently decreased from the 1st and 7th day in the MNU rats. Moreover, Wnt signaling pathway proteins expression was significantly up-regulated in both rat models. Knockdown of Ofd1 expression resulted in a smaller population, shorter length of cell cilia, and lower cell viability. Ofd1 overexpression partially attenuated MNU toxic effects by reducing ROS levels and mitigating apoptosis. To the best of our knowledge, this is the first study demonstrating Ofd1 localization and its function in rat retina and in retinal degeneration rat models. Ofd1 plays a role in controlling photoreceptor cilium length and number. Importantly, it demonstrates a neuroprotective function by protecting the photoreceptor

  18. Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants

    Science.gov (United States)

    Basyuni, M.; Wati, R.

    2018-03-01

    The present study evaluates the bioinformatics methods to analyze twenty-four predicted polyprenol reductase genes from higher plants on GenBank as well as predicted the structure, composition, similarity, subcellular localization, and phylogenetic. The physicochemical properties of plant polyprenol showed diversity among the observed genes. The percentage of the secondary structure of plant polyprenol genes followed the ratio order of α helix > random coil > extended chain structure. The values of chloroplast but not signal peptide were too low, indicated that few chloroplast transit peptide in plant polyprenol reductase genes. The possibility of the potential transit peptide showed variation among the plant polyprenol reductase, suggested the importance of understanding the variety of peptide components of plant polyprenol genes. To clarify this finding, a phylogenetic tree was drawn. The phylogenetic tree shows several branches in the tree, suggested that plant polyprenol reductase genes grouped into divergent clusters in the tree.

  19. Functional photoreceptor loss revealed with adaptive optics: an alternate cause of color blindness.

    Science.gov (United States)

    Carroll, Joseph; Neitz, Maureen; Hofer, Heidi; Neitz, Jay; Williams, David R

    2004-06-01

    There is enormous variation in the X-linked L/M (long/middle wavelength sensitive) gene array underlying "normal" color vision in humans. This variability has been shown to underlie individual variation in color matching behavior. Recently, red-green color blindness has also been shown to be associated with distinctly different genotypes. This has opened the possibility that there may be important phenotypic differences within classically defined groups of color blind individuals. Here, adaptive optics retinal imaging has revealed a mechanism for producing dichromatic color vision in which the expression of a mutant cone photopigment gene leads to the loss of the entire corresponding class of cone photoreceptor cells. Previously, the theory that common forms of inherited color blindness could be caused by the loss of photoreceptor cells had been discounted. We confirm that remarkably, this loss of one-third of the cones does not impair any aspect of vision other than color.

  20. The role of carcinine in signaling at the Drosophila photoreceptor synapse.

    Directory of Open Access Journals (Sweden)

    Brendan A Gavin

    2007-12-01

    Full Text Available The Drosophila melanogaster photoreceptor cell has long served as a model system for researchers focusing on how animal sensory neurons receive information from their surroundings and translate this information into chemical and electrical messages. Electroretinograph (ERG analysis of Drosophila mutants has helped to elucidate some of the genes involved in the visual transduction pathway downstream of the photoreceptor cell, and it is now clear that photoreceptor cell signaling is dependent upon the proper release and recycling of the neurotransmitter histamine. While the neurotransmitter transporters responsible for clearing histamine, and its metabolite carcinine, from the synaptic cleft have remained unknown, a strong candidate for a transporter of either substrate is the uncharacterized inebriated protein. The inebriated gene (ine encodes a putative neurotransmitter transporter that has been localized to photoreceptor cells in Drosophila and mutations in ine result in an abnormal ERG phenotype in Drosophila. Loss-of-function mutations in ebony, a gene required for the synthesis of carcinine in Drosophila, suppress components of the mutant ine ERG phenotype, while loss-of-function mutations in tan, a gene necessary for the hydrolysis of carcinine in Drosophila, have no effect on the ERG phenotype in ine mutants. We also show that by feeding wild-type flies carcinine, we can duplicate components of mutant ine ERGs. Finally, we demonstrate that treatment with H(3 receptor agonists or inverse agonists rescue several components of the mutant ine ERG phenotype. Here, we provide pharmacological and genetic epistatic evidence that ine encodes a carcinine neurotransmitter transporter. We also speculate that the oscillations observed in mutant ine ERG traces are the result of the aberrant activity of a putative H(3 receptor.

  1. The Role of Carcinine in Signaling at the Drosophila Photoreceptor Synapse

    Science.gov (United States)

    Gavin, Brendan A; Arruda, Susan E; Dolph, Patrick J

    2007-01-01

    The Drosophila melanogaster photoreceptor cell has long served as a model system for researchers focusing on how animal sensory neurons receive information from their surroundings and translate this information into chemical and electrical messages. Electroretinograph (ERG) analysis of Drosophila mutants has helped to elucidate some of the genes involved in the visual transduction pathway downstream of the photoreceptor cell, and it is now clear that photoreceptor cell signaling is dependent upon the proper release and recycling of the neurotransmitter histamine. While the neurotransmitter transporters responsible for clearing histamine, and its metabolite carcinine, from the synaptic cleft have remained unknown, a strong candidate for a transporter of either substrate is the uncharacterized inebriated protein. The inebriated gene (ine) encodes a putative neurotransmitter transporter that has been localized to photoreceptor cells in Drosophila and mutations in ine result in an abnormal ERG phenotype in Drosophila. Loss-of-function mutations in ebony, a gene required for the synthesis of carcinine in Drosophila, suppress components of the mutant ine ERG phenotype, while loss-of-function mutations in tan, a gene necessary for the hydrolysis of carcinine in Drosophila, have no effect on the ERG phenotype in ine mutants. We also show that by feeding wild-type flies carcinine, we can duplicate components of mutant ine ERGs. Finally, we demonstrate that treatment with H3 receptor agonists or inverse agonists rescue several components of the mutant ine ERG phenotype. Here, we provide pharmacological and genetic epistatic evidence that ine encodes a carcinine neurotransmitter transporter. We also speculate that the oscillations observed in mutant ine ERG traces are the result of the aberrant activity of a putative H3 receptor. PMID:18069895

  2. Retinal cone photoreceptors of the deer mouse Peromyscus maniculatus: development, topography, opsin expression and spectral tuning.

    Directory of Open Access Journals (Sweden)

    Patrick Arbogast

    Full Text Available A quantitative analysis of photoreceptor properties was performed in the retina of the nocturnal deer mouse, Peromyscus maniculatus, using pigmented (wildtype and albino animals. The aim was to establish whether the deer mouse is a more suitable model species than the house mouse for photoreceptor studies, and whether oculocutaneous albinism affects its photoreceptor properties. In retinal flatmounts, cone photoreceptors were identified by opsin immunostaining, and their numbers, spectral types, and distributions across the retina were determined. Rod photoreceptors were counted using differential interference contrast microscopy. Pigmented P. maniculatus have a rod-dominated retina with rod densities of about 450.000/mm(2 and cone densities of 3000-6500/mm(2. Two cone opsins, shortwave sensitive (S and middle-to-longwave sensitive (M, are present and expressed in distinct cone types. Partial sequencing of the S opsin gene strongly supports UV sensitivity of the S cone visual pigment. The S cones constitute a 5-15% minority of the cones. Different from house mouse, S and M cone distributions do not have dorsoventral gradients, and coexpression of both opsins in single cones is exceptional (<2% of the cones. In albino P. maniculatus, rod densities are reduced by approximately 40% (270.000/mm(2. Overall, cone density and the density of cones exclusively expressing S opsin are not significantly different from pigmented P. maniculatus. However, in albino retinas S opsin is coexpressed with M opsin in 60-90% of the cones and therefore the population of cones expressing only M opsin is significantly reduced to 5-25%. In conclusion, deer mouse cone properties largely conform to the general mammalian pattern, hence the deer mouse may be better suited than the house mouse for the study of certain basic cone properties, including the effects of albinism on cone opsin expression.

  3. DELLA genes restrict inflorescence meristem function independently of plant height.

    Science.gov (United States)

    Serrano-Mislata, Antonio; Bencivenga, Stefano; Bush, Max; Schiessl, Katharina; Boden, Scott; Sablowski, Robert

    2017-09-01

    DELLA proteins associate with transcription factors to control plant growth in response to gibberellin 1 . Semi-dwarf DELLA mutants with improved harvest index and decreased lodging greatly improved global food security during the 'green revolution' in the 1960-1970s 2 . However, DELLA mutants are pleiotropic and the developmental basis for their effects on plant architecture remains poorly understood. Here, we show that DELLA proteins have genetically separable roles in controlling stem growth and the size of the inflorescence meristem, where flowers initiate. Quantitative three-dimensional image analysis, combined with a genome-wide screen for DELLA-bound loci in the inflorescence tip, revealed that DELLAs limit meristem size in Arabidopsis by directly upregulating the cell-cycle inhibitor KRP2 in the underlying rib meristem, without affecting the canonical WUSCHEL-CLAVATA meristem size regulators 3 . Mutation of KRP2 in a DELLA semi-dwarf background restored meristem size, but not stem growth, and accelerated flower production. In barley, secondary mutations in the DELLA gain-of-function mutant Sln1d 4 also uncoupled meristem and inflorescence size from plant height. Our work reveals an unexpected and conserved role for DELLA genes in controlling shoot meristem function and suggests how dissection of pleiotropic DELLA functions could unlock further yield gains in semi-dwarf mutants.

  4. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  5. Different effects of valproic acid on photoreceptor loss in Rd1 and Rd10 retinal degeneration mice.

    Science.gov (United States)

    Mitton, Kenneth P; Guzman, Alvaro E; Deshpande, Mrinalini; Byrd, David; DeLooff, Camryn; Mkoyan, Kristina; Zlojutro, Paul; Wallace, Adrianne; Metcalf, Brandon; Laux, Kirsten; Sotzen, Jason; Tran, Trung

    2014-01-01

    The histone-deacetylase inhibitor activity of valproic acid (VPA) was discovered after VPA's adoption as an anticonvulsant. This generated speculation for VPA's potential to increase the expression of neuroprotective genes. Clinical trials for retinitis pigmentosa (RP) are currently active, testing VPA's potential to reduce photoreceptor loss; however, we lack information regarding the effects of VPA on available mammalian models of retinal degeneration, nor do we know if retinal gene expression is perturbed by VPA in a predictable way. Thus, we examined the effects of systemic VPA on neurotrophic factor and Nrl-related gene expression in the mouse retina and compared VPA's effects on the rate of photoreceptor loss in two strains of mice, Pde6b(rd1/rd1) and Pde6b(rd10/rd10) . The expression of Bdnf, Gdnf, Cntf, and Fgf2 was measured by quantitative PCR after single and multiple doses of VPA (intraperitoneal) in wild-type and Pde6b(rd1/rd1) mice. Pde6b(rd1/rd1) mice were treated with daily doses of VPA during the period of rapid photoreceptor loss. Pde6b(rd10/rd10) mice were also treated with systemic VPA to compare in a partial loss-of-function model. Retinal morphology was assessed by virtual microscopy or spectral-domain optical coherence tomography (SD-OCT). Full-field and focal electroretinography (ERG) analysis were employed with Pde6b(rd10/rd10) mice to measure retinal function. In wild-type postnatal mice, a single VPA dose increased the expression of Bdnf and Gdnf in the neural retina after 18 h, while the expression of Cntf was reduced by 70%. Daily dosing of wild-type mice from postnatal day P17 to P28 resulted in smaller increases in Bdnf and Gdnf expression, normal Cntf expression, and reduced Fgf2 expression (25%). Nrl gene expression was decreased by 50%, while Crx gene expression was not affected. Rod-specific expression of Mef2c and Nr2e3 was decreased substantially by VPA treatment, while Rhodopsin and Pde6b gene expression was normal at P28. Daily

  6. The compact Selaginella genome identifies changes in gene content associated with the evolution of vascular plants

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.; Banks, Jo Ann; Nishiyama, Tomoaki; Hasebe, Mitsuyasu; Bowman, John L.; Gribskov, Michael; dePamphilis, Claude; Albert, Victor A.; Aono, Naoki; Aoyama, Tsuyoshi; Ambrose, Barbara A.; Ashton, Neil W.; Axtell, Michael J.; Barker, Elizabeth; Barker, Michael S.; Bennetzen, Jeffrey L.; Bonawitz, Nicholas D.; Chapple, Clint; Cheng, Chaoyang; Correa, Luiz Gustavo Guedes; Dacre, Michael; DeBarry, Jeremy; Dreyer, Ingo; Elias, Marek; Engstrom, Eric M.; Estelle, Mark; Feng, Liang; Finet, Cedric; Floyd, Sandra K.; Frommer, Wolf B.; Fujita, Tomomichi; Gramzow, Lydia; Gutensohn, Michael; Harholt, Jesper; Hattori, Mitsuru; Heyl, Alexander; Hirai, Tadayoshi; Hiwatashi, Yuji; Ishikawa, Masaki; Iwata, Mineko; Karol, Kenneth G.; Koehler, Barbara; Kolukisaoglu, Uener; Kubo, Minoru; Kurata, Tetsuya; Lalonde, Sylvie; Li, Kejie; Li, Ying; Litt, Amy; Lyons, Eric; Manning, Gerard; Maruyama, Takeshi; Michael, Todd P.; Mikami, Koji; Miyazaki, Saori; Morinaga, Shin-ichi; Murata, Takashi; Mueller-Roeber, Bernd; Nelson, David R.; Obara, Mari; Oguri, Yasuko; Olmstead, Richard G.; Onodera, Naoko; Petersen, Bent Larsen; Pils, Birgit; Prigge, Michael; Rensing, Stefan A.; Riano-Pachon, Diego Mauricio; Roberts, Alison W.; Sato, Yoshikatsu; Scheller, Henrik Vibe; Schulz, Burkhard; Schulz, Christian; Shakirov, Eugene V.; Shibagaki, Nakako; Shinohara, Naoki; Shippen, Dorothy E.; Sorensen, Iben; Sotooka, Ryo; Sugimoto, Nagisa; Sugita, Mamoru; Sumikawa, Naomi; Tanurdzic, Milos; Theilsen, Gunter; Ulvskov, Peter; Wakazuki, Sachiko; Weng, Jing-Ke; Willats, William W.G.T.; Wipf, Daniel; Wolf, Paul G.; Yang, Lixing; Zimmer, Andreas D.; Zhu, Qihui; Mitros, Therese; Hellsten, Uffe; Loque, Dominique; Otillar, Robert; Salamov, Asaf; Schmutz, Jeremy; Shapiro, Harris; Lindquist, Erika; Lucas, Susan; Rokhsar, Daniel

    2011-04-28

    We report the genome sequence of the nonseed vascular plant, Selaginella moellendorffii, and by comparative genomics identify genes that likely played important roles in the early evolution of vascular plants and their subsequent evolution

  7. Ferritin gene organization: differences between plants and animals suggest possible kingdom-specific selective constraints.

    Science.gov (United States)

    Proudhon, D; Wei, J; Briat, J; Theil, E C

    1996-03-01

    Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may

  8. Genetic Dissection of Dual Roles for the Transcription Factor six7 in Photoreceptor Development and Patterning in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Mailin Sotolongo-Lopez

    2016-04-01

    Full Text Available The visual system of a particular species is highly adapted to convey detailed ecological and behavioral information essential for survival. The consequences of structural mutations of opsins upon spectral sensitivity and environmental adaptation have been studied in great detail, but lacking is knowledge of the potential influence of alterations in gene regulatory networks upon the diversity of cone subtypes and the variation in the ratio of rods and cones observed in numerous diurnal and nocturnal species. Exploiting photoreceptor patterning in cone-dominated zebrafish, we uncovered two independent mechanisms by which the sine oculis homeobox homolog 7 (six7 regulates photoreceptor development. In a genetic screen, we isolated the lots-of-rods-junior (ljrp23ahub mutation that resulted in an increased number and uniform distribution of rods in otherwise normal appearing larvae. Sequence analysis, genome editing using TALENs and knockdown strategies confirm ljrp23ahub as a hypomorphic allele of six7, a teleost orthologue of six3, with known roles in forebrain patterning and expression of opsins. Based on the lack of predicted protein-coding changes and a deletion of a conserved element upstream of the transcription start site, a cis-regulatory mutation is proposed as the basis of the reduced expression of six7 in ljrp23ahub. Comparison of the phenotypes of the hypomorphic and knock-out alleles provides evidence of two independent roles in photoreceptor development. EdU and PH3 labeling show that the increase in rod number is associated with extended mitosis of photoreceptor progenitors, and TUNEL suggests that the lack of green-sensitive cones is the result of cell death of the cone precursor. These data add six7 to the small but growing list of essential genes for specification and patterning of photoreceptors in non-mammalian vertebrates, and highlight alterations in transcriptional regulation as a potential source of photoreceptor variation

  9. New insights on the evolution of Leafy cotyledon1 (LEC1) type genes in vascular plants.

    Science.gov (United States)

    Cagliari, Alexandro; Turchetto-Zolet, Andreia Carina; Korbes, Ana Paula; Maraschin, Felipe Dos Santos; Margis, Rogerio; Margis-Pinheiro, Marcia

    2014-01-01

    NF-Y is a conserved oligomeric transcription factor found in all eukaryotes. In plants, this regulator evolved with a broad diversification of the genes coding for its three subunits (NF-YA, NF-YB and NF-YC). The NF-YB members can be divided into Leafy Cotyledon1 (LEC1) and non-LEC1 types. Here we presented a comparative genomic study using phylogenetic analyses to validate an evolutionary model for the origin of LEC-type genes in plants and their emergence from non-LEC1-type genes. We identified LEC1-type members in all vascular plant genomes, but not in amoebozoa, algae, fungi, metazoa and non-vascular plant representatives, which present exclusively non-LEC1-type genes as constituents of their NF-YB subunits. The non-synonymous to synonymous nucleotide substitution rates (Ka/Ks) between LEC1 and non-LEC1-type genes indicate the presence of positive selection acting on LEC1-type members to the fixation of LEC1-specific amino acid residues. The phylogenetic analyses demonstrated that plant LEC1-type genes are evolutionary divergent from the non-LEC1-type genes of plants, fungi, amoebozoa, algae and animals. Our results point to a scenario in which LEC1-type genes have originated in vascular plants after gene expansion in plants. We suggest that processes of neofunctionalization and/or subfunctionalization were responsible for the emergence of a versatile role for LEC1-type genes in vascular plants, especially in seed plants. LEC1-type genes besides being phylogenetic divergent also present different expression profile when compared with non-LEC1-type genes. Altogether, our data provide new insights about the LEC1 and non-LEC1 evolutionary relationship during the vascular plant evolution. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

    Science.gov (United States)

    Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

    2018-01-01

    DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

  11. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  12. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés

    2014-03-01

    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  13. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  14. Horizontal transfer of a subtilisin gene from plants into an ancestor of the plant pathogenic fungal genus Colletotrichum.

    Science.gov (United States)

    Armijos Jaramillo, Vinicio Danilo; Vargas, Walter Alberto; Sukno, Serenella Ana; Thon, Michael R

    2013-01-01

    The genus Colletotrichum contains a large number of phytopathogenic fungi that produce enormous economic losses around the world. The effect of horizontal gene transfer (HGT) has not been studied yet in these organisms. Inter-Kingdom HGT into fungal genomes has been reported in the past but knowledge about the HGT between plants and fungi is particularly limited. We describe a gene in the genome of several species of the genus Colletotrichum with a strong resemblance to subtilisins typically found in plant genomes. Subtilisins are an important group of serine proteases, widely distributed in all of the kingdoms of life. Our hypothesis is that the gene was acquired by Colletotrichum spp. through (HGT) from plants to a Colletotrichum ancestor. We provide evidence to support this hypothesis in the form of phylogenetic analyses as well as a characterization of the similarity of the subtilisin at the primary, secondary and tertiary structural levels. The remarkable level of structural conservation of Colletotrichum plant-like subtilisin (CPLS) with plant subtilisins and the differences with the rest of Colletotrichum subtilisins suggests the possibility of molecular mimicry. Our phylogenetic analysis indicates that the HGT event would have occurred approximately 150-155 million years ago, after the divergence of the Colletotrichum lineage from other fungi. Gene expression analysis shows that the gene is modulated during the infection of maize by C. graminicola suggesting that it has a role in plant disease. Furthermore, the upregulation of the CPLS coincides with the downregulation of several plant genes encoding subtilisins. Based on the known roles of subtilisins in plant pathogenic fungi and the gene expression pattern that we observed, we postulate that the CPLSs have an important role in plant infection.

  15. Exploring Plant Co-Expression and Gene-Gene Interactions with CORNET 3.0.

    Science.gov (United States)

    Van Bel, Michiel; Coppens, Frederik

    2017-01-01

    Selecting and filtering a reference expression and interaction dataset when studying specific pathways and regulatory interactions can be a very time-consuming and error-prone task. In order to reduce the duplicated efforts required to amass such datasets, we have created the CORNET (CORrelation NETworks) platform which allows for easy access to a wide variety of data types: coexpression data, protein-protein interactions, regulatory interactions, and functional annotations. The CORNET platform outputs its results in either text format or through the Cytoscape framework, which is automatically launched by the CORNET website.CORNET 3.0 is the third iteration of the web platform designed for the user exploration of the coexpression space of plant genomes, with a focus on the model species Arabidopsis thaliana. Here we describe the platform: the tools, data, and best practices when using the platform. We indicate how the platform can be used to infer networks from a set of input genes, such as upregulated genes from an expression experiment. By exploring the network, new target and regulator genes can be discovered, allowing for follow-up experiments and more in-depth study. We also indicate how to avoid common pitfalls when evaluating the networks and how to avoid over interpretation of the results.All CORNET versions are available at http://bioinformatics.psb.ugent.be/cornet/ .

  16. Phylogenetics and evolution of Trx SET genes in fully sequenced land plants.

    Science.gov (United States)

    Zhu, Xinyu; Chen, Caoyi; Wang, Baohua

    2012-04-01

    Plant Trx SET proteins are involved in H3K4 methylation and play a key role in plant floral development. Genes encoding Trx SET proteins constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. To investigate the evolutionary history of the Trx SET gene family, we made a comprehensive evolutionary analysis on this gene family from 13 major representatives of green plants. A novel clustering (here named as cpTrx clade), which included the III-1, III-2, and III-4 orthologous groups, previously resolved was identified. Our analysis showed that plant Trx proteins possessed a variety of domain organizations and gene structures among paralogs. Additional domains such as PHD, PWWP, and FYR were early integrated into primordial SET-PostSET domain organization of cpTrx clade. We suggested that the PostSET domain was lost in some members of III-4 orthologous group during the evolution of land plants. At least four classes of gene structures had been formed at the early evolutionary stage of land plants. Three intronless orphan Trx SET genes from the Physcomitrella patens (moss) were identified, and supposedly, their parental genes have been eliminated from the genome. The structural differences among evolutionary groups of plant Trx SET genes with different functions were described, contributing to the design of further experimental studies.

  17. Phylogenomic analysis demonstrates a pattern of rare and ancient horizontal gene transfer between plants and fungi.

    Science.gov (United States)

    Richards, Thomas A; Soanes, Darren M; Foster, Peter G; Leonard, Guy; Thornton, Christopher R; Talbot, Nicholas J

    2009-07-01

    Horizontal gene transfer (HGT) describes the transmission of genetic material across species boundaries and is an important evolutionary phenomenon in the ancestry of many microbes. The role of HGT in plant evolutionary history is, however, largely unexplored. Here, we compare the genomes of six plant species with those of 159 prokaryotic and eukaryotic species and identify 1689 genes that show the highest similarity to corresponding genes from fungi. We constructed a phylogeny for all 1689 genes identified and all homolog groups available from the rice (Oryza sativa) genome (3177 gene families) and used these to define 14 candidate plant-fungi HGT events. Comprehensive phylogenetic analyses of these 14 data sets, using methods that account for site rate heterogeneity, demonstrated support for nine HGT events, demonstrating an infrequent pattern of HGT between plants and fungi. Five HGTs were fungi-to-plant transfers and four were plant-to-fungi HGTs. None of the fungal-to-plant HGTs involved angiosperm recipients. These results alter the current view of organismal barriers to HGT, suggesting that phagotrophy, the consumption of a whole cell by another, is not necessarily a prerequisite for HGT between eukaryotes. Putative functional annotation of the HGT candidate genes suggests that two fungi-to-plant transfers have added phenotypes important for life in a soil environment. Our study suggests that genetic exchange between plants and fungi is exceedingly rare, particularly among the angiosperms, but has occurred during their evolutionary history and added important metabolic traits to plant lineages.

  18. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  19. Patterns of nucleotide diversity at photoperiod related genes in Norway spruce [Picea abies (L.) Karst].

    Science.gov (United States)

    Källman, Thomas; De Mita, Stéphane; Larsson, Hanna; Gyllenstrand, Niclas; Heuertz, Myriam; Parducci, Laura; Suyama, Yoshihisa; Lagercrantz, Ulf; Lascoux, Martin

    2014-01-01

    The ability of plants to track seasonal changes is largely dependent on genes assigned to the photoperiod pathway, and variation in those genes is thereby important for adaptation to local day length conditions. Extensive physiological data in several temperate conifer species suggest that populations are adapted to local light conditions, but data on the genes underlying this adaptation are more limited. Here we present nucleotide diversity data from 19 genes putatively involved in photoperiodic response in Norway spruce (Picea abies). Based on similarity to model plants the genes were grouped into three categories according to their presumed position in the photoperiod pathway: photoreceptors, circadian clock genes, and downstream targets. An HKA (Hudson, Kreitman and Aquade) test showed a significant excess of diversity at photoreceptor genes, but no departure from neutrality at circadian genes and downstream targets. Departures from neutrality were also tested with Tajima's D and Fay and Wu's H statistics under three demographic scenarios: the standard neutral model, a population expansion model, and a more complex population split model. Only one gene, the circadian clock gene PaPRR3 with a highly positive Tajima's D value, deviates significantly from all tested demographic scenarios. As the PaPRR3 gene harbours multiple non-synonymous variants it appears as an excellent candidate gene for control of photoperiod response in Norway spruce.

  20. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

    Science.gov (United States)

    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

    1995-09-01

    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  1. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  2. A plant defensin gene from Orychophragmus violaceus can improve ...

    African Journals Online (AJOL)

    Quantitative RT-PCR showed that the expression of Ovd in the sense plant line was stronger than non-transformed plant and antisense plant. The lesion size on detached leaves of the transgenic plants and nontransformed control caused by Sclerotinia sclerotiorum mycelia was examined. Lesion size was reduced in sense ...

  3. The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses

    Directory of Open Access Journals (Sweden)

    Yuling Bai

    2018-06-01

    Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.

  4. Expression of TLP-3 gene without signal peptide in tobacco plants ...

    African Journals Online (AJOL)

    Expression of TLP-3 gene without signal peptide in tobacco plants using Agrobacterium mediated transformation. ... Plants are exploited as a source of food by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. So paying attention to their protection is very important.

  5. plantiSMASH: automated identification, annotation and expression analysis of plant biosynthetic gene clusters

    DEFF Research Database (Denmark)

    Kautsar, Satria A.; Suarez Duran, Hernando G.; Blin, Kai

    2017-01-01

    exploration of the nature and dynamics of gene clustering in plant metabolism. Moreover, spurred by the continuing decrease in costs of plant genome sequencing, they will allow genome mining technologies to be applied to plant natural product discovery. The plantiSMASH web server, precalculated results...

  6. RPGR: Its role in photoreceptor physiology, human disease, and future therapies.

    Science.gov (United States)

    Megaw, Roly D; Soares, Dinesh C; Wright, Alan F

    2015-09-01

    Mammalian photoreceptors contain specialised connecting cilia that connect the inner (IS) to the outer segments (OS). Dysfunction of the connecting cilia due to mutations in ciliary proteins are a common cause of the inherited retinal dystrophy retinitis pigmentosa (RP). Mutations affecting the Retinitis Pigmentosa GTPase Regulator (RPGR) protein is one such cause, affecting 10-20% of all people with RP and the majority of those with X-linked RP. RPGR is located in photoreceptor connecting cilia. It interacts with a wide variety of ciliary proteins, but its exact function is unknown. Recently, there have been important advances both in our understanding of RPGR function and towards the development of a therapy. This review summarises the existing literature on human RPGR function and dysfunction, and suggests that RPGR plays a role in the function of the ciliary gate, which controls access of both membrane and soluble proteins to the photoreceptor outer segment. We discuss key models used to investigate and treat RPGR disease and suggest that gene augmentation therapy offers a realistic therapeutic approach, although important questions still remain to be answered, while cell replacement therapy based on retinal progenitor cells represents a more distant prospect. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Gnaz couples the circadian and dopaminergic system to G protein-mediated signaling in mouse photoreceptors.

    Directory of Open Access Journals (Sweden)

    Patrick Vancura

    Full Text Available The mammalian retina harbors a circadian clockwork that regulates vision and promotes healthiness of retinal neurons, mainly through directing the rhythmic release of the neurohormones dopamine-acting on dopamine D4 receptors-and melatonin-acting on MT1 and MT2 receptors. The gene Gnaz-a unique Gi/o subfamily member-was seen in the present study to be expressed in photoreceptors where its protein product Gαz shows a daily rhythm in its subcellular localization. Apart from subcellular localization, Gnaz displays a daily rhythm in expression-with peak values at night-in preparations of the whole retina, microdissected photoreceptors and photoreceptor-related pinealocytes. In retina, Gnaz rhythmicity was observed to persist under constant darkness and to be abolished in retina deficient for Clock or dopamine D4 receptors. Furthermore, circadian regulation of Gnaz was disturbed in the db/db mouse, a model of diabetic retinopathy. The data of the present study suggest that Gnaz links the circadian clockwork-via dopamine acting on D4 receptors-to G protein-mediated signaling in intact but not diabetic retina.

  8. Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment.

    Science.gov (United States)

    Schietroma, Cataldo; Parain, Karine; Estivalet, Amrit; Aghaie, Asadollah; Boutet de Monvel, Jacques; Picaud, Serge; Sahel, José-Alain; Perron, Muriel; El-Amraoui, Aziz; Petit, Christine

    2017-06-05

    Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis , these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23 , encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15-containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. © 2017 Schietroma et al.

  9. Usher syndrome type 1–associated cadherins shape the photoreceptor outer segment

    Science.gov (United States)

    Parain, Karine; Aghaie, Asadollah; Picaud, Serge

    2017-01-01

    Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis, these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23, encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15–containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. PMID:28495838

  10. NADPH Oxidase Contributes to Photoreceptor Degeneration in Constitutively Active RAC1 Mice

    Science.gov (United States)

    Song, Hongman; Vijayasarathy, Camasamudram; Zeng, Yong; Marangoni, Dario; Bush, Ronald A.; Wu, Zhijian; Sieving, Paul A.

    2016-01-01

    Purpose The active form of small GTPase RAC1 is required for activation of NADPH oxidase (NOX), which in turn generates reactive oxygen species (ROS) in nonphagocytic cells. We explored whether NOX-induced oxidative stress contributes to rod degeneration in retinas expressing constitutively active (CA) RAC1. Methods Transgenic (Tg)–CA-RAC1 mice were given apocynin (10 mg/kg, intraperitoneal), a NOX inhibitor, or vehicle daily for up to 13 weeks. Superoxide production and oxidative damage were assessed by dihydroethidium staining and by protein carbonyls and malondialdehyde levels, respectively. Outer nuclear layer (ONL) cells were counted and electroretinogram (ERG) amplitudes measured in Tg-CA-RAC1 mice. Outer nuclear layer cells were counted in wild-type (WT) mice after transfer of CA-Rac1 gene by subretinal injection of AAV8-pOpsin-CA Rac1-GFP. Results Transgenic-CA-RAC1 retinas had significantly fewer photoreceptor cells and more apoptotic ONL cells than WT controls from postnatal week (Pw) 3 to Pw13. Superoxide accumulation and protein and lipid oxidation were increased in Tg-CA-RAC1 retinas and were reduced in mice treated with apocynin. Apocynin reduced the loss of photoreceptors and increased the rod ERG a- and b-wave amplitudes when compared with vehicle-injected transgenic controls. Photoreceptor loss was also observed in regions of adult WT retina transduced with AAV8-pOpsin-CA Rac1-GFP but not in neighboring regions that were not transduced or in AAV8-pOpsin-GFP–transduced retinas. Conclusions Constitutively active RAC1 promotes photoreceptor cell death by oxidative damage that occurs, at least partially, through NOX-induced ROS. Reactive oxygen species are likely involved in multiple forms of retinal degenerations, and our results support investigating RAC1 inhibition as a therapeutic approach that targets this disease pathway. PMID:27233035

  11. Cryptochrome photoreceptors in green algae: Unexpected versatility of mechanisms and functions.

    Science.gov (United States)

    Kottke, Tilman; Oldemeyer, Sabine; Wenzel, Sandra; Zou, Yong; Mittag, Maria

    2017-10-01

    Green algae have a highly complex and diverse set of cryptochrome photoreceptor candidates including members of the following subfamilies: plant, plant-like, animal-like, DASH and cryptochrome photolyase family 1 (CPF1). While some green algae encode most or all of them, others lack certain members. Here we present an overview about functional analyses of so far investigated cryptochrome photoreceptors from the green algae Chlamydomonas reinhardtii (plant and animal-like cryptochromes) and Ostreococcus tauri (CPF1) with regard to their biological significance and spectroscopic properties. Cryptochromes of both algae have been demonstrated recently to be involved to various extents in circadian clock regulation and in Chlamydomonas additionally in life cycle control. Moreover, CPF1 even performs light-driven DNA repair. The plant cryptochrome and CPF1 are UVA/blue light receptors, whereas the animal-like cryptochrome responds to almost the whole visible spectrum including red light. Accordingly, plant cryptochrome, animal-like cryptochrome and CPF1 differ fundamentally in their structural response to light as revealed by their visible and infrared spectroscopic signatures, and in the role of the flavin neutral radical acting as dark form or signaling state. Copyright © 2017 Elsevier GmbH. All rights reserved.

  12. Gene expression in plant lipid metabolism in Arabidopsis seedlings.

    Directory of Open Access Journals (Sweden)

    An-Shan Hsiao

    Full Text Available Events in plant lipid metabolism are important during seedling establishment. As it has not been experimentally verified whether lipid metabolism in 2- and 5-day-old Arabidopsis thaliana seedlings is diurnally-controlled, quantitative real-time PCR analysis was used to investigate the expression of target genes in acyl-lipid transfer, β-oxidation and triacylglycerol (TAG synthesis and hydrolysis in wild-type Arabidopsis WS and Col-0. In both WS and Col-0, ACYL-COA-BINDING PROTEIN3 (ACBP3, DIACYLGLYCEROL ACYLTRANSFERASE1 (DGAT1 and DGAT3 showed diurnal control in 2- and 5-day-old seedlings. Also, COMATOSE (CTS was diurnally regulated in 2-day-old seedlings and LONG-CHAIN ACYL-COA SYNTHETASE6 (LACS6 in 5-day-old seedlings in both WS and Col-0. Subsequently, the effect of CIRCADIAN CLOCK ASSOCIATED1 (CCA1 and LATE ELONGATED HYPOCOTYL (LHY from the core clock system was examined using the cca1lhy mutant and CCA1-overexpressing (CCA1-OX lines versus wild-type WS and Col-0, respectively. Results revealed differential gene expression in lipid metabolism between 2- and 5-day-old mutant and wild-type WS seedlings, as well as between CCA1-OX and wild-type Col-0. Of the ACBPs, ACBP3 displayed the most significant changes between cca1lhy and WS and between CCA1-OX and Col-0, consistent with previous reports that ACBP3 is greatly affected by light/dark cycling. Evidence of oil body retention in 4- and 5-day-old seedlings of the cca1lhy mutant in comparison to WS indicated the effect of cca1lhy on storage lipid reserve mobilization. Lipid profiling revealed differences in primary lipid metabolism, namely in TAG, fatty acid methyl ester and acyl-CoA contents amongst cca1lhy, CCA1-OX, and wild-type seedlings. Taken together, this study demonstrates that lipid metabolism is subject to diurnal regulation in the early stages of seedling development in Arabidopsis.

  13. Identification of endogenous fluorophores in the photoreceptors using autofluorescence spectroscopy

    Science.gov (United States)

    Zhao, Lingling; Qu, Junle; Niu, Hanben

    2007-11-01

    In this paper, we present our investigation on the identification of endogenous fluorophores in photoreceptors using autofluorescence spectroscopy, which is performed with an inverted laser scanning confocal microscope equipped with an Argon ion laser and a GreNe laser. In our experiments, individual cones and rods are clearly resolved even in freshly prepared retina samples, without slicing or labeling. The experiment results show that autofluorescence spectrum of the photoreceptors has three peaks approximately at 525nm, 585nm and 665nm. Furthermore, the brightest autofluorescence originates from the photoreceptor outer segments. We can, therefore, come to a conclusion that the peaks at 525nm, 585nm are corresponding to FAD and A2-PE, respectively, which are distributed in the photoreceptor outer segments.

  14. Extracellular electrical activity from the photoreceptors of midge

    Indian Academy of Sciences (India)

    Unknown

    349. Keywords. Chironomus; electroretinogram; insect development; midge; photoreceptor ... ceran insects, only larval ocelli of mosquito (Family: Culi- cidae) have been ... and Ball (1995) studied the influence of light in Chiro- nomus tentans ...

  15. [Modification of retinal photoreceptor membranes and Ca ion binding].

    Science.gov (United States)

    Korchagin, V P; Berman, A L; Shukoliukov, S A; Rychkova, M P; Etingof, R N

    1978-10-01

    Calcium binding by modified photoreceptor membranes of cattle retina has been studied. Ca2+-binding the membranes significantly changes after C-phospholipase treatment, displaying the initial growth (less than 65% of lipid phosphorus removed) with subsequent decrease (more than 65% of phosphorus removed). Liposomes of the photoreceptor membranes lipids were found to bind more calcium than do the native photoreceptor membranes. Proteolytic enzymes (papaine, pronase) splitting some rhodopsin fragments do not affect the ability of the membrane to bind Ca2+. The increase of light-induced Ca-binding is observed only after the outer segments preincubation under conditions providing for rhodopsin phosphorylation. This effect was observed also after the splitting of the rhodopsin fragment by papaine. It is concluded that calcium binding in the photoreceptor membranes is mainly due to the phosphate groups of phospholipids.

  16. Photoreceptor atrophy in acute zonal occult outer retinopathy

    DEFF Research Database (Denmark)

    Zibrandtsen, N.; Munch, I.C.; Klemp, K.

    2008-01-01

    appearance were examined using optical coherence tomography (OCT), automated perimetry and electroretinography (ERG). RESULTS: Both patients demonstrated photoreceptor atrophy corresponding to partial or complete scotomata with reduced or extinct electroretinographic responses. Attenuation or complete loss...... of all the segments composing the photoreceptor layer was found by OCT. Full-field ERG revealed affection of the 30 Hz flicker responses and subnormal photopic responses in both patients and subnormal scotopic responses in case 1. Multifocal electroretinography (mERG) revealed localized outer retinal...

  17. Photoreceptor atrophy in acute zonal occult outer retinopathy

    DEFF Research Database (Denmark)

    Zibrandtsen, N.; Munch, I.C.; Klemp, K.

    2008-01-01

    examined using optical coherence tomography (OCT), automated perimetry and electroretinography (ERG). Both patients demonstrated photoreceptor atrophy corresponding to partial or complete scotomata with reduced or extinct electroretinographic responses. Attenuation or complete loss of all the segments...... composing the photoreceptor layer was found by OCT. Full-field ERG revealed affection of the 30 Hz flicker responses and subnormal photopic responses in both patients and subnormal scotopic responses in case 1. Multifocal electroretinography (mERG) revealed localized outer retinal dysfunction. The field...

  18. Photoreceptor layer map using spectral-domain optical coherence tomography.

    Science.gov (United States)

    Lee, Ji Eun; Lim, Dae Won; Bae, Han Yong; Park, Hyun Jin

    2009-12-01

    To develop a novel method for analysis of the photoreceptor layer map (PLM) generated using spectral-domain optical coherence tomography (OCT). OCT scans were obtained from 20 eyes, 10 with macular holes (MH) and 10 with central serous chorioretinopathy (CSC) using the Macular Cube (512 x 128) protocol of the Cirrus HD-OCT (Carl Zeiss). The scanned data were processed using embedded tools of the advanced visualization. A partial thickness OCT fundus image of the photoreceptor layer was generated by setting the region of interest to a 50-microm thick layer that was parallel and adjacent to the retinal pigment epithelium. The resulting image depicted the photoreceptor layer as a map of the reflectivity in OCT. The PLM was compared with fundus photography, auto-fluorescence, tomography, and retinal thickness map. The signal from the photoreceptor layer of every OCT scan in each case was demonstrated as a single image of PLM in a fundus photograph fashion. In PLM images, detachment of the sensory retina is depicted as a hypo-reflective area, which represents the base of MH and serous detachment in CSC. Relative hypo-reflectivity, which was also noted at closed MH and at recently reattached retina in CSC, was associated with reduced signal from the junction between the inner and outer segments of photoreceptors in OCT images. Using PLM, changes in the area of detachment and reflectivity of the photoreceptor layer could be efficiently monitored. The photoreceptor layer can be analyzed as a map using spectral-domain OCT. In the treatment of both MH and CSC, PLM may provide new pathological information about the photoreceptor layer to expand our understanding of these diseases.

  19. PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.

    Science.gov (United States)

    Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R

    2018-01-04

    The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Plant interactions with multiple insect herbivores: from community to genes

    NARCIS (Netherlands)

    Stam, J.M.; Kroes, A.; Li, Y.; Gols, R.; Loon, van J.J.A.; Poelman, E.H.; Dicke, M.

    2014-01-01

    Every plant is a member of a complex insect community that consists of tens to hundreds of species that belong to different trophic levels. The dynamics of this community are critically influenced by the plant, which mediates interactions between community members that can occur on the plant

  1. Phytoplasma adapt to the diverse environments of their plant and insect hosts by altering gene expression

    DEFF Research Database (Denmark)

    Makarova, Olga; MacLean, Allyson M.; Nicolaisen, Mogens

    2015-01-01

    a role in host adaptation. 74 genes were up-regulated in insects and included genes involved in stress response, phospholipid synthesis, malate and pyruvate metabolism, hemolysin and transporter genes, multiple copies of thymidylate kinase, sigma factor and Zn-proteases genes. In plants, 34 genes...... encoding an immune dominant membrane protein, membrane-associated proteins, and multidrug resistance ABC-type transporters, were up-regulated. Differential regulation of gene expression thus appears to play an important role in host adaptation of phytoplasmas....

  2. Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

    Directory of Open Access Journals (Sweden)

    O.I. Grabelnych

    2017-02-01

    Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

  3. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A

    2008-09-01

    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  4. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  5. High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes

    DEFF Research Database (Denmark)

    Wang, Wen; Zheng, Hongkung; Fan, Chuanzhu

    2006-01-01

    Retroposition is widely found to play essential roles in origination of new mammalian and other animal genes. However, the scarcity of retrogenes in plants has led to the assumption that plant genomes rarely evolve new gene duplicates by retroposition, despite abundant retrotransposons in plants......, confirming a previously observed role of retroelements in generating plant retrogenes. Substitution analyses revealed that the vast majority are subject to negative selection, suggesting, along with expression data and evidence of age, that they are likely functional retrogenes. In addition, 42...

  6. Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.

    Science.gov (United States)

    Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji

    2018-02-15

    Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

    Science.gov (United States)

    Wang, Feng-Yu; Fu, Wen-Chun; Wang, I-Li; Yan, Hong Young; Wang, Tzi-Yuan

    2014-01-01

    Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2) revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292) and four putative (S124, V189, V286, I290) tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

  8. The giant mottled eel, Anguilla marmorata, uses blue-shifted rod photoreceptors during upstream migration.

    Directory of Open Access Journals (Sweden)

    Feng-Yu Wang

    Full Text Available Catadromous fishes migrate between ocean and freshwater during particular phases of their life cycle. The dramatic environmental changes shape their physiological features, e.g. visual sensitivity, olfactory ability, and salinity tolerance. Anguilla marmorata, a catadromous eel, migrates upstream on dark nights, following the lunar cycle. Such behavior may be correlated with ontogenetic changes in sensory systems. Therefore, this study was designed to identify changes in spectral sensitivity and opsin gene expression of A. marmorata during upstream migration. Microspectrophotometry analysis revealed that the tropical eel possesses a duplex retina with rod and cone photoreceptors. The λmax of rod cells are 493, 489, and 489 nm in glass, yellow, and wild eels, while those of cone cells are 508, and 517 nm in yellow, and wild eels, respectively. Unlike European and American eels, Asian eels exhibited a blue-shifted pattern of rod photoreceptors during upstream migration. Quantitative gene expression analyses of four cloned opsin genes (Rh1f, Rh1d, Rh2, and SWS2 revealed that Rh1f expression is dominant at all three stages, while Rh1d is expressed only in older yellow eel. Furthermore, sequence comparison and protein modeling studies implied that a blue shift in Rh1d opsin may be induced by two known (N83, S292 and four putative (S124, V189, V286, I290 tuning sites adjacent to the retinal binding sites. Finally, expression of blue-shifted Rh1d opsin resulted in a spectral shift in rod photoreceptors. Our observations indicate that the giant mottled eel is color-blind, and its blue-shifted scotopic vision may influence its upstream migration behavior and habitat choice.

  9. Transcriptomic analysis of human retinal detachment reveals both inflammatory response and photoreceptor death.

    Directory of Open Access Journals (Sweden)

    Marie-Noëlle Delyfer

    Full Text Available BACKGROUND: Retinal detachment often leads to a severe and permanent loss of vision and its therapeutic management remains to this day exclusively surgical. We have used surgical specimens to perform a differential analysis of the transcriptome of human retinal tissues following detachment in order to identify new potential pharmacological targets that could be used in combination with surgery to further improve final outcome. METHODOLOGY/PRINCIPAL FINDINGS: Statistical analysis reveals major involvement of the immune response in the disease. Interestingly, using a novel approach relying on coordinated expression, the interindividual variation was monitored to unravel a second crucial aspect of the pathological process: the death of photoreceptor cells. Within the genes identified, the expression of the major histocompatibility complex I gene HLA-C enables diagnosis of the disease, while PKD2L1 and SLCO4A1 -which are both down-regulated- act synergistically to provide an estimate of the duration of the retinal detachment process. Our analysis thus reveals the two complementary cellular and molecular aspects linked to retinal detachment: an immune response and the degeneration of photoreceptor cells. We also reveal that the human specimens have a higher clinical value as compared to artificial models that point to IL6 and oxidative stress, not implicated in the surgical specimens studied here. CONCLUSIONS/SIGNIFICANCE: This systematic analysis confirmed the occurrence of both neurodegeneration and inflammation during retinal detachment, and further identifies precisely the modification of expression of the different genes implicated in these two phenomena. Our data henceforth give a new insight into the disease process and provide a rationale for therapeutic strategies aimed at limiting inflammation and photoreceptor damage associated with retinal detachment and, in turn, improving visual prognosis after retinal surgery.

  10. Functional network analysis of genes differentially expressed during xylogenesis in soc1ful woody Arabidopsis plants.

    Science.gov (United States)

    Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic

    2016-06-01

    Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

  11. Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

    Science.gov (United States)

    Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

    2015-09-29

    The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

  12. Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

    Science.gov (United States)

    Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

    2017-04-01

    Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

  13. Modeling the Flexural Rigidity of Rod Photoreceptors

    Science.gov (United States)

    Haeri, Mohammad; Knox, Barry E.; Ahmadi, Aphrodite

    2013-01-01

    In vertebrate eyes, the rod photoreceptor has a modified cilium with an extended cylindrical structure specialized for phototransduction called the outer segment (OS). The OS has numerous stacked membrane disks and can bend or break when subjected to mechanical forces. The OS exhibits axial structural variation, with extended bands composed of a few hundred membrane disks whose thickness is diurnally modulated. Using high-resolution confocal microscopy, we have observed OS flexing and disruption in live transgenic Xenopus rods. Based on the experimental observations, we introduce a coarse-grained model of OS mechanical rigidity using elasticity theory, representing the axial OS banding explicitly via a spring-bead model. We calculate a bending stiffness of ∼105 nN⋅μm2, which is seven orders-of-magnitude larger than that of typical cilia and flagella. This bending stiffness has a quadratic relation to OS radius, so that thinner OS have lower fragility. Furthermore, we find that increasing the spatial frequency of axial OS banding decreases OS rigidity, reducing its fragility. Moreover, the model predicts a tendency for OS to break in bands with higher spring number density, analogous to the experimental observation that transgenic rods tended to break preferentially in bands of high fluorescence. We discuss how pathological alterations of disk membrane properties by mutant proteins may lead to increased OS rigidity and thus increased breakage, ultimately contributing to retinal degeneration. PMID:23442852

  14. Derivation of Traceable and Transplantable Photoreceptors from Mouse Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Sarah Decembrini

    2014-06-01

    Full Text Available Retinal degenerative diseases resulting in the loss of photoreceptors are one of the major causes of blindness. Photoreceptor replacement therapy is a promising treatment because the transplantation of retina-derived photoreceptors can be applied now to different murine retinopathies to restore visual function. To have an unlimited source of photoreceptors, we derived a transgenic embryonic stem cell (ESC line in which the Crx-GFP transgene is expressed in photoreceptors and assessed the capacity of a 3D culture protocol to produce integration-competent photoreceptors. This culture system allows the production of a large number of photoreceptors recapitulating the in vivo development. After transplantation, integrated cells showed the typical morphology of mature rods bearing external segments and ribbon synapses. We conclude that a 3D protocol coupled with ESCs provides a safe and renewable source of photoreceptors displaying a development and transplantation competence comparable to photoreceptors from age-matched retinas.

  15. Novel enabling technologies of gene isolation and plant transformation for improved crop protection

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2013-02-04

    Meeting the needs of agricultural producers requires the continued development of improved transgenic crop protection products. The completed project focused on developing novel enabling technologies of gene discovery and plant transformation to facilitate the generation of such products.

  16. Expression of TLP-3 gene without signal peptide in tobacco plants ...

    African Journals Online (AJOL)

    Administrator

    2011-06-06

    Jun 6, 2011 ... African Journal of Biotechnology Vol. ... group of plant proteins which accumulate as a result of different types ... across the plasma membranes, the rapid production of ..... transformation and RT-PCR analysis confirm the gene.

  17. Drosophila photoreceptor axon guidance and targeting requires the dreadlocks SH2/SH3 adapter protein.

    Science.gov (United States)

    Garrity, P A; Rao, Y; Salecker, I; McGlade, J; Pawson, T; Zipursky, S L

    1996-05-31

    Mutations in the Drosophila gene dreadlocks (dock) disrupt photoreceptor cell (R cell) axon guidance and targeting. Genetic mosaic analysis and cell-type-specific expression of dock transgenes demonstrate dock is required in R cells for proper innervation. Dock protein contains one SH2 and three SH3 domains, implicating it in tyrosine kinase signaling, and is highly related to the human proto-oncogene Nck. Dock expression is detected in R cell growth cones in the target region. We propose Dock transmits signals in the growth cone in response to guidance and targeting cues. These findings provide an important step for dissection of signaling pathways regulating growth cone motility.

  18. Plant-bacteria partnership: phytoremediation of hydrocarbons contaminated soil and expression of catabolic genes

    Directory of Open Access Journals (Sweden)

    Hamna Saleem

    2016-01-01

    Full Text Available Petroleum hydrocarbons are harmful to living organisms when they are exposed in natural environment. Once they come in contact, it is not an easy to remove them because many of their constituents are persistent in nature. To achieve this target, different approaches have been exploited by using plants, bacteria, and plant-bacteria together. Among them, combined use of plants and bacteria has gained tremendous attention as bacteria possess set of catabolic genes which produce catabolic enzymes to decontaminate hydrocarbons. In return, plant ooze out root exudates containing nutrients and necessary metabolites which facilitate the microbial colonization in plant rhizosphere. This results into high gene abundance and gene expression in the rhizosphere and, thus, leads to enhanced degradation. Moreover, high proportions of beneficial bacteria helps plant to gain more biomass due to their plant growth promoting activities and production of phytohromones. This review focuses functioning and mechanisms of catabolic genes responsible for degradation of straight chain and aromatic hydrocarbons with their potential of degradation in bioremediation. With the understanding of expression mechanisms, rate of degradation can be enhanced by adjusting environmental factors and acclimatizing plant associated bacteria in plant rhizosphere.

  19. The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool

    Directory of Open Access Journals (Sweden)

    Nan Zhao

    2018-02-01

    Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.

  20. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Delivery of gene biotechnologies to plants: Pathogen and pest control

    Science.gov (United States)

    Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

  2. Molecular Evolution and Expression Divergence of HMT Gene Family in Plants

    Directory of Open Access Journals (Sweden)

    Man Zhao

    2018-04-01

    Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.

  3. In Silico Identification, Phylogenetic and Bioinformatic Analysis of Argonaute Genes in Plants

    Directory of Open Access Journals (Sweden)

    Khaled Mirzaei

    2014-01-01

    Full Text Available Argonaute protein family is the key players in pathways of gene silencing and small regulatory RNAs in different organisms. Argonaute proteins can bind small noncoding RNAs and control protein synthesis, affect messenger RNA stability, and even participate in the production of new forms of small RNAs. The aim of this study was to characterize and perform bioinformatic analysis of Argonaute proteins in 32 plant species that their genome was sequenced. A total of 437 Argonaute genes were identified and were analyzed based on lengths, gene structure, and protein structure. Results showed that Argonaute proteins were highly conserved across plant kingdom. Phylogenic analysis divided plant Argonautes into three classes. Argonaute proteins have three conserved domains PAZ, MID and PIWI. In addition to three conserved domains namely, PAZ, MID, and PIWI, we identified few more domains in AGO of some plant species. Expression profile analysis of Argonaute proteins showed that expression of these genes varies in most of tissues, which means that these proteins are involved in regulation of most pathways of the plant system. Numbers of alternative transcripts of Argonaute genes were highly variable among the plants. A thorough analysis of large number of putative Argonaute genes revealed several interesting aspects associated with this protein and brought novel information with promising usefulness for both basic and biotechnological applications.

  4. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  5. Exploring two plant hosts for expression of diterpenoid pathway genes

    DEFF Research Database (Denmark)

    Bach, Søren Spanner

    Plants produce more than 10.000 diterpenoid compounds of which the large majority is involved in specialized metabolism, while a few are involved in general metabolism. Specialized metabolism diterpenoids have functions in interactions of plants with other organisms and selected ones are utilized....... Since only small changes in the amino acid sequence can influence the roduct outcome of a diterpene synthase (diTPS), prediction of the catalytic activity diTPS of a is not possible purely based on phylogenetic relationship. Thus, functional characterization is required in to determine the catalytic...... and aracterization of diTPSs deriving from the plant kingdom, a plant expression host offers several advantages such as the presence of all relevant compartments (plastids and endoplasmic reticulum) and the universal C5 building blocks for isoprenoid biosynthesis. In addition, a plant based xpression host...

  6. Macro optical projection tomography for large scale 3D imaging of plant structures and gene activity.

    Science.gov (United States)

    Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S

    2017-01-01

    Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  7. Laser induced photoreceptor damage and recovery in the high numerical aperture eye of the garter snake.

    Science.gov (United States)

    Zwick, H; Edsall, P; Stuck, B E; Wood, E; Elliott, R; Cheramie, R; Hacker, H

    2008-02-01

    The garter snake provides a unique model for in-vivo imaging of photoreceptor damage induced by laser retinal exposure. Laser thermal/mechanical retinal injury induced alterations in photoreceptor structure and leukocyte cellular behavior. Photoreceptors turned white, lost mode structure, and swelled; leukocyte activity was observed in the vicinity of photoreceptor cells. Non-thermal alterations were identified with a bio-tag for oxidative stress. Mechanisms of photoreceptor recovery and replacement were observed and evaluated for active cytoskeletal systems by using an anti-actin tag that could detect the presence of active cytoskeletal systems resident in photoreceptors as well as other retinal systems.

  8. UV-C-Induced alleviation of transcriptional gene silencing through plant-plant communication: Key roles of jasmonic acid and salicylic acid pathways.

    Science.gov (United States)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-08-01

    Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Silencing of meiosis-critical genes for engineering male sterility in plants

    Science.gov (United States)

    Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

  10. Plants, genes and justice : an inquiry into fair and equitable benefit-sharing

    NARCIS (Netherlands)

    Jonge, de B.

    2009-01-01

    Since the advent of biotechnology, plant genetic resources have become more valuable as possible sources for new products and inventions. With knowledge about the genetic make-up and functioning of a plant, biotechnologists can identify and isolate genes with interesting traits which, after long

  11. The complexity of nitrogen metabolism and nitrogen-regulated gene expression in plant pathogenic fungi

    NARCIS (Netherlands)

    Bolton, M.D.; Thomma, B.P.H.J.

    2008-01-01

    Plant pathogens secrete effector molecules that contribute to the establishment of disease in their plant hosts. The identification of cellular cues that regulate effector gene expression is an important aspect of understanding the infection process. Nutritional status in the cell has been

  12. A new hemoglobin gene from soybean: a role for hemoglobin in all plants

    DEFF Research Database (Denmark)

    Anderson, C R; Jensen, E O; LLewellyn, D J

    1996-01-01

    We have isolated a new hemoglobin gene from soybean. It is expressed in cotyledons, stems of seedlings, roots, young leaves, and in some cells in the nodules that are associated with the nitrogen-fixing Bradyrhizobium symbiont. This contrasts with the expression of the leghemoglobins, which...... are active only in the infected cells of the nodules. The deduced protein sequence of the new gene shows only 58% similarity to one of the soybean leghemoglobins, but 85-87% similarity to hemoglobins from the nonlegumes Parasponia, Casuarina, and barley. The pattern of expression and the gene sequence...... indicate that this new gene is a nonsymbiotic legume hemoglobin. The finding of this gene in legumes and similar genes in other species strengthens our previous suggestion that genomes of all plants contain hemoglobin genes. The specialized leghemoglobin gene family may have arisen from a preexisting...

  13. Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

    Science.gov (United States)

    Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

    2017-09-30

    Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

  14. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  15. Horizontal gene transfer of a plastid gene in the non-photosynthetic flowering plants Orobanche and Phelipanche (Orobanchaceae).

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M

    2007-06-01

    Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.

  16. Plant reference genes for development and stress response studies

    Indian Academy of Sciences (India)

    Joyous T Joseph

    2018-02-09

    Feb 9, 2018 ... HKGs are constitutive genes required for the maintenance of basic cellular functions like cell ... abiotic, biotic, and developmental factors affecting the cells in which they express. ..... expression. Theory Biosci. 131 215–223.

  17. Photoreceptor spectral sensitivity in the bumblebee, Bombus impatiens (Hymenoptera: Apidae.

    Directory of Open Access Journals (Sweden)

    Peter Skorupski

    Full Text Available The bumblebee Bombus impatiens is increasingly used as a model in comparative studies of colour vision, or in behavioural studies relying on perceptual discrimination of colour. However, full spectral sensitivity data on the photoreceptor inputs underlying colour vision are not available for B. impatiens. Since most known bee species are trichromatic, with photoreceptor spectral sensitivity peaks in the UV, blue and green regions of the spectrum, data from a related species, where spectral sensitivity measurements have been made, are often applied to B impatiens. Nevertheless, species differences in spectral tuning of equivalent photoreceptor classes may result in peaks that differ by several nm, which may have small but significant effects on colour discrimination ability. We therefore used intracellular recording to measure photoreceptor spectral sensitivity in B. impatiens. Spectral peaks were estimated at 347, 424 and 539 nm for UV, blue and green receptors, respectively, suggesting that this species is a UV-blue-green trichromat. Photoreceptor spectral sensitivity peaks are similar to previous measurements from Bombus terrestris, although there is a significant difference in the peak sensitivity of the blue receptor, which is shifted in the short wave direction by 12-13 nm in B. impatiens compared to B. terrestris.

  18. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    Energy Technology Data Exchange (ETDEWEB)

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  19. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Directory of Open Access Journals (Sweden)

    Aaron E Walworth

    Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of

  20. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    Science.gov (United States)

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  1. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Science.gov (United States)

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  2. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  3. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  4. Elucidating gene function and function evolution through comparison of co-expression networks in plants

    Directory of Open Access Journals (Sweden)

    Marek eMutwil

    2014-08-01

    Full Text Available The analysis of gene expression data has shown that transcriptionally coordinated (co-expressed genes are often functionally related, enabling scientists to use expression data in gene function prediction. This Focused Review discusses our original paper (Large-scale co-expression approach to dissect secondary cell wall formation across plant species, Frontiers in Plant Science 2:23. In this paper we applied cross-species analysis to co-expression networks of genes involved in cellulose biosynthesis. We show that the co-expression networks from different species are highly similar, indicating that whole biological pathways are conserved across species. This finding has two important implications. First, the analysis can transfer gene function annotation from well-studied plants, such as Arabidopsis, to other, uncharacterized plant species. As the analysis finds genes that have similar sequence and similar expression pattern across different organisms, functionally equivalent genes can be identified. Second, since co-expression analyses are often noisy, a comparative analysis should have higher performance, as parts of co-expression networks that are conserved are more likely to be functionally relevant. In this Focused Review, we outline the comparative analysis done in the original paper and comment on the recent advances and approaches that allow comparative analyses of co-function networks. We hypothesize that, in comparison to simple co-expression analysis, comparative analysis would yield more accurate gene function predictions. Finally, by combining comparative analysis with genomic information of green plants, we propose a possible composition of cellulose biosynthesis machinery during earlier stages of plant evolution.

  5. Lactococcus lactis Metabolism and Gene Expression during Growth on Plant Tissues

    Science.gov (United States)

    Golomb, Benjamin L.

    2014-01-01

    Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484

  6. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  7. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  8. Coordinations between gene modules control the operation of plant amino acid metabolic networks

    Directory of Open Access Journals (Sweden)

    Galili Gad

    2009-01-01

    Full Text Available Abstract Background Being sessile organisms, plants should adjust their metabolism to dynamic changes in their environment. Such adjustments need particular coordination in branched metabolic networks in which a given metabolite can be converted into multiple other metabolites via different enzymatic chains. In the present report, we developed a novel "Gene Coordination" bioinformatics approach and use it to elucidate adjustable transcriptional interactions of two branched amino acid metabolic networks in plants in response to environmental stresses, using publicly available microarray results. Results Using our "Gene Coordination" approach, we have identified in Arabidopsis plants two oppositely regulated groups of "highly coordinated" genes within the branched Asp-family network of Arabidopsis plants, which metabolizes the amino acids Lys, Met, Thr, Ile and Gly, as well as a single group of "highly coordinated" genes within the branched aromatic amino acid metabolic network, which metabolizes the amino acids Trp, Phe and Tyr. These genes possess highly coordinated adjustable negative and positive expression responses to various stress cues, which apparently regulate adjustable metabolic shifts between competing branches of these networks. We also provide evidence implying that these highly coordinated genes are central to impose intra- and inter-network interactions between the Asp-family and aromatic amino acid metabolic networks as well as differential system interactions with other growth promoting and stress-associated genome-wide genes. Conclusion Our novel Gene Coordination elucidates that branched amino acid metabolic networks in plants are regulated by specific groups of highly coordinated genes that possess adjustable intra-network, inter-network and genome-wide transcriptional interactions. We also hypothesize that such transcriptional interactions enable regulatory metabolic adjustments needed for adaptation to the stresses.

  9. Hif1a inactivation rescues photoreceptor degeneration induced by a chronic hypoxia-like stress.

    Science.gov (United States)

    Barben, Maya; Ail, Divya; Storti, Federica; Klee, Katrin; Schori, Christian; Samardzija, Marijana; Michalakis, Stylianos; Biel, Martin; Meneau, Isabelle; Blaser, Frank; Barthelmes, Daniel; Grimm, Christian

    2018-04-17

    Reduced choroidal blood flow and tissue changes in the ageing human eye impair oxygen delivery to photoreceptors and the retinal pigment epithelium. As a consequence, mild but chronic hypoxia may develop and disturb cell metabolism, function and ultimately survival, potentially contributing to retinal pathologies such as age-related macular degeneration (AMD). Here, we show that several hypoxia-inducible genes were expressed at higher levels in the aged human retina suggesting increased activity of hypoxia-inducible transcription factors (HIFs) during the physiological ageing process. To model chronically elevated HIF activity and investigate ensuing consequences for photoreceptors, we generated mice lacking von Hippel Lindau (VHL) protein in rods. This activated HIF transcription factors and led to a slowly progressing retinal degeneration in the ageing mouse retina. Importantly, this process depended mainly on HIF1 with only a minor contribution of HIF2. A gene therapy approach using AAV-mediated RNA interference through an anti-Hif1a shRNA significantly mitigated the degeneration suggesting a potential intervention strategy that may be applicable to human patients.

  10. Physiological and gene expression responses of sunflower (Helianthus annuus L.) plants differ according to irrigation placement.

    Science.gov (United States)

    Aguado, Ana; Capote, Nieves; Romero, Fernando; Dodd, Ian C; Colmenero-Flores, José M

    2014-10-01

    To investigate effects of soil moisture heterogeneity on plant physiology and gene expression in roots and leaves, three treatments were implemented in sunflower plants growing with roots split between two compartments: a control (C) treatment supplying 100% of plant evapotranspiration, and two treatments receiving 50% of plant evapotranspiration, either evenly distributed to both compartments (deficit irrigation - DI) or unevenly distributed to ensure distinct wet and dry compartments (partial rootzone drying - PRD). Plants receiving the same amount of water responded differently under the two irrigation systems. After 3 days, evapotranspiration was similar in C and DI, but 20% less in PRD, concomitant with decreased leaf water potential (Ψleaf) and increased leaf xylem ABA concentration. Six water-stress responsive genes were highly induced in roots growing in the drying soil compartment of PRD plants, and their expression was best correlated with local soil water content. On the other hand, foliar gene expression differed significantly from that of the root and correlated better with xylem ABA concentration and Ψleaf. While the PRD irrigation strategy triggered stronger physiological and molecular responses, suggesting a more intense and systemic stress reaction due to local dehydration of the dry compartment of PRD plants, the DI strategy resulted in similar water savings without strongly inducing these responses. Correlating physiological and molecular responses in PRD/DI plants may provide insights into the severity and location of water deficits and may enable a better understanding of long-distance signalling mechanisms. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Nicotiana plumbaginifolia hlg mutants have a mutation in a PHYB-type phytochrome gene: they have elongated hypocotyls in red light, but are not elongated as adult plants.

    Science.gov (United States)

    Hudson, M; Robson, P R; Kraepiel, Y; Caboche, M; Smith, H

    1997-11-01

    Two new allelic mutants of Nicotiana plumbaginifolia have been isolated which display a hypocotyl which is long (hlg) when seedlings are grown in continuous white light (W). This can be accounted for by the decreased response to red light (R) of the hypocotyl elongation rate in these mutants. Responses to other wavelengths are unaffected in the mutants. When grown in white light, mature hlg mutants are not elongated with respect to the wild-type; they also bolt and flower later. The shade-avoidance responses to red/far red ratio (R:FR) are intact in these mutants. Both mutants are deficient in phyB-like polypeptide that is immunodetectable in the wild-type; both have wild-type levels of a phyA-like polypeptide. These alleles are inherited in a partially dominant manner, and correspond to single-base missense mutations in a gene highly homologous to N. tabacum PHYB, which codes for a phytochrome B-type photoreceptor. One allele, hlg-1, has an introduced amino acid substitution; this may define a residue essential for phytochrome protein stability. The other allele, hlg-2, has a stop codon introduced C-terminal to the chromophore binding domain. As these phyB mutants are unaffected in shade-avoidance responses, but deficient in perception of R, it is concluded that the phyB absent in these mutants is responsible for R perception in the N. plumbaginifolia seedling, but is not a R:FR sensor in light-grown plants.

  12. A plant defensin gene from Orychophragmus violaceus can improve ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-16

    Nov 16, 2009 ... seedlings and plants from attacking of soil-bore patho- gens (Terras et al., ..... The boxes were covered with plastic film and then kept at. 20°C in dark. ... form four structure-stabilizing disulfide bridges as reported before which ...

  13. Control of plant architecture by distinctive TALE homeobox gene interactions

    NARCIS (Netherlands)

    Bao, D.|info:eu-repo/dai/nl/304838063

    2009-01-01

    In eukaryotes, transcription factor (TF)-based network is a widely used mechanism to regulate fundamental developmental processes. Both animals and plants utilize three-amino-acid-loop-extension (TALE) homeodomain (HD) transcription factors to subdivide their body plan. In animals, MEIS/PBC TF

  14. Identification of plant genes for abiotic stress resistance

    NARCIS (Netherlands)

    Dixit, S.A.

    2008-01-01

    As water and salt stresses occur frequently and can affect many habitats, plants have developed several strategies to cope with these challenges: either adaptation mechanisms, which allow them to survive the adverse conditions, or specific growth habits to avoid stress conditions. Stress-tolerant

  15. Controversy Associated With the Common Component of Most Transgenic Plants – Kanamycin Resistance Marker Gene

    Directory of Open Access Journals (Sweden)

    Srećko Jelenić

    2003-01-01

    Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.

  16. Transcriptomic Analysis Using Olive Varieties and Breeding Progenies Identifies Candidate Genes Involved in Plant Architecture.

    Science.gov (United States)

    González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R

    2016-01-01

    Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  17. GeneBins: a database for classifying gene expression data, with application to plant genome arrays

    Directory of Open Access Journals (Sweden)

    Weiller Georg

    2007-03-01

    Full Text Available Abstract Background To interpret microarray experiments, several ontological analysis tools have been developed. However, current tools are limited to specific organisms. Results We developed a bioinformatics system to assign the probe set sequences of any organism to a hierarchical functional classification modelled on KEGG ontology. The GeneBins database currently supports the functional classification of expression data from four Affymetrix arrays; Arabidopsis thaliana, Oryza sativa, Glycine max and Medicago truncatula. An online analysis tool to identify relevant functions is also provided. Conclusion GeneBins provides resources to interpret gene expression results from microarray experiments. It is available at http://bioinfoserver.rsbs.anu.edu.au/utils/GeneBins/

  18. The ALDH21 gene found in lower plants and some vascular plants codes for a NADP+ -dependent succinic semialdehyde dehydrogenase.

    Science.gov (United States)

    Kopečná, Martina; Vigouroux, Armelle; Vilím, Jan; Končitíková, Radka; Briozzo, Pierre; Hájková, Eva; Jašková, Lenka; von Schwartzenberg, Klaus; Šebela, Marek; Moréra, Solange; Kopečný, David

    2017-10-01

    Lower plant species including some green algae, non-vascular plants (bryophytes) as well as the oldest vascular plants (lycopods) and ferns (monilophytes) possess a unique aldehyde dehydrogenase (ALDH) gene named ALDH21, which is upregulated during dehydration. However, the gene is absent in flowering plants. Here, we show that ALDH21 from the moss Physcomitrella patens codes for a tetrameric NADP + -dependent succinic semialdehyde dehydrogenase (SSALDH), which converts succinic semialdehyde, an intermediate of the γ-aminobutyric acid (GABA) shunt pathway, into succinate in the cytosol. NAD + is a very poor coenzyme for ALDH21 unlike for mitochondrial SSALDHs (ALDH5), which are the closest related ALDH members. Structural comparison between the apoform and the coenzyme complex reveal that NADP + binding induces a conformational change of the loop carrying Arg-228, which seals the NADP + in the coenzyme cavity via its 2'-phosphate and α-phosphate groups. The crystal structure with the bound product succinate shows that its carboxylate group establishes salt bridges with both Arg-121 and Arg-457, and a hydrogen bond with Tyr-296. While both arginine residues are pre-formed for substrate/product binding, Tyr-296 moves by more than 1 Å. Both R121A and R457A variants are almost inactive, demonstrating a key role of each arginine in catalysis. Our study implies that bryophytes but presumably also some green algae, lycopods and ferns, which carry both ALDH21 and ALDH5 genes, can oxidize SSAL to succinate in both cytosol and mitochondria, indicating a more diverse GABA shunt pathway compared with higher plants carrying only the mitochondrial ALDH5. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  19. Design of Knowledge Bases for Plant Gene Regulatory Networks.

    Science.gov (United States)

    Mukundi, Eric; Gomez-Cano, Fabio; Ouma, Wilberforce Zachary; Grotewold, Erich

    2017-01-01

    Developing a knowledge base that contains all the information necessary for the researcher studying gene regulation in a particular organism can be accomplished in four stages. This begins with defining the data scope. We describe here the necessary information and resources, and outline the methods for obtaining data. The second stage consists of designing the schema, which involves defining the entire arrangement of the database in a systematic plan. The third stage is the implementation, defined by actualization of the database by using software according to a predefined schema. The final stage is development, where the database is made available to users in a web-accessible system. The result is a knowledgebase that integrates all the information pertaining to gene regulation, and which is easily expandable and transferable.

  20. Gene expression in mycorrhizal orchid protocorms suggests a friendly plant-fungus relationship.

    Science.gov (United States)

    Perotto, Silvia; Rodda, Marco; Benetti, Alex; Sillo, Fabiano; Ercole, Enrico; Rodda, Michele; Girlanda, Mariangela; Murat, Claude; Balestrini, Raffaella

    2014-06-01

    Orchids fully depend on symbiotic interactions with specific soil fungi for seed germination and early development. Germinated seeds give rise to a protocorm, a heterotrophic organ that acquires nutrients, including organic carbon, from the mycorrhizal partner. It has long been debated if this interaction is mutualistic or antagonistic. To investigate the molecular bases of the orchid response to mycorrhizal invasion, we developed a symbiotic in vitro system between Serapias vomeracea, a Mediterranean green meadow orchid, and the rhizoctonia-like fungus Tulasnella calospora. 454 pyrosequencing was used to generate an inventory of plant and fungal genes expressed in mycorrhizal protocorms, and plant genes could be reliably identified with a customized bioinformatic pipeline. A small panel of plant genes was selected and expression was assessed by real-time quantitative PCR in mycorrhizal and non-mycorrhizal protocorm tissues. Among these genes were some markers of mutualistic (e.g. nodulins) as well as antagonistic (e.g. pathogenesis-related and wound/stress-induced) genes. None of the pathogenesis or wound/stress-related genes were significantly up-regulated in mycorrhizal tissues, suggesting that fungal colonization does not trigger strong plant defence responses. In addition, the highest expression fold change in mycorrhizal tissues was found for a nodulin-like gene similar to the plastocyanin domain-containing ENOD55. Another nodulin-like gene significantly more expressed in the symbiotic tissues of mycorrhizal protocorms was similar to a sugar transporter of the SWEET family. Two genes coding for mannose-binding lectins were significantly up-regulated in the presence of the mycorrhizal fungus, but their role in the symbiosis is unclear.

  1. Domestication of transposable elements into MicroRNA genes in plants.

    Directory of Open Access Journals (Sweden)

    Yang Li

    Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.

  2. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  3. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P. [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Eapen, Susan, E-mail: eapenhome@yahoo.com [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2011-08-15

    Highlights: {yields} Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. {yields} Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. {yields} Using in vitro T{sub 1} seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. {yields} This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of {sup 14}C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T{sub 0} and T{sub 1}) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  4. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    International Nuclear Information System (INIS)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P.; Eapen, Susan

    2011-01-01

    Highlights: → Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. → Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. → Using in vitro T 1 seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. → This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of 14 C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T 0 and T 1 ) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  5. Implication of the changing concept of genes on plant breeder’s work

    Directory of Open Access Journals (Sweden)

    Marco Aurélio D. Dias

    2011-01-01

    Full Text Available The recent genome sequencing of some species has accumulated evidence that for a large number of traits, thecontrol and action of genes are far more complex than previously thought. This article discusses possible implications of newinsights into the gene concept on the work of plant breeders. Apparently, the successful application of biotechnological techniques is not as simple as once assumed. The evident changes in the available concept of genes confirmed what the past experience had shown,i.e, selection should focus on the phenotype, under the same conditions as the plant is to be cultivated in. Advanced vocationaltraining of plant breeders must be continuously maintained, focusing on phenotype-based selection in as accurate as possibleexperiments.

  6. Impact of Bee Species and Plant Density on Alfalfa Pollination and Potential for Gene Flow

    Directory of Open Access Journals (Sweden)

    Johanne Brunet

    2010-01-01

    Full Text Available In outcrossing crops like alfalfa, various bee species can contribute to pollination and gene flow in seed production fields. With the increasing use of transgenic crops, it becomes important to determine the role of these distinct pollinators on alfalfa pollination and gene flow. The current study examines the relative contribution of honeybees, three bumble bee species, and three solitary bee species to pollination and gene flow in alfalfa. Two wild solitary bee species and one wild bumble bee species were best at tripping flowers, while the two managed pollinators commonly used in alfalfa seed production, honeybees and leaf cutting bees, had the lowest tripping rate. Honeybees had the greatest potential for gene flow and risk of transgene escape relative to the other pollinators. For honeybees, gene flow and risk of transgene escape were not affected by plant density although for the three bumble bee species gene flow and risk of transgene escape were the greatest in high-density fields.

  7. Transcriptomic changes reveal gene networks responding to the overexpression of a blueberry DWARF AND DELAYED FLOWERING 1 gene in transgenic blueberry plants.

    Science.gov (United States)

    Song, Guo-Qing; Gao, Xuan

    2017-06-19

    Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.

  8. Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

    OpenAIRE

    Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng

    2017-01-01

    Background Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution...

  9. MADS goes genomic in conifers: towards determining the ancestral set of MADS-box genes in seed plants.

    Science.gov (United States)

    Gramzow, Lydia; Weilandt, Lisa; Theißen, Günter

    2014-11-01

    MADS-box genes comprise a gene family coding for transcription factors. This gene family expanded greatly during land plant evolution such that the number of MADS-box genes ranges from one or two in green algae to around 100 in angiosperms. Given the crucial functions of MADS-box genes for nearly all aspects of plant development, the expansion of this gene family probably contributed to the increasing complexity of plants. However, the expansion of MADS-box genes during one important step of land plant evolution, namely the origin of seed plants, remains poorly understood due to the previous lack of whole-genome data for gymnosperms. The newly available genome sequences of Picea abies, Picea glauca and Pinus taeda were used to identify the complete set of MADS-box genes in these conifers. In addition, MADS-box genes were identified in the growing number of transcriptomes available for gymnosperms. With these datasets, phylogenies were constructed to determine the ancestral set of MADS-box genes of seed plants and to infer the ancestral functions of these genes. Type I MADS-box genes are under-represented in gymnosperms and only a minimum of two Type I MADS-box genes have been present in the most recent common ancestor (MRCA) of seed plants. In contrast, a large number of Type II MADS-box genes were found in gymnosperms. The MRCA of extant seed plants probably possessed at least 11-14 Type II MADS-box genes. In gymnosperms two duplications of Type II MADS-box genes were found, such that the MRCA of extant gymnosperms had at least 14-16 Type II MADS-box genes. The implied ancestral set of MADS-box genes for seed plants shows simplicity for Type I MADS-box genes and remarkable complexity for Type II MADS-box genes in terms of phylogeny and putative functions. The analysis of transcriptome data reveals that gymnosperm MADS-box genes are expressed in a great variety of tissues, indicating diverse roles of MADS-box genes for the development of gymnosperms. This study is

  10. Overexpression of the AtSHI gene in poinsettia, Euphorbia pulcherrima, results in compact plants

    DEFF Research Database (Denmark)

    Islam, M. Ashraful; Lütken, Henrik Vlk; Haugslien, Sissel

    2013-01-01

    of the AtSHI gene into poinsettia by genetic engineering can be an effective approach in controlling plant height without negatively affecting flowering time. This can help to reduce or avoid the use of toxic growth retardants of environmental and human health concern. This is the first report that At......Euphorbia pulcherrima, poinsettia, is a non-food and non-feed vegetatively propagated ornamental plant. Appropriate plant height is one of the most important traits in poinsettia production and is commonly achieved by application of chemical growth retardants. To produce compact poinsettia plants...... integration of transgene was verified by PCR and Southern blot analysis. Reduced plant height (21–52%) and internode lengths (31–49%) were obtained in the transgenic lines compared to control plants. This correlates positively with the AtSHI transcript levels, with the highest levels in the most dwarfed...

  11. Lateral interactions in the photoreceptor membrane: a NMR study

    International Nuclear Information System (INIS)

    Mollevanger, L.C.P.J.

    1987-01-01

    The photoreceptor membrane has an exceptionally high content of polyunsaturated fatty acyl chains combined with a high amount of phosphatidyl ethanolamine. It is situated in a cell organelle, the rod outer segment, with a high biological activity in which controlable trans-membrane currents of different ions play an important role. These characteristics make it a very interesting biological membrane to search for the existence of non-bilayer structures. Therefore in this thesis a detailed study of the polymorphic phase behaviour of the rod outer segment photoreceptor lipids was undertaken, concerning modulation of the polymorphic phase behaviour of photoreceptor membrane lipids by divalent cations and temperature, polymorphism of the individual phospholipid classes phosphatidylethanolamine and phosphatidylserine and effects of cholesterol, bilayer stabilization by (rhod)opsin. Morphologically intact rod outer segment possesses a large magnetic anisotropy. This property is used to obtain 31 P-NMR of oriented photoreceptor membranes which allows spectral analysis and identification of individual phospholipid classes, and allows to study lateral lipid diffusion in intact disk membranes. The power of high resolution solid state 13 C-NMR to study the conformation of the chromophore in rhodopsin is demonstrated. (Auth.)

  12. Cubozoan genome illuminates functional diversification of opsins and photoreceptor evolution

    Czech Academy of Sciences Publication Activity Database

    Liegertová, Michaela; Pergner, Jiří; Kozmiková, Iryna; Fabian, Peter; Pombinho, António R.; Strnad, Hynek; Pačes, Jan; Vlček, Čestmír; Bartůněk, Petr; Kozmik, Zbyněk

    2015-01-01

    Roč. 5, Jul 8 (2015) ISSN 2045-2322 R&D Projects: GA ČR GAP305/10/2141; GA MŠk LO1220 Institutional support: RVO:68378050 Keywords : Cubozoan genome * opsins * photoreceptor * evolution Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.228, year: 2015

  13. Atypical retinal pigment epithelial defects with retained photoreceptor layers

    DEFF Research Database (Denmark)

    Giannakaki-Zimmermann, Helena; Querques, Giuseppe; Munch, Inger Christine

    2017-01-01

    BACKGROUND: To report patients with age-related macular degeneration and atypical central retinal pigment epithelium (RPE) defects not attributable to geographic atrophy (GA) or RPE-tears with overlying preserved photoreceptor layers. METHODS: Multimodal imaging case-series evaluating the course...

  14. Protein and signaling networks in vertebrate photoreceptor cells

    Directory of Open Access Journals (Sweden)

    Karl-Wilhelm eKoch

    2015-11-01

    Full Text Available Vertebrate photoreceptor cells are exquisite light detectors operating under very dim and bright illumination. The photoexcitation and adaptation machinery in photoreceptor cells consists of protein complexes that can form highly ordered supramolecular structures and control the homeostasis and mutual dependence of the secondary messengers cGMP and Ca2+. The visual pigment in rod photoreceptors, the G protein-coupled receptor rhodopsin is organized in tracks of dimers thereby providing a signaling platform for the dynamic scaffolding of the G protein transducin. Illuminated rhodopsin is turned off by phosphorylation catalyzed by rhodopsin kinase GRK1 under control of Ca2+-recoverin. The GRK1 protein complex partly assembles in lipid raft structures, where shutting off rhodopsin seems to be more effective. Re-synthesis of cGMP is another crucial step in the recovery of the photoresponse after illumination. It is catalyzed by membrane bound sensory guanylate cyclases and is regulated by specific neuronal Ca2+-sensor proteins called GCAPs. At least one guanylate cyclase (ROS-GC1 was shown to be part of a multiprotein complex having strong interactions with the cytoskeleton and being controlled in a multimodal Ca2+-dependent fashion. The final target of the cGMP signaling cascade is a cyclic nucleotide-gated channel that is a hetero-oligomeric protein located in the plasma membrane and interacting with accessory proteins in highly organized microdomains. We summarize results and interpretations of findings related to the inhomogeneous organization of signaling units in photoreceptor outer segments.

  15. Expression of kenaf mitochondrial chimeric genes HM184 causes male sterility in transgenic tobacco plants.

    Science.gov (United States)

    Zhao, Yanhong; Liao, Xiaofang; Huang, Zhipeng; Chen, Peng; Zhou, Bujin; Liu, Dongmei; Kong, Xiangjun; Zhou, Ruiyang

    2015-08-01

    Chimeric genes resulting from the rearrangement of a mitochondrial genome were generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS). In the study, earlier we reported that identifying a 47 bp deletion at 3'- flanking of atp9 that was linked to male sterile cytoplasm in kenaf. The truncated fragment was fused with atp9, a mitochondrial transit signal (MTS) and/or GFP, comprised two chimeric genes MTS-HM184-GFP and MTS-HM184. The plant expression vector pBI121 containing chimeric genes were then introduced to tobacco plants by Agrobacterium-mediated T-DNA transformation. The result showed that certain transgenic plants were male sterility or semi-sterility, while some were not. The expression analysis further demonstrated that higher level of expression were showed in the sterility plants, while no expression or less expression in fertility plants, the levels of expression of semi-sterility were in between. And the sterile plant (containing MTS-HM184-GFP) had abnormal anther produced malformed/shriveled pollen grains stained negative that failed to germinate (0%), the corresponding fruits was shrunken, the semi-sterile plants having normal anther shape produced about 10-50% normal pollen grains, the corresponding fruits were not full, and the germination rate was 58%. Meanwhile these transgenic plants which altered on fertility were further analyzed in phenotype. As a result, the metamorphosis leaves were observed in the seedling stage, the plant height of transgenic plants was shorter than wild type. The growth duration of transgenic tobacco was delayed 30-45 days compared to the wild type. The copy numbers of target genes of transgenic tobacco were analyzed using the real-time quantitative method. The results showed that these transgenic plants targeting-expression in mitochondrial containing MTS-HM184-GFP had 1 copy and 2 copies, the other two plants containing MTS-HM184 both had 3 copies, but 0 copy in wild type. In

  16. ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

    Directory of Open Access Journals (Sweden)

    Dominika Ďurechová

    2013-02-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

  17. Seeing the forest for the trees: annotating small RNA producing genes in plants.

    Science.gov (United States)

    Coruh, Ceyda; Shahid, Saima; Axtell, Michael J

    2014-04-01

    A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. [Viability of 7 kinds of medicinal plant seeds stored in medium-term gene bank of the National Medicinal Plant Gene Bank].

    Science.gov (United States)

    Jin, Yue; Yang, Cheng-Min; Wei, Jian-He

    2016-05-01

    In order to evaluate seed viability of Platycodon grandiflorum, Schizonepeta tenuifolia, Andrographis paniculat, Codonopsis pilosula, Scutellaria baicalensis, Leonurus japonicus, Rabdosia rubescens, stored in the medium-term gene bank of the National Medicinal Plant Gene Bank for 4 years, we tested seed germination rate of 7 species of medicinal plant and analyzed the change of significance of levels of the germination rate in pre and post store. Seed germination rates of 7 species of medicinal plants were all decreased after 4 years, and the decrease of S. tenuifolia and S. baicalensis germination rates were much smaller than other species. The higher initial germination rate of P. grandiflorum, C. pilosula, R. rubescens seed has the smaller decline of germination rate, but the data of A. paniculata showed the opposite trend. The rate decline of the germination of S. tenuifolia and S. baicalensis was roughly the same in different germination rate interval. The results showed that low temperature storage could effectively prolong the seed longevity, and maintain the seed vigor. Moreover, it is necessary to study on the storage characteristics of the main medicinal plant seeds, and establish the monitoring plan and regeneration standard. Copyright© by the Chinese Pharmaceutical Association.

  19. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  20. Construction and comparison of gene co-expression networks shows complex plant immune responses

    Directory of Open Access Journals (Sweden)

    Luis Guillermo Leal

    2014-10-01

    Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.

  1. An ant-plant mutualism through the lens of cGMP-dependent kinase genes.

    Science.gov (United States)

    Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E

    2017-09-13

    In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).

  2. Arabidopsis Vacuolar Pyrophosphatase gene (AVP1) induces drought and salt tolerance in Nicotiana tabacum plants (abstract)

    International Nuclear Information System (INIS)

    Arif, A.; Mohsin, A.M.; Shafiq, S.; Zafar, Y.; Hameed, S.M.; Arif, M.; Javed, M.; Gaxiola, R.A.

    2005-01-01

    Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na

  3. Silicon Regulates Potential Genes Involved in Major Physiological Processes in Plants to Combat Stress

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2017-08-01

    Full Text Available Silicon (Si, the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.

  4. Diversity of alkane hydroxylase genes on the rhizoplane of grasses planted in petroleum-contaminated soils

    OpenAIRE

    Tsuboi, Shun; Yamamura, Shigeki; Nakajima-Kambe, Toshiaki; Iwasaki, Kazuhiro

    2015-01-01

    The study investigated the diversity and genotypic features of alkane hydroxylase genes on rhizoplanes of grasses planted in artificial petroleum-contaminated soils to acquire new insights into the bacterial communities responsible for petroleum degradation in phytoremediation. Four types of grass (Cynodon dactylon, two phenotypes of Zoysia japonica, and Z. matrella) were used. The concentrations of total petroleum hydrocarbon effectively decreased in the grass-planted systems compared with t...

  5. [The obtainment and characteristics of Kalanchoe pinnata L. plants expressing the artificial gene of the cecropin P1 antimicrobial peptide].

    Science.gov (United States)

    Zakharchenko, N S; Rukavtsova, E B; Shevchuk, T V; Furs, O V; Pigoleva, S V; Lebedeva, A A; Chulina, I A; Baidakova, L K; Bur'yanov, Ya I

    2016-01-01

    Kalanchoe pinnata L. plants bearing an artificial CP1 gene encoding the cecropin P1 antimicrobial peptide have been obtained. The presence of the CP1 gene in the plant genome has been confirmed by PCR. Cecropin P1 synthesis in transgenic plants has been shown by MALDI mass spectrometry and Western blotting. The obtained plants have been highly resistant to bacterial and fungal phytopathogens, and their extracts have demonstrated antimicrobial activity towards human and animal pathogens. It has been shown that transgenic plants bearing the CP1 gene can be colonized by the beneficial associative microorganisms Methylovorus mays.

  6. Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))

    1991-10-01

    Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.

  7. Fundus Autofluorescence and Photoreceptor Cell Rosettes in Mouse Models

    Science.gov (United States)

    Flynn, Erin; Ueda, Keiko; Auran, Emily; Sullivan, Jack M.; Sparrow, Janet R.

    2014-01-01

    Purpose. This study was conducted to study correlations among fundus autofluorescence (AF), RPE lipofuscin accumulation, and photoreceptor cell degeneration and to investigate the structural basis of fundus AF spots. Methods. Fundus AF images (55° lens; 488-nm excitation) and spectral-domain optical coherence tomography (SD-OCT) scans were acquired in pigmented Rdh8−/−/Abca4−/− mice (ages 1–9 months) with a confocal scanning laser ophthalmoscope (cSLO). For quantitative fundus AF (qAF), gray levels (GLs) were calibrated to an internal fluorescence reference. Retinal bisretinoids were measured by quantitative HPLC. Histometric analysis of outer nuclear layer (ONL) thicknesses was performed, and cryostat sections of retina were examined by fluorescence microscopy. Results. Quantified A2E and qAF intensities increased until age 4 months in the Rdh8−/−/Abca4−/− mice. The A2E levels declined after 4 months of age, but qAF intensity values continued to rise. The decline in A2E levels in the Rdh8−/−/Abca4−/− mice paralleled reduced photoreceptor cell viability as reflected in ONL thinning. Hyperautofluorescent puncta in fundus AF images corresponded to photoreceptor cell rosettes in SD-OCT images and histological sections stained with hematoxylin and eosin. The inner segment/outer segment–containing core of the rosette emitted an autofluorescence detected by fluorescence microscopy. Conclusions. When neural retina is disordered, AF from photoreceptor cells can contribute to noninvasive fundus AF images. Hyperautofluorescent puncta in fundus AF images are attributable, in at least some cases, to photoreceptor cell rosettes. PMID:25015357

  8. Retinal Thickening and Photoreceptor Loss in HIV Eyes without Retinitis.

    Directory of Open Access Journals (Sweden)

    Cheryl A Arcinue

    Full Text Available To determine the presence of structural changes in HIV retinae (i.e., photoreceptor density and retinal thickness in the macula compared with age-matched HIV-negative controls.Cohort of patients with known HIV under CART (combination Antiretroviral Therapy treatment were examined with a flood-illuminated retinal AO camera to assess the cone photoreceptor mosaic and spectral-domain optical coherence tomography (SD-OCT to assess retinal layers and retinal thickness.Twenty-four eyes of 12 patients (n = 6 HIV-positive and 6 HIV-negative were imaged with the adaptive optics camera. In each of the regions of interest studied (nasal, temporal, superior, inferior, the HIV group had significantly less mean cone photoreceptor density compared with age-matched controls (difference range, 4,308-6,872 cones/mm2. A different subset of forty eyes of 20 patients (n = 10 HIV-positive and 10 HIV-negative was included in the retinal thickness measurements and retinal layer segmentation with the SD-OCT. We observed significant thickening in HIV positive eyes in the total retinal thickness at the foveal center, and in each of the three horizontal B-scans (through the macular center, superior, and inferior to the fovea. We also noted that the inner retina (combined thickness from ILM through RNFL to GCL layer was also significantly thickened in all the different locations scanned compared with HIV-negative controls.Our present study shows that the cone photoreceptor density is significantly reduced in HIV retinae compared with age-matched controls. HIV retinae also have increased macular retinal thickness that may be caused by inner retinal edema secondary to retinovascular disease in HIV. The interaction of photoreceptors with the aging RPE, as well as possible low-grade ocular inflammation causing diffuse inner retinal edema, may be the key to the progressive vision changes in HIV-positive patients without overt retinitis.

  9. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  10. Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.

    Science.gov (United States)

    Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella

    2017-10-01

    Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.

    Science.gov (United States)

    Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan

    2016-09-26

    Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.

  12. Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants

    Science.gov (United States)

    Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.

    2005-04-01

    This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.

  13. Reference Gene Selection in the Desert Plant Eremosparton songoricum

    Directory of Open Access Journals (Sweden)

    Dao-Yuan Zhang

    2012-06-01

    Full Text Available Eremosparton songoricum (Litv. Vass. (E. songoricum is a rare and extremely drought-tolerant desert plant that holds promise as a model organism for the identification of genes associated with water deficit stress. Here, we cloned and evaluated the expression of eight candidate reference genes using quantitative real-time reverse transcriptase polymerase chain reactions. The expression of these candidate reference genes was analyzed in a diverse set of 20 samples including various E. songoricum plant tissues exposed to multiple environmental stresses. GeNorm analysis indicated that expression stability varied between the reference genes in the different experimental conditions, but the two most stable reference genes were sufficient for normalization in most conditions. EsEF and Esα-TUB were sufficient for various stress conditions, EsEF and EsACT were suitable for samples of differing germination stages, and EsGAPDHand EsUBQ were most stable across multiple adult tissue samples. The Es18S gene was unsuitable as a reference gene in our analysis. In addition, the expression level of the drought-stress related transcription factor EsDREB2 verified the utility of E. songoricum reference genes and indicated that no single gene was adequate for normalization on its own. This is the first systematic report on the selection of reference genes in E. songoricum, and these data will facilitate future work on gene expression in this species.

  14. Using a periclinal chimera to unravel layer-specific gene expression in plants.

    Science.gov (United States)

    Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

    2013-09-01

    Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.

  15. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    NARCIS (Netherlands)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Rocha, Da Martine; Bajew, Simon; Neilson, Roy; Sokolova, Elena; Silva, Da Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Hans; Jones, John T.; Eves-van den Akker, Sebastian

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been

  16. Lysergic acid diethylamide causes photoreceptor cell damage through inducing inflammatory response and oxidative stress.

    Science.gov (United States)

    Hu, Qi-Di; Xu, Ling-Li; Gong, Yan; Wu, Guo-Hai; Wang, Yu-Wen; Wu, Shan-Jun; Zhang, Zhe; Mao, Wei; Zhou, Yu-Sheng; Li, Qin-Bo; Yuan, Jian-Shu

    2018-01-19

    Lysergic acid diethylamide (LSD), a classical hallucinogen, was used as a popular and notorious substance of abuse in various parts of the world. Its abuse could result in long-lasting abnormalities in retina and little is known about the exact mechanism. This study was to investigate the effect of LSD on macrophage activation state at non-toxic concentration and its resultant toxicity to photoreceptor cells. Results showed that cytotoxicity was caused by LSD on 661 W cells after co-culturing with RAW264.7 cells. Treatment with LSD-induced RAW264.7 cells to the M1 phenotype, releasing more pro-inflammatory cytokines, and increasing the M1-related gene expression. Moreover, after co-culturing with RAW264.7 cells, significant oxidative stress in 661 W cells treated with LSD was observed, by increasing the level of malondialdehyde (MDA) and reactive oxygen species (ROS), and decreasing the level of glutathione (GSH) and the activity of superoxide dismutase (SOD). Our study demonstrated that LSD caused photoreceptor cell damage by inducing inflammatory response and resultant oxidative stress, providing the scientific rationale for the toxicity of LSD to retina.

  17. UV-B photoreceptor-mediated protection of the photosynthetic machinery in Chlamydomonas reinhardtii.

    Science.gov (United States)

    Allorent, Guillaume; Lefebvre-Legendre, Linnka; Chappuis, Richard; Kuntz, Marcel; Truong, Thuy B; Niyogi, Krishna K; Ulm, Roman; Goldschmidt-Clermont, Michel

    2016-12-20

    Life on earth is dependent on the photosynthetic conversion of light energy into chemical energy. However, absorption of excess sunlight can damage the photosynthetic machinery and limit photosynthetic activity, thereby affecting growth and productivity. Photosynthetic light harvesting can be down-regulated by nonphotochemical quenching (NPQ). A major component of NPQ is qE (energy-dependent nonphotochemical quenching), which allows dissipation of light energy as heat. Photodamage peaks in the UV-B part of the spectrum, but whether and how UV-B induces qE are unknown. Plants are responsive to UV-B via the UVR8 photoreceptor. Here, we report in the green alga Chlamydomonas reinhardtii that UVR8 induces accumulation of specific members of the light-harvesting complex (LHC) superfamily that contribute to qE, in particular LHC Stress-Related 1 (LHCSR1) and Photosystem II Subunit S (PSBS). The capacity for qE is strongly induced by UV-B, although the patterns of qE-related proteins accumulating in response to UV-B or to high light are clearly different. The competence for qE induced by acclimation to UV-B markedly contributes to photoprotection upon subsequent exposure to high light. Our study reveals an anterograde link between photoreceptor-mediated signaling in the nucleocytosolic compartment and the photoprotective regulation of photosynthetic activity in the chloroplast.

  18. UV-B photoreceptor-mediated protection of the photosynthetic machinery in Chlamydomonas reinhardtii

    Science.gov (United States)

    Allorent, Guillaume; Lefebvre-Legendre, Linnka; Chappuis, Richard; Kuntz, Marcel; Truong, Thuy B.; Niyogi, Krishna K.; Goldschmidt-Clermont, Michel

    2016-01-01

    Life on earth is dependent on the photosynthetic conversion of light energy into chemical energy. However, absorption of excess sunlight can damage the photosynthetic machinery and limit photosynthetic activity, thereby affecting growth and productivity. Photosynthetic light harvesting can be down-regulated by nonphotochemical quenching (NPQ). A major component of NPQ is qE (energy-dependent nonphotochemical quenching), which allows dissipation of light energy as heat. Photodamage peaks in the UV-B part of the spectrum, but whether and how UV-B induces qE are unknown. Plants are responsive to UV-B via the UVR8 photoreceptor. Here, we report in the green alga Chlamydomonas reinhardtii that UVR8 induces accumulation of specific members of the light-harvesting complex (LHC) superfamily that contribute to qE, in particular LHC Stress-Related 1 (LHCSR1) and Photosystem II Subunit S (PSBS). The capacity for qE is strongly induced by UV-B, although the patterns of qE-related proteins accumulating in response to UV-B or to high light are clearly different. The competence for qE induced by acclimation to UV-B markedly contributes to photoprotection upon subsequent exposure to high light. Our study reveals an anterograde link between photoreceptor-mediated signaling in the nucleocytosolic compartment and the photoprotective regulation of photosynthetic activity in the chloroplast. PMID:27930292

  19. Cadmium resistance in tobacco plants expressing the MuSI gene

    OpenAIRE

    Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

    2011-01-01

    MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI t...

  20. Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Kenneth W. Berendzen

    2013-04-01

    Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.

  1. Bioinformatics analysis of the oxidosqualene cyclase gene and the amino acid sequence in mangrove plants

    Science.gov (United States)

    Basyuni, M.; Wati, R.

    2017-01-01

    This study described the bioinformatics methods to analyze seven oxidosqualene cyclase (OSC) genes from mangrove plants on DDBJ/EMBL/GenBank as well as predicted the structure, composition, similarity, subcellular localization and phylogenetic. The physical and chemical properties of seven mangrove OSC showed variation among the genes. The percentage of the secondary structure of seven mangrove OSC genes followed the order of a helix > random coil > extended chain structure. The values of chloroplast or signal peptide were too low, indicated that no chloroplast transit peptide or signal peptide of secretion pathway in mangrove OSC genes. The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the mangrove OSC gene, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, Kandelia KcMS join with Bruguiera BgLUS, Rhizophora RsM1 was close to Bruguiera BgbAS, and Rhizophora RcCAS join with Kandelia KcCAS. The present study, therefore, supported the previous results that plant OSC genes form distinct clusters in the tree.

  2. Viral vectors for gene modification of plants as chem/bio sensors.

    Energy Technology Data Exchange (ETDEWEB)

    Manginell, Monica; Harper, Jason C.; Arango, Dulce C.; Brozik, Susan Marie; Dolan, Patricia L.

    2006-11-01

    Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport. We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing

  3. Obtaining of transgenic papaya plants var. Maradol roja that carry out the rice oryzacystatin gene

    Directory of Open Access Journals (Sweden)

    Milady F. Mendoza

    2004-10-01

    Full Text Available Papaya (Carica papaya L., is severely affected by Papaya Ringspot virus, which belongs to plant potyvirus group. A recent strategy for pest control produced by this virus is the transformation with genes encoding cysteine proteinase inhibitors. Rice oryzacistatin gene encoding for cystatins, was inserted in a pCAMBIA binary vector, for genetic transformation of papaya somatic embryos var. Maradol roja, mediated by gene gun. Gene integration was confirmed by means of polimerase chain reaction using the primers designed from gene bar sequence. Forty out of eighty in vitro transgenic papaya lines amplified a 402 fragment which correspond to the expecting size. Key words: Carica papaya, genetic engineering, potyvirus, proteinase inhibitor

  4. Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene.

    Science.gov (United States)

    Amara, Imen; Capellades, Montserrat; Ludevid, M Dolors; Pagès, Montserrat; Goday, Adela

    2013-06-15

    Late Embryogenesis Abundant (LEA) proteins participate in plant stress responses and contribute to the acquisition of desiccation tolerance. In this report Rab28 LEA gene has been over-expressed in maize plants under a constitutive maize promoter. The expression of Rab28 transcripts led to the accumulation and stability of Rab28 protein in the transgenic plants. Native Rab28 protein is localized to nucleoli in wild type maize embryo cells; here we find by whole-mount immunocytochemistry that in root cells of Rab28 transgenic and wild-type plants the protein is also associated to nucleolar structures. Transgenic plants were tested for stress tolerance and resulted in sustained growth under polyethyleneglycol (PEG)-mediated dehydration compared to wild-type controls. Under osmotic stress transgenic seedlings showed increased leaf and root areas, higher relative water content (RWC), reduced chlorophyll loss and lower Malondialdehyde (MDA) production in relation to wild-type plants. Moreover, transgenic seeds exhibited higher germination rates than wild-type seeds under water deficit. Overall, our results highlight the presence of transgenic Rab28 protein in nucleolar structures and point to the potential of group 5 LEA Rab28 gene as candidate to enhance stress tolerance in maize plants. Copyright © 2013 Elsevier GmbH. All rights reserved.

  5. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  6. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  7. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  8. Ethical perception of cross-species gene transfer in plant | Amin ...

    African Journals Online (AJOL)

    Plants can be genetically modified through a variety of methods in the hope that it will be improved in some way to increase the yield and quality of a crop, or to add nutritional value or shelf life. The development of genetically modified (GM) rice to enrich its nutritional value, such as Vitamin C might involve gene transfer ...

  9. Identifying new sex-linked genes through BAC sequencing in the dioecious plant Silene latifolia

    Czech Academy of Sciences Publication Activity Database

    Blavet, Nicolas; Blavet, Hana; Muyle, A.; Käfer, J.; Cegan, R.; Deschamps, C.; Zemp, N.; Mousset, S.; Aubourg, S.; Bergero, R.; Charlesworth, D.; Hobza, Roman; Widmer, A.; Marais, G.A.B.

    2015-01-01

    Roč. 16, JUL 25 (2015), s. 546 ISSN 1471-2164 R&D Projects: GA ČR GAP501/12/2220 Institutional support: RVO:61389030 Keywords : Sex chromosomes * Sex-linked genes * Plant Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

  10. Evolutionary history of the phl gene cluster in the plant-associated bacterium Pseudomonas fluorescens

    NARCIS (Netherlands)

    Moynihan, J.A.; Morrissey, J.P.; Coppoolse, E.; Stiekema, W.J.; O'Gara, F.; Boyd, E.F.

    2009-01-01

    Pseudomonas fluorescens is of agricultural and economic importance as a biological control agent largely because of its plant-association and production of secondary metabolites, in particular 2, 4-diacetylphloroglucinol (2, 4-DAPG). This polyketide, which is encoded by the eight gene phl cluster,

  11. An efficient marker-free vector for clean gene transfer into plants ...

    African Journals Online (AJOL)

    A marker-free vector, pBINMF, for clean gene transfer was constructed based on the binary vector pBINPLUS. Vector pBINMF, carrying only a multiple cloning site (MCS) between the left and the right T-DNA border, was suitable to directly generate marker-free transgenic plants (MFTPs) without any vector sequences ...

  12. NDH expression marks major transitions in plant evolution and reveals coordinate intracellular gene loss.

    Science.gov (United States)

    Ruhlman, Tracey A; Chang, Wan-Jung; Chen, Jeremy J W; Huang, Yao-Ting; Chan, Ming-Tsair; Zhang, Jin; Liao, De-Chih; Blazier, John C; Jin, Xiaohua; Shih, Ming-Che; Jansen, Robert K; Lin, Choun-Sea

    2015-04-11

    Key innovations have facilitated novel niche utilization, such as the movement of the algal predecessors of land plants into terrestrial habitats where drastic fluctuations in light intensity, ultraviolet radiation and water limitation required a number of adaptations. The NDH (NADH dehydrogenase-like) complex of Viridiplantae plastids participates in adapting the photosynthetic response to environmental stress, suggesting its involvement in the transition to terrestrial habitats. Although relatively rare, the loss or pseudogenization of plastid NDH genes is widely distributed across diverse lineages of photoautotrophic seed plants and mutants/transgenics lacking NDH function demonstrate little difference from wild type under non-stressed conditions. This study analyzes large transcriptomic and genomic datasets to evaluate the persistence and loss of NDH expression across plants. Nuclear expression profiles showed accretion of the NDH gene complement at key transitions in land plant evolution, such as the transition to land and at the base of the angiosperm lineage. While detection of transcripts for a selection of non-NDH, photosynthesis related proteins was independent of the state of NDH, coordinate, lineage-specific loss of plastid NDH genes and expression of nuclear-encoded NDH subunits was documented in Pinaceae, gnetophytes, Orchidaceae and Geraniales confirming the independent and complete loss of NDH in these diverse seed plant taxa. The broad phylogenetic distribution of NDH loss and the subtle phenotypes of mutants suggest that the NDH complex is of limited biological significance in contemporary plants. While NDH activity appears dispensable under favorable conditions, there were likely sufficiently frequent episodes of abiotic stress affecting terrestrial habitats to allow the retention of NDH activity. These findings reveal genetic factors influencing plant/environment interactions in a changing climate through 450 million years of land plant

  13. Overexpression of the AtSHI gene in poinsettia, Euphorbia pulcherrima, results in compact plants.

    Directory of Open Access Journals (Sweden)

    M Ashraful Islam

    Full Text Available Euphorbia pulcherrima, poinsettia, is a non-food and non-feed vegetatively propagated ornamental plant. Appropriate plant height is one of the most important traits in poinsettia production and is commonly achieved by application of chemical growth retardants. To produce compact poinsettia plants with desirable height and reduce the utilization of growth retardants, the Arabidopsis SHORT INTERNODE (AtSHI gene controlled by the cauliflower mosaic virus 35S promoter was introduced into poinsettia by Agrobacterium-mediated transformation. Three independent transgenic lines were produced and stable integration of transgene was verified by PCR and Southern blot analysis. Reduced plant height (21-52% and internode lengths (31-49% were obtained in the transgenic lines compared to control plants. This correlates positively with the AtSHI transcript levels, with the highest levels in the most dwarfed transgenic line (TL1. The indole-3-acetic acid (IAA content appeared lower (11-31% reduction in the transgenic lines compared to the wild type (WT controls, with the lowest level (31% reduction in TL1. Total internode numbers, bract numbers and bract area were significantly reduced in all transgenic lines in comparison with the WT controls. Only TL1 showed significantly lower plant diameter, total leaf area and total dry weight, whereas none of the AtSHI expressing lines showed altered timing of flower initiation, cyathia abscission or bract necrosis. This study demonstrated that introduction of the AtSHI gene into poinsettia by genetic engineering can be an effective approach in controlling plant height without negatively affecting flowering time. This can help to reduce or avoid the use of toxic growth retardants of environmental and human health concern. This is the first report that AtSHI gene was overexpressed in poinsettia and transgenic poinsettia plants with compact growth were produced.

  14. A contribution to the study of plant development evolution based on gene co-expression networks

    Directory of Open Access Journals (Sweden)

    Francisco J. Romero-Campero

    2013-08-01

    Full Text Available Phototrophic eukaryotes are among the most successful organisms on Earth due to their unparalleled efficiency at capturing light energy and fixing carbon dioxide to produce organic molecules. A conserved and efficient network of light-dependent regulatory modules could be at the bases of this success. This regulatory system conferred early advantages to phototrophic eukaryotes that allowed for specialization, complex developmental processes and modern plant characteristics. We have studied light-dependent gene regulatory modules from algae to plants employing integrative-omics approaches based on gene co-expression networks. Our study reveals some remarkably conserved ways in which eukaryotic phototrophs deal with day length and light signaling. Here we describe how a family of Arabidopsis transcription factors involved in photoperiod response has evolved from a single algal gene according to the innovation, amplification and divergence theory of gene evolution by duplication. These modifications of the gene co-expression networks from the ancient unicellular green algae Chlamydomonas reinhardtii to the modern brassica Arabidopsis thaliana may hint on the evolution and specialization of plants and other organisms.

  15. The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys

    Directory of Open Access Journals (Sweden)

    Anna V. Shchennikova

    2018-01-01

    Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.

  16. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  17. Gene stacking of multiple traits for high yield of fermentable sugars in plant biomass

    DEFF Research Database (Denmark)

    Aznar, Aude; Chalvin, Camille; Shih, Patrick M.

    2018-01-01

    the ratio of C6 to C5 sugars in the cell wall and decreasing the lignin content are two important targets in engineering of plants that are more suitable for downstream processing for second-generation biofuel production.Results: We have studied the basic mechanisms of cell wall biosynthesis and identified...... genes involved in biosynthesis of pectic galactan, including the GALS1 galactan synthase and the UDP-galactose/UDP-rhamnose transporter URGT1. We have engineered plants with a more suitable biomass composition by applying these findings, in conjunction with synthetic biology and gene stacking tools...... to vessels where this polysaccharide is essential. Finally, the high galactan and low xylan traits were stacked with the low lignin trait obtained by expressing the QsuB gene encoding dehydroshikimate dehydratase in lignifying cells.Conclusion: The results show that approaches to increasing C6 sugar content...

  18. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  19. A Comparison of Selective Pressures in Plant X-Linked and Autosomal Genes.

    Science.gov (United States)

    Krasovec, Marc; Nevado, Bruno; Filatov, Dmitry A

    2018-05-03

    Selection is expected to work differently in autosomal and X-linked genes because of their ploidy difference and the exposure of recessive X-linked mutations to haploid selection in males. However, it is not clear whether these expectations apply to recently evolved sex chromosomes, where many genes retain functional X- and Y-linked gametologs. We took advantage of the recently evolved sex chromosomes in the plant Silene latifolia and its closely related species to compare the selective pressures between hemizygous and non-hemizygous X-linked genes as well as between X-linked genes and autosomal genes. Our analysis, based on over 1000 genes, demonstrated that, similar to animals, X-linked genes in Silene evolve significantly faster than autosomal genes—the so-called faster-X effect. Contrary to expectations, faster-X divergence was detectable only for non-hemizygous X-linked genes. Our phylogeny-based analyses of selection revealed no evidence for faster adaptation in X-linked genes compared to autosomal genes. On the other hand, partial relaxation of purifying selection was apparent on the X-chromosome compared to the autosomes, consistent with a smaller genetic diversity in S. latifolia X-linked genes (π x = 0.016; π aut = 0.023). Thus, the faster-X divergence in S. latifolia appears to be a consequence of the smaller effective population size rather than of a faster adaptive evolution on the X-chromosome. We argue that this may be a general feature of “young” sex chromosomes, where the majority of X-linked genes are not hemizygous, preventing haploid selection in heterogametic sex.

  20. Using The Corngrass1 Gene To Enhance The Biofuel Properties Of Crop Plants

    Energy Technology Data Exchange (ETDEWEB)

    Hake, Sarah [USDA Agricultural Research Service, Washington DC (United States); Chuck, George [USDA Agricultural Research Service, Washington DC (United States)

    2015-10-29

    The development of novel plant germplasm is vital to addressing our increasing bioenergy demands. The major hurdle to digesting plant biomass is the complex structure of the cell walls, the substrate of fermentation. Plant cell walls are inaccessible matrices of macromolecules that are polymerized with lignin, making fermentation difficult. Overcoming this hurdle is a major goal toward developing usable bioenergy crop plants. Our project seeks to enhance the biofuel properties of perennial grass species using the Corngrass1 (Cg1) gene and its targets. Dominant maize Cg1 mutants produce increased biomass by continuously initiating extra axillary meristems and leaves. We cloned Cg1 and showed that its phenotype is caused by over expression of a unique miR156 microRNA gene that negatively regulates SPL transcription factors. We transferred the Cg1 phenotype to other plants by expressing the gene behind constitutive promoters in four different species, including the monocots, Brachypodium and switchgrass, and dicots, Arabidopsis and poplar. All transformants displayed a similar range of phenotypes, including increased biomass from extended leaf production, and increased vegetative branching. Field grown switchgrass transformants showed that overall lignin content was reduced, the ratio of glucans to xylans was increased, and surprisingly, that starch levels were greatly increased. The goals of this project are to control the tissue and temporal expression of Cg1 by using different promoters to drive its expression, elucidate the function of the SPL targets of Cg1 by generating gain and loss of function alleles, and isolate downstream targets of select SPL genes using deep sequencing and chromatin immunoprecipitation. We believe it is possible to control biomass accumulation, cell wall properties, and sugar levels through manipulation of either the Cg1 gene and/or its SPL targets.

  1. Slow food: insect prey and chitin induce phytohormone accumulation and gene expression in carnivorous Nepenthes plants.

    Science.gov (United States)

    Yilamujiang, Ayufu; Reichelt, Michael; Mithöfer, Axel

    2016-08-01

    Carnivorous Nepenthes plants use modified leaves forming pitfall traps to capture and digest prey, mainly insects, for additional nutrient supply. These traps, so called pitchers, contain a plant-derived fluid composed of many hydrolytic enzymes and defence-related proteins. In this study, the prey-induced induction of corresponding genes of those proteins and a role for phytohormones in this process was analysed. Tissue from insect prey-fed, chitin- and phytohormone-challenged pitchers was harvested and analysed for selected gene expressions by a quantitative PCR technique. Phytohormone levels were determined by LC-MS/MS. Nepenthesin proteolytic activities were measured in the digestive fluid using a fluorescence substrate. Insect prey in the pitchers induced the accumulation of phytohormones such as jasmonates as well as the transcription of studied genes encoding a chitinase 3 and a protease (nepenthesin I), whereas a defence-related protein (PR-1) gene was not induced. Treatment with chitin as a component of the insects' exoskeleton triggered the accumulation of jasmonates, the expression of nepenthesin I and chitinase 3 genes similar to jasmonic acid treatment, and induced protease activity in the fluid. All detectable responses were slowly induced. The results suggest that upon insect prey catch a sequence of signals is initiated: (1) insect-derived chitin, (2) jasmonate as endogenous phytohormone signal, (3) the induction of digestive gene expression and (4) protein expression. This resembles a similar hierarchy of events as described from plant pathogen/herbivore interactions, supporting the idea that carnivory evolved from plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

    2013-05-01

    Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application

  3. High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

    2013-05-15

    Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application.

  4. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  5. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    International Nuclear Information System (INIS)

    Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

    2016-01-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  6. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhenyu, E-mail: wzy72609@163.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Wang, Bing, E-mail: wangbing@ibcas.ac.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Liu, Erlong, E-mail: liuel14@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Chen, Ni, E-mail: 63710156@qq.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhang, Wei, E-mail: wzhang1216@yahoo.com [Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444 (China); Liu, Heng, E-mail: hengliu@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China)

    2016-04-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  7. Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

    Science.gov (United States)

    Vozárová, Z; Žilová, M; Šubr, Z

    2015-12-01

    Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

  8. Genes under positive selection in a model plant pathogenic fungus, Botrytis.

    Science.gov (United States)

    Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian

    2012-07-01

    The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

    Science.gov (United States)

    Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

    2015-09-01

    In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

  10. Remote sensing of gene expression in Planta: transgenic plants as monitors of exogenous stress perception in extraterrestrial environments

    Science.gov (United States)

    Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.

    2002-01-01

    Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.

  11. Cadmium resistance in tobacco plants expressing the MuSI gene.

    Science.gov (United States)

    Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

    2011-10-01

    MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI transgenic tobacco plants absorbed less Cd than wild-type plants. Cd translocation from roots to shoots was reduced in the transgenic plants, thereby avoiding Cd toxicity. The number of short trichomes in the leaves of wild-type tobacco plants was increased by Cd treatment, while this was unchanged in MuSI transgenic tobacco. These results suggest that MuSI transgenic tobacco plants have enhanced tolerance to Cd via reduced Cd uptake and/or increased Cd immobilization in the roots, resulting in less Cd translocation to the shoots.

  12. Fibroblast and keratinocyte gene expression following exposure to the extracts of holy basil plant (Ocimum tenuiflorum, malabar nut plant (Justicia adhatoda, and emblic myrobalan plant (Phyllanthus emblica

    Directory of Open Access Journals (Sweden)

    Takao Someya

    2018-04-01

    Full Text Available This data article provides gene expression profiles, determined by using real-time PCR, of fibroblasts and keratinocytes treated with 0.01% and 0.001% extracts of holy basil plant (Ocimum tenuiflorum, sri lankan local name “maduruthala”, 0.1% and 0.01% extracts of malabar nut plant (Justicia adhatoda, sri lankan local name “adayhoda” and 0.003% and 0.001% extracts of emblic myrobalan plant (Phyllanthus emblica, sri lankan local name “nelli”, harvested in Sri Lanka. For fibroblasts, the dataset includes expression profiles for genes encoding hyaluronan synthase 1 (HAS1, hyaluronan synthase 2 (HAS2, hyaluronidase-1 (HYAL1, hyaluronidase-2 (HYAL2, versican, aggrecan, CD44, collagen, type I, alpha 1 (COL1A1, collagen, type III, alpha 1 (COL3A1, collagen, type VII, alpha 1 (COL7A1, matrix metalloproteinase 1 (MMP1, acid ceramidase, basic fibroblast growth factor (bFGF, fibroblast growth factor-7 (FGF7, vascular endothelial growth factor (VEGF, interleukin-1 alpha (IL-1α, cyclooxygenase-2 (cox2, transforming growth factor beta (TGF-β, and aquaporin 3 (AQP3. For keratinocytes, the expression profiles are for genes encoding HAS1, HAS2, HYAL1, HYAL2, versican, CD44, IL-1α, cox2, TGF-β, AQP3, Laminin5, collagen, type XVII, alpha 1 (COL17A1, integrin alpha-6 (ITGA6, ceramide synthase 3 (CERS3, elongation of very long chain fatty acids protein 1 (ELOVL1, elongation of very long chain fatty acids protein 4 (ELOVL4, filaggrin (FLG, transglutaminase 1 (TGM1, and keratin 1 (KRT1. The expression profiles are provided as bar graphs. Keywords: Real-time PCR, Gene expression profile, Fibroblast, Keratinocyte, Holy basil extract, Ocimum tenuiflorum, Maduruthala, Malabar nut plant extract, Justicia adhatoda, Adayhoda, Emblic myrobalan extract, Phyllanthus emblica, Nelli

  13. Integrity of the cone photoreceptor mosaic in oligocone trichromacy

    DEFF Research Database (Denmark)

    Michaelides, Michel; Rha, Jungtae; Dees, Elise W

    2011-01-01

    Oligocone trichromacy (OT) is an unusual cone dysfunction syndrome characterized by reduced visual acuity, mild photophobia, reduced amplitude of the cone electroretinogram with normal rod responses, normal fundus appearance, and normal or near-normal color vision. It has been proposed that these...... that these patients have a reduced number of normal functioning cones (oligocone). This paper has sought to evaluate the integrity of the cone photoreceptor mosaic in four patients previously described as having OT....

  14. Responses of crayfish photoreceptor cells following intense light adaptation.

    Science.gov (United States)

    Cummins, D R; Goldsmith, T H

    1986-01-01

    After intense orange adapting exposures that convert 80% of the rhodopsin in the eye to metarhodopsin, rhabdoms become covered with accessory pigment and appear to lose some microvillar order. Only after a delay of hours or even days is the metarhodopsin replaced by rhodopsin (Cronin and Goldsmith 1984). After 24 h of dark adaptation, when there has been little recovery of visual pigment, the photoreceptor cells have normal resting potentials and input resistances, and the reversal potential of the light response is 10-15 mV (inside positive), unchanged from controls. The log V vs log I curve is shifted about 0.6 log units to the right on the energy axis, quantitatively consistent with the decrease in the probability of quantum catch expected from the lowered concentration of rhodopsin in the rhabdoms. Furthermore, at 24 h the photoreceptors exhibit a broader spectral sensitivity than controls, which is also expected from accumulations of metarhodopsin in the rhabdoms. In three other respects, however, the transduction process appears to be light adapted: The voltage responses are more phasic than those of control photoreceptors. The relatively larger effect (compared to controls) of low extracellular Ca++ (1 mmol/l EGTA) in potentiating the photoresponses suggests that the photoreceptors may have elevated levels of free cytoplasmic Ca++. The saturating depolarization is only about 30% as large as the maximal receptor potentials of contralateral, dark controls, and by that measure the log V-log I curve is shifted downward by 0.54 log units.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Early photoreceptor outer segment loss and retinoschisis in Cohen syndrome.

    Science.gov (United States)

    Uyhazi, Katherine E; Binenbaum, Gil; Carducci, Nicholas; Zackai, Elaine H; Aleman, Tomas S

    2018-06-01

    To describe early structural and functional retinal changes in a patient with Cohen syndrome. A 13-month-old Caucasian girl of Irish and Spanish ancestry was noted to have micrognathia and laryngomalacia at birth, which prompted a genetic evaluation that revealed biallelic deletions in COH1 (VPS13B) (a maternally inherited 60-kb deletion involving exons 26-32 and a paternally inherited 3.5-kb deletion within exon 17) consistent with Cohen syndrome. She underwent a complete ophthalmic examination, full-field flash electroretinography and retinal imaging with spectral domain optical coherence tomography. Central vision was central, steady, and maintained. There was bilateral myopic astigmatic refractive error. Fundus exam was notable for dark foveolar pigmentation, but no obvious abnormalities of either eye. Spectral domain optical coherence tomography cross sections through the fovea revealed a normal appearing photoreceptor outer nuclear layer but loss of the interdigitation signal between the photoreceptor outer segments and the apical retinal pigment epithelium. Retinoschisis involving the inner nuclear layer of both eyes and possible ganglion cell layer thinning were also noted. There was a detectable electroretinogram with similarly reduced amplitudes of rod- (white, 0.01 cd.s.m -2 ) and cone-mediated (3 cd.s.m -2 , 30 Hz) responses. Photoreceptor outer segment abnormalities and retinoschisis may represent the earliest structural retinal change detected by spectral domain optical coherence tomography in patients with Cohen syndrome, suggesting a complex pathophysiology with primary involvement of the photoreceptor cilium and disorganization of the structural integrity of the inner retina.

  16. Does Apoptosis Regulate the Function of Retinal Photoreceptors?

    OpenAIRE

    Halaby, Reginald

    2012-01-01

    Apoptosis, or programmed cell death, is an integral component of developmental biology, embryology, and anatomy. All eukaryotic cells possess the molecular machinery necessary to execute apoptosis. However, dysregulated apoptosis in the form of too much or too little cell death results in diseases such as Alzheimer’s disease, autoimmune disorders, and cancer. It is postulated that apoptosis of the photoreceptors in the retina plays a vital role in mediating vision, and evidence is presented h...

  17. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  18. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

    Science.gov (United States)

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

    2016-11-01

    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  19. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions

    Science.gov (United States)

    Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio

    2018-01-01

    Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216

  20. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions.

    Directory of Open Access Journals (Sweden)

    Corina Diana Ceapă

    Full Text Available Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.

  1. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    Science.gov (United States)

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  2. Calcium channel-dependent molecular maturation of photoreceptor synapses.

    Directory of Open Access Journals (Sweden)

    Nawal Zabouri

    Full Text Available Several studies have shown the importance of calcium channels in the development and/or maturation of synapses. The Ca(V1.4(α(1F knockout mouse is a unique model to study the role of calcium channels in photoreceptor synapse formation. It features abnormal ribbon synapses and aberrant cone morphology. We investigated the expression and targeting of several key elements of ribbon synapses and analyzed the cone morphology in the Ca(V1.4(α(1F knockout retina. Our data demonstrate that most abnormalities occur after eye opening. Indeed, scaffolding proteins such as Bassoon and RIM2 are properly targeted at first, but their expression and localization are not maintained in adulthood. This indicates that either calcium or the Ca(V1.4 channel, or both are necessary for the maintenance of their normal expression and distribution in photoreceptors. Other proteins, such as Veli3 and PSD-95, also display abnormal expression in rods prior to eye opening. Conversely, vesicle related proteins appear normal. Our data demonstrate that the Ca(V1.4 channel is important for maintaining scaffolding proteins in the ribbon synapse but less vital for proteins related to vesicular release. This study also confirms that in adult retinae, cones show developmental features such as sprouting and synaptogenesis. Overall we present evidence that in the absence of the Ca(V1.4 channel, photoreceptor synapses remain immature and are unable to stabilize.

  3. Calcium channel-dependent molecular maturation of photoreceptor synapses.

    Science.gov (United States)

    Zabouri, Nawal; Haverkamp, Silke

    2013-01-01

    Several studies have shown the importance of calcium channels in the development and/or maturation of synapses. The Ca(V)1.4(α(1F)) knockout mouse is a unique model to study the role of calcium channels in photoreceptor synapse formation. It features abnormal ribbon synapses and aberrant cone morphology. We investigated the expression and targeting of several key elements of ribbon synapses and analyzed the cone morphology in the Ca(V)1.4(α(1F)) knockout retina. Our data demonstrate that most abnormalities occur after eye opening. Indeed, scaffolding proteins such as Bassoon and RIM2 are properly targeted at first, but their expression and localization are not maintained in adulthood. This indicates that either calcium or the Ca(V)1.4 channel, or both are necessary for the maintenance of their normal expression and distribution in photoreceptors. Other proteins, such as Veli3 and PSD-95, also display abnormal expression in rods prior to eye opening. Conversely, vesicle related proteins appear normal. Our data demonstrate that the Ca(V)1.4 channel is important for maintaining scaffolding proteins in the ribbon synapse but less vital for proteins related to vesicular release. This study also confirms that in adult retinae, cones show developmental features such as sprouting and synaptogenesis. Overall we present evidence that in the absence of the Ca(V)1.4 channel, photoreceptor synapses remain immature and are unable to stabilize.

  4. Studies on gene expressions analyses for Arabidopsis thaliana plants stimulated by space flight condition

    Science.gov (United States)

    Lu, Jinying; Liu, Min; Pan, Yi; Li, Huasheng

    We carried out whole-genome microarray to screen the transcript profile of Arabidopsis thaliana seedlings after three treatment: space microgravity condition( Seedlings grown in microgravity state of space flight of SIMBOX on Shenzhou-8), 1g centrifugal force in space(Seedlings grown in 1g centrifugal force state of space flight of SIMBOX on Shenzhou-8) and ground control. The result of microarray analysis is as followed: There were 368 genes significantly differentially expressed in space microgravity condition compared with that in 1g centrifuge space condition. Space radiation caused 246 genes significantly differentially expressed between seedlings in 1g centrifuge space condition and ground control. Space conditions (including microgravity and radiation) caused 621 genes significantly differentially expressed between seedlings in space microgravity condition and ground control. Microgravity and radiation as a single factor can cause plant gene expression change, but two factors synergism can produce some new effects on plant gene expression. The function of differential expression genes were analyst by bioinformatics, and we found the expression of genes related with stress were more different, such as the dehydration of protein (dehydrin Xero2) expression is up-regulated 57 times; low-temperature-induced protein expression is up-regulated in 49 times; heat shock protein expression is up-regulated 20 times; transcription factor DREB2A expression increase 25 times; protein phosphatase 2C expression is up-regulated 14 times; transcription factor NAM-like protein expression is up-regulated 13 times; cell wall metabolism related genes (xyloglucan, endo-1, 4-beta-D-glucanase) expression is down-regulated in 15 times. The results provide scientific data for the mechanism of space mutation.

  5. Rate variation in parasitic plants: correlated and uncorrelated patterns among plastid genes of different function

    Directory of Open Access Journals (Sweden)

    dePamphilis Claude W

    2005-02-01

    Full Text Available Abstract Background The analysis of synonymous and nonsynonymous rates of DNA change can help in the choice among competing explanations for rate variation, such as differences in constraint, mutation rate, or the strength of genetic drift. Nonphotosynthetic plants of the Orobanchaceae have increased rates of DNA change. In this study 38 taxa of Orobanchaceae and relatives were used and 3 plastid genes were sequenced for each taxon. Results Phylogenetic reconstructions of relative rates of sequence evolution for three plastid genes (rbcL, matK and rps2 show significant rate heterogeneity among lineages and among genes. Many of the non-photosynthetic plants have increases in both synonymous and nonsynonymous rates, indicating that both (1 selection is relaxed, and (2 there has been a change in the rate at which mutations are entering the population in these species. However, rate increases are not always immediate upon loss of photosynthesis. Overall there is a poor correlation of synonymous and nonsynonymous rates. There is, however, a strong correlation of synonymous rates across the 3 genes studied and the lineage-speccific pattern for each gene is strikingly similar. This indicates that the causes of synonymous rate variation are affecting the whole plastid genome in a similar way. There is a weaker correlation across genes for nonsynonymous rates. Here the picture is more complex, as could be expected if there are many causes of variation, differing from taxon to taxon and gene to gene. Conclusions The distinctive pattern of rate increases in Orobanchaceae has at least two causes. It is clear that there is a relaxation of constraint in many (though not all non-photosynthetic lineages. However, there is also some force affecting synonymous sites as well. At this point, it is not possible to tell whether it is generation time, speciation rate, mutation rate, DNA repair efficiency or some combination of these factors.

  6. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    Science.gov (United States)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  7. Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses

    Directory of Open Access Journals (Sweden)

    Magdalena eMazur

    2012-09-01

    Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.

  8. Bioaerosols from a food waste composting plant affect human airway epithelial cell remodeling genes.

    Science.gov (United States)

    Chang, Min-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-12-24

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 10(2) conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5-10 μm) having higher endotoxin levels than did fine particles (0.5-2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21 WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers.

  9. Bioaerosols from a Food Waste Composting Plant Affect Human Airway Epithelial Cell Remodeling Genes

    Science.gov (United States)

    Chang, Ming-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-01-01

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 102 conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5–10 μm) having higher endotoxin levels than did fine particles (0.5–2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers. PMID:24368426

  10. Disruption of plant carotenoid biosynthesis through virus-induced gene silencing affects oviposition behaviour of the butterfly Pieris rapae

    NARCIS (Netherlands)

    Zheng, S.J.; Snoeren, T.A.L.; Hogewoning, S.W.; Loon, van J.J.A.; Dicke, M.

    2010-01-01

    Optical plant characteristics are important cues to plant-feeding insects. In this article, we demonstrate for the first time that silencing the phytoene desaturase (PDS) gene, encoding a key enzyme in plant carotenoid biosynthesis, affects insect oviposition site selection behaviour. Virus-induced

  11. Phenotypic performance of transgenic potato (Solanum tuberosum L.) plants with pyramided rice cystatin genes (OCI and OCII)

    Science.gov (United States)

    The evaluation of transgenic plants commonly carried out under controlled conditions in culture rooms and greenhouses can give valuable information about the influence of introduced genes on transgenic plant phenotype. However, an overall assessment of plant performance can only be made by testing t...

  12. Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa

    Science.gov (United States)

    Basyuni, M.; Sumardi

    2017-01-01

    This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.

  13. Plant-Mediated Changes in Soil N-Cycling Genes during Revegetation of Copper Mine Tailings

    Directory of Open Access Journals (Sweden)

    Yang Li

    2017-11-01

    Full Text Available Nitrogen limitation represents a major bottleneck during the revegetation of mine tailings. However, controls over key nitrogen-cycling genes in rhizospheric soils under differential vegetation management remain poorly understood. The abundance and transcriptional activity of nitrogen-cycling genes and the enzymatic activity of nitrogen transformation are mediated differentially during revegetation of mine tailings by Imperata cylindrica and Chrysopogon zizanioides plants. Results showed that the highest total organic carbon (TOC, total nitrogen (TN, and NH4+-N contents were found in the rhizosphere of I. cylindrica. The nifH gene abundances differed between I. cylindrica and C. zizanioides, and were higher in I. cylindrica which demonstrated by 3.39-fold higher mRNA transcript abundance of the nifH gene and a 2.15-fold higher nitrogen fixation rate in the rhizosphere. In addition, C. zizanioides exhibited a 4.94-fold higher transcript abundance of the archaeal amoA gene and the highest nitrification rate (1.706 ± 0.293 μg N-NO2- g−1 h−1 in the rhizosphere. In conclusion, I. cylindrica and C. zizanioides stimulated the abundances and activities of nifH gene and archaeal amoA gene, respectively. In addition, I. cylindrica appears to be capable of enhancing nitrogen fixation and exhibited accelerated nitrogen accumulation, which may be particularly useful for the rehabilitation of mine tailings.

  14. Metagenomic profiling of antibiotic resistance genes and mobile genetic elements in a tannery wastewater treatment plant.

    Directory of Open Access Journals (Sweden)

    Zhu Wang

    Full Text Available Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs and mobile genetic elements (MGEs in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP. Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns.

  15. Identification and Expression Profiling of Radiation-sensitive Genes Using Plant Model System, Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Kim, Dong-Sub; Kang, Si-Yong; Lee, Geung-Joo; Kim, Jin-Baek

    2008-06-01

    The purpose of this study is to characterize genes specifically expressed in response to ionizing energy (gamma-rays) of acute irradiation and elucidate signalling mechanisms via functional analysis of isolated genes in Arabidopsis thaliana. Recent improvements in DNA microarray technologies and bioinformatics have made it possible to look for common features of ionizing radiation-responsive genes and their regulatory regions. It has produced massive quantities of gene expression and other functional genomics data, and its application will increase in plant genomics. In this study, we used oligonucleotide microarrays to detect the Arabidopsis genes expressed differentially by a gamma-irradiation during the vegetative (VT, 21 DAG) and reproductive (RT, 28 DAG) stages. Wild-type (Ler) Arabidopsis was irradiated with gamma-rays with 100 and 800 Gy doses. Among the 21,500 genes represented in the Agilent chip, approximately 13,500 ( ∼ 61.4 %) responsive genes to ν -irradiation were expressed with signal intensity greater than 192 when compared to the combined control (non-irradiated vegetative and reproductive pool). Expression patterns of several radiation inducible genes were confirmed by RT-PCR and Northern blotting. Our microarray results may contribute to an overall understanding of the type and quantities of genes that are expressed by an acute gamma-irradiation. In addition, to investigate the oxidative damage caused by irradiation, RT-PCR analysis for the expression of antioxidant isoenzyme genes, and a Transmission Electron Microscope (TEM) observation for visualizing the H 2 O 2 scavenging activity in leaves were applied

  16. Identification and Expression Profiling of Radiation-sensitive Genes Using Plant Model System, Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Sub; Kang, Si-Yong; Lee, Geung-Joo; Kim, Jin-Baek

    2008-06-15

    The purpose of this study is to characterize genes specifically expressed in response to ionizing energy (gamma-rays) of acute irradiation and elucidate signalling mechanisms via functional analysis of isolated genes in Arabidopsis thaliana. Recent improvements in DNA microarray technologies and bioinformatics have made it possible to look for common features of ionizing radiation-responsive genes and their regulatory regions. It has produced massive quantities of gene expression and other functional genomics data, and its application will increase in plant genomics. In this study, we used oligonucleotide microarrays to detect the Arabidopsis genes expressed differentially by a gamma-irradiation during the vegetative (VT, 21 DAG) and reproductive (RT, 28 DAG) stages. Wild-type (Ler) Arabidopsis was irradiated with gamma-rays with 100 and 800 Gy doses. Among the 21,500 genes represented in the Agilent chip, approximately 13,500 ({sup {approx}}61.4 %) responsive genes to {nu} -irradiation were expressed with signal intensity greater than 192 when compared to the combined control (non-irradiated vegetative and reproductive pool). Expression patterns of several radiation inducible genes were confirmed by RT-PCR and Northern blotting. Our microarray results may contribute to an overall understanding of the type and quantities of genes that are expressed by an acute gamma-irradiation. In addition, to investigate the oxidative damage caused by irradiation, RT-PCR analysis for the expression of antioxidant isoenzyme genes, and a Transmission Electron Microscope (TEM) observation for visualizing the H{sub 2}O{sub 2} scavenging activity in leaves were applied.

  17. Plant nodulation inducers enhance horizontal gene transfer of Azorhizobium caulinodans symbiosis island.

    Science.gov (United States)

    Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun

    2016-11-29

    Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.

  18. Less is more: strategies to remove marker genes from transgenic plants.

    Science.gov (United States)

    Yau, Yuan-Yeu; Stewart, C Neal

    2013-04-23

    Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.

  19. Less is more: strategies to remove marker genes from transgenic plants

    Science.gov (United States)

    2013-01-01

    Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583

  20. Transgenic Alfalfa Plants Expressing the Sweetpotato Orange Gene Exhibit Enhanced Abiotic Stress Tolerance

    Science.gov (United States)

    Wang, Zhi; Ke, Qingbo; Kim, Myoung Duck; Kim, Sun Ha; Ji, Chang Yoon; Jeong, Jae Cheol; Lee, Haeng-Soon; Park, Woo Sung; Ahn, Mi-Jeong; Li, Hongbing; Xu, Bingcheng; Deng, Xiping; Lee, Sang-Hoon; Lim, Yong Pyo; Kwak, Sang-Soo

    2015-01-01

    Alfalfa (Medicago sativa L.), a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr) is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye) under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants), three lines (SOR2, SOR3, and SOR8) selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV)-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands. PMID:25946429

  1. Plant responses to environmental stress: regulation and functions of the Arabidopsis TCH genes

    Science.gov (United States)

    Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.; McIntire, L. V. (Principal Investigator)

    1997-01-01

    Expression of the Arabidopsis TCH genes is markedly upregulated in response to a variety of environmental stimuli including the seemingly innocuous stimulus of touch. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicates that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that at least a subset of the TCH proteins may collaborate in cell wall biogenesis.

  2. C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein

    Science.gov (United States)

    Cloix, Catherine; Kaiserli, Eirini; Heilmann, Monika; Baxter, Katherine J.; Brown, Bobby A.; O’Hara, Andrew; Smith, Brian O.; Christie, John M.; Jenkins, Gareth I.

    2012-01-01

    UV-B light initiates photomorphogenic responses in plants. Arabidopsis UV RESISTANCE LOCUS8 (UVR8) specifically mediates these responses by functioning as a UV-B photoreceptor. UV-B exposure converts UVR8 from a dimer to a monomer, stimulates the rapid accumulation of UVR8 in the nucleus, where it binds to chromatin, and induces interaction of UVR8 with CONSTITUTIVELY PHOTOMORPHOGENIC1 (COP1), which functions with UVR8 to control photomorphogenic UV-B responses. Although the crystal structure of UVR8 reveals the basis of photoreception, it does not show how UVR8 initiates signaling through interaction with COP1. Here we report that a region of 27 amino acids from the C terminus of UVR8 (C27) mediates the interaction with COP1. The C27 region is necessary for UVR8 function in the regulation of gene expression and hypocotyl growth suppression in Arabidopsis. However, UVR8 lacking C27 still undergoes UV-B–induced monomerization in both yeast and plant protein extracts, accumulates in the nucleus in response to UV-B, and interacts with chromatin at the UVR8-regulated ELONGATED HYPOCOTYL5 (HY5) gene. The UV-B–dependent interaction of UVR8 and COP1 is reproduced in yeast cells and we show that C27 is both necessary and sufficient for the interaction of UVR8 with the WD40 domain of COP1. Furthermore, we show that C27 interacts in yeast with the REPRESSOR OF UV-B PHOTOMORPHOGENESIS proteins, RUP1 and RUP2, which are negative regulators of UVR8 function. Hence the C27 region has a key role in UVR8 function. PMID:22988111

  3. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes.

    Science.gov (United States)

    Danchin, Etienne G J; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Guzeeva, Elena Sokolova; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T; den Akker, Sebastian Eves-van

    2017-10-23

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus , representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus , respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  4. The rice YABBY4 gene regulates plant growth and development through modulating the gibberellin pathway.

    Science.gov (United States)

    Yang, Chao; Ma, Yamei; Li, Jianxiong

    2016-10-01

    YABBY genes encode seed plant-specific transcription factors that play pivotal roles in diverse aspects of leaf, shoot, and flower development. Members of the YABBY gene family are primarily expressed in lateral organs in a polar manner and function to specify abaxial cell fate in dicotyledons, but this polar expression is not conserved in monocotyledons. The function of YABBY genes is therefore not well understood in monocotyledons. Here we show that overexpression of the rice (Oryza sativa L.) YABBY4 gene (OsYABBY4) leads to a semi-dwarf phenotype, abnormal development in the uppermost internode, an increased number of floral organs, and insensitivity to gibberellin (GA) treatment. We report on an important role for OsYABBY4 in negative control of the expression of a GA biosynthetic gene by binding to the promoter region of the gibberellin 20-oxidase 2 gene (GA20ox2), which is a direct target of SLR1 (the sole DELLA protein negatively controlling GA responses in rice). OsYABBY4 also suppresses the expression level of SLR1 and interacts with SLR1 protein. The interaction inhibits GA-dependent degradation of SLR1 and therefore leads to GA insensitivity. These data together suggest that OsYABBY4 serves as a DNA-binding intermediate protein for SLR1 and is associated with the GA signaling pathway regulating gene expression during plant growth and development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  5. Weighted Gene Co-expression Network Analysis of the Dioscin Rich Medicinal Plant Dioscorea nipponica

    Directory of Open Access Journals (Sweden)

    Wei Sun

    2017-06-01

    Full Text Available Dioscorea contains critically important species which can be used as staple foods or sources of bioactive substances, including Dioscorea nipponica, which has been used to develop highly successful drugs to treat cardiovascular disease. Its major active ingredients are thought to be sterol compounds such as diosgenin, which has been called “medicinal gold” because of its valuable properties. However, reliance on naturally growing plants as a production system limits the potential use of D. nipponica, raising interest in engineering metabolic pathways to enhance the production of secondary metabolites. However, the biosynthetic pathway of diosgenin is still poorly understood, and D. nipponica is poorly characterized at a molecular level, hindering in-depth investigation. In the present work, the RNAs from five organs and seven methyl jasmonate treated D. nipponica rhizomes were sequenced using the Illumina high-throughput sequencing platform, yielding 52 gigabases of data, which were pooled and assembled into a reference transcriptome. Four hundred and eighty two genes were found to be highly expressed in the rhizomes, and these genes are mainly involved in stress response and transcriptional regulation. Based on their expression patterns, 36 genes were selected for further investigation as candidate genes involved in dioscin biosynthesis. Constructing co-expression networks based on significant changes in gene expression revealed 15 gene modules. Of these, four modules with properties correlating to dioscin regulation and biosynthesis, consisting of 4,665 genes in total, were selected for further functional investigation. These results improve our understanding of dioscin biosynthesis in this important medicinal plant and will help guide more intensive investigations.

  6. Limited gene dispersal and spatial genetic structure as stabilizing factors in an ant-plant mutualism.

    Science.gov (United States)

    Malé, P-J G; Leroy, C; Humblot, P; Dejean, A; Quilichini, A; Orivel, J

    2016-12-01

    Comparative studies of the population genetics of closely associated species are necessary to properly understand the evolution of these relationships because gene flow between populations affects the partners' evolutionary potential at the local scale. As a consequence (at least for antagonistic interactions), asymmetries in the strength of the genetic structures of the partner populations can result in one partner having a co-evolutionary advantage. Here, we assess the population genetic structure of partners engaged in a species-specific and obligatory mutualism: the Neotropical ant-plant, Hirtella physophora, and its ant associate, Allomerus decemarticulatus. Although the ant cannot complete its life cycle elsewhere than on H. physophora and the plant cannot live for long without the protection provided by A. decemarticulatus, these species also have antagonistic interactions: the ants have been shown to benefit from castrating their host plant and the plant is able to retaliate against too virulent ant colonies. We found similar short dispersal distances for both partners, resulting in the local transmission of the association and, thus, inbred populations in which too virulent castrating ants face the risk of local extinction due to the absence of H. physophora offspring. On the other hand, we show that the plant populations probably experienced greater gene flow than did the ant populations, thus enhancing the evolutionary potential of the plants. We conclude that such levels of spatial structure in the partners' populations can increase the stability of the mutualistic relationship. Indeed, the local transmission of the association enables partial alignments of the partners' interests, and population connectivity allows the plant retaliation mechanisms to be locally adapted to the castration behaviour of their symbionts. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

  7. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    Science.gov (United States)

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  8. ESTs, cDNA microarrays, and gene expression profiling: tools for dissecting plant physiology and development.

    Science.gov (United States)

    Alba, Rob; Fei, Zhangjun; Payton, Paxton; Liu, Yang; Moore, Shanna L; Debbie, Paul; Cohn, Jonathan; D'Ascenzo, Mark; Gordon, Jeffrey S; Rose, Jocelyn K C; Martin, Gregory; Tanksley, Steven D; Bouzayen, Mondher; Jahn, Molly M; Giovannoni, Jim

    2004-09-01

    Gene expression profiling holds tremendous promise for dissecting the regulatory mechanisms and transcriptional networks that underlie biological processes. Here we provide details of approaches used by others and ourselves for gene expression profiling in plants with emphasis on cDNA microarrays and discussion of both experimental design and downstream analysis. We focus on methods and techniques emphasizing fabrication of cDNA microarrays, fluorescent labeling, cDNA hybridization, experimental design, and data processing. We include specific examples that demonstrate how this technology can be used to further our understanding of plant physiology and development (specifically fruit development and ripening) and for comparative genomics by comparing transcriptome activity in tomato and pepper fruit.

  9. Fate of antibiotic resistance genes within the microbial communities of three waste water treatment plants

    OpenAIRE

    Di Cesare, Andrea; Eckert, Ester; D'Urso, Silvia; Doppelbauer, Julia; Corno, Gianluca

    2016-01-01

    Although Waste Water Treatment Plant (WWTP) are designed to reduce the biological pollution of urban waters, they lack a specific action against antibiotic resistance bacteria (ARB) or antibiotic resistance genes (ARGs). Nowadays, it is well documented that WWTPs constitute a reservoir of antibiotic resistances and, in some cases, they can be a favorable environment for the selection of ARB. This represent a serious concern for the public health, because the effluents of the WWTPs can be reus...

  10. De Novo Deep Transcriptome Analysis of Medicinal Plants for Gene Discovery in Biosynthesis of Plant Natural Products.

    Science.gov (United States)

    Han, R; Rai, A; Nakamura, M; Suzuki, H; Takahashi, H; Yamazaki, M; Saito, K

    2016-01-01

    Study on transcriptome, the entire pool of transcripts in an organism or single cells at certain physiological or pathological stage, is indispensable in unraveling the connection and regulation between DNA and protein. Before the advent of deep sequencing, microarray was the main approach to handle transcripts. Despite obvious shortcomings, including limited dynamic range and difficulties to compare the results from distinct experiments, microarray was widely applied. During the past decade, next-generation sequencing (NGS) has revolutionized our understanding of genomics in a fast, high-throughput, cost-effective, and tractable manner. By adopting NGS, efficiency and fruitful outcomes concerning the efforts to elucidate genes responsible for producing active compounds in medicinal plants were profoundly enhanced. The whole process involves steps, from the plant material sampling, to cDNA library preparation, to deep sequencing, and then bioinformatics takes over to assemble enormous-yet fragmentary-data from which to comb and extract information. The unprecedentedly rapid development of such technologies provides so many choices to facilitate the task, which can cause confusion when choosing the suitable methodology for specific purposes. Here, we review the general approaches for deep transcriptome analysis and then focus on their application in discovering biosynthetic pathways of medicinal plants that produce important secondary metabolites. © 2016 Elsevier Inc. All rights reserved.

  11. Pineal photoreceptor cells are required for maintaining the circadian rhythms of behavioral visual sensitivity in zebrafish.

    Directory of Open Access Journals (Sweden)

    Xinle Li

    Full Text Available In non-mammalian vertebrates, the pineal gland functions as the central pacemaker that regulates the circadian rhythms of animal behavior and physiology. We generated a transgenic zebrafish line [Tg(Gnat2:gal4-VP16/UAS:nfsB-mCherry] in which the E. coli nitroreductase is expressed in pineal photoreceptor cells. In developing embryos and young adults, the transgene is expressed in both retinal and pineal photoreceptor cells. During aging, the expression of the transgene in retinal photoreceptor cells gradually diminishes. By 8 months of age, the Gnat2 promoter-driven nitroreductase is no longer expressed in retinal photoreceptor cells, but its expression in pineal photoreceptor cells persists. This provides a tool for selective ablation of pineal photoreceptor cells, i.e., by treatments with metronidazole. In the absence of pineal photoreceptor cells, the behavioral visual sensitivity of the fish remains unchanged; however, the circadian rhythms of rod and cone sensitivity are diminished. Brief light exposures restore the circadian rhythms of behavioral visual sensitivity. Together, the data suggest that retinal photoreceptor cells respond to environmental cues and are capable of entraining the circadian rhythms of visual sensitivity; however, they are insufficient for maintaining the rhythms. Cellular signals from the pineal photoreceptor cells may be required for maintaining the circadian rhythms of visual sensitivity.

  12. Evolution of Parallel Spindles Like genes in plants and highlight of unique domain architecture#

    Directory of Open Access Journals (Sweden)

    Consiglio Federica M

    2011-03-01

    Full Text Available Abstract Background Polyploidy has long been recognized as playing an important role in plant evolution. In flowering plants, the major route of polyploidization is suggested to be sexual through gametes with somatic chromosome number (2n. Parallel Spindle1 gene in Arabidopsis thaliana (AtPS1 was recently demonstrated to control spindle orientation in the 2nd division of meiosis and, when mutated, to induce 2n pollen. Interestingly, AtPS1 encodes a protein with a FHA domain and PINc domain putatively involved in RNA decay (i.e. Nonsense Mediated mRNA Decay. In potato, 2n pollen depending on parallel spindles was described long time ago but the responsible gene has never been isolated. The knowledge derived from AtPS1 as well as the availability of genome sequences makes it possible to isolate potato PSLike (PSL and to highlight the evolution of PSL family in plants. Results Our work leading to the first characterization of PSLs in potato showed a greater PSL complexity in this species respect to Arabidopsis thaliana. Indeed, a genomic PSL locus and seven cDNAs affected by alternative splicing have been cloned. In addition, the occurrence of at least two other PSL loci in potato was suggested by the sequence comparison of alternatively spliced transcripts. Phylogenetic analysis on 20 Viridaeplantae showed the wide distribution of PSLs throughout the species and the occurrence of multiple copies only in potato and soybean. The analysis of PSLFHA and PSLPINc domains evidenced that, in terms of secondary structure, a major degree of variability occurred in PINc domain respect to FHA. In terms of specific active sites, both domains showed diversification among plant species that could be related to a functional diversification among PSL genes. In addition, some specific active sites were strongly conserved among plants as supported by sequence alignment and by evidence of negative selection evaluated as difference between non-synonymous and

  13. Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.

    Directory of Open Access Journals (Sweden)

    Kazuhiro Hayashi

    Full Text Available Coenzyme Q (CoQ is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9 that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.

  14. Plant-Derived Transcription Factors for Orthologous Regulation of Gene Expression in the Yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Naseri, Gita; Balazadeh, Salma; Machens, Fabian; Kamranfar, Iman; Messerschmidt, Katrin; Mueller-Roeber, Bernd

    2017-09-15

    Control of gene expression by transcription factors (TFs) is central in many synthetic biology projects for which a tailored expression of one or multiple genes is often needed. As TFs from evolutionary distant organisms are unlikely to affect gene expression in a host of choice, they represent excellent candidates for establishing orthogonal control systems. To establish orthogonal regulators for use in yeast (Saccharomyces cerevisiae), we chose TFs from the plant Arabidopsis thaliana. We established a library of 106 different combinations of chromosomally integrated TFs, activation domains (yeast GAL4 AD, herpes simplex virus VP64, and plant EDLL) and synthetic promoters harboring cognate cis-regulatory motifs driving a yEGFP reporter. Transcriptional output of the different driver/reporter combinations varied over a wide spectrum, with EDLL being a considerably stronger transcription activation domain in yeast than the GAL4 activation domain, in particular when fused to Arabidopsis NAC TFs. Notably, the strength of several NAC-EDLL fusions exceeded that of the strong yeast TDH3 promoter by 6- to 10-fold. We furthermore show that plant TFs can be used to build regulatory systems encoded by centromeric or episomal plasmids. Our library of TF-DNA binding site combinations offers an excellent tool for diverse synthetic biology applications in yeast.

  15. Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

    Science.gov (United States)

    Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.

    2013-01-01

    Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276

  16. Human Usher 1B/mouse shaker-1: the retinal phenotype discrepancy explained by the presence/absence of myosin VIIA in the photoreceptor cells.

    Science.gov (United States)

    el-Amraoui, A; Sahly, I; Picaud, S; Sahel, J; Abitbol, M; Petit, C

    1996-08-01

    Usher syndrome type 1 (USH1) associates severe congenital deafness, vestibular dysfunction and progressive retinitis pigmentosa leading to blindness. The gene encoding myosin VIIA is responsible for USH1B. Mutations in the murine orthologous gene lead to the shaker-1 phenotype, which manifests cochlear and vestibular dysfunction, without any retinal defect. To address this phenotypic discrepancy, the expression of myosin VIIA in retinal cells was analyzed in human and mouse during embryonic development and adult life. In the human embryo, myosin VIIA was present first in the pigment epithelium cells, and later in these cells as well as in the photoreceptor cells. In the adult human retina, myosin VIIA was present in both cell types. In contrast, in mouse, only pigment epithelium cells expressed the protein throughout development and adult life. Myosin VIIA was also found to be absent in the photoreceptor cells of other rodents (rat and guinea-pig), whereas these cells expressed the protein in amphibians, avians and primates. These observations suggest that retinitis pigmentosa of USH1B results from a primary rod and cone defect. The USH1B/shaker-1 paradigm illustrates a species-specific cell pattern of gene expression as a possible cause for the discrepancy between phenotypes involving defective orthologous genes in man and mouse. Interestingly, in the photoreceptor cells, myosin VIIA is mainly localized in the inner and base of outer segments as well as in the synaptic ending region where it is co-localized with the synaptic vesicles. Therefore, we suggest that myosin VIIA might play a role in the trafficking of ribbon-synaptic vesicle complexes and the renewal processes of the outer photoreceptor disks.

  17. Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

    NARCIS (Netherlands)

    Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

    2016-01-01

    Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

  18. A moso bamboo WRKY gene PeWRKY83 confers salinity tolerance in transgenic Arabidopsis plants.

    Science.gov (United States)

    Wu, Min; Liu, Huanlong; Han, Guomin; Cai, Ronghao; Pan, Feng; Xiang, Yan

    2017-09-15

    The WRKY family are transcription factors, involved in plant development, and response to biotic and abiotic stresses. Moso bamboo is an important bamboo that has high ecological, economic and cultural value and is widely distributed in the south of China. In this study, we performed a genome-wide identification of WRKY members in moso bamboo and identified 89 members. By comparative analysis in six grass genomes, we found the WRKY gene family may have experienced or be experiencing purifying selection. Based on relative expression levels among WRKY IIc members under three abiotic stresses, PeWRKY83 functioned as a transcription factor and was selected for detailed analysis. The transgenic Arabidopsis of PeWRKY83 showed superior physiological properties compared with the WT under salt stress. Overexpression plants were less sensitive to ABA at both germination and postgermination stages and accumulated more endogenous ABA under salt stress conditions. Further studies demonstrated that overexpression of PeWRKY83 could regulate the expression of some ABA biosynthesis genes (AtAAO3, AtNCED2, AtNCED3), signaling genes (AtABI1, AtPP2CA) and responsive genes (AtRD29A, AtRD29B, AtABF1) under salt stress. Together, these results suggested that PeWRKY83 functions as a novel WRKY-related TF which plays a positive role in salt tolerance by regulating stress-induced ABA synthesis.

  19. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    Science.gov (United States)

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.

    Science.gov (United States)

    Kumar, Rahul

    2016-01-01

    Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.

  1. Mfsd2a Is a Transporter for the Essential ω-3 Fatty Acid Docosahexaenoic Acid (DHA) in Eye and Is Important for Photoreceptor Cell Development.

    Science.gov (United States)

    Wong, Bernice H; Chan, Jia Pei; Cazenave-Gassiot, Amaury; Poh, Rebecca W; Foo, Juat Chin; Galam, Dwight L A; Ghosh, Sujoy; Nguyen, Long N; Barathi, Veluchamy A; Yeo, Sia W; Luu, Chi D; Wenk, Markus R; Silver, David L

    2016-05-13

    Eye photoreceptor membrane discs in outer rod segments are highly enriched in the visual pigment rhodopsin and the ω-3 fatty acid docosahexaenoic acid (DHA). The eye acquires DHA from blood, but transporters for DHA uptake across the blood-retinal barrier or retinal pigment epithelium have not been identified. Mfsd2a is a newly described sodium-dependent lysophosphatidylcholine (LPC) symporter expressed at the blood-brain barrier that transports LPCs containing DHA and other long-chain fatty acids. LPC transport via Mfsd2a has been shown to be necessary for human brain growth. Here we demonstrate that Mfsd2a is highly expressed in retinal pigment epithelium in embryonic eye, before the development of photoreceptors, and is the primary site of Mfsd2a expression in the eye. Eyes from whole body Mfsd2a-deficient (KO) mice, but not endothelium-specific Mfsd2a-deficient mice, were DHA-deficient and had significantly reduced LPC/DHA transport in vivo Fluorescein angiography indicated normal blood-retinal barrier function. Histological and electron microscopic analysis indicated that Mfsd2a KO mice exhibited a specific reduction in outer rod segment length, disorganized outer rod segment discs, and mislocalization of and reduction in rhodopsin early in postnatal development without loss of photoreceptors. Minor photoreceptor cell loss occurred in adult Mfsd2a KO mice, but electroretinography indicated visual function was normal. The developing eyes of Mfsd2a KO mice had activated microglia and up-regulation of lipogenic and cholesterogenic genes, likely adaptations to loss of LPC transport. These findings identify LPC transport via Mfsd2a as an important pathway for DHA uptake in eye and for development of photoreceptor membrane discs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata

    Science.gov (United States)

    Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.

    2018-03-01

    It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.

  3. Overexpression of yeast ArDH gene in chloroplasts confers salinity tolerance in plants (abstract)

    International Nuclear Information System (INIS)

    Khan, M.S.; Kanwal, B.; Khalid, A.M.; Zafar, Y.; Malik, K.A.

    2005-01-01

    Water stress due to salinity and drought is the main limiting factor for plant growth, productivity and quality. A common response to water deficit is the accumulation of osmoprotectants such as sugars and amino acids. In yeast, arabitol dehydrogenase is found responsible for the production of arabitol from ribulose-5-phosphate. All plants synthesize ribulose-5-phosphate via pentose pathway in chloroplasts.. Therefore, osmotolerance of the plants could be enhanced through metabolic engineering of chloroplasts by introducing ArDH gene into the plastome, which is responsible for the conversion of ribulose-5- phosphate to arabitol. Here we report high-level expression of arabitol dehydrogenase (ArDH) in chloroplasts. Homoplasmic transgenic plants were recovered on spectinomycin-containing regeneration medium. Transformed tobacco plants survived whereas non-transformed were severely stressed or killed when two weeks old seedlings were exposed to NaCl (up to 400 mM), suggesting a role for arabitol in salt tolerance. Seedlings survived up to five weeks on medium containing high salt concentrations (350-400 mM). Nevertheless, seedlings remained green and grew normal on concentrations up to 350 mM NaCl for several weeks. Hypothesis that membranes are protected under stress conditions due to the arabitol accumulation in chloroplasts, seedlings were grown in liquid medium containing polyethylene glycol (PEG, up to 6%). Seedlings were tolerant to 6% PEG, suggesting that ArDH enzyme protects membranes integrity under stress. Therefore, it is concluded that ArDH gene could be expressed in crop plants to withstand abiotic stresses. (author)

  4. Expression of the Galanthus nivalis agglutinin (GNA) gene in transgenic potato plants confers resistance to aphids.

    Science.gov (United States)

    Mi, Xiaoxiao; Liu, Xue; Yan, Haolu; Liang, Lina; Zhou, Xiangyan; Yang, Jiangwei; Si, Huaijun; Zhang, Ning

    2017-01-01

    Aphids, the largest group of sap-sucking pests, cause significant yield losses in agricultural crops worldwide every year. The massive use of pesticides to combat this pest causes severe damage to the environment, putting in risk the human health. In this study, transgenic potato plants expressing Galanthus nivalis agglutinin (GNA) gene were developed using CaMV 35S and ST-LS1 promoters generating six transgenic lines (35S1-35S3 and ST1-ST3 corresponding to the first and second promoter, respectively). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the GNA gene was expressed in leaves, stems and roots of transgenic plants under the control of the CaMV 35S promoter, while it was only expressed in leaves and stems under the control of the ST-LS1 promoter. The levels of aphid mortality after 5 days of the inoculation in the assessed transgenic lines ranged from 20 to 53.3%. The range of the aphid population in transgenic plants 15 days after inoculation was between 17.0±1.43 (ST2) and 36.6±0.99 (35S3) aphids per plant, which corresponds to 24.9-53.5% of the aphid population in non-transformed plants. The results of our study suggest that GNA expressed in transgenic potato plants confers a potential tolerance to aphid attack, which appears to be an alternative against the use of pesticides in the future. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  5. The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.

    Science.gov (United States)

    Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J

    2017-05-01

    The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.

  6. A nucleotide metabolite controls stress-responsive gene expression and plant development.

    Directory of Open Access Journals (Sweden)

    Hao Chen

    Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt

  7. A nucleotide metabolite controls stress-responsive gene expression and plant development

    KAUST Repository

    Chen, Hao

    2011-10-19

    Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target

  8. [Expression of plant antimicrobial peptide pro-SmAMP2 gene increases resistance of transgenic potato plants to Alternaria and Fusarium pathogens].

    Science.gov (United States)

    Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A

    2016-09-01

    The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.

  9. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  10. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  11. Integration of Genome-Wide TF Binding and Gene Expression Data to Characterize Gene Regulatory Networks in Plant Development.

    Science.gov (United States)

    Chen, Dijun; Kaufmann, Kerstin

    2017-01-01

    Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.

  12. Regulatory arrestin cycle secures the fidelity and maintenance of the fly photoreceptor cell.

    Science.gov (United States)

    Byk, T; Bar-Yaacov, M; Doza, Y N; Minke, B; Selinger, Z

    1993-01-01

    Excitation of fly photoreceptor cells is initiated by photoisomerization of rhodopsin to the active form of metarhodopsin. Fly metarhodopsin is thermostable, does not bleach, and does not regenerate spontaneously to rhodopsin. For this reason, the activity of metarhodopsin must be stopped by an effective termination reaction. On the other hand, there is also a need to restore the inactivated photopigment to an excitable state in order to keep a sufficient number of photopigment molecules available for excitation. The following findings reveal how these demands are met. The photopigment undergoes rapid phosphorylation upon photoconversion of rhodopsin to metarhodopsin and an efficient Ca2+ dependent dephosphorylation upon regeneration of metarhodopsin to rhodopsin. Phosphorylation decreases the ability of metarhodopsin to activate the guanine nucleotide-binding protein. Binding of 49-kDa arrestin further quenches the activity of metarhodopsin and protects it from dephosphorylation. Light-dependent binding and release of 49-kDa arrestin from metarhodopsin- and rhodopsin-containing membranes, respectively, directs the dephosphorylation reaction toward rhodopsin. This ensures the return of phosphorylated metarhodopsin to the rhodopsin pool without initiating transduction in the dark. Assays of rhodopsin dephosphorylation in the Drosophila retinal degeneration C (rdgC) mutant, a mutant in a gene previously cloned and predicted to encode a serine/threonine protein phosphatase, reveal that phosphorylated rhodopsin is a major substrate for the rdgC phosphatase. We propose that mutations resulting in either a decrease or an improper regulation of rhodopsin phosphatase activity bring about degeneration of the fly photoreceptor cells. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8446607

  13. Environmental control of plant nuclear gene expression by chloroplast redox signals

    Directory of Open Access Journals (Sweden)

    Jeannette ePfalz

    2012-11-01

    Full Text Available Plant photosynthesis takes place in specialised cell organelles, the chloroplasts, which perform all essential steps of this process. The proteins involved in photosynthesis are encoded by genes located on the plastid and nuclear genomes. Proper function and regulation of light harvesting and energy fixation thus requires a tight coordination of the gene expression machineries in the two genetic compartments. This is achieved by a bi-directional exchange of information between nucleus and plastids. Signals emerging from plastids report the functional and developmental state of the organelle to the nucleus and initiate distinct nuclear gene expression profiles, which trigger responses that support or improve plastid functions. Recent research indicated that this signalling is absolutely essential for plant growth and development. Reduction/oxidation (redox signals from photosynthesis are key players in this information network since they do report functional disturbances in photosynthesis, the primary energy source of plants. Such disturbances are caused by environmental fluctuations for instance in illumination, temperature or water availability. These environmental changes affect the linear electron flow of photosynthesis and result in changes of the redox state of the components involved (e.g. the plastoquinone pool or coupled to it (e.g. the thioredoxin pool. Thus, the changes in redox state directly reflect the environmental impact and serve as immediate plastidial signals to the nucleus. The triggered responses range from counterbalancing reactions within the physiological range up to severe stress responses including cell death. This review focuses on physiological redox signals from photosynthetic electron transport, their relation to the environment, potential transduction pathways to the nucleus and their impact on nuclear gene expression.

  14. Spatial analyses of mono, di and trinucleotide trends in plant genes.

    Directory of Open Access Journals (Sweden)

    Andrea Porceddu

    Full Text Available Genomic DNA sequences display compositional heterogeneity on many scales. In this paper we analyzed tendencies and anomalies in the occurence of mono, di and trinucleotides in structural regions of plant genes. Representation of these trends as a function of position along genic sequences highlighted compositional features peculiar of either monocots or eudicots that were remarkably uniform within these two evolutionary clades. The most evident of these features appeared in the form of gradient of base content along the direction of transcription. The robustness of such a representation was validated in sequences sub-datasets generated considering structural and compositional features such as total length of cds, overall GC content and genic orientation in the genome. Piecewise regression analyses indicated that the gradients could be conveniently approximated to a two segmented model where a first region featuring a steep slope is followed by a second segment fitting a milder variation. In general, monocots species showed steeper segments than eudicots. The guanine gradient was the most distinctive feature between the two evolutionary clades, being moderately increasing in eudicots and firmly decreasing in monocots. Single gene investigation revealed that a high proportion of genes show compositional trends compatible with a segmented model suggesting that these features are essential attributes of gene organization. Dinucleotide and trinucleotide biases were referred to expectation based on a random union of the component elements. The average bias at dinucleotide level identified a significant undererpresentation of some dinucleotide and the overrepresention of others. The bias at trinucleotide level was on average low. Finally, the analysis of bryophyte coding sequences showed mononucleotide, dinucleotide and trinucleotide compositional trends resembling those of higher plants. This finding suggested that the emergenge of compositional bias

  15. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  16. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  17. Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae

    Science.gov (United States)

    Melis, Anastasios; Mitra, Mautusi

    2010-06-29

    The invention provides method and compositions to minimize the chlorophyll antenna size of photosynthesis by decreasing TLA1 gene expression, thereby improving solar conversion efficiencies and photosynthetic productivity in plants, e.g., green microalgae, under bright sunlight conditions.

  18. Light adaptation and the evolution of vertebrate photoreceptors.

    Science.gov (United States)

    Morshedian, Ala; Fain, Gordon L

    2017-07-15

    Lamprey are cyclostomes, a group of vertebrates that diverged from lines leading to jawed vertebrates (including mammals) in the late Cambrian, 500 million years ago. It may therefore be possible to infer properties of photoreceptors in early vertebrate progenitors by comparing lamprey to other vertebrates. We show that lamprey rods and cones respond to light much like rods and cones in amphibians and mammals. They operate over a similar range of light intensities and adapt to backgrounds and bleaches nearly identically. These correspondences are pervasive and detailed; they argue for the presence of rods and cones very early in the evolution of vertebrates with properties much like those of rods and cones in existing vertebrate species. The earliest vertebrates were agnathans - fish-like organisms without jaws, which first appeared near the end of the Cambrian radiation. One group of agnathans became cyclostomes, which include lamprey and hagfish. Other agnathans gave rise to jawed vertebrates or gnathostomes, the group including all other existing vertebrate species. Because cyclostomes diverged from other vertebrates 500 million years ago, it may be possible to infer some of the properties of the retina of early vertebrate progenitors by comparing lamprey to other vertebrates. We have previously shown that rods and cones in lamprey respond to light much like photoreceptors in other vertebrates and have a similar sensitivity. We now show that these affinities are even closer. Both rods and cones adapt to background light and to bleaches in a manner almost identical to other vertebrate photoreceptors. The operating range in darkness is nearly the same in lamprey and in amphibian or mammalian rods and cones; moreover background light shifts response-intensity curves downward and to the right over a similar range of ambient intensities. Rods show increment saturation at about the same intensity as mammalian rods, and cones never saturate. Bleaches decrease

  19. Expression of Root Genes in Arabidopsis Seedlings Grown by Standard and Improved Growing Methods.

    Science.gov (United States)

    Qu, Yanli; Liu, Shuai; Bao, Wenlong; Xue, Xian; Ma, Zhengwen; Yokawa, Ken; Baluška, František; Wan, Yinglang

    2017-05-03

    Roots of Arabidopsis thaliana seedlings grown in the laboratory using the traditional plant-growing culture system (TPG) were covered to maintain them in darkness. This new method is based on a dark chamber and is named the improved plant-growing method (IPG). We measured the light conditions in dark chambers, and found that the highest light intensity was dramatically reduced deeper in the dark chamber. In the bottom and side parts of dark chambers, roots were almost completely shaded. Using the high-throughput RNA sequencing method on the whole RNA extraction from roots, we compared the global gene expression levels in roots of seedlings from these two conditions and identified 141 differently expressed genes (DEGs) between them. According to the KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment, the flavone and flavonol biosynthesis and flavonoid biosynthesis pathways were most affected among all annotated pathways. Surprisingly, no genes of known plant photoreceptors were identified as DEGs by this method. Considering that the light intensity was decreased in the IPG system, we collected four sections (1.5 cm for each) of Arabidopsis roots grown in TPG and IPG conditions, and the spatial-related differential gene expression levels of plant photoreceptors and polar auxin transporters, including CRY1 , CRY2 , PHYA , PHYB , PHOT1 , PHOT2 , and UVR8 were analyzed by qRT-PCR. Using these results, we generated a map of the spatial-related expression patterns of these genes under IPG and TPG conditions. The expression levels of light-related genes in roots is highly sensitive to illumination and it provides a background reference for selecting an improved culture method for laboratory-maintained Arabidopsis seedlings.

  20. Plant and fungal gene expression in mycorrhizal protocorms of the orchid Serapias vomeracea colonized by Tulasnella calospora.

    Science.gov (United States)

    Balestrini, Raffaella; Nerva, Luca; Sillo, Fabiano; Girlanda, Mariangela; Perotto, Silvia

    2014-01-01

    Little is known on the molecular bases of plant-fungal interactions in orchid mycorrhiza. We developed a model system to investigate gene expression in mycorrhizal protocorms of Serapias vomeracea colonised by Tulasnella calospora. Our recent results with a small panel of genes as indicators of plant response to mycorrhizal colonization indicate that genes related with plant defense were not significantly up-regulated in mycorrhizal tissues. Here, we used laser microdissection to investigate whether expression of some orchid genes was restricted to specific cell types. Results showed that SvNod1, a S. vomeracea nodulin-like protein containing a plastocyanin-like domain, is expressed only in protocorm cells containing intracellular fungal hyphae. In addition, we investigated a family of fungal zinc metallopeptidases (M36). This gene family has expanded in the T. calospora genome and RNA-Seq experiments indicate that some members of the M36 metallopeptidases family are differentially regulated in orchid mycorrhizal protocorms.

  1. Gene expression and plant hormone levels in two contrasting rice genotypes responding to brown planthopper infestation.

    Science.gov (United States)

    Li, Changyan; Luo, Chao; Zhou, Zaihui; Wang, Rui; Ling, Fei; Xiao, Langtao; Lin, Yongjun; Chen, Hao

    2017-02-28

    The brown planthopper (BPH; Nilaparvata lugens Stål) is a destructive piercing-sucking insect pest of rice. The plant hormones salicylic acid (SA) and jasmonic acid (JA) play important roles in plant-pest interactions. Many isolated rice genes that modulate BPH resistance are involved in the metabolism or signaling pathways of SA, JA and ethylene. 'Rathu Heenati' (RH) is a rice cultivar with a high-level, broad-spectrum resistance to all BPH biotypes. Here, RH was used as the research material, while a BPH-susceptible rice cultivar 'Taichung Native 1' (TN1) was the control. A cDNA microarray analysis illuminated the resistance response at the genome level of RH under BPH infestation. The levels of SA and JA in RH and TN1 seedlings after BPH infestation were also determined. The expression pattern clustering indicated that 1467 differential probe sets may be associated with constitutive resistance and 67 with the BPH infestation-responsive resistance of RH. A Venn diagram analysis revealed 192 RH-specific and BPH-inducible probe sets. Finally, 23 BPH resistance-related gene candidates were selected based on the expression pattern clustering and Venn diagram analysis. In RH, the SA content significantly increased and the JA content significantly decreased after BPH infestation, with the former occurring prior to the latter. In RH, the differential genes in the SA pathway were synthesis-related and were up-regulated after BPH infestation. The differential genes in the JA pathway were also up-regulated. They were jasmonate ZIM-domain transcription factors, which are important negative regulators of the JA pathway. Comparatively, genes involved in the ET pathway were less affected by a BPH infestation in RH. DNA sequence analysis revealed that most BPH infestation-inducible genes may be regulated by the genetic background in a trans-acting manner, instead of by their promoters. We profiled the analysis of the global gene expression in RH and TN1 under BPH infestation

  2. Knocking Down Snrnp200 Initiates Demorphogenesis of Rod Photoreceptors in Zebrafish

    Directory of Open Access Journals (Sweden)

    Yuan Liu

    2015-01-01

    Full Text Available Purpose. The small nuclear ribonucleoprotein 200 kDa (SNRNP200 gene is a fundamental component for precursor message RNA (pre-mRNA splicing and has been implicated in the etiology of autosomal dominant retinitis pigmentosa (adRP. This study aims to determine the consequences of knocking down Snrnp200 in zebrafish. Methods. Expression of the Snrnp200 transcript in zebrafish was determined via whole mount in situ hybridization. Morpholino oligonucleotide (MO aiming to knock down the expression of Snrnp200 was injected into zebrafish embryos, followed by analyses of aberrant splicing and expression of the U4/U6-U5 tri-small nuclear ribonucleoproteins (snRNPs components and retina-specific transcripts. Systemic changes and retinal phenotypes were further characterized by histological study and immunofluorescence staining. Results. Snrnp200 was ubiquitously expressed in zebrafish. Knocking down Snrnp200 in zebrafish triggered aberrant splicing of the cbln1 gene, upregulation of other U4/U6-U5 tri-snRNP components, and downregulation of a panel of retina-specific transcripts. Systemic defects were found correlated with knockdown of Snrnp200 in zebrafish. Only demorphogenesis of rod photoreceptors was detected in the initial stage, mimicking the disease characteristics of RP. Conclusions. We conclude that knocking down Snrnp200 in zebrafish could alter regular splicing and expression of a panel of genes, which may eventually trigger rod defects.

  3. Gene expression profiling--Opening the black box of plant ecosystem responses to global change

    Energy Technology Data Exchange (ETDEWEB)

    Leakey, A.D.B.; Ainsworth, E.A.; Bernard, S.M.; Markelz, R.J.C.; Ort, D.R.; Placella, S.A.P.; Rogers, A.; Smith, M.D.; Sudderth, E.A.; Weston, D.J.; Wullschleger, S.D.; Yuan, S.

    2009-11-01

    The use of genomic techniques to address ecological questions is emerging as the field of genomic ecology. Experimentation under environmentally realistic conditions to investigate the molecular response of plants to meaningful changes in growth conditions and ecological interactions is the defining feature of genomic ecology. Since the impact of global change factors on plant performance are mediated by direct effects at the molecular, biochemical and physiological scales, gene expression analysis promises important advances in understanding factors that have previously been consigned to the 'black box' of unknown mechanism. Various tools and approaches are available for assessing gene expression in model and non-model species as part of global change biology studies. Each approach has its own unique advantages and constraints. A first generation of genomic ecology studies in managed ecosystems and mesocosms have provided a testbed for the approach and have begun to reveal how the experimental design and data analysis of gene expression studies can be tailored for use in an ecological context.

  4. Not just gene expression: 3D implications of chromatin modifications during sexual plant reproduction.

    Science.gov (United States)

    Dukowic-Schulze, Stefanie; Liu, Chang; Chen, Changbin

    2018-01-01

    DNA methylation and histone modifications are epigenetic changes on a DNA molecule that alter the three-dimensional (3D) structure locally as well as globally, impacting chromatin looping and packaging on a larger scale. Epigenetic marks thus inform higher-order chromosome organization and placement in the nucleus. Conventional epigenetic marks are joined by chromatin modifiers like cohesins, condensins and membrane-anchoring complexes to support particularly 3D chromosome organization. The most popular consequences of epigenetic modifications are gene expression changes, but chromatin modifications have implications beyond this, particularly in actively dividing cells and during sexual reproduction. In this opinion paper, we will focus on epigenetic mechanisms and chromatin modifications during meiosis as part of plant sexual reproduction where 3D management of chromosomes and re-organization of chromatin are defining features and prime tasks in reproductive cells, not limited to modulating gene expression. Meiotic chromosome organization, pairing and synapsis of homologous chromosomes as well as distribution of meiotic double-strand breaks and resulting crossovers are presumably highly influenced by epigenetic mechanisms. Special mobile small RNAs have been described in anthers, where these so-called phasiRNAs seem to direct DNA methylation in meiotic cells. Intriguingly, many of the mentioned developmental processes make use of epigenetic changes and small RNAs in a manner other than gene expression changes. Widening our approaches and opening our mind to thinking three-dimensionally regarding epigenetics in plant development holds high promise for new discoveries and could give us a boost for further knowledge.

  5. Arabidopsis female gametophyte gene expression map reveals similarities between plant and animal gametes.

    Science.gov (United States)

    Wuest, Samuel E; Vijverberg, Kitty; Schmidt, Anja; Weiss, Manuel; Gheyselinck, Jacqueline; Lohr, Miriam; Wellmer, Frank; Rahnenführer, Jörg; von Mering, Christian; Grossniklaus, Ueli

    2010-03-23

    The development of multicellular organisms is controlled by differential gene expression whereby cells adopt distinct fates. A spatially resolved view of gene expression allows the elucidation of transcriptional networks that are linked to cellular identity and function. The haploid female gametophyte of flowering plants is a highly reduced organism: at maturity, it often consists of as few as three cell types derived from a common precursor [1, 2]. However, because of its inaccessibility and small size, we know little about the molecular basis of cell specification and differentiation in the female gametophyte. Here we report expression profiles of all cell types in the mature Arabidopsis female gametophyte. Differentially expressed posttranscriptional regulatory modules and metabolic pathways characterize the distinct cell types. Several transcription factor families are overrepresented in the female gametophyte in comparison to other plant tissues, e.g., type I MADS domain, RWP-RK, and reproductive meristem transcription factors. PAZ/Piwi-domain encoding genes are upregulated in the egg, indicating a role of epigenetic regulation through small RNA pathways-a feature paralleled in the germline of animals [3]. A comparison of human and Arabidopsis egg cells for enrichment of functional groups identified several similarities that may represent a consequence of coevolution or ancestral gametic features. 2010 Elsevier Ltd. All rights reserved.

  6. Agrobacterium rhizogenes rolB gene affects photosynthesis and chlorophyll content in transgenic tomato (Solanum lycopersicum L.) plants.

    Science.gov (United States)

    Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa

    2016-10-01

    Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  7. Advances in plant gene-targeted and functional markers: a review

    Directory of Open Access Journals (Sweden)

    Poczai Péter

    2013-02-01

    Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information

  8. Advances in plant gene-targeted and functional markers: a review

    Science.gov (United States)

    2013-01-01

    Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the

  9. Evidence for dynamic network regulation of Drosophila photoreceptor function from mutants lacking the neurotransmitter histamine

    Directory of Open Access Journals (Sweden)

    An eDau

    2016-03-01

    Full Text Available Synaptic feedback from interneurons to photoreceptors can help to optimize visual information flow by balancing its allocation on retinal pathways under changing light conditions. But little is known about how this critical network operation is regulated dynamically. Here, we investigate this question by comparing signaling properties and performance of wild-type Drosophila R1-R6 photoreceptors to those of the hdcJK910 mutant, which lacks the neurotransmitter histamine and therefore cannot transmit information to interneurons. Recordings show that hdcJK910 photoreceptors sample similar amounts of information from naturalistic stimulation to wild-type photoreceptors, but this information is packaged in smaller responses, especially under bright illumination. Analyses reveal how these altered dynamics primarily resulted from network overload that affected hdcJK910 photoreceptors in two ways. First, the missing inhibitory histamine input to interneurons almost certainly depolarized them irrevocably, which in turn increased their excitatory feedback to hdcJK910 R1-R6s. This tonic excitation depolarized the photoreceptors to artificially high potentials, reducing their operational range. Second, rescuing histamine input to interneurons in hdcJK910 mutant also restored their normal phasic feedback modulation to R1-R6s, causing photoreceptor output to accentuate dynamic intensity differences at bright illumination, similar to the wild-type. These results provide mechanistic explanations of how synaptic feedback connections optimize information packaging in photoreceptor output and novel insight into the operation and design of dynamic network regulation of sensory neurons.

  10. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka

    2012-08-01

    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  11. Digital Gene Expression Analysis Based on De Novo Transcriptome Assembly Reveals New Genes Associated with Floral Organ Differentiation of the Orchid Plant Cymbidium ensifolium.

    Directory of Open Access Journals (Sweden)

    Fengxi Yang

    Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms

  12. Photoreceptor processing speed and input resistance changes during light adaptation correlate with spectral class in the bumblebee, Bombus impatiens.

    Directory of Open Access Journals (Sweden)

    Peter Skorupski

    Full Text Available Colour vision depends on comparison of signals from photoreceptors with different spectral sensitivities. However, response properties of photoreceptor cells may differ in ways other than spectral tuning. In insects, for example, broadband photoreceptors, with a major sensitivity peak in the green region of the spectrum (>500 nm, drive fast visual processes, which are largely blind to chromatic signals from more narrowly-tuned photoreceptors with peak sensitivities in the blue and UV regions of the spectrum. In addition, electrophysiological properties of the photoreceptor membrane may result in differences in response dynamics of photoreceptors of similar spectral class between species, and different spectral classes within a species. We used intracellular electrophysiological techniques to investigate response dynamics of the three spectral classes of photoreceptor underlying trichromatic colour vision in the bumblebee, Bombus impatiens, and we compare these with previously published data from a related species, Bombus terrestris. In both species, we found significantly faster responses in green, compared with blue- or UV-sensitive photoreceptors, although all 3 photoreceptor types are slower in B. impatiens than in B. terrestris. Integration times for light-adapted B. impatiens photoreceptors (estimated from impulse response half-width were 11.3 ± 1.6 ms for green photoreceptors compared with 18.6 ± 4.4 ms and 15.6 ± 4.4 for blue and UV, respectively. We also measured photoreceptor input resistance in dark- and light-adapted conditions. All photoreceptors showed a decrease in input resistance during light adaptation, but this decrease was considerably larger (declining to about 22% of the dark value in green photoreceptors, compared to blue and UV (41% and 49%, respectively. Our results suggest that the conductances associated with light adaptation are largest in green photoreceptors, contributing to their greater temporal processing speed

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. Response Function of the Crayfish Caudal Photoreceptor to Hydrodynamic Stimuli

    Science.gov (United States)

    Breite, Sally; Bahar, Sonya; Neiman, Alexander; Moss, Frank

    2002-03-01

    In its abdominal 6th ganglion the crayfish houses 2 light-sensitive neurons (caudal photoreceptors, or CPRs). It is known that these neurons work in tandem with a mechanosensory system of tiny hairs spread across the tailfan, which make synaptic contact with the photoreceptors. A stochastic resonance effect has been shown in this system in which light enhances the transduction of a weak, periodic mechanosensory (hydrodynamic) stimulus. It is not known, however, whether an optimal response from the CPR is induced by a single sine wave cycle or some other waveform. We have experimentally investigated this favorable waveform by driving a tailfan preparation with mechanical 10 Hz correlated Ornstein-Uhlenbeck noise and calculating the response function from the spike-triggered average of the applied noise waveform. We will discuss differences in the shape of the optimal waveform under dark and light conditions, as well as what seems to be a noticeable difference in the magnitude of the animals' response to a noisy stimulus in comparison with a periodic stimulus.

  15. Planting increases the abundance and structure complexity of soil core functional genes relevant to carbon and nitrogen cycling.

    Science.gov (United States)

    Wang, Feng; Liang, Yuting; Jiang, Yuji; Yang, Yunfeng; Xue, Kai; Xiong, Jinbo; Zhou, Jizhong; Sun, Bo

    2015-09-23

    Plants have an important impact on soil microbial communities and their functions. However, how plants determine the microbial composition and network interactions is still poorly understood. During a four-year field experiment, we investigated the functional gene composition of three types of soils (Phaeozem, Cambisols and Acrisol) under maize planting and bare fallow regimes located in cold temperate, warm temperate and subtropical regions, respectively. The core genes were identified using high-throughput functional gene microarray (GeoChip 3.0), and functional molecular ecological networks (fMENs) were subsequently developed with the random matrix theory (RMT)-based conceptual framework. Our results demonstrated that planting significantly (P soils and 83.5% of microbial alpha-diversity can be explained by the plant factor. Moreover, planting had significant impacts on the microbial community structure and the network interactions of the microbial communities. The calculated network complexity was higher under maize planting than under bare fallow regimes. The increase of the functional genes led to an increase in both soil respiration and nitrification potential with maize planting, indicating that changes in the soil microbial communities and network interactions influenced ecological functioning.

  16. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta.

    Science.gov (United States)

    McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; de Pamphilis, Claude W

    2007-10-24

    Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  17. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta

    Directory of Open Access Journals (Sweden)

    Kuehl Jennifer V

    2007-10-01

    Full Text Available Abstract Background Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Results Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Conclusion Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  18. Gene expression and activity of antioxidant enzymes in rice plants, cv. BRS AG, under saline stress.

    Science.gov (United States)

    Rossatto, Tatiana; do Amaral, Marcelo Nogueira; Benitez, Letícia Carvalho; Vighi, Isabel Lopes; Braga, Eugenia Jacira Bolacel; de Magalhães Júnior, Ariano Martins; Maia, Mara Andrade Colares; da Silva Pinto, Luciano

    2017-10-01

    The rice cultivar ( Oryza sativa L.) BRS AG, developed by Embrapa Clima Temperado, is the first cultivar designed for purposes other than human consumption. It may be used in ethanol production and animal feed. Different abiotic stresses negatively affect plant growth. Soil salinity is responsible for a serious reduction in productivity. Therefore, the objective of this study was to evaluate the gene expression and the activity of antioxidant enzymes (SOD, CAT, APX and GR) and identify their functions in controlling ROS levels in rice plants, cultivar BRS AG, after a saline stress period. The plants were grown in vitro with two NaCl concentrations (0 and 136 mM), collected at 10, 15 and 20 days of cultivation. The results indicated that the activity of the enzymes evaluated promotes protection against oxidative stress. Although, there was an increase of reactive oxygen species, there was no increase in MDA levels. Regarding genes encoding isoforms of antioxidant enzymes, it was observed that OsSOD3 - CU/Zn , OsSOD2 - Cu/Zn , OsSOD - Cu/Zn , OsSOD4 - Cu/Zn , OsSODCc1 - Cu/Zn , OsSOD - Fe , OsAPX1 , OsCATB and OsGR2 were the most responsive. The increase in the transcription of all genes among evaluated isoforms, except for OsAPX6 , which remained stable, contributed to the increase or the maintenance of enzyme activity. Thus, it is possible to infer that the cv. BRS AG has defense mechanisms against salt stress.

  19. Molecular Mapping of Reduced Plant Height Gene Rht24 in Bread Wheat.

    Science.gov (United States)

    Tian, Xiuling; Wen, Weie; Xie, Li; Fu, Luping; Xu, Dengan; Fu, Chao; Wang, Desen; Chen, Xinmin; Xia, Xianchun; Chen, Quanjia; He, Zhonghu; Cao, Shuanghe

    2017-01-01

    Height is an important trait related to plant architecture and yield potential in bread wheat ( Triticum aestivum L.). We previously identified a major quantitative trait locus QPH.caas-6A flanked by simple sequence repeat markers Xbarc103 and Xwmc256 that reduced height by 8.0-10.4%. Here QPH.caas-6A , designated as Rht24 , was confirmed using recombinant inbred lines (RILs) derived from a Jingdong 8/Aikang 58 cross. The target sequences of Xbarc103 and Xwmc256 were used as queries to BLAST against International Wheat Genome Sequence Consortium database and hit a super scaffold of approximately 208 Mb. Based on gene annotation of the scaffold, three gene-specific markers were developed to genotype the RILs, and Rht24 was narrowed to a 1.85 cM interval between TaAP2 and TaFAR . In addition, three single nucleotide polymorphism (SNP) markers linked to Rht24 were identified from SNP chip-based screening in combination with bulked segregant analysis. The allelic efficacy of Rht24 was validated in 242 elite wheat varieties using TaAP2 and TaFAR markers. These showed a significant association between genotypes and plant height. Rht24 reduced plant height by an average of 6.0-7.9 cm across environments and were significantly associated with an increased TGW of 2.0-3.4 g. The findings indicate that Rht24 is a common dwarfing gene in wheat breeding, and TaAP2 and TaFAR can be used for marker-assisted selection.

  20. Abundance of antibiotic resistance genes in five municipal wastewater treatment plants in the Monastir Governorate, Tunisia.

    Science.gov (United States)

    Rafraf, Ikbel Denden; Lekunberri, Itziar; Sànchez-Melsió, Alexandre; Aouni, Mahjoub; Borrego, Carles M; Balcázar, José Luis

    2016-12-01

    Antimicrobial resistance is a growing and significant threat to global public health, requiring better understanding of the sources and mechanisms involved in its emergence and spread. We investigated the abundance of antibiotic resistance genes (ARGs) before and after treatment in five wastewater treatment plants (WWTPs) located in different areas of the Monastir Governorate (Tunisia). Three of these WWTPs (Frina, Sahline and Zaouiet) use a conventional activated sludge process as secondary treatment, whereas the WWTP located in Beni Hassen applies an ultraviolet disinfection step after the activated sludge process and the WWTP located in Moknine treats wastewater using naturally aerated lagoons as a secondary treatment process. The abundance of six ARGs (bla CTX-M , bla TEM , qnrA, qnrS, sul I and ermB) and the class 1 integron-integrase gene (intI1) were determined by quantitative PCR. All ARGs and the intI1 gene were detected in the wastewater samples, except the bla CTX-M gene, which was not detected in both influent and effluent samples from Sahline and Beni Hassen WWTPs, and the qnrS gene, which was not detected neither in the WWTP influent in Moknine nor in the WWTP effluent in Beni Hassen. Although the relative concentration of ARGs was generally found to be similar between samples collected before and after the wastewater treatment, the abundance of bla CTX-M , bla TEM , and qnrS genes was higher in the effluent of the Frina WWTP which, unlike other WWTPs, not only receives domestic or industrial sewage but also untreated hospital waste. To the best of our knowledge, this study quantified for the first time the abundance of ARGs in different Tunisian WWTPs, and the results agree with previous studies suggesting that conventional wastewater treatment does not efficiently reduce ARGs. Therefore, these findings could be useful to improve the design or operation of WWTPs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Boolean Dynamic Modeling Approaches to Study Plant Gene Regulatory Networks: Integration, Validation, and Prediction.

    Science.gov (United States)

    Velderraín, José Dávila; Martínez-García, Juan Carlos; Álvarez-Buylla, Elena R

    2017-01-01

    Mathematical models based on dynamical systems theory are well-suited tools for the integration of available molecular experimental data into coherent frameworks in order to propose hypotheses about the cooperative regulatory mechanisms driving developmental processes. Computational analysis of the proposed models using well-established methods enables testing the hypotheses by contrasting predictions with observations. Within such framework, Boolean gene regulatory network dynamical models have been extensively used in modeling plant development. Boolean models are simple and intuitively appealing, ideal tools for collaborative efforts between theorists and experimentalists. In this chapter we present protocols used in our group for the study of diverse plant developmental processes. We focus on conceptual clarity and practical implementation, providing directions to the corresponding technical literature.

  2. A Complementary Bioinformatics Approach to Identify Potential Plant Cell Wall Glycosyltransferase-Encoding Genes

    DEFF Research Database (Denmark)

    Egelund, Jack; Skjøt, Michael; Geshi, Naomi

    2004-01-01

    Plant cell wall (CW) synthesizing enzymes can be divided into the glycan (i.e. cellulose and callose) synthases, which are multimembrane spanning proteins located at the plasma membrane, and the glycosyltransferases (GTs), which are Golgi localized single membrane spanning proteins, believed....... Although much is known with regard to composition and fine structures of the plant CW, only a handful of CW biosynthetic GT genes-all classified in the CAZy system-have been characterized. In an effort to identify CW GTs that have not yet been classified in the CAZy database, a simple bioinformatics...... approach was adopted. First, the entire Arabidopsis proteome was run through the Transmembrane Hidden Markov Model 2.0 server and proteins containing one or, more rarely, two transmembrane domains within the N-terminal 150 amino acids were collected. Second, these sequences were submitted...

  3. De novo assembly and characterization of the transcriptome of the parasitic weed dodder identifies genes associated with plant parasitism.

    Science.gov (United States)

    Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R

    2014-11-01

    Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. © 2014 American Society of Plant Biologists. All Rights Reserved.

  4. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Science.gov (United States)

    Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K

    2014-01-01

    Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  5. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Directory of Open Access Journals (Sweden)

    Nidhi Thakur

    Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  6. A novel Usher protein network at the periciliary reloading point between molecular transport machineries in vertebrate photoreceptor cells.

    Science.gov (United States)

    Maerker, Tina; van Wijk, Erwin; Overlack, Nora; Kersten, Ferry F J; McGee, Joann; Goldmann, Tobias; Sehn, Elisabeth; Roepman, Ronald; Walsh, Edward J; Kremer, Hannie; Wolfrum, Uwe

    2008-01-01

    The human Usher syndrome (USH) is the most frequent cause of combined deaf-blindness. USH is genetically heterogeneous with at least 12 chromosomal loci assigned to three clinical types, USH1-3. Although these USH types exhibit similar phenotypes in human, the corresponding gene products belong to very different protein classes and families. The scaffold protein harmonin (USH1C) was shown to integrate all identified USH1 and USH2 molecules into protein networks. Here, we analyzed a protein network organized in the absence of harmonin by the scaffold proteins SANS (USH1G) and whirlin (USH2D). Immunoelectron microscopic analyses disclosed the colocalization of all network components in the apical inner segment collar and the ciliary apparatus of mammalian photoreceptor cells. In this complex, whirlin and SANS directly interact. Furthermore, SANS provides a linkage to the microtubule transport machinery, whereas whirlin may anchor USH2A isoform b and VLGR1b (very large G-protein coupled receptor 1b) via binding to their cytodomains at specific membrane domains. The long ectodomains of both transmembrane proteins extend into the gap between the adjacent membranes of the connecting cilium and the apical inner segment. Analyses of Vlgr1/del7TM mice revealed the ectodomain of VLGR1b as a component of fibrous links present in this gap. Comparative analyses of mouse and Xenopus photoreceptors demonstrated that this USH protein network is also part of the periciliary ridge complex in Xenopus. Since this structural specialization in amphibian photoreceptor cells defines a specialized membrane domain for docking and fusion of transport vesicles, we suggest a prominent role of the USH proteins in cargo shipment.

  7. Enhanced iron and zinc accumulation in genetically engineered pineapple plants using soybean ferritin gene.

    Science.gov (United States)

    Mhatre, Minal; Srinivas, Lingam; Ganapathi, Thumballi R

    2011-12-01

    Pineapple (Ananas comosus L. Merr., cv. "Queen") leaf bases were transformed with Agrobacterium tumefaciens strain EHA 105 harboring the pSF and pEFESF plasmids with soybean ferritin cDNA. Four to eight percent of the co-cultivated leaf bases produced multiple shoots 6 weeks after transfer to Murashige and Skoog's medium supplemented with α-naphthalene acetic acid 1.8 mg/l, indole-3-butyric acid 2.0 mg/l, kinetin 2.0 mg/l, cefotaxime 400 mg/l, and kanamycin 50 mg/l. Putatively transformed shoots (1-2 cm) were selected and multiplied on medium of the same composition and elongated shoots (5 cm) were rooted on liquid rooting medium supplemented with cefotaxime 400 mg/l and kanamycin 100 mg/l. The rooted plants were analyzed through PCR, genomic Southern analysis, and reverse transcription PCR. The results clearly confirmed the integration and expression of soybean ferritin gene in the transformed plants. Atomic absorption spectroscopic analysis carried out with six independently transformed lines of pSF and pEFE-SF revealed a maximum of 5.03-fold increase in iron and 2.44-fold increase in zinc accumulation in the leaves of pSF-transformed plants. In pEFE-SF-transformed plants, a 3.65-fold increase in iron and 2.05-fold increase in zinc levels was observed. Few of the transgenic plants were hardened in the greenhouse and are being grown to maturity to determine the enhanced iron and zinc accumulation in the fruits. To the best of our knowledge this is the first report on the transformation of pineapple with soybean ferritin for enhanced accumulation of iron and zinc content in the transgenic plants.

  8. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.

    Science.gov (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle

    2017-08-01

    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Feedback regulation of an Agrobacterium catalase gene katA involved in Agrobacterium-plant interaction.

    Science.gov (United States)

    Xu, X Q; Li, L P; Pan, S Q

    2001-11-01

    Catalases are known to detoxify H2O2, a major component of oxidative stress imposed on a cell. An Agrobacterium tumefaciens catalase encoded by a chromosomal gene katA has been implicated as an important virulence factor as it is involved in detoxification of H2O2 released during Agrobacterium-plant interaction. In this paper, we report a feedback regulation pathway that controls the expression of katA in A. tumefaciens cells. We observed that katA could be induced by plant tissue sections and by acidic pH on a minimal medium, which resembles the plant environment that the bacteria encounter during the course of infection. This represents a new regulatory factor for catalase induction in bacteria. More importantly, a feedback regulation was observed when the katA-gfp expression was studied in different genetic backgrounds. We found that introduction of a wild-type katA gene encoding a functional catalase into A. tumefaciens cells could repress the katA-gfp expression over 60-fold. The katA gene could be induced by H2O2 and the encoded catalase could detoxify H2O2. In addition, the katA-gfp expression of one bacterial cell could be repressed by other surrounding catalase-proficient bacterial cells. Furthermore, mutation at katA caused a 10-fold increase of the intracellular H2O2 concentration in the bacteria grown on an acidic pH medium. These results suggest that the endogenous H2O2 generated during A. tumefaciens cell growth could serve as the intracellular and intercellular inducer for the katA gene expression and that the acidic pH could pose an oxidative stress on the bacteria. Surprisingly, one mutated KatA protein, exhibiting no significant catalase activity as a result of the alteration of two important residues at the putative active site, could partially repress the katA-gfp expression. The feedback regulation of the katA gene by both catalase activity and KatA protein could presumably maintain an appropriated level of catalase activity and H2O2 inside A

  10. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Directory of Open Access Journals (Sweden)

    Etienne G.J. Danchin

    2017-10-01

    Full Text Available Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  11. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Science.gov (United States)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Sokolova (Guzeeva), Elena; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T.

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum. PMID:29065523

  12. The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries.

    Directory of Open Access Journals (Sweden)

    Bharani Manoharan

    Full Text Available The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph colonises the surface of common bean plants before moving into the interior of plant tissue, via wounds and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and forms microcolonies (biofilms around plant cells. If the pathogen can suppress the plant's natural resistance response, it will cause halo blight disease. The process of resistance suppression is fairly well understood, but the mechanisms used by the pathogen in colonisation are less clear. We hypothesised that we could apply in vitro genetic screens to look for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn mutant libraries of Pph strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony morphology, motility and biofilm formation. Identification of the insertion point of the Tn identified within the genome highlighted, as expected, a number of altered motility mutants bearing mutations in genes encoding various parts of the flagellum. Genes involved in nutrient biosynthesis, membrane associated proteins, and a number of conserved hypothetical protein (CHP genes were also identified. A mutation of one CHP gene caused a positive increase in in planta bacterial growth. This rapid and inexpensive screening method allows the discovery of genes important for in vitro traits that can be correlated to roles in the plant interaction.

  13. Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

    2016-01-01

    Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants.

  14. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    Science.gov (United States)

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  15. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  16. Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

    International Nuclear Information System (INIS)

    Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

    2009-01-01

    Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

  17. Gene expression analysis in rice plants after external radiation exposure in Iitate village

    Energy Technology Data Exchange (ETDEWEB)

    Hayashi, G.; Fukumoto, M. [Institute of Development, Aging and Cancer, Tohoku University (Japan); Imanaka, T. [Research Reactor Institute, Kyoto University (Japan); Shibato, J. [Department of Anatomy I, School of Medicine, Showa University (Japan); Kubo, A. [Center for Environmental Biology and Ecosystem Studies, National Institute for Environmental Studies (Japan); Kikuchi, S. [Plant Genome Research Unit, Agrogenomics Research Center, National Institute of Agrobiological Sciences (Japan); Rakwal, R. [Organization for Educational Initiatives, University of Tsukuba (Japan)

    2014-07-01

    Rice plants exposed to radiation respond to the stress by activating self-defense mechanisms. A well-established molecular approach to measure stress is by cataloging global gene expression profiles. Here, we examined the effect of radiation exposure in a cereal crop model plant - rice (Oryza sativa L.) cultivar Nipponbare - in the village of Iitate of Fukushima prefecture. Iitate village is a highly radio-contaminated site due to the Fukushima Daiichi nuclear power plant accident following the Great East Japan Earthquake. The experimental approach comprised of five steps. First, healthy rice seedlings were grown in the greenhouse facility at National Institute for Environmental Sciences. Post-germination at 30 deg. C similarly germinated seeds were placed in neat rows in seedling pots having commercial soil (JA Zen-Noh, Japan; http//www.zennoh.or.jp/) with recommended NPK (nitrogen, phosphorus, and potash) doses at a controlled (25 deg. C, 70% relative humidity and natural light condition) greenhouse. Second, the seedlings were transported from a controlled greenhouse in Tsukuba to Iitate Farm (ITF) and placed, with no direct contact with soil, in a low-level gamma field where the rate of Cs-137 was 700 kBq/m{sup 2}. Third, exposure periods were set at 6, 12, 24, 48, and 72 h after arrival at ITF, and rice leaves at the 3. position (from the base) from 6 to 10 seedlings were sampled in dry ice. As control, rice leaves were sampled at the start in Tsukuba and immediately at arrival upon ITF; to know the radiation levels during growth and transport of the rice to ITF, accumulated radiation dose was calculated using a MYDOSE mini electronic pocket dosimeter (model PDM-222-52, ALOKA, Japan). A sample set was also taken at 72 h from healthy rice seedlings in the greenhouse at Tsukuba. All samples were stored at -80 deg. C. Accumulated total dose for exposed rice seedlings at 72 h was 200 mSv. Fourth, gene expression analysis was initiated by grinding the leaves to a

  18. Genome-Wide Identification of the Alba Gene Family in Plants and Stress-Responsive Expression of the Rice Alba Genes.

    Science.gov (United States)

    Verma, Jitendra Kumar; Wardhan, Vijay; Singh, Deepali; Chakraborty, Subhra; Chakraborty, Niranjan

    2018-03-28

    Architectural proteins play key roles in genome construction and regulate the expression of many genes, albeit the modulation of genome plasticity by these proteins is largely unknown. A critical screening of the architectural proteins in five crop species, viz., Oryza sativa , Zea mays , Sorghum bicolor , Cicer arietinum , and Vitis vinifera , and in the model plant Arabidopsis thaliana along with evolutionary relevant species such as Chlamydomonas reinhardtii , Physcomitrella patens , and Amborella trichopoda , revealed 9, 20, 10, 7, 7, 6, 1, 4, and 4 Alba (acetylation lowers binding affinity) genes, respectively. A phylogenetic analysis of the genes and of their counterparts in other plant species indicated evolutionary conservation and diversification. In each group, the structural components of the genes and motifs showed significant conservation. The chromosomal location of the Alba genes of rice ( OsAlba ), showed an unequal distribution on 8 of its 12 chromosomes. The expression profiles of the OsAlba genes indicated a distinct tissue-specific expression in the seedling, vegetative, and reproductive stages. The quantitative real-time PCR (qRT-PCR) analysis of the OsAlba genes confirmed their stress-inducible expression under multivariate environmental conditions and phytohormone treatments. The evaluation of the regulatory elements in 68 Alba genes from the 9 species studied led to the identification of conserved motifs and overlapping microRNA (miRNA) target sites, suggesting the conservation of their function in related proteins and a divergence in their biological roles across species. The 3D structure and the prediction of putative ligands and their binding sites for OsAlba proteins offered a key insight into the structure-function relationship. These results provide a comprehensive overview of the subtle genetic diversification of the OsAlba genes, which will help in elucidating their functional role in plants.

  19. Expression of Aluminum-Induced Genes in Transgenic Arabidopsis Plants Can Ameliorate Aluminum Stress and/or Oxidative Stress1

    Science.gov (United States)

    Ezaki, Bunichi; Gardner, Richard C.; Ezaki, Yuka; Matsumoto, Hideaki

    2000-01-01

    To examine the biological role of Al-stress-induced genes, nine genes derived from Arabidopsis, tobacco (Nicotiana tabacum L.), wheat (Triticum aestivum L.), and yeast (Saccharomyces cerevisiae) were expressed in Arabidopsis ecotype Landsberg. Lines containing eight of these genes were phenotypically normal and were tested in root elongation assays for their sensitivity to Al, Cd, Cu, Na, Zn, and to oxidative stresses. An Arabidopsis blue-copper-binding protein gene (AtBCB), a tobacco glutathione S-transferase gene (parB), a tobacco peroxidase gene (NtPox), and a tobacco GDP-dissociation inhibitor gene (NtGDI1) conferred a degree of resistance to Al. Two of these genes, AtBCB and parB, and a peroxidase gene from Arabidopsis (AtPox) also showed increased resistance to oxidative stress induced by diamide, while parB conferred resistance to Cu and Na. Al content of Al-treated root tips was reduced in the four Al-resistant plant lines compared with wild-type Ler-0, as judged by morin staining. All four Al-resistant lines also showed reduced staining of roots with 2′,7′-dichloro fluorescein diacetate (H2DCFDA), an indicator of oxidative stress. We conclude that Al-induced genes can serve to protect against Al toxicity, and also provide genetic evidence for a link between Al stress and oxidative stress in plants. PMID:10712528

  20. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  1. Cone photoreceptor structure in patients with x-linked cone dysfunction and red-green color vision deficiency

    DEFF Research Database (Denmark)

    Patterson, Emily J.; Wilk, Melissa; Langlo, Christopher S.

    2016-01-01

    encoded by exon 4, and two with a novel insertion in exon 2. Foveal cone structure and retinal thickness was disrupted to a variable degree, even among related individuals with the same L/M array. CONCLUSIONS. Our findings provide a direct link between disruption of the cone mosaic and L/ M opsin variants......PURPOSE. Mutations in the coding sequence of the L and M opsin genes are often associated with X-linked cone dysfunction (such as Bornholm Eye Disease, BED), though the exact color vision phenotype associated with these disorders is variable. We examined individuals with L/ M opsin gene mutations...... to clarify the link between color vision deficiency and cone dysfunction.  METHODS. We recruited 17 males for imaging. The thickness and integrity of the photoreceptor layers were evaluated using spectral-domain optical coherence tomography. Cone density was measured using high-resolution images of the cone...

  2. [Induced expression of Serratia marcescens ribonuclease III gene in transgenic Nicotiana tabacum L. cv. SR1 tobacco plants].

    Science.gov (United States)

    Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K

    2016-11-01

    Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.

  3. Genes of the most conserved WOX clade in plants affect root and flower development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Moreau Hervé

    2008-10-01

    Full Text Available Abstract Background The Wuschel related homeobox (WOX family proteins are key regulators implicated in the determination of cell fate in plants by preventing cell differentiation. A recent WOX phylogeny, based on WOX homeodomains, showed that all of the Physcomitrella patens and Selaginella moellendorffii WOX proteins clustered into a single orthologous group. We hypothesized that members of this group might preferentially share a significant part of their function in phylogenetically distant organisms. Hence, we first validated the limits of the WOX13 orthologous group (WOX13 OG using the occurrence of other clade specific signatures and conserved intron insertion sites. Secondly, a functional analysis using expression data and mutants was undertaken. Results The WOX13 OG contained the most conserved plant WOX proteins including the only WOX detected in the highly proliferating basal unicellular and photosynthetic organism Ostreococcus tauri. A large expansion of the WOX family was observed after the separation of mosses from other land plants and before monocots and dicots have arisen. In Arabidopsis thaliana, AtWOX13 was dynamically expressed during primary and lateral root initiation and development, in gynoecium and during embryo development. AtWOX13 appeared to affect the floral transition. An intriguing clade, represented by the functional AtWOX14 gene inside the WOX13 OG, was only found in the Brassicaceae. Compared to AtWOX13, the gene expression profile of AtWOX14 was restricted to the early stages of lateral root formation and specific to developing anthers. A mutational insertion upstream of the AtWOX14 homeodomain sequence led to abnormal root development, a delay in the floral transition and premature anther differentiation. Conclusion Our data provide evidence in favor of the WOX13 OG as the clade containing the most conserved WOX genes and established a functional link to organ initiation and development in Arabidopsis, most

  4. Mutually exclusive expression of human red and green visual pigment-reporter transgenes occurs at high frequency in murine cone photoreceptors.

    Science.gov (United States)

    Wang, Y; Smallwood, P M; Cowan, M; Blesh, D; Lawler, A; Nathans, J

    1999-04-27

    This study examines the mechanism of mutually exclusive expression of the human X-linked red and green visual pigment genes in their respective cone photoreceptors by asking whether this expression pattern can be produced in a mammal that normally carries only a single X-linked visual pigment gene. To address this question, we generated transgenic mice that carry a single copy of a minimal human X chromosome visual pigment gene array in which the red and green pigment gene transcription units were replaced, respectively, by alkaline phosphatase and beta-galactosidase reporters. As determined by histochemical staining, the reporters are expressed exclusively in cone photoreceptor cells. In 20 transgenic mice carrying any one of three independent transgene insertion events, an average of 63% of expressing cones have alkaline phosphatase activity, 10% have beta-galactosidase activity, and 27% have activity for both reporters. Thus, mutually exclusive expression of red and green pigment transgenes can be achieved in a large fraction of cones in a dichromat mammal, suggesting a facile evolutionary path for the development of trichromacy after visual pigment gene duplication. These observations are consistent with a model of visual pigment expression in which stochastic pairing occurs between a locus control region and either the red or the green pigment gene promotor.

  5. Generation, purification and transplantation of photoreceptors derived from human induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Deepak A Lamba

    2010-01-01

    Full Text Available Inherited and acquired retinal degenerations are frequent causes of visual impairment and photoreceptor cell replacement therapy may restore visual function to these individuals. To provide a source of new retinal neurons for cell based therapies, we developed methods to derive retinal progenitors from human ES cells.In this report we have used a similar method to direct induced pluripotent stem cells (iPS from human fibroblasts to a retinal progenitor fate, competent to generate photoreceptors. We also found we could purify the photoreceptors derived from the iPS cells using fluorescence activated cell sorting (FACS after labeling photoreceptors with a lentivirus driving GFP from the IRBP cis-regulatory sequences. Moreover, we found that when we transplanted the FACS purified iPSC derived photoreceptors, they were able to integrate into a normal mouse retina and express photoreceptor markers.This report provides evidence that enriched populations of human photoreceptors can be derived from iPS cells.

  6. Characterization of multiple light damage paradigms reveals regional differences in photoreceptor loss.

    Science.gov (United States)

    Thomas, Jennifer L; Nelson, Craig M; Luo, Xixia; Hyde, David R; Thummel, Ryan

    2012-04-01

    Zebrafish provide an attractive model to study the retinal response to photoreceptor apoptosis due to its remarkable ability to spontaneously regenerate retinal neurons following damage. There are currently two widely-used light-induced retinal degeneration models to damage photoreceptors in the adult zebrafish. One model uses constant bright light, whereas the other uses a short exposure to extremely intense ultraviolet light. Although both models are currently used, it is unclear whether they differ in regard to the extent of photoreceptor damage or the subsequent regeneration response. Here we report a thorough analysis of the photoreceptor damage and subsequent proliferation response elicited by each individual treatment, as well as by the concomitant use of both treatments. We show a differential loss of rod and cone photoreceptors with each treatment. Additionally, we show that the extent of proliferation observed in the retina directly correlates with the severity of photoreceptor loss. We also demonstrate that both the ventral and posterior regions of the retina are partially protected from light damage. Finally, we show that combining a short ultraviolet exposure followed by a constant bright light treatment largely eliminates the neuroprotected regions, resulting in widespread loss of rod and cone photoreceptors and a robust regenerative response throughout the retina. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. A new photosensory function for simple photoreceptors, the intrinsically photoresponsive neurons of the sea slug Onchidium

    Directory of Open Access Journals (Sweden)

    Tsukasa Gotow

    2009-12-01

    Full Text Available Simple photoreceptors, namely intrinsically light-sensitive neurons without microvilli and/or cilia, have long been known to exist in the central ganglia of crayfish, Aplysia, Onchidium, and Helix. These simple photoreceptors are not only first-order photosensory cells, but also second-order neurons (interneurons, relaying several kinds of sensory synaptic inputs. Another important issue is that the photoresponses of these simple photoreceptors show very slow kinetics and little adaptation. These characteristics suggest that the simple photoreceptors of the Onchidium have a function in non-image-forming vision, different from classical eye photoreceptors used for cording dynamic images of vision. The cited literature provides evidence that the depolarizing and hyperpolarizing photoresponses of simple photoreceptors play a role in the long-lasting potentiation of synaptic transmission of excitatory and inhibitory sensory inputs, and as well as in the potentiation and the suppression of the subsequent behavioral outputs. In short, we suggest that simple photoreceptors operate in the general potentiation of synaptic transmission and subsequent motor output; i.e., they perform a new photosensory function.

  8. Generation of a genetically encoded marker of rod photoreceptor outer segment growth and renewal

    Directory of Open Access Journals (Sweden)

    John J. Willoughby

    2011-10-01

    Vertebrate photoreceptors are specialized light sensing neurons. The photoreceptor outer segment is a highly modified cilium where photons of light are transduced into a chemical and electrical signal. The outer segment has the typical cilary axoneme but, in addition, it has a large number of densely packed, stacked, intramembranous discs. The molecular and cellular mechanisms that contribute to vertebrate photoreceptor outer segment morphogenesis are still largely unknown. Unlike typical cilia, the outer segment is continuously regenerated or renewed throughout the life of the animal through the combined process of distal outer segment shedding and proximal outer segment growth. The process of outer segment renewal was discovered over forty years ago, but we still lack an understanding of how photoreceptors renew their outer segments and few, if any, molecular mechanisms that regulate outer segment growth or shedding have been described. Our lack of progress in understanding how photoreceptors renew their outer segments has been hampered by the difficulty in measuring rates of renewal. We have created a new method that uses heat-shock induction of a fluorescent protein that can be used to rapidly measure outer segment growth rates. We describe this method, the stable transgenic line we created, and the growth rates observed in larval and adult rod photoreceptors using this new method. This new method will allow us to begin to define the genetic and molecular mechanisms that regulate rod outer segment renewal, a crucial aspect of photoreceptor function and, possibly, viability.

  9. Preservation of photoreceptors in dystrophic RCS rats following allo- and xenotransplantation of IPE cells.

    Science.gov (United States)

    Thumann, Gabriele; Salz, Anna Katharina; Walter, Peter; Johnen, Sandra

    2009-03-01

    To examine whether iris pigment epithelial (IPE) cells transplanted into the subretinal space of Royal College of Surgeons (RCS) rats have the ability to rescue photoreceptors. Rat IPE (rIPE) or human IPE (hIPE) cells were transplanted subretinally in 23-day-old RCS rats. Sham injection and transplantation of ARPE-19 cells served as controls. After 12 weeks, eyes were evaluated for photoreceptor survival by morphometric analysis and electron microscopy. Morphometric analysis showed photoreceptor rescue in all transplanted and sham-injected animals (number of photoreceptors/300 microm retina+/-sd: rIPE 41.67 +/- 28; hIPE 29.50 +/- 16; ARPE-19 36.12 +/- 21; sham 16.56 +/- 6) compared to age-matched, control rats (number of photoreceptors/300 microm retina+/-sd: 9.71 +/- 4). Photoreceptor rescue was prominent in IPE cell-transplanted rats and was significantly greater than sham-injected eyes (p = 0.02 for rIPE and p = 0.04 for hIPE). Since IPE cells transplanted into the subretinal space have the ability to rescue photoreceptors from degeneration in the RCS rat without any harmful effects, IPE cells may represent an ideal cell to genetically modify and thus carry essential genetic information for the repair of defects in the subretinal space.

  10. Optimization of reload of nuclear power plants using ACO together with the GENES reactor physics code

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Alan M.M. de; Freire, Fernando S.; Nicolau, Andressa S.; Schirru, Roberto, E-mail: alan@lmp.ufrj.br, E-mail: andressa@lmp.ufrj.br, E-mail: schirru@lmp.ufrj.br, E-mail: ffreire@eletronuclear.gov.br [Coordenacao de Pos-Graduacao e Pesquisa de Engenharia (PEN/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil); Eletrobras Termonuclear S.A. (ELETRONUCLEAR), Rio de Janeiro, RJ (Brazil)

    2017-11-01

    The Nuclear reload of a Pressurized Water Reactor (PWR) occurs whenever the burning of the fuel elements can no longer maintain the criticality of the reactor, that is, it cannot maintain the Nuclear power plant operates within its nominal power. Nuclear reactor reload optimization problem consists of finding a loading pattern of fuel assemblies in the reactor core in order to minimize the cost/benefit ratio, trying to obtain maximum power generation with a minimum of cost, since in all reloads an average of one third of the new fuel elements are purchased. This loading pattern must also satisfy constraints of symmetry and security. In practice, it consists of the placing 121 fuel elements in 121 core positions, in the case of the Angra 1 Brazilian Nuclear Power Plant (NPP), making this new arrangement provide the best cost/benefit ratio. It is an extremely complex problem, since it has around 1% of great places. A core of 121 fuel elements has approximately 10{sup 13} combinations and 10{sup 11} great locations. With this number of possible combinations it is impossible to test all, in order to choose the best. In this work a system called ACO-GENES is proposed in order to optimization the Nuclear Reactor Reload Problem. ACO is successfully used in combination problems, and it is expected that ACO-GENES will show a robust optimization system, since in addition to optimizing ACO, it allows important prior knowledge such as K infinite, burn, etc. After optimization by ACO-GENES, the best results will be validated by a licensed reactor physics code and will be compared with the actual results of the cycle. (author)

  11. Optimization of reload of nuclear power plants using ACO together with the GENES reactor physics code

    International Nuclear Information System (INIS)

    Lima, Alan M.M. de; Freire, Fernando S.; Nicolau, Andressa S.; Schirru, Roberto

    2017-01-01

    The Nuclear reload of a Pressurized Water Reactor (PWR) occurs whenever the burning of the fuel elements can no longer maintain the criticality of the reactor, that is, it cannot maintain the Nuclear power plant operates within its nominal power. Nuclear reactor reload optimization problem consists of finding a loading pattern of fuel assemblies in the reactor core in order to minimize the cost/benefit ratio, trying to obtain maximum power generation with a minimum of cost, since in all reloads an average of one third of the new fuel elements are purchased. This loading pattern must also satisfy constraints of symmetry and security. In practice, it consists of the placing 121 fuel elements in 121 core positions, in the case of the Angra 1 Brazilian Nuclear Power Plant (NPP), making this new arrangement provide the best cost/benefit ratio. It is an extremely complex problem, since it has around 1% of great places. A core of 121 fuel elements has approximately 10"1"3 combinations and 10"1"1 great locations. With this number of possible combinations it is impossible to test all, in order to choose the best. In this work a system called ACO-GENES is proposed in order to optimization the Nuclear Reactor Reload Problem. ACO is successfully used in combination problems, and it is expected that ACO-GENES will show a robust optimization system, since in addition to optimizing ACO, it allows important prior knowledge such as K infinite, burn, etc. After optimization by ACO-GENES, the best results will be validated by a licensed reactor physics code and will be compared with the actual results of the cycle. (author)

  12. The abundance and diversity of antibiotic resistance genes in the atmospheric environment of composting plants.

    Science.gov (United States)

    Gao, Min; Qiu, Tianlei; Sun, Yanmei; Wang, Xuming

    2018-07-01

    Composting is considered to reduce the introduction of antimicrobial resistance genes (ARGs) into the environment through land application of manure; however, the possible pollution of ARGs in the atmospheric environment of composting plants is unknown. In this study, 29 air samples including up- and downwind, composting, packaging, and office areas from 4 composting plants were collected. Dynamic concentrations of 22 subtypes of ARGs, class 1 integron (intl1), and 2 potential human pathogenic bacteria (HPB), and bacterial communities were investigated using droplet digital PCR and 16S rRNA gene sequencing, respectively. In this study, intl1 and 22 subtypes of ARGs (except tetQ) were detected in air of composting, packaging, office, and downwind areas. The highest concentration of 15 out of 22 subtypes of ARGs was detected in the packaging areas, and intl1 also had the maximum average concentration of 10 4  copies/m 3 , with up to (1.78 ± 0.49) × 10 -2 copies/16S rRNA copy. Non-metric multi-dimensional scaling of ARGs, potential HPBs, and bacterial components all indicated that the bioaerosol pollutant pattern in packaging areas was most similar to that in composting areas, followed by office, downwind, and upwind areas. The co-occurrence between ARGs and bacterial taxa assessed by Procrustes test, mantel test, and network analysis implied that aerosolized ARG fragments from composting and packaging areas contributed to the compositions of ARG aerosols in office and downwind areas. The results presented here show that atmoshperic environments of composting plants harbor abundant and diverse ARGs, which highlight the urgent need for comprehensive evaluation of potential human health and ecological risks of composts during both production as well as land application. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Selectable genes for transformation of the fungal plant pathogen Glomerella cingulata f. sp. phaseoli (Colletotrichum lindemuthianum).

    Science.gov (United States)

    Rodriguez, R J; Yoder, O C

    1987-01-01

    Glomerella cingulata f. sp. phaseoli (Gcp) was transformed using either of two selectable markers: the amdS + gene of Aspergillus nidulans, which encodes acetamidase and permits growth on acetamide as the sole nitrogen source and the hygBR gene of Escherichia coli which encodes hygromycin B (Hy) phosphotransferase and permits growth in the presence of the antibiotic Hy. The amdS+ gene functioned in Gcp under control of A. nidulans regulatory signals and hygBR was expressed after fusion to a promoter from Cochliobolus heterostrophus, another filamentous ascomycete. Protoplasts to be transformed were generated with the digestive enzyme complex Novozym 234 and then were exposed to plasmid DNA in the presence of 10 mM CaCl2 and polyethylene glycol. Transformation occurred by integration of single or multiple copies of either the amdS+ or hygBR plasmid into the fungal genome. There was no evidence of autonomous plasmid replication. Transformants were mitotically stable on selective and nonselective media. However, transforming DNA in hygBR transformants was observed to occasionally rearrange during nonselective growth, resulting in fewer copies of the plasmid per genome. These transformants were capable of infecting bean (Phaseolus vulgaris), the Gcp host plant, and after recovery from infected tissue were found to have retained both the transforming DNA unrearranged in their genomes and the Hy resistance phenotype. All single-conidial cultures derived from both amdS+ and hygBR transformants had the transplanted phenotype, suggesting that transformants were homokaryons.

  14. Bifurcation analysis of a photoreceptor interaction model for Retinitis Pigmentosa

    Science.gov (United States)

    Camacho, Erika T.; Radulescu, Anca; Wirkus, Stephen

    2016-09-01

    Retinitis Pigmentosa (RP) is the term used to describe a diverse set of degenerative eye diseases affecting the photoreceptors (rods and cones) in the retina. This work builds on an existing mathematical model of RP that focused on the interaction of the rods and cones. We non-dimensionalize the model and examine the stability of the equilibria. We then numerically investigate other stable modes that are present in the system for various parameter values and relate these modes to the original problem. Our results show that stable modes exist for a wider range of parameter values than the stability of the equilibrium solutions alone, suggesting that additional approaches to preventing cone death may exist.

  15. Blue and ultraviolet-B light photoreceptors in parsley cells

    International Nuclear Information System (INIS)

    Ensminger, P.A.; Schaefer, E.

    1992-01-01

    The authors studied UV-B photoreception in parsley cell cultures with physiological experiments involving temperature shifts and examined the possible role of flavin in blue and UV-B light photo-reception. Cells irradiated with UV-B light (0.5-15 min) at 2 o C have the same fluence requirement for chalcone synthase and flavonoid induction as controls irradiated at 25 o C. This is indicative of a purely photochemical reaction. Cells fed with riboflavin and irradiated with 6 h of UV-containing white light synthesize higher levels of chalcone synthase and flavonoid than unfed controls. This effect did not occur with blue light. These results indicate that flavin-sensitization requires excitation of flavin and the UV-B light photoreceptor. (author)

  16. Effect of plant extracts on H2O2-induced inflammatory gene expression in macrophages

    Science.gov (United States)

    Pomari, Elena; Stefanon, Bruno; Colitti, Monica

    2014-01-01

    Background Arctium lappa (AL), Camellia sinensis (CS), Echinacea angustifolia, Eleutherococcus senticosus, Panax ginseng (PG), and Vaccinium myrtillus (VM) are plants traditionally used in many herbal formulations for the treatment of various conditions. Although they are well known and already studied for their anti-inflammatory properties, their effects on H2O2-stimulated macrophages are a novel area of study. Materials and methods Cell viability was tested after treatment with increasing doses of H2O2 and/or plant extracts at different times of incubation to identify the optimal experimental conditions. The messenger (m)RNA expression of TNFα, COX2, IL1β, NFκB1, NFκB2, NOS2, NFE2L2, and PPARγ was analyzed in macrophages under H2O2 stimulation. The same genes were also quantified after plant extract treatment on cells pre-stimulated with H2O2. Results A noncytotoxic dose (200 μM) of H2O2 induced active mRNA expression of COX2, IL1β, NFE2L2, NFκB1, NFκB2, NOS2, and TNFα, while PPARγ was depressed. The expression of all genes tested was significantly (P<0.001) regulated by plant extracts after pre-stimulation with H2O2. COX2 was downregulated by AL, PG, and VM. All extracts depressed IL1β expression, but upregulated NFE2L2. NFκB1, NFκB2, and TNFα were downregulated by AL, CS, PG, and VM. NOS2 was inhibited by CS, PG, and VM. PPARγ was decreased only after treatment with E. angustifolia and E. senticosus. Conclusion The results of the present study indicate that the stimulation of H2O2 on RAW267.4 cells induced the transcription of proinflammatory mediators, showing that this could be an applicable system by which to activate macrophages. Plant extracts from AL, CS, PG, and VM possess in vitro anti-inflammatory activity on H2O2-stimulated macrophages by modulating key inflammation mediators. Further in vitro and in vivo investigation into molecular mechanisms modulated by herbal extracts should be undertaken to shed light on the development of novel

  17. Effect of plant extracts on H2O2-induced inflammatory gene expression in macrophages

    Directory of Open Access Journals (Sweden)

    Pomari E

    2014-06-01

    Full Text Available Elena Pomari, Bruno Stefanon, Monica Colitti Department of Agricultural and Environmental Sciences, University of Udine, Udine, Italy Background: Arctium lappa (AL, Camellia sinensis (CS, Echinacea angustifolia, Eleutherococcus senticosus, Panax ginseng (PG, and Vaccinium myrtillus (VM are plants traditionally used in many herbal formulations for the treatment of various conditions. Although they are well known and already studied for their anti-inflammatory properties, their effects on H2O2-stimulated macrophages are a novel area of study. Materials and methods: Cell viability was tested after treatment with increasing doses of H2O2 and/or plant extracts at different times of incubation to identify the optimal experimental conditions. The messenger (mRNA expression of TNFα, COX2, IL1β, NFκB1, NFκB2, NOS2, NFE2L2, and PPARγ was analyzed in macrophages under H2O2 stimulation. The same genes were also quantified after plant extract treatment on cells pre-stimulated with H2O2. Results: A noncytotoxic dose (200 µM of H2O2 induced active mRNA expression of COX2, IL1β, NFE2L2, NFκB1, NFκB2, NOS2, and TNFα, while PPARγ was depressed. The expression of all genes tested was significantly (P<0.001 regulated by plant extracts after pre-stimulation with H2O2. COX2 was downregulated by AL, PG, and VM. All extracts depressed IL1β expression, but upregulated NFE2L2. NFκB1, NFκB2, and TNFα were downregulated by AL, CS, PG, and VM. NOS2 was inhibited by CS, PG, and VM. PPARγ was decreased only after treatment with E. angustifolia and E. senticosus. Conclusion: The results of the present study indicate that the stimulation of H2O2 on RAW267.4 cells induced the transcription of proinflammatory mediators, showing that this could be an applicable system by which to activate macrophages. Plant extracts from AL, CS, PG, and VM possess in vitro anti-inflammatory activity on H2O2-stimulated macrophages by modulating key inflammation mediators. Further in

  18. Evolution of endogenous non-retroviral genes integrated into plant genomes

    Directory of Open Access Journals (Sweden)

    Hyosub Chu

    2014-08-01

    Full Text Available Numerous comparative genome analyses have revealed the wide extent of horizontal gene transfer (HGT in living organisms, which contributes to their evolution and genetic diversity. Viruses play important roles in HGT. Endogenous viral elements (EVEs are defined as viral DNA sequences present within the genomes of non-viral organisms. In eukaryotic cells, the majority of EVEs are derived from RNA viruses using reverse transcription. In contrast, endogenous non-retroviral elements (ENREs are poorly studied. However, the increasing availability of genomic data and the rapid development of bioinformatics tools have enabled the identification of several ENREs in various eukaryotic organisms. To date, a small number of ENREs integrated into plant genomes have been identified. Of the known non-retroviruses, most identified ENREs are derived from double-strand (ds RNA viruses, followed by single-strand (ss DNA and ssRNA viruses. At least eight virus families have been identified. Of these, viruses in the family Partitiviridae are dominant, followed by viruses of the families Chrysoviridae and Geminiviridae. The identified ENREs have been primarily identified in eudicots, followed by monocots. In this review, we briefly discuss the current view on non-retroviral sequences integrated into plant genomes that are associated with plant-virus evolution and their possible roles in antiviral resistance.

  19. Exploring the Role of Cell Wall-Related Genes and Polysaccharides during Plant Development.

    Science.gov (United States)

    Tucker, Matthew R; Lou, Haoyu; Aubert, Matthew K; Wilkinson, Laura G; Little, Alan; Houston, Kelly; Pinto, Sara C; Shirley, Neil J

    2018-05-31

    The majority of organs in plants are not established until after germination, when pluripotent stem cells in the growing apices give rise to daughter cells that proliferate and subsequently differentiate into new tissues and organ primordia. This remarkable capacity is not only restricted to the meristem, since maturing cells in many organs can also rapidly alter their identity depending on the cues they receive. One general feature of plant cell differentiation is a change in cell wall composition at the cell surface. Historically, this has been viewed as a downstream response to primary cues controlling differentiation, but a closer inspection of the wall suggests that it may play a much more active role. Specific polymers within the wall can act as substrates for modifications that impact receptor binding, signal mobility, and cell flexibility. Therefore, far from being a static barrier, the cell wall and its constituent polysaccharides can dictate signal transmission and perception, and directly contribute to a cell's capacity to differentiate. In this review, we re-visit the role of plant cell wall-related genes and polysaccharides during various stages of development, with a particular focus on how changes in cell wall machinery accompany the exit of cells from the stem cell niche.

  20. Antisense oligodeoxynucleotide inhibition as a potent diagnostic tool for gene function in plant biology

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, Christer; Sun, Chuanxin; Ghebramedhin, Haile; Hoglund, Anna-Stina; Jansson, Christer

    2008-01-15

    Antisense oligodeoxynucleotide (ODN) inhibition emerges as an effective means for probing gene function in plant cells. Employing this method we have established the importance of the SUSIBA2 transcription factor for regulation of starch synthesis in barley endosperm, and arrived at a model for the role of the SUSIBAs in sugar signaling and source-sink commutation during cereal endosperm development. In this addendum we provide additional data demonstrating the suitability of the antisense ODN technology in studies on starch branching enzyme activities in barley leaves. We also comment on the mechanism for ODN uptake in plant cells. Antisense ODNs are short (12-25 nt-long) stretches of single-stranded ODNs that hybridize to the cognate mRNA in a sequence-specific manner, thereby inhibiting gene expression. They are naturally occurring in both prokaryotes and eukaryotes where they partake in gene regulation and defense against viral infection. The mechanisms for antisense ODN inhibition are not fully understood but it is generally considered that the ODN either sterically interferes with translation or promotes transcript degradation by RNase H activation. The earliest indication of the usefulness of antisense ODN technology for the purposes of molecular biology and medical therapy was the demonstration in 1978 that synthetic ODNs complementary to Raos sarcoma virus could inhibit virus replication in tissue cultures of chick embryo fibroblasts. Since then the antisense ODN technology has been widely used in animal sciences and as an important emerging therapeutic approach in clinical medicine. However, antisense ODN inhibition has been an under-exploited strategy for plant tissues, although the prospects for plant cells in suspension cultures to take up single-stranded ODNs was reported over a decade ago. In 2001, two reports from Malho and coworker demonstrated the use of cationic-complexed antisense ODNs to suppress expression of genes encoding pollen

  1. Transplantation of adult mouse iPS cell-derived photoreceptor precursors restores retinal structure and function in degenerative mice.

    Directory of Open Access Journals (Sweden)

    Budd A Tucker

    2011-04-01

    Full Text Available This study was designed to determine whether adult mouse induced pluripotent stem cells (iPSCs, could be used to produce retinal precursors and subsequently photoreceptor cells for retinal transplantation to restore retinal function in degenerative hosts. iPSCs were generated using adult dsRed mouse dermal fibroblasts via retroviral induction of the transcription factors Oct4, Sox2, KLF4 and c-Myc. As with normal mouse ES cells, adult dsRed iPSCs expressed the pluripotency genes SSEA1, Oct4, Sox2, KLF4, c-Myc and Nanog. Following transplantation into the eye of immune-compromised retinal degenerative mice these cells proceeded to form teratomas containing tissue comprising all three germ layers. At 33 days post-differentiation a large proportion of the cells expressed the retinal progenitor cell marker Pax6 and went on to express the photoreceptor markers, CRX, recoverin, and rhodopsin. When tested using calcium imaging these cells were shown to exhibit characteristics of normal retinal physiology, responding to delivery of neurotransmitters. Following subretinal transplantation into degenerative hosts differentiated iPSCs took up residence in the retinal outer nuclear layer and gave rise to increased electro retinal function as determined by ERG and functional anatomy. As such, adult fibroblast-derived iPSCs provide a viable source for the production of retinal precursors to be used for transplantation and treatment of retinal degenerative disease.

  2. Lrit1, a Retinal Transmembrane Protein, Regulates Selective Synapse Formation in Cone Photoreceptor Cells and Visual Acuity

    Directory of Open Access Journals (Sweden)

    Akiko Ueno

    2018-03-01

    Full Text Available Summary: In the vertebrate retina, cone photoreceptors play crucial roles in photopic vision by transmitting light-evoked signals to ON- and/or OFF-bipolar cells. However, the mechanisms underlying selective synapse formation in the cone photoreceptor pathway remain poorly understood. Here, we found that Lrit1, a leucine-rich transmembrane protein, localizes to the photoreceptor synaptic terminal and regulates the synaptic connection between cone photoreceptors and cone ON-bipolar cells. Lrit1-deficient retinas exhibit an aberrant morphology of cone photoreceptor pedicles, as well as an impairment of signal transmission from cone photoreceptors to cone ON-bipolar cells. Furthermore, we demonstrated that Lrit1 interacts with Frmpd2, a photoreceptor scaffold protein, and with mGluR6, an ON-bipolar cell-specific glutamate receptor. Additionally, Lrit1-null mice showed visual acuity impairments in their optokinetic responses. These results suggest that the Frmpd2-Lrit1-mGluR6 axis regulates selective synapse formation in cone photoreceptors and is essential for normal visual function. : Ueno et al. finds that Lrit1 plays an important role in regulating the synaptic connection between cone photoreceptors and cone ON-bipolar cells. The Frmpd2-Lrit1-mGluR6 axis is crucial for selective synapse formation in cone photoreceptors and for development of normal visual function. Keywords: retina, circuit, synapse formation, cone photoreceptor cell, ON-bipolar cell, visual acuity

  3. Visual cycle and its metabolic support in gecko photoreceptors.

    Science.gov (United States)

    Kolesnikov, A V; Ala-Laurila, P; Shukolyukov, S A; Crouch, R K; Wiggert, B; Estevez, M E; Govardovskii, V I; Cornwall, M C

    2007-02-01

    Photoreceptors of nocturnal geckos are transmuted cones that acquired rod morphological and physiological properties but retained cone-type phototransduction proteins. We have used microspectrophotometry and microfluorometry of solitary isolated green-sensitive photoreceptors of Tokay gecko to study the initial stages of the visual cycle within these cells. These stages are the photolysis of the visual pigment, the reduction of all-trans retinal to all-trans retinol, and the clearance of all-trans retinol from the outer segment (OS) into the interphotoreceptor space. We show that the rates of decay of metaproducts (all-trans retinal release) and retinal-to-retinol reduction are intermediate between those of typical rods and cones. Clearance of retinol from the OS proceeds at a rate that is typical of rods and is greatly accelerated by exposure to interphotoreceptor retinoid-binding protein, IRBP. The rate of retinal release from metaproducts is independent of the position within the OS, while its conversion to retinol is strongly spatially non-uniform, being the fastest at the OS base and slowest at the tip. This spatial gradient of retinol production is abolished by dialysis of saponin-permeabilized OSs with exogenous NADPH or substrates for its production by the hexose monophosphate pathway (NADP+glucose-6-phosphate or 6-phosphogluconate, glucose-6-phosphate alone). Following dialysis by these agents, retinol production is accelerated by several-fold compared to the fastest rates observed in intact cells in standard Ringer solution. We propose that the speed of retinol production is set by the availability of NADPH which in turn depends on ATP supply within the outer segment. We also suggest that principal source of this ATP is from mitochondria located within the ellipsoid region of the inner segment.

  4. Mechanisms underlying stage-1 TRPL channel translocation in Drosophila photoreceptors.

    Directory of Open Access Journals (Sweden)

    Minh-Ha Lieu

    Full Text Available TRP channels function as key mediators of sensory transduction and other cellular signaling pathways. In Drosophila, TRP and TRPL are the light-activated channels in photoreceptors. While TRP is statically localized in the signaling compartment of the cell (the rhabdomere, TRPL localization is regulated by light. TRPL channels translocate out of the rhabdomere in two distinct stages, returning to the rhabdomere with dark-incubation. Translocation of TRPL channels regulates their availability, and thereby the gain of the signal. Little, however, is known about the mechanisms underlying this trafficking of TRPL channels.We first examine the involvement of de novo protein synthesis in TRPL translocation. We feed flies cycloheximide, verify inhibition of protein synthesis, and test for TRPL translocation in photoreceptors. We find that protein synthesis is not involved in either stage of TRPL translocation out of the rhabdomere, but that re-localization to the rhabdomere from stage-1, but not stage-2, depends on protein synthesis. We also characterize an ex vivo eye preparation that is amenable to biochemical and genetic manipulation. We use this preparation to examine mechanisms of stage-1 TRPL translocation. We find that stage-1 translocation is: induced with ATP depletion, unaltered with perturbation of the actin cytoskeleton or inhibition of endocytosis, and slowed with increased membrane sterol content.Our results indicate that translocation of TRPL out of the rhabdomere is likely due to protein transport, and not degradation/re-synthesis. Re-localization from each stage to the rhabdomere likely involves different strategies. Since TRPL channels can translocate to stage-1 in the absence of ATP, with no major requirement of the cytoskeleton, we suggest that stage-1 translocation involves simple diffusion through the apical membrane, which may be regulated by release of a light-dependent anchor in the rhabdomere.

  5. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals

    Directory of Open Access Journals (Sweden)

    Wentao Wu

    2017-10-01

    Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  6. The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

    Science.gov (United States)

    Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

    2017-12-01

    SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

  7. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals.

    Science.gov (United States)

    Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli

    2017-10-08

    The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.

  8. Structural evolution of the 4/1 genes and proteins in non-vascular and lower vascular plants.

    Science.gov (United States)

    Morozov, Sergey Y; Milyutina, Irina A; Bobrova, Vera K; Ryazantsev, Dmitry Y; Erokhina, Tatiana N; Zavriev, Sergey K; Agranovsky, Alexey A; Solovyev, Andrey G; Troitsky, Alexey V

    2015-12-01

    The 4/1 protein of unknown function is encoded by a single-copy gene in most higher plants. The 4/1 protein of Nicotiana tabacum (Nt-4/1 protein) has been shown to be alpha-helical and predominantly expressed in conductive tissues. Here, we report the analysis of 4/1 genes and the encoded proteins of lower land plants. Sequences of a number of 4/1 genes from liverworts, lycophytes, ferns and gymnosperms were determined and analyzed together with sequences available in databases. Most of the vascular plants were found to encode Magnoliophyta-like 4/1 proteins exhibiting previously described gene structure and protein properties. Identification of the 4/1-like proteins in hornworts, liverworts and charophyte algae (sister lineage to all land plants) but not in mosses suggests that 4/1 proteins are likely important for plant development but not required for a primary metabolic function of plant cell. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  9. Transgenic rice plants expressing synthetic cry2AX1 gene exhibits resistance to rice leaffolder (Cnaphalocrosis medinalis).

    Science.gov (United States)

    Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V

    2016-06-01

    Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T 0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T 0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T 1 progenies through Southern and ELISA. In T 1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.

  10. Genomics-Based Discovery of Plant Genes for Synthetic Biology of Terpenoid Fragrances: A Case Study in Sandalwood oil Biosynthesis.

    Science.gov (United States)

    Celedon, J M; Bohlmann, J

    2016-01-01

    Terpenoid fragrances are powerful mediators of ecological interactions in nature and have a long history of traditional and modern industrial applications. Plants produce a great diversity of fragrant terpenoid metabolites, which make them a superb source of biosynthetic genes and enzymes. Advances in fragrance gene discovery have enabled new approaches in synthetic biology of high-value speciality molecules toward applications in the fragrance and flavor, food and beverage, cosmetics, and other industries. Rapid developments in transcriptome and genome sequencing of nonmodel plant species have accelerated the discovery of fragrance biosynthetic pathways. In parallel, advances in metabolic engineering of microbial and plant systems have established platforms for synthetic biology applications of some of the thousands of plant genes that underlie fragrance diversity. While many fragrance molecules (eg, simple monoterpenes) are abundant in readily renewable plant materials, some highly valuable fragrant terpenoids (eg, santalols, ambroxides) are rare in nature and interesting targets for synthetic biology. As a representative example for genomics/transcriptomics enabled gene and enzyme discovery, we describe a strategy used successfully for elucidation of a complete fragrance biosynthetic pathway in sandalwood (Santalum album) and its reconstruction in yeast (Saccharomyces cerevisiae). We address questions related to the discovery of specific genes within large gene families and recovery of rare gene transcripts that are selectively expressed in recalcitrant tissues. To substantiate the validity of the approaches, we describe the combination of methods used in the gene and enzyme discovery of a cytochrome P450 in the fragrant heartwood of tropical sandalwood, responsible for the fragrance defining, final step in the biosynthesis of (Z)-santalols. © 2016 Elsevier Inc. All rights reserved.

  11. In planta Transformed Cumin (Cuminum cyminum L.) Plants, Overexpressing the SbNHX1 Gene Showed Enhanced Salt Endurance.

    Science.gov (United States)

    Pandey, Sonika; Patel, Manish Kumar; Mishra, Avinash; Jha, Bhavanath

    2016-01-01

    Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII) specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13), overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid), and lower electrolytic leakage, lipid peroxidation (MDA content) and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.

  12. In planta Transformed Cumin (Cuminum cyminum L. Plants, Overexpressing the SbNHX1 Gene Showed Enhanced Salt Endurance.

    Directory of Open Access Journals (Sweden)

    Sonika Pandey

    Full Text Available Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13, overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid, and lower electrolytic leakage, lipid peroxidation (MDA content and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.

  13. Evolution of melanopsin photoreceptors: discovery and characterization of a new melanopsin in nonmammalian vertebrates.

    Directory of Open Access Journals (Sweden)

    James Bellingham

    2006-07-01

    Full Text Available In mammals, the melanopsin gene (Opn4 encodes a sensory photopigment that underpins newly discovered inner retinal photoreceptors. Since its first discovery in Xenopus laevis and subsequent description in humans and mice, melanopsin genes have been described in all vertebrate classes. Until now, all of these sequences have been considered representatives of a single orthologous gene (albeit with duplications in the teleost fish. Here, we describe the discovery and functional characterisation of a new melanopsin gene in fish, bird, and amphibian genomes, demonstrating that, in fact, the vertebrates have evolved two quite separate melanopsins. On the basis of sequence similarity, chromosomal localisation, and phylogeny, we identify our new melanopsins as the true orthologs of the melanopsin gene previously described in mammals and term this grouping Opn4m. By contrast, the previously published melanopsin genes in nonmammalian vertebrates represent a separate branch of the melanopsin family which we term Opn4x. RT-PCR analysis in chicken, zebrafish, and Xenopus identifies expression of both Opn4m and Opn4x genes in tissues known to be photosensitive (eye, brain, and skin. In the day-14 chicken eye, Opn4m mRNA is found in a subset of cells in the outer nuclear, inner nuclear, and ganglion cell layers, the vast majority of which also express Opn4x. Importantly, we show that a representative of the new melanopsins (chicken Opn4m encodes a photosensory pigment capable of activating G protein signalling cascades in a light- and retinaldehyde-dependent manner under heterologous expression in Neuro-2a cells. A comprehensive in silico analysis of vertebrate genomes indicates that while most vertebrate species have both Opn4m and Opn4x genes, the latter is absent from eutherian and, possibly, marsupial mammals, lost in the course of their evolution as a result of chromosomal reorganisation. Thus, our findings show for the first time that nonmammalian

  14. Genome-wide association study identified genetic variations and candidate genes for plant architecture component traits in Chinese upland cotton.

    Science.gov (United States)

    Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun

    2018-06-01

    Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation

  15. UV-Induced Cell Death in Plants

    Science.gov (United States)

    Nawkar, Ganesh M.; Maibam, Punyakishore; Park, Jung Hoon; Sahi, Vaidurya Pratap; Lee, Sang Yeol; Kang, Chang Ho

    2013-01-01

    Plants are photosynthetic organisms that depend on sunlight for energy. Plants respond to light through different photoreceptors and show photomorphogenic development. Apart from Photosynthetically Active Radiation (PAR; 400–700 nm), plants are exposed to UV light, which is comprised of UV-C (below 280 nm), UV-B (280–320 nm) and UV-A (320–390 nm). The atmospheric ozone layer protects UV-C radiation from reaching earth while the UVR8 protein acts as a receptor for UV-B radiation. Low levels of UV-B exposure initiate signaling through UVR8 and induce secondary metabolite genes involved in protection against UV while higher dosages are very detrimental to plants. It has also been reported that genes involved in MAPK cascade help the plant in providing tolerance against UV radiation. The important targets of UV radiation in plant cells are DNA, lipids and proteins and also vital processes such as photosynthesis. Recent studies showed that, in response to UV radiation, mitochondria and chloroplasts produce a reactive oxygen species (ROS). Arabidopsis metacaspase-8 (AtMC8) is induced in response to oxidative stress caused by ROS, which acts downstream of the radical induced cell death (AtRCD1) gene making plants vulnerable to cell death. The studies on salicylic and jasmonic acid signaling mutants revealed that SA and JA regulate the ROS level and antagonize ROS mediated cell death. Recently, molecular studies have revealed genes involved in response to UV exposure, with respect to programmed cell death (PCD). PMID:23344059

  16. Phylogenetic Analysis, Lineage-Specific Expansion and Functional Divergence of seed dormancy 4-Like Genes in Plants.

    Directory of Open Access Journals (Sweden)

    Saminathan Subburaj

    Full Text Available The rice gene seed dormancy 4 (OsSdr4 functions in seed dormancy and is a major factor associated with pre-harvest sprouting (PHS. Although previous studies of this protein family were reported for rice and other species, knowledge of the evolution of genes homologous to OsSdr4 in plants remains inadequate. Fifty four Sdr4-like (hereafter designated Sdr4L genes were identified in nine plant lineages including 36 species. Phylogenetic analysis placed these genes in eight subfamilies (I-VIII. Genes from the same lineage clustered together, supported by analysis of conserved motifs and exon-intron patterns. Segmental duplications were present in both dicot and monocot clusters, while tandemly duplicated genes occurred only in monocot clusters indicating that both tandem and segmental duplications contributed to expansion of the grass I and II subfamilies. Estimation of the approximate ages of the duplication events indicated that ancestral Sdr4 genes evolved from a common angiosperm ancestor, about 160 million years ago (MYA. Moreover, diversification of Sdr4L genes in mono and dicot plants was mainly associated with genome-wide duplication and speciation events. Functional divergence was observed in all subfamily pairs, except IV/VIIIa. Further analysis indicated that functional constraints between subfamily pairs I/II, I/VIIIb, II/VI, II/VIIIb, II/IV, and VI/VIIIb were statistically significant. Site and branch-site model analyses of positive selection suggested that these genes were under strong adaptive selection pressure. Critical amino acids detected for both functional divergence and positive selection were mostly located in the loops, pointing to functional importance of these regions in this protein family. In addition, differential expression studies by transcriptome atlas of 11 Sdr4L genes showed that the duplicated genes may have undergone divergence in expression between plant species. Our findings showed that Sdr4L genes are

  17. Role of ethylene and related gene expression in the interaction between strawberry plants and the plant growth-promoting bacterium Azospirillum brasilense.

    Science.gov (United States)

    Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O

    2018-05-01

    Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society

  18. High-throughput profiling of antibiotic resistance genes in drinking water treatment plants and distribution systems.

    Science.gov (United States)

    Xu, Like; Ouyang, Weiying; Qian, Yanyun; Su, Chao; Su, Jianqiang; Chen, Hong

    2016-06-01

    Antibiotic resistance genes (ARGs) are present in surface water and often cannot be completely eliminated by drinking water treatment plants (DWTPs). Improper elimination of the ARG-harboring microorganisms contaminates the water supply and would lead to animal and human disease. Therefore, it is of utmost importance to determine the most effective ways by which DWTPs can eliminate ARGs. Here, we tested water samples from two DWTPs and distribution systems and detected the presence of 285 ARGs, 8 transposases, and intI-1 by utilizing high-throughput qPCR. The prevalence of ARGs differed in the two DWTPs, one of which employed conventional water treatments while the other had advanced treatment processes. The relative abundance of ARGs increased significantly after the treatment with biological activated carbon (BAC), raising the number of detected ARGs from 76 to 150. Furthermore, the final chlorination step enhanced the relative abundance of ARGs in the finished water generated from both DWTPs. The total enrichment of ARGs varied from 6.4-to 109.2-fold in tap water compared to finished water, among which beta-lactam resistance genes displayed the highest enrichment. Six transposase genes were detected in tap water samples, with the transposase gene TnpA-04 showing the greatest enrichment (up to 124.9-fold). We observed significant positive correlations between ARGs and mobile genetic elements (MGEs) during the distribution systems, indicating that transposases and intI-1 may contribute to antibiotic resistance in drinking water. To our knowledge, this is the first study to investigate the diversity and abundance of ARGs in drinking water treatment systems utilizing high-throughput qPCR techniques in China. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Evidence for functional convergence in genes upregulated by herbivores ingesting plant secondary compounds

    Science.gov (United States)

    2014-01-01

    Background Nearly 40 years ago, Freeland and Janzen predicted that liver biotransformation enzymes dictated diet selection by herbivores. Despite decades of research on model species and humans, little is known about the biotransformation mechanisms used by mammalian herbivores to metabolize plant secondary compounds (PSCs). We investigated the independent evolution of PSC biotransformation mechanisms by capitalizing on a dramatic diet change event—the dietary inclusion of creosote bush (Larrea tridentata)—that occurred in the recent evolutionary history of two species of woodrats (Neotoma lepida and N. bryanti). Results By comparing gene expression profiles of two populations of woodrats with evolutionary experience to creosote and one population naïve to creosote, we identified genes either induced by a diet containing creosote PSCs or constitutively higher in populations with evolutionary experience of creosote. Although only one detoxification gene (an aldo-keto reductase) was induced by both experienced populations, these populations converged upon functionally equivalent strategies to biotransform the PSCs of creosote bush by constitutively expressing aldehyde and alcohol dehydrogenases, Cytochromes P450s, methyltransferases, glutathione S-transferases and sulfotransferases. The response of the naïve woodrat population to creosote bush was indicative of extreme physiological stress. Conclusions The hepatic detoxification system of mammals is notoriously complex, with hundreds of known biotransformation enzymes. The comparison herein of woodrat taxa that differ in evolutionary and ecological experience with toxins in creosote bush reveals convergence in the overall strategies used by independent species after a historical shift in diet. In addition, remarkably few genes seemed to be important in this dietary shift. The research lays the requisite groundwork for future studies of specific biotransformation pathways used by woodrats to metabolize the

  20. Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

    Science.gov (United States)

    Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

    2000-06-01

    Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

  1. Application of a scalable plant transient gene expression platform for malaria vaccine development

    Directory of Open Access Journals (Sweden)

    Holger eSpiegel

    2015-12-01

    Full Text Available Despite decades of intensive research efforts there is currently no vaccine that provides sustained sterile immunity against malaria. In this context, a large number of targets from the different stages of the Plasmodium falciparum life cycle have been evaluated as vaccine candidates. None of these candidates has fulfilled expectations, and as long as we lack a single target that induces strain-transcending protective immune responses, combining key antigens from different life cycle stages seems to be the most promising route towards the development of efficacious malaria vaccines. After the identification of potential targets using approaches such as omics-based technology and reverse immunology, the rapid expression, purification and characterization of these proteins, as well as the generation and analysis of fusion constructs combining different promising antigens or antigen domains before committing to expensive and time consuming clinical development, represents one of the bottlenecks in the vaccine development pipeline. The production of recombinant proteins by transient gene expression in plants is a robust and versatile alternative to cell-based microbial and eukaryotic production platforms. The transfection of plant tissues and/or whole plants using Agrobacterium tumefaciens offers a low technical entry barrier, low costs and a high degree of flexibility embedded within a rapid and scalable workflow. Recombinant proteins can easily be targeted to different subcellular compartments according to their physicochemical requirements, including post-translational modifications, to ensure optimal yields of high quality product, and to support simple and economical downstream processing. Here we demonstrate the use of a plant transient expression platform based on transfection with A. tumefaciens as essential component of a malaria vaccine development workflow involving screens for expression, solubility and stability using fluorescent fusion

  2. Insights into the evolution and diversification of the AT-hook Motif Nuclear Localized gene family in land plants.

    Science.gov (United States)

    Zhao, Jianfei; Favero, David S; Qiu, Jiwen; Roalson, Eric H; Neff, Michael M

    2014-10-14

    Members of the ancient land-plant-specific transcription factor AT-Hook Motif Nuclear Localized (AHL) gene family regulate various biological processes. However, the relationships among the AHL genes, as well as their evolutionary history, still remain unexplored. We analyzed over 500 AHL genes from 19 land plant species, ranging from the early diverging Physcomitrella patens and Selaginella to a variety of monocot and dicot flowering plants. We classified the AHL proteins into three types (Type-I/-II/-III) based on the number and composition of their functional domains, the AT-hook motif(s) and PPC domain. We further inferred their phylogenies via Bayesian inference analysis and predicted gene gain/loss events throughout their diversification. Our analyses suggested that the AHL gene family emerged in embryophytes and further evolved into two distinct clades, with Type-I AHLs forming one clade (Clade-A), and the other two types together diversifying in another (Clade-B). The two AHL clades likely diverged before the separation of Physcomitrella patens from the vascular plant lineage. In angiosperms, Clade-A AHLs expanded into 5 subfamilies; while, the ones in Clade-B expanded into 4 subfamilies. Examination of their expression patterns suggests that the AHLs within each clade share similar expression patterns with each other; however, AHLs in one monophyletic clade exhibit distinct expression patterns from the ones in the other cla