WorldWideScience

Sample records for plant homeobox genes

  1. A Comprehensive Classification and Evolutionary Analysis of Plant Homeobox Genes

    OpenAIRE

    Mukherjee, Krishanu; Brocchieri, Luciano; B?rglin, Thomas R.

    2009-01-01

    The full complement of homeobox transcription factor sequences, including genes and pseudogenes, was determined from the analysis of 10 complete genomes from flowering plants, moss, Selaginella, unicellular green algae, and red algae. Our exhaustive genome-wide searches resulted in the discovery in each class of a greater number of homeobox genes than previously reported. All homeobox genes can be unambiguously classified by sequence evolutionary analysis into 14 distinct classes also charact...

  2. Evolution of homeobox genes.

    Science.gov (United States)

    Holland, Peter W H

    2013-01-01

    Many homeobox genes encode transcription factors with regulatory roles in animal and plant development. Homeobox genes are found in almost all eukaryotes, and have diversified into 11 gene classes and over 100 gene families in animal evolution, and 10 to 14 gene classes in plants. The largest group in animals is the ANTP class which includes the well-known Hox genes, plus other genes implicated in development including ParaHox (Cdx, Xlox, Gsx), Evx, Dlx, En, NK4, NK3, Msx, and Nanog. Genomic data suggest that the ANTP class diversified by extensive tandem duplication to generate a large array of genes, including an NK gene cluster and a hypothetical ProtoHox gene cluster that duplicated to generate Hox and ParaHox genes. Expression and functional data suggest that NK, Hox, and ParaHox gene clusters acquired distinct roles in patterning the mesoderm, nervous system, and gut. The PRD class is also diverse and includes Pax2/5/8, Pax3/7, Pax4/6, Gsc, Hesx, Otx, Otp, and Pitx genes. PRD genes are not generally arranged in ancient genomic clusters, although the Dux, Obox, and Rhox gene clusters arose in mammalian evolution as did several non-clustered PRD genes. Tandem duplication and genome duplication expanded the number of homeobox genes, possibly contributing to the evolution of developmental complexity, but homeobox gene loss must not be ignored. Evolutionary changes to homeobox gene expression have also been documented, including Hox gene expression patterns shifting in concert with segmental diversification in vertebrates and crustaceans, and deletion of a Pitx1 gene enhancer in pelvic-reduced sticklebacks. WIREs Dev Biol 2013, 2:31-45. doi: 10.1002/wdev.78 For further resources related to this article, please visit the WIREs website. The author declares that he has no conflicts of interest. Copyright © 2012 Wiley Periodicals, Inc.

  3. Control of plant architecture by distinctive TALE homeobox gene interactions

    NARCIS (Netherlands)

    Bao, D.|info:eu-repo/dai/nl/304838063

    2009-01-01

    In eukaryotes, transcription factor (TF)-based network is a widely used mechanism to regulate fundamental developmental processes. Both animals and plants utilize three-amino-acid-loop-extension (TALE) homeodomain (HD) transcription factors to subdivide their body plan. In animals, MEIS/PBC TF

  4. Homeobox genes and melatonin synthesis

    DEFF Research Database (Denmark)

    Rohde, Kristian; Møller, Morten; Rath, Martin Fredensborg

    2014-01-01

    Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a cAMP-based indu......Nocturnal synthesis of melatonin in the pineal gland is controlled by a circadian rhythm in arylalkylamine N-acetyltransferase (AANAT) enzyme activity. In the rodent, Aanat gene expression displays a marked circadian rhythm; release of norepinephrine in the gland at night causes a c......AMP-based induction of Aanat transcription. However, additional transcriptional control mechanisms exist. Homeobox genes, which are generally known to encode transcription factors controlling developmental processes, are also expressed in the mature rodent pineal gland. Among these, the cone-rod homeobox (CRX......) transcription factor is believed to control pineal-specific Aanat expression. Based on recent advances in our understanding of Crx in the rodent pineal gland, we here suggest that homeobox genes play a role in adult pineal physiology both by ensuring pineal-specific Aanat expression and by facilitating c...

  5. Homeobox Genes in the Rodent Pineal Gland

    DEFF Research Database (Denmark)

    Rath, Martin Fredensborg; Rohde, Kristian; Klein, David C

    2013-01-01

    The pineal gland is a neuroendocrine gland responsible for nocturnal synthesis of melatonin. During early development of the rodent pineal gland from the roof of the diencephalon, homeobox genes of the orthodenticle homeobox (Otx)- and paired box (Pax)-families are expressed and are essential...... for normal pineal development consistent with the well-established role that homeobox genes play in developmental processes. However, the pineal gland appears to be unusual because strong homeobox gene expression persists in the pineal gland of the adult brain. Accordingly, in addition to developmental...... functions, homeobox genes appear to be key regulators in postnatal phenotype maintenance in this tissue. In this paper, we review ontogenetic and phylogenetic aspects of pineal development and recent progress in understanding the involvement of homebox genes in rodent pineal development and adult function...

  6. Homeobox gene expression in Brachiopoda

    DEFF Research Database (Denmark)

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas

    2011-01-01

    (ectoderm) specification with co-opted functions in notochord formation in chordates and left/right determination in ambulacrarians and vertebrates. The caudal ortholog, TtrCdx, is first expressed in the ectoderm of the gastrulating embryo in the posterior region of the blastopore. Its expression stays......The molecular control that underlies brachiopod ontogeny is largely unknown. In order to contribute to this issue we analyzed the expression pattern of two homeobox containing genes, Not and Cdx, during development of the rhynchonelliform (i.e., articulate) brachiopod Terebratalia transversa...... completion of larval development, which is marked by a three-lobed body with larval setae. Expression starts at gastrulation in two areas lateral to the blastopore and subsequently extends over the animal pole of the gastrula. With elongation of the gastrula, expression at the animal pole narrows to a small...

  7. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  8. Control of plant architecture by the TALE homeobox genes ATH1 and PENNYWISE

    NARCIS (Netherlands)

    Rutjens, B.P.W.

    2007-01-01

    In plants, pattern formation is an ongoing process that starts during embryogenesis and lasts the entire life span. Most of the plant adult body is formed post-embryonically by continuous organogenic potential of the root and shoot meristems. Proper shoot apical meristem (SAM) function requires

  9. Classification and expression analyses of homeobox genes from ...

    Indian Academy of Sciences (India)

    We present here the first genome-wide classification and comparative genomic analysis of the 14 homeobox genes present in D. discoideum. Based on the structural alignment of the homeodomains, they can be broadly divided into TALE and non-TALE classes. When individual homeobox genes were compared with ...

  10. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  11. Planarian homeobox genes: cloning, sequence analysis, and expression.

    Science.gov (United States)

    Garcia-Fernàndez, J; Baguñà, J; Saló, E

    1991-01-01

    Freshwater planarians (Platyhelminthes, Turbellaria, and Tricladida) are acoelomate, triploblastic, unsegmented, and bilaterally symmetrical organisms that are mainly known for their ample power to regenerate a complete organism from a small piece of their body. To identify potential pattern-control genes in planarian regeneration, we have isolated two homeobox-containing genes, Dth-1 and Dth-2 [Dugesia (Girardia) tigrina homeobox], by using degenerate oligonucleotides corresponding to the most conserved amino acid sequence from helix-3 of the homeodomain. Dth-1 and Dth-2 homeodomains are closely related (68% at the nucleotide level and 78% at the protein level) and show the conserved residues characteristic of the homeodomains identified to data. Similarity with most homeobox sequences is low (30-50%), except with Drosophila NK homeodomains (80-82% with NK-2) and the rodent TTF-1 homeodomain (77-87%). Some unusual amino acid residues specific to NK-2, TTF-1, Dth-1, and Dth-2 can be observed in the recognition helix (helix-3) and may define a family of homeodomains. The deduced amino acid sequences from the cDNAs contain, in addition to the homeodomain, other domains also present in various homeobox-containing genes. The expression of both genes, detected by Northern blot analysis, appear slightly higher in cephalic regions than in the rest of the intact organism, while a slight increase is detected in the central period (5 days) or regeneration. Images PMID:1714599

  12. A TALE of shrimps: Genome-wide survey of homeobox genes in 120 species from diverse crustacean taxa.

    Science.gov (United States)

    Chang, Wai Hoong; Lai, Alvina G

    2018-01-01

    The homeodomain-containing proteins are an important group of transcription factors found in most eukaryotes including animals, plants and fungi. Homeobox genes are responsible for a wide range of critical developmental and physiological processes, ranging from embryonic development, innate immune homeostasis to whole-body regeneration. With continued fascination on this key class of proteins by developmental and evolutionary biologists, multiple efforts have thus far focused on the identification and characterization of homeobox orthologs from key model organisms in attempts to infer their evolutionary origin and how this underpins the evolution of complex body plans. Despite their importance, the genetic complement of homeobox genes has yet been described in one of the most valuable groups of animals representing economically important food crops. With crustacean aquaculture being a growing industry worldwide, it is clear that systematic and cross-species identification of crustacean homeobox orthologs is necessary in order to harness this genetic circuitry for the improvement of aquaculture sustainability. Using publicly available transcriptome data sets, we identified a total of 4183 putative homeobox genes from 120 crustacean species that include food crop species, such as lobsters, shrimps, crayfish and crabs. Additionally, we identified 717 homeobox orthologs from 6 other non-crustacean arthropods, which include the scorpion, deer tick, mosquitoes and centipede. This high confidence set of homeobox genes will now serve as a key resource to the broader community for future functional and comparative genomics studies.

  13. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  14. Identification and Characterization of TALE Homeobox Genes in the Endangered Fern Vandenboschia speciosa.

    Science.gov (United States)

    Ruiz-Estévez, Mercedes; Bakkali, Mohammed; Martín-Blázquez, Rubén; Garrido-Ramos, Manuel A

    2017-10-17

    We report and discuss the results of a quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of the expression patterns of seven three amino acid loop extension ( TALE ) homeobox genes (four KNOTTED-like homeobox ( KNOX ) and three BEL1-like homeobox ( BELL ) genes) identified after next generation sequencing (NGS) and assembly of the sporophyte and gametophyte transcriptomes of the endangered fern species Vandenboschia speciosa . Among the four KNOX genes, two belonged to the KNOX1 class and the other two belonged to the KNOX2 class. Analysis of the deduced amino acid sequences supported the typical domain structure of both types of TALE proteins, and the homology to TALE proteins of mosses, lycophytes, and seed plant species. The expression analyses demonstrate that these homeodomain proteins appear to have a key role in the establishment and development of the gametophyte and sporophyte phases of V. speciosa lifecycle, as well as in the control of the transition between both phases. Vandenboschia speciosa VsKNAT3 (a KNOX2 class protein) as well as VsBELL4 and VsBELL10 proteins have higher expression levels during the sporophyte program. On the contrary, one V. speciosa KNOX1 protein (VsKNAT6) and one KNOX2 protein (VsKNAT4) seem important during the development of the gametophyte phase. TALE homeobox genes might be among the key regulators in the gametophyte-to-sporophyte developmental transition in regular populations that show alternation of generations, since some of the genes analyzed here ( VsKNAT3 , VsKNAT6 , VsBELL4 , and VsBELL6 ) are upregulated in a non-alternating population in which only independent gametophytes are found (they grow by vegetative reproduction outside of the range of sporophyte distribution). Thus, these four genes might trigger the vegetative propagation of the gametophyte and the repression of the sexual development in populations composed of independent gametophytes. This study represents a comprehensive

  15. The homeobox BcHOX8 gene in Botrytis cinerea regulates vegetative growth and morphology.

    Directory of Open Access Journals (Sweden)

    Zsuzsanna Antal

    Full Text Available Filamentous growth and the capacity at producing conidia are two critical aspects of most fungal life cycles, including that of many plant or animal pathogens. Here, we report on the identification of a homeobox transcription factor encoding gene that plays a role in these two particular aspects of the development of the phytopathogenic fungus Botrytis cinerea. Deletion of the BcHOX8 gene in both the B. cinerea B05-10 and T4 strains causes similar phenotypes, among which a curved, arabesque-like, hyphal growth on hydrophobic surfaces; the mutants were hence named Arabesque. Expression of the BcHOX8 gene is higher in conidia and infection cushions than in developing appressorium or mycelium. In the Arabesque mutants, colony growth rate is reduced and abnormal infection cushions are produced. Asexual reproduction is also affected with abnormal conidiophore being formed, strongly reduced conidia production and dramatic changes in conidial morphology. Finally, the mutation affects the fungus ability to efficiently colonize different host plants. Analysis of the B. cinerea genome shows that BcHOX8 is one member of a nine putative homeobox genes family. Available gene expression data suggest that these genes are functional and sequence comparisons indicate that two of them would be specific to B. cinerea and its close relative Sclerotinia sclerotiorum.

  16. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  17. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  18. A TALE of shrimps: Genome-wide survey of homeobox genes in 120 species from diverse crustacean taxa [version 1; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Wai Hoong Chang

    2018-01-01

    Full Text Available The homeodomain-containing proteins are an important group of transcription factors found in most eukaryotes including animals, plants and fungi. Homeobox genes are responsible for a wide range of critical developmental and physiological processes, ranging from embryonic development, innate immune homeostasis to whole-body regeneration. With continued fascination on this key class of proteins by developmental and evolutionary biologists, multiple efforts have thus far focused on the identification and characterization of homeobox orthologs from key model organisms in attempts to infer their evolutionary origin and how this underpins the evolution of complex body plans. Despite their importance, the genetic complement of homeobox genes has yet been described in one of the most valuable groups of animals representing economically important food crops. With crustacean aquaculture being a growing industry worldwide, it is clear that systematic and cross-species identification of crustacean homeobox orthologs is necessary in order to harness this genetic circuitry for the improvement of aquaculture sustainability. Using publicly available transcriptome data sets, we identified a total of 4183 putative homeobox genes from 120 crustacean species that include food crop species, such as lobsters, shrimps, crayfish and crabs. Additionally, we identified 717 homeobox orthologs from 6 other non-crustacean arthropods, which include the scorpion, deer tick, mosquitoes and centipede. This high confidence set of homeobox genes will now serve as a key resource to the broader community for future functional and comparative genomics studies.

  19. Extensive expression of craniofacial related homeobox genes in canine mammary sarcomas

    NARCIS (Netherlands)

    Wensman, H.; Goransson, H.; Leuchowius, K.J.; Stromberg, S.; Ponten, F.; Isaksson, A.; Rutteman, G.R.; Heldin, N.; Pejler, G.; Hellmen, E.

    2009-01-01

    Extensive expression of craniofacial related homeobox genes in canine mammary sarcomas Journal Breast Cancer Research and Treatment Publisher Springer Netherlands ISSN 0167-6806 (Print) 1573-7217 (Online) Issue Volume 118, Number 2 / November, 2009 Category Preclinical Study DOI

  20. Conservation of gene linkage in dispersed vertebrate NK homeobox clusters.

    Science.gov (United States)

    Wotton, Karl R; Weierud, Frida K; Juárez-Morales, José L; Alvares, Lúcia E; Dietrich, Susanne; Lewis, Katharine E

    2009-10-01

    Nk homeobox genes are important regulators of many different developmental processes including muscle, heart, central nervous system and sensory organ development. They are thought to have arisen as part of the ANTP megacluster, which also gave rise to Hox and ParaHox genes, and at least some NK genes remain tightly linked in all animals examined so far. The protostome-deuterostome ancestor probably contained a cluster of nine Nk genes: (Msx)-(Nk4/tinman)-(Nk3/bagpipe)-(Lbx/ladybird)-(Tlx/c15)-(Nk7)-(Nk6/hgtx)-(Nk1/slouch)-(Nk5/Hmx). Of these genes, only NKX2.6-NKX3.1, LBX1-TLX1 and LBX2-TLX2 remain tightly linked in humans. However, it is currently unclear whether this is unique to the human genome as we do not know which of these Nk genes are clustered in other vertebrates. This makes it difficult to assess whether the remaining linkages are due to selective pressures or because chance rearrangements have "missed" certain genes. In this paper, we identify all of the paralogs of these ancestrally clustered NK genes in several distinct vertebrates. We demonstrate that tight linkages of Lbx1-Tlx1, Lbx2-Tlx2 and Nkx3.1-Nkx2.6 have been widely maintained in both the ray-finned and lobe-finned fish lineages. Moreover, the recently duplicated Hmx2-Hmx3 genes are also tightly linked. Finally, we show that Lbx1-Tlx1 and Hmx2-Hmx3 are flanked by highly conserved noncoding elements, suggesting that shared regulatory regions may have resulted in evolutionary pressure to maintain these linkages. Consistent with this, these pairs of genes have overlapping expression domains. In contrast, Lbx2-Tlx2 and Nkx3.1-Nkx2.6, which do not seem to be coexpressed, are also not associated with conserved noncoding sequences, suggesting that an alternative mechanism may be responsible for the continued clustering of these genes.

  1. Origins and Evolution of WUSCHEL-Related Homeobox Protein Family in Plant Kingdom

    Directory of Open Access Journals (Sweden)

    Gaibin Lian

    2014-01-01

    Full Text Available WUSCHEL-related homeobox (WOX is a large group of transcription factors specifically found in plants. WOX members contain the conserved homeodomain essential for plant development by regulating cell division and differentiation. However, the evolutionary relationship of WOX members in plant kingdom remains to be elucidated. In this study, we searched 350 WOX members from 50 species in plant kingdom. Linkage analysis of WOX protein sequences demonstrated that amino acid residues 141–145 and 153–160 located in the homeodomain are possibly associated with the function of WOXs during the evolution. These 350 members were grouped into 3 clades: the first clade represents the conservative WOXs from the lower plant algae to higher plants; the second clade has the members from vascular plant species; the third clade has the members only from spermatophyte species. Furthermore, among the members of Arabidopsis thaliana and Oryza sativa, we observed ubiquitous expression of genes in the first clade and the diversified expression pattern of WOX genes in distinct organs in the second clade and the third clade. This work provides insight into the origin and evolutionary process of WOXs, facilitating their functional investigations in the future.

  2. Aberrant activity of NKL homeobox gene NKX3-2 in a T-ALL subset

    Science.gov (United States)

    Meyer, Corinna; Kaufmann, Maren; Zaborski, Margarete; MacLeod, Roderick A. F.; Drexler, Hans G.

    2018-01-01

    T-cell acute lymphoblastic leukemia (T-ALL) is a hematopoietic malignancy originating from T-cell progenitors in which differentiation is blocked at early stages. Physiological expression of specific NKL homeobox genes obeys a hematopoietic NKL-code implicated in the process of lymphopoiesis while in differentiated T-cells these genes are silenced. We propose that this developmental expression pattern underlies the observation that NKL homeobox genes are the most ubiquitous group of transcription factors deregulated in T-ALL, including TLX1, TLX3, NKX2-5 and NKX3-1. Here, we describe a novel member of the NKL homeobox gene subclass, NKX3-2 (BAPX1), which is aberrantly activated in 18% of pediatric T-ALL patients analyzed while being normally expressed in developing spleen. Identification of NKX3-2 expression in T-ALL cell line CCRF-CEM qualified these cells to model its deregulation and function in a leukemic context. Genomic and chromosomal analyses demonstrated normal configuration of the NKX3-2 locus at chromosome 4p15, thus excluding cytogenetic dysregulation. Comparative expression profiling analysis of NKX3-2 patient data revealed deregulated activity of BMP- and MAPK-signalling. These candidate pathways were experimentally confirmed to mediate aberrant NKX3-2 expression. We also show that homeobox gene SIX6, plus MIR17HG and GATA3 are downstream targets of NKX3-2 and plausibly contribute to the pathogenesis of this malignancy by suppressing T-cell differentiation. Finally, NKL homeobox gene NKX2-5 was activated by NKX3-2 in CCRF-CEM and by FOXG1 in PEER, representing mutually inhibitory activators of this translocated oncogene. Together, our findings reveal a novel oncogenic NKL homeobox gene subclass member which is aberrantly expressed in a large subset of T-ALL patients and participates in a deregulated gene network likely to arise in developing spleen. PMID:29746601

  3. The Aspergillus flavus Homeobox Gene, hbx1, Is Required for Development and Aflatoxin Production

    Directory of Open Access Journals (Sweden)

    Jeffrey W. Cary

    2017-10-01

    Full Text Available Homeobox proteins, a class of well conserved transcription factors, regulate the expression of targeted genes, especially those involved in development. In filamentous fungi, homeobox genes are required for normal conidiogenesis and fruiting body formation. In the present study, we identified eight homeobox (hbx genes in the aflatoxin-producing ascomycete, Aspergillus flavus, and determined their respective role in growth, conidiation and sclerotial production. Disruption of seven of the eight genes had little to no effect on fungal growth and development. However, disruption of the homeobox gene AFLA_069100, designated as hbx1, in two morphologically different A. flavus strains, CA14 and AF70, resulted in complete loss of production of conidia and sclerotia as well as aflatoxins B1 and B2, cyclopiazonic acid and aflatrem. Microscopic examination showed that the Δhbx1 mutants did not produce conidiophores. The inability of Δhbx1 mutants to produce conidia was related to downregulation of brlA (bristle and abaA (abacus, regulatory genes for conidiophore development. These mutants also had significant downregulation of the aflatoxin pathway biosynthetic genes aflC, aflD, aflM and the cluster-specific regulatory gene, aflR. Our results demonstrate that hbx1 not only plays a significant role in controlling A. flavus development but is also critical for the production of secondary metabolites, such as aflatoxins.

  4. Calcisponges have a ParaHox gene and dynamic expression of dispersed NK homeobox genes.

    Science.gov (United States)

    Fortunato, Sofia A V; Adamski, Marcin; Ramos, Olivia Mendivil; Leininger, Sven; Liu, Jing; Ferrier, David E K; Adamska, Maja

    2014-10-30

    Sponges are simple animals with few cell types, but their genomes paradoxically contain a wide variety of developmental transcription factors, including homeobox genes belonging to the Antennapedia (ANTP) class, which in bilaterians encompass Hox, ParaHox and NK genes. In the genome of the demosponge Amphimedon queenslandica, no Hox or ParaHox genes are present, but NK genes are linked in a tight cluster similar to the NK clusters of bilaterians. It has been proposed that Hox and ParaHox genes originated from NK cluster genes after divergence of sponges from the lineage leading to cnidarians and bilaterians. On the other hand, synteny analysis lends support to the notion that the absence of Hox and ParaHox genes in Amphimedon is a result of secondary loss (the ghost locus hypothesis). Here we analysed complete suites of ANTP-class homeoboxes in two calcareous sponges, Sycon ciliatum and Leucosolenia complicata. Our phylogenetic analyses demonstrate that these calcisponges possess orthologues of bilaterian NK genes (Hex, Hmx and Msx), a varying number of additional NK genes and one ParaHox gene, Cdx. Despite the generation of scaffolds spanning multiple genes, we find no evidence of clustering of Sycon NK genes. All Sycon ANTP-class genes are developmentally expressed, with patterns suggesting their involvement in cell type specification in embryos and adults, metamorphosis and body plan patterning. These results demonstrate that ParaHox genes predate the origin of sponges, thus confirming the ghost locus hypothesis, and highlight the need to analyse the genomes of multiple sponge lineages to obtain a complete picture of the ancestral composition of the first animal genome.

  5. The Lhx9 homeobox gene controls pineal gland development and prevents postnatal hydrocephalus

    DEFF Research Database (Denmark)

    Yamazaki, Fumiyoshi; Møller, Morten; Fu, Cong

    2015-01-01

    Lhx9 is a member of the LIM homeobox gene family. It is expressed during mammalian embryogenesis in the brain including the pineal gland. Deletion of Lhx9 results in sterility due to failure of gonadal development. The current study was initiated to investigate Lhx9 biology in the pineal gland. Lhx...

  6. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Directory of Open Access Journals (Sweden)

    Evelyne Coppin

    Full Text Available Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  7. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Science.gov (United States)

    Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

    2012-01-01

    Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  8. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Classification and expression analyses of homeobox genes from ...

    Indian Academy of Sciences (India)

    2015-04-27

    Apr 27, 2015 ... Supplementary materials pertaining to this article are available on the Journal of Biosciences Website at .... Bank (PDB) was used as a template and the quality of the model was ... different genes and also to place them in a framework that ..... Kim JS, Seo JH, Yim HS and Kang SO 2011 Homeoprotein Hbx4.

  10. AP-2α and AP-2β cooperatively orchestrate homeobox gene expression during branchial arch patterning.

    Science.gov (United States)

    Van Otterloo, Eric; Li, Hong; Jones, Kenneth L; Williams, Trevor

    2018-01-25

    The evolution of a hinged moveable jaw with variable morphology is considered a major factor behind the successful expansion of the vertebrates. DLX homeobox transcription factors are crucial for establishing the positional code that patterns the mandible, maxilla and intervening hinge domain, but how the genes encoding these proteins are regulated remains unclear. Herein, we demonstrate that the concerted action of the AP-2α and AP-2β transcription factors within the mouse neural crest is essential for jaw patterning. In the absence of these two proteins, the hinge domain is lost and there are alterations in the size and patterning of the jaws correlating with dysregulation of homeobox gene expression, with reduced levels of Emx, Msx and Dlx paralogs accompanied by an expansion of Six1 expression. Moreover, detailed analysis of morphological features and gene expression changes indicate significant overlap with various compound Dlx gene mutants. Together, these findings reveal that the AP-2 genes have a major function in mammalian neural crest development, influencing patterning of the craniofacial skeleton via the DLX code, an effect that has implications for vertebrate facial evolution, as well as for human craniofacial disorders. © 2018. Published by The Company of Biologists Ltd.

  11. Msx homeobox genes inhibit differentiation through upregulation of cyclin D1.

    Science.gov (United States)

    Hu, G; Lee, H; Price, S M; Shen, M M; Abate-Shen, C

    2001-06-01

    During development, patterning and morphogenesis of tissues are intimately coordinated through control of cellular proliferation and differentiation. We describe a mechanism by which vertebrate Msx homeobox genes inhibit cellular differentiation by regulation of the cell cycle. We show that misexpression of Msx1 via retroviral gene transfer inhibits differentiation of multiple mesenchymal and epithelial progenitor cell types in culture. This activity of Msx1 is associated with its ability to upregulate cyclin D1 expression and Cdk4 activity, while Msx1 has minimal effects on cellular proliferation. Transgenic mice that express Msx1 under the control of the mouse mammary tumor virus long terminal repeat (MMTV LTR) display impaired differentiation of the mammary epithelium during pregnancy, which is accompanied by elevated levels of cyclin D1 expression. We propose that Msx1 gene expression maintains cyclin D1 expression and prevents exit from the cell cycle, thereby inhibiting terminal differentiation of progenitor cells. Our model provides a framework for reconciling the mutant phenotypes of Msx and other homeobox genes with their functions as regulators of cellular proliferation and differentiation during embryogenesis.

  12. Expansion of TALE homeobox genes and the evolution of spiralian development.

    Science.gov (United States)

    Morino, Yoshiaki; Hashimoto, Naoki; Wada, Hiroshi

    2017-12-01

    Spiralians, including molluscs, annelids and platyhelminths, share a unique development process that includes the typical geometry of early cleavage and early segregation of cell fate in blastomeres along the animal-vegetal axis. However, the molecular mechanisms underlying this early cell fate segregation are largely unknown. Here, we report spiralian-specific expansion of the three-amino-acid loop extension (TALE) class of homeobox genes. During early development, some of these TALE genes are expressed in staggered domains along the animal-vegetal axis in the limpet Nipponacmea fuscoviridis and the polychaete Spirobranchus kraussii. Inhibition or overexpression of these genes alters the developmental fate of blastomeres, as predicted by the gene expression patterns. These results suggest that the expansion of novel TALE genes plays a critical role in the establishment of a novel cell fate segregation mechanism in spiralians.

  13. Altered epigenetic regulation of homeobox genes in human oral squamous cell carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Marcinkiewicz, Katarzyna M.; Gudas, Lorraine J., E-mail: ljgudas@med.cornell.edu

    2014-01-01

    To gain insight into oral squamous cell carcinogenesis, we performed deep sequencing (RNAseq) of non-tumorigenic human OKF6-TERT1R and tumorigenic SCC-9 cells. Numerous homeobox genes are differentially expressed between OKF6-TERT1R and SCC-9 cells. Data from Oncomine, a cancer microarray database, also show that homeobox (HOX) genes are dysregulated in oral SCC patients. The activity of Polycomb repressive complexes (PRC), which causes epigenetic modifications, and retinoic acid (RA) signaling can control HOX gene transcription. HOXB7, HOXC10, HOXC13, and HOXD8 transcripts are higher in SCC-9 than in OKF6-TERT1R cells; using ChIP (chromatin immunoprecipitation) we detected PRC2 protein SUZ12 and the epigenetic H3K27me3 mark on histone H3 at these genes in OKF6-TERT1R, but not in SCC-9 cells. In contrast, IRX1, IRX4, SIX2 and TSHZ3 transcripts are lower in SCC-9 than in OKF6-TERT1R cells. We detected SUZ12 and the H3K27me3 mark at these genes in SCC-9, but not in OKF6-TERT1R cells. SUZ12 depletion increased HOXB7, HOXC10, HOXC13, and HOXD8 transcript levels and decreased the proliferation of OKF6-TERT1R cells. Transcriptional responses to RA are attenuated in SCC-9 versus OKF6-TERT1R cells. SUZ12 and H3K27me3 levels were not altered by RA at these HOX genes in SCC-9 and OKF6-TERT1R cells. We conclude that altered activity of PRC2 is associated with dysregulation of homeobox gene expression in human SCC cells, and that this dysregulation potentially plays a role in the neoplastic transformation of oral keratinocytes. - Highlights: • RNAseq elucidates differences between non-tumorigenic and tumorigenic oral keratinocytes. • Changes in HOX mRNA in SCC-9 vs. OKF6-TERT1R cells are a result of altered epigenetic regulation. • RNAseq shows that retinoic acid (RA) influences gene expression in both OKF6-TERT1R and SCC-9 cells.

  14. Altered epigenetic regulation of homeobox genes in human oral squamous cell carcinoma cells

    International Nuclear Information System (INIS)

    Marcinkiewicz, Katarzyna M.; Gudas, Lorraine J.

    2014-01-01

    To gain insight into oral squamous cell carcinogenesis, we performed deep sequencing (RNAseq) of non-tumorigenic human OKF6-TERT1R and tumorigenic SCC-9 cells. Numerous homeobox genes are differentially expressed between OKF6-TERT1R and SCC-9 cells. Data from Oncomine, a cancer microarray database, also show that homeobox (HOX) genes are dysregulated in oral SCC patients. The activity of Polycomb repressive complexes (PRC), which causes epigenetic modifications, and retinoic acid (RA) signaling can control HOX gene transcription. HOXB7, HOXC10, HOXC13, and HOXD8 transcripts are higher in SCC-9 than in OKF6-TERT1R cells; using ChIP (chromatin immunoprecipitation) we detected PRC2 protein SUZ12 and the epigenetic H3K27me3 mark on histone H3 at these genes in OKF6-TERT1R, but not in SCC-9 cells. In contrast, IRX1, IRX4, SIX2 and TSHZ3 transcripts are lower in SCC-9 than in OKF6-TERT1R cells. We detected SUZ12 and the H3K27me3 mark at these genes in SCC-9, but not in OKF6-TERT1R cells. SUZ12 depletion increased HOXB7, HOXC10, HOXC13, and HOXD8 transcript levels and decreased the proliferation of OKF6-TERT1R cells. Transcriptional responses to RA are attenuated in SCC-9 versus OKF6-TERT1R cells. SUZ12 and H3K27me3 levels were not altered by RA at these HOX genes in SCC-9 and OKF6-TERT1R cells. We conclude that altered activity of PRC2 is associated with dysregulation of homeobox gene expression in human SCC cells, and that this dysregulation potentially plays a role in the neoplastic transformation of oral keratinocytes. - Highlights: • RNAseq elucidates differences between non-tumorigenic and tumorigenic oral keratinocytes. • Changes in HOX mRNA in SCC-9 vs. OKF6-TERT1R cells are a result of altered epigenetic regulation. • RNAseq shows that retinoic acid (RA) influences gene expression in both OKF6-TERT1R and SCC-9 cells

  15. Chicken homeobox gene Msx-1: structure, expression in limb buds and effect of retinoic acid.

    Science.gov (United States)

    Yokouchi, Y; Ohsugi, K; Sasaki, H; Kuroiwa, A

    1991-10-01

    A chicken gene carrying a homeobox highly homologous to the Drosophila muscle segment homeobox (msh) gene was isolated and designated as Msx-1. Conceptual translation from the longest ORF gave a protein of 259 amino acids lacking the conserved hexapeptide. Northern analysis detected a single 2.6 kb transcript. As early as day 2 of incubation, the transcript was detected but was not found in adult tissue. In situ hybridization analysis revealed that Msx-1 expression is closely related to a particular mesenchymal cell lineage during limb bud formation. In early stage embryos, Msx-1 was expressed in the somatopleure. When primordial mesenchyme cells for limb bud were generated from the Wolffian ridge of the somatopleure, Msx-1 expression began to diminish in the posterior half of the limb bud then in the presumptive cartilage-forming mesenchyme. In developing limb buds, remarkable expression was seen in the apical ectodermal ridge (AER), which is responsible for the sustained outgrowth and development of the limb. The Msx-1 transcripts were found in the limb mesenchymal cells in the region covering the necrotic zone and ectodermal cells overlying such mesenchymal cells. Both ectodermal and mesenchymal expression in limb bud were rapidly suppressed by local treatment of retinoic acid which can generate mirror-image duplication of digits. This indicates that retinoic acid alters the marginal presumptive non-cartilage forming mesenchyme cell lineage through suppression of Msx-1 expression.

  16. The homeobox gene Msx in development and transdifferentiation of jellyfish striated muscle.

    Science.gov (United States)

    Galle, Sabina; Yanze, Nathalie; Seipel, Katja

    2005-01-01

    Bilaterian Msx homeobox genes are generally expressed in areas of cell proliferation and in association with multipotent progenitor cells. Likewise, jellyfish Msx is expressed in progenitor cells of the developing entocodon, a cell layer giving rise to the striated and smooth muscles of the medusa. However, in contrast to the bilaterian homologs, Msx gene expression is maintained at high levels in the differentiated striated muscle of the medusa in vivo and in vitro. This tissue exhibits reprogramming competence. Upon induction, the Msx gene is immediately switched off in the isolated striated muscle undergoing transdifferentiation, to be upregulated again in the emerging smooth muscle cells which, in a stem cell like manner, undergo quantal cell divisions producing two cell types, a proliferating smooth muscle cell and a differentiating nerve cell. This study indicates that the Msx protein may be a key component of the reprogramming machinery responsible for the extraordinary transdifferentation and regeneration potential of striated muscle in the hydrozoan jellyfish.

  17. Epidermal dysplasia and abnormal hair follicles in transgenic mice overexpressing homeobox gene MSX-2.

    Science.gov (United States)

    Jiang, T X; Liu, Y H; Widelitz, R B; Kundu, R K; Maxson, R E; Chuong, C M

    1999-08-01

    The homeobox gene Msx-2 is expressed specifically in sites of skin appendage formation. To explore its part in skin morphogenesis, we produced transgenic mice expressing Msx-2 under the control of the cytomegalovirus promoter. The skin of these transgenic mice was flaky, exhibiting desquamation and shorter hairs. Histologic analysis showed thickened epidermis with hyperproliferation, which was restricted to the basal layer. Hyperkeratosis was also evident. A wide zone of suprabasal cells were misaligned and coexpressed keratins 14 and 10. There was reduced expression of integrin beta 1 and DCC in the basal layer. Hair follicles were misaligned with a shrunken matrix region. The dermis showed increased cellularity and empty vacuoles. We suggest that Msx-2 is involved in the growth control of skin and skin appendages.

  18. A modulatory role of the Rax homeobox gene in mature pineal gland function

    DEFF Research Database (Denmark)

    Rohde, Kristian; Bering, Tenna; Furukawa, Takahisa

    2017-01-01

    The retinal and anterior neural fold homeobox gene (Rax) controls development of the eye and the forebrain. Postnatal expression of Rax in the brain is restricted to the pineal gland, a forebrain structure devoted to melatonin synthesis. The role of Rax in pineal function is unknown. In order...... to investigate the role of Rax in pineal function while circumventing forebrain abnormalities of the global Rax knockout, we generated an eye and pineal-specific Rax conditional knockout mouse. Deletion of Rax in the pineal gland did not affect morphology of the gland, suggesting that Rax is not essential...... for the nucleus to develop. Telemetric analyses confirmed the lack of a functional circadian clock. Arylalkylamine N-acetyltransferase (Aanat) transcripts, encoding the melatonin rhythm-generating enzyme, were undetectable in the pineal gland of the Rax conditional knockout under normal conditions, whereas...

  19. Ontogenetic expression of the Otx2 and Crx homeobox genes in the retina of the rat

    DEFF Research Database (Denmark)

    Rath, Martin F; Morin, Fabrice; Shi, Qiong

    2007-01-01

    . This confirmed the presence of Otx2 mRNA in both the embryonic retinal pigment epithelium and the developing neural retina. During development, the expression of Otx2 persists in the pigment epithelium, whereas Otx2 expression of the neural retina becomes progressively restricted to the outer nuclear layer......Otx2 and Crx are vertebrate orthologs of the orthodenticle family of homeobox genes, which are involved in retinal development. In this study, the temporal expression patterns of Otx2 and Crx in the rat retina during embryonic and postnatal stages of development were analyzed in detail...... and the outer part of the inner nuclear layer. Immunohistochemistry revealed that Otx2 protein is also present in cell bodies of the ganglion cell layer, which does not contain the Otx2 transcript, suggesting that Otx2 protein is synthesized in cell bodies of the bipolar neurons and then transported...

  20. Exclusion of pituitary homeobox 2 gene polymorphism in vertical mandibular asymmetry patients: a preliminary study

    Science.gov (United States)

    Sofyanti, Ervina; Boel, Trelia; Soegiharto, Benny; Ilyas, Syafruddin; Irani Nainggolan, Lidya; Auerkari, Elza Ibrahim

    2018-03-01

    Pituitary Homeobox 2 (PITX2), is an active gene as a paired-related homeobox gene that encodes multiple isoforms. Its Nodal pathway in determination of left-right patterning during embryogenesis has been reported in satellite cells and expressed in adult human skeletal muscle. PITX2A and PITX2B are produced by alternative splicing and used of different promoters. PITX2C uses an alternative promoter located upstream of exon 4. PITX2D is produced by PITX2C alternative promoter and differential splicing. The 5’-primers and 3’- antisense primer were unique for each isoforms. Variability measurement in vertical dimension showed stronger genetic component than sagittal. This study aims to obtain the genotype marker of vertical mandibular asymmetry related to PITX2A and PITX2D isoform by visualization of the amplified product on stained gel to allele specific oligonucleotide between the case and control with Restriction Fragment Length Polymorphism (RFLP). Determination of vertical mandibular asymmetry based on condylar height asymmetry index of pre-treatment panoramic radiograph using Kjellberg’s technique whilst vertical mandibular growth pattern using lateral cephalogram. The differences of condylar height asymmetry in case-control based on vertical growth pattern was compared using Pearson’s chi-squared test. DNA extraction of 129 out-coming orthodontic patients in Universitas Sumatera Utara Dental Hospital were obtained from Buccal swab. Then DNA samples were amplified by Polymerase chain reaction (PCR) and digested with NciI restriction enzyme prior to electrophoresis visualization. There was no significant statistical difference in vertical mandibular asymmetry compared to vertical mandibular growth pattern. The RFLP analysis did not show any polymorphism for PITX2A and PITX2D isoform. All of the samples showed wild type homozygote. Further analysis method, except RFLP, were required to understand the genetic factor in the variance of vertical mandibular

  1. Complementary striped expression patterns of NK homeobox genes during segment formation in the annelid Platynereis.

    Science.gov (United States)

    Saudemont, Alexandra; Dray, Nicolas; Hudry, Bruno; Le Gouar, Martine; Vervoort, Michel; Balavoine, Guillaume

    2008-05-15

    NK genes are related pan-metazoan homeobox genes. In the fruitfly, NK genes are clustered and involved in patterning various mesodermal derivatives during embryogenesis. It was therefore suggested that the NK cluster emerged in evolution as an ancestral mesodermal patterning cluster. To test this hypothesis, we cloned and analysed the expression patterns of the homologues of NK cluster genes Msx, NK4, NK3, Lbx, Tlx, NK1 and NK5 in the marine annelid Platynereis dumerilii, a representative of trochozoans, the third great branch of bilaterian animals alongside deuterostomes and ecdysozoans. We found that most of these genes are involved, as they are in the fly, in the specification of distinct mesodermal derivatives, notably subsets of muscle precursors. The expression of the homologue of NK4/tinman in the pulsatile dorsal vessel of Platynereis strongly supports the hypothesis that the vertebrate heart derived from a dorsal vessel relocated to a ventral position by D/V axis inversion in a chordate ancestor. Additionally and more surprisingly, NK4, Lbx, Msx, Tlx and NK1 orthologues are expressed in complementary sets of stripes in the ectoderm and/or mesoderm of forming segments, suggesting an involvement in the segment formation process. A potentially ancient role of the NK cluster genes in segment formation, unsuspected from vertebrate and fruitfly studies so far, now deserves to be investigated in other bilaterian species, especially non-insect arthropods and onychophorans.

  2. Characterization of Rice Homeobox Genes, OsHOX22 and OsHOX24, and Over-expression of OsHOX24 in Transgenic Arabidopsis Suggest their Role in Abiotic Stress Response

    Directory of Open Access Journals (Sweden)

    Annapurna eBhattacharjee

    2016-05-01

    Full Text Available Homeobox transcription factors are well known regulators of plant growth and development. In this study, we carried out functional analysis of two candidate stress-responsive HD-ZIP I class homeobox genes from rice, OsHOX22 and OsHOX24. These genes were highly upregulated under various abiotic stress conditions at different stages of rice development, including seedling, mature and reproductive stages. The transcript levels of these genes were enhanced significantly in the presence of plant hormones, including abscisic acid (ABA, auxin, salicylic acid and gibberellic acid. The recombinant full-length and truncated homeobox proteins were found to be localized in the nucleus. Electrophoretic mobility shift assay established the binding of these homeobox proteins with specific DNA sequences, AH1 (CAAT(A/TATTG and AH2 (CAAT(C/GATTG. Transactivation assays in yeast revealed the transcriptional activation potential of full-length OsHOX22 and OsHOX24 proteins. Homo- and hetero-dimerization capabilities of these proteins have also been demonstrated. Further, we identified putative novel interacting proteins of OsHOX22 and OsHOX24 via yeast-two hybrid analysis. Over-expression of OsHOX24 imparted higher sensitivity to stress hormone, ABA, and abiotic stresses in the transgenic Arabidopsis plants as revealed by various physiological and phenotypic assays. Microarray analysis revealed differential expression of several stress-responsive genes in transgenic lines as compared to wild-type. Many of these genes were found to be involved in transcriptional regulation and various metabolic pathways. Altogether, our results suggest the possible role of OsHOX22/OsHOX24 homeobox proteins as negative regulators in abiotic stress responses.

  3. Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development

    International Nuclear Information System (INIS)

    Simeone, A.; Mavilio, F.; Acampora, D.

    1987-01-01

    Two human cDNA clones (HHO.c1.95 and HHO.c8.5111) containing a homeobox region have been characterized, and the respective genomic regions have been partially analyzed. Expression of the corresponding genes, termed c1 and c8, was evaluated in different organs and body parts during human embryonic/fetal development. HHO.c1.95 apparently encodes a 217-amino acid protein containing a class I homeodomain that shares 60 out of 61 amino acid residues with the Antennapedia homeodomain of Drosophila melanogaster. HHO.c8.5111 encodes a 153-amino acid protein containing a homeodomains identical to that of the frog AC1 gene. Clones HHO.c1 and HHO.c8 detect by blot-hybridization one and two specific polyadenylylated transcripts, respectively. These are differentially expressed in spinal cord, backbone rudiments, limb buds (or limbs), heart, and skin of human embryos and early fetuses in the 5- to 9-week postfertilization period, thus suggesting that the c1 and c8 genes play a key role in a variety of developmental processes. Together, the results of the embryonic/fetal expression of c1 and c8 and those of two previously analyzed genes (c10 and c13) indicate a coherent pattern of expression of these genes in early human ontogeny

  4. Two human homeobox genes, c1 and c8: structure analysis and expression in embryonic development.

    Science.gov (United States)

    Simeone, A; Mavilio, F; Acampora, D; Giampaolo, A; Faiella, A; Zappavigna, V; D'Esposito, M; Pannese, M; Russo, G; Boncinelli, E

    1987-07-01

    Two human cDNA clones (HHO.c1.95 and HHO.c8.5111) containing a homeobox region have been characterized, and the respective genomic regions have been partially analyzed. Expression of the corresponding genes, termed c1 and c8, was evaluated in different organs and body parts during human embryonic/fetal development. HHO.c1.95 apparently encodes a 217-amino acid protein containing a class I homeodomain that shares 60 out of 61 amino acid residues with the Antennapedia homeodomain of Drosophila melanogaster. HHO.c8.5111 encodes a 153-amino acid protein containing a homeodomain identical to that of the frog AC1 gene. Clones HHO.c1 and HHO.c8 detect by blot-hydridization one and two specific polyadenylylated transcripts, respectively. These are differentially expressed in spinal cord, backbone rudiments, limb buds (or limbs), heart, and skin of human embryos and early fetuses in the 5- to 9-week postfertilization period, thus suggesting that the c1 and c8 genes play a key role in a variety of developmental processes. Together, the results of the embryonic/fetal expression of c1 and c8 and those of two previously analyzed genes (c10 and c13) indicate a coherent pattern of expression of these genes in early human ontogeny.

  5. Expression of the KNOTTED HOMEOBOX Genes in the Cactaceae Cambial Zone Suggests Their Involvement in Wood Development.

    Science.gov (United States)

    Reyes-Rivera, Jorge; Rodríguez-Alonso, Gustavo; Petrone, Emilio; Vasco, Alejandra; Vergara-Silva, Francisco; Shishkova, Svetlana; Terrazas, Teresa

    2017-01-01

    The vascular cambium is a lateral meristem that produces secondary xylem (i.e., wood) and phloem. Different Cactaceae species develop different types of secondary xylem; however, little is known about the mechanisms underlying wood formation in the Cactaceae. The KNOTTED HOMEOBOX (KNOX) gene family encodes transcription factors that regulate plant development. The role of class I KNOX genes in the regulation of the shoot apical meristem, inflorescence architecture, and secondary growth is established in a few model species, while the functions of class II KNOX genes are less well understood, although the Arabidopsis thaliana class II KNOX protein KNAT7 is known to regulate secondary cell wall biosynthesis. To explore the involvement of the KNOX genes in the enormous variability of wood in Cactaceae, we identified orthologous genes expressed in species with fibrous ( Pereskia lychnidiflora and Pilosocereus alensis ), non-fibrous ( Ariocarpus retusus ), and dimorphic ( Ferocactus pilosus ) wood. Both class I and class II KNOX genes were expressed in the cactus cambial zone, including one or two class I paralogs of KNAT1 , as well as one or two class II paralogs of KNAT3 - KNAT4 - KNAT5 . While the KNOX gene SHOOTMERISTEMLESS ( STM) and its ortholog ARK1 are expressed during secondary growth in the Arabidopsis and Populus stem, respectively, we did not find STM orthologs in the Cactaceae cambial zone, which suggests possible differences in the vascular cambium genetic regulatory network in these species. Importantly, while two class II KNOX paralogs from the KNAT7 clade were expressed in the cambial zone of A. retusus and F. pilosus , we did not detect KNAT7 ortholog expression in the cambial zone of P. lychnidiflora . Differences in the transcriptional repressor activity of secondary cell wall biosynthesis by the KNAT7 orthologs could therefore explain the differences in wood development in the cactus species.

  6. A concerted action of a paired-type homeobox gene, aristaless, and a homolog of Hox11/tlx homeobox gene, clawless, is essential for the distal tip development of the Drosophila leg.

    Science.gov (United States)

    Kojima, Tetsuya; Tsuji, Takuya; Saigo, Kaoru

    2005-03-15

    The subdivision of the developing field by region-specific expression of genes encoding transcription factors is an essential step during appendage development in arthropod and vertebrates. In Drosophila leg development, the distal-most region (pretarsus) is specified by the expression of homeobox genes, aristaless and Lim1, and its immediate neighbor (distal tarsus) is specified by the expression of a pair of Bar homeobox genes. Here, we show that one additional gene, clawless, which is a homolog of vertebrate Hox11/tlx homeobox gene family and formerly known as C15, is specifically expressed in the pretarsus and cooperatively acts with aristaless to repress Bar and possibly to activate Lim1. Similar to aristaless, the maximal expression of clawless requires Lim1 and its co-factor, Chip. Bar attenuates aristaless and clawless expression through Lim1 repression. Aristaless and Clawless proteins form a complex capable of binding to specific DNA targets, which cannot be well recognized solely by Aristaless or Clawless.

  7. Homeobox genes Msx-1 and Msx-2 are associated with induction and growth of skin appendages.

    Science.gov (United States)

    Noveen, A; Jiang, T X; Ting-Berreth, S A; Chuong, C M

    1995-05-01

    The mechanism involved in the morphogenesis of skin appendages is a fundamental issue underlying the development and healing of skin. To identify molecules involved in the induction and growth of skin appendages, we studied the expression of two homeobox genes, Msx-1 and Msx-2, during embryonic chicken skin development. We found that i) both Msx-1 and Msx-2 are early markers of epithelial placodes for skin appendages; ii) both Msx-1 and Msx-2 are expressed in the growing feather bud epithelia but not in the interbud epithelia; iii) although mostly overlapping, there are differences between the expression of the two Msx genes, Msx-1 being expressed more toward the anterior whereas Msx-2 is expressed more toward the distal feather bud; iv) there is no body-position-specific expression pattern as was observed for members of the Hox A-D clusters; v) in the feather follicle, Msx-1 and 2 are expressed in the collar and barb ridge epithelia, both regions of continuous cell proliferation; vi) when feather-bud growth was inhibited by forskolin, an activator of adenylyl cyclase, the expression of both genes was reduced. These results showed that Msx genes are specifically expressed in epithelial domains destined to become skin appendages. Its function in skin-appendage morphogenesis may be twofold, first in making epithelial cells competent to become skin appendages and, second, in making epithelial cells maintain their potential for continuous growth.

  8. Msx homeobox genes critically regulate embryo implantation by controlling paracrine signaling between uterine stroma and epithelium.

    Directory of Open Access Journals (Sweden)

    Shanmugasundaram Nallasamy

    Full Text Available The mammalian Msx homeobox genes, Msx1 and Msx2, encode transcription factors that control organogenesis and tissue interactions during embryonic development. We observed overlapping expression of these factors in uterine epithelial and stromal compartments of pregnant mice prior to embryo implantation. Conditional ablation of both Msx1 and Msx2 in the uterus resulted in female infertility due to a failure in implantation. In these mutant mice (Msx1/2(d/d, the uterine epithelium exhibited persistent proliferative activity and failed to attach to the embryos. Gene expression profiling of uterine epithelium and stroma of Msx1/2(d/d mice revealed an elevated expression of several members of the Wnt gene family in the preimplantation uterus. Increased canonical Wnt signaling in the stromal cells activated β-catenin, stimulating the production of a subset of fibroblast growth factors (FGFs in these cells. The secreted FGFs acted in a paracrine manner via the FGF receptors in the epithelium to promote epithelial proliferation, thereby preventing differentiation of this tissue and creating a non-receptive uterus refractory to implantation. Collectively, these findings delineate a unique signaling network, involving Msx1/2, Wnts, and FGFs, which operate in the uterus at the time of implantation to control the mesenchymal-epithelial dialogue critical for successful establishment of pregnancy.

  9. A new role for muscle segment homeobox genes in mammalian embryonic diapause

    Science.gov (United States)

    Cha, Jeeyeon; Sun, Xiaofei; Bartos, Amanda; Fenelon, Jane; Lefèvre, Pavine; Daikoku, Takiko; Shaw, Geoff; Maxson, Robert; Murphy, Bruce D.; Renfree, Marilyn B.; Dey, Sudhansu K.

    2013-01-01

    Mammalian embryonic diapause is a phenomenon defined by the temporary arrest in blastocyst growth and metabolic activity within the uterus which synchronously becomes quiescent to blastocyst activation and implantation. This reproductive strategy temporally uncouples conception from parturition until environmental or maternal conditions are favourable for the survival of the mother and newborn. The underlying molecular mechanism by which the uterus and embryo temporarily achieve quiescence, maintain blastocyst survival and then resume blastocyst activation with subsequent implantation remains unknown. Here, we show that uterine expression of Msx1 or Msx2, members of an ancient, highly conserved homeobox gene family, persists in three unrelated mammalian species during diapause, followed by rapid downregulation with blastocyst activation and implantation. Mice with uterine inactivation of Msx1 and Msx2 fail to achieve diapause and reactivation. Remarkably, the North American mink and Australian tammar wallaby share similar expression patterns of MSX1 or MSX2 as in mice—it persists during diapause and is rapidly downregulated upon blastocyst activation and implantation. Evidence from mouse studies suggests that the effects of Msx genes in diapause are mediated through Wnt5a, a known transcriptional target of uterine Msx. These studies provide strong evidence that the Msx gene family constitutes a common conserved molecular mediator in the uterus during embryonic diapause to improve female reproductive fitness. PMID:23615030

  10. Msx homeobox genes critically regulate embryo implantation by controlling paracrine signaling between uterine stroma and epithelium.

    Science.gov (United States)

    Nallasamy, Shanmugasundaram; Li, Quanxi; Bagchi, Milan K; Bagchi, Indrani C

    2012-01-01

    The mammalian Msx homeobox genes, Msx1 and Msx2, encode transcription factors that control organogenesis and tissue interactions during embryonic development. We observed overlapping expression of these factors in uterine epithelial and stromal compartments of pregnant mice prior to embryo implantation. Conditional ablation of both Msx1 and Msx2 in the uterus resulted in female infertility due to a failure in implantation. In these mutant mice (Msx1/2(d/d)), the uterine epithelium exhibited persistent proliferative activity and failed to attach to the embryos. Gene expression profiling of uterine epithelium and stroma of Msx1/2(d/d) mice revealed an elevated expression of several members of the Wnt gene family in the preimplantation uterus. Increased canonical Wnt signaling in the stromal cells activated β-catenin, stimulating the production of a subset of fibroblast growth factors (FGFs) in these cells. The secreted FGFs acted in a paracrine manner via the FGF receptors in the epithelium to promote epithelial proliferation, thereby preventing differentiation of this tissue and creating a non-receptive uterus refractory to implantation. Collectively, these findings delineate a unique signaling network, involving Msx1/2, Wnts, and FGFs, which operate in the uterus at the time of implantation to control the mesenchymal-epithelial dialogue critical for successful establishment of pregnancy.

  11. Conditional deletion of Msx homeobox genes in the uterus inhibits blastocyst implantation by altering uterine receptivity.

    Science.gov (United States)

    Daikoku, Takiko; Cha, Jeeyeon; Sun, Xiaofei; Tranguch, Susanne; Xie, Huirong; Fujita, Tomoko; Hirota, Yasushi; Lydon, John; DeMayo, Francesco; Maxson, Robert; Dey, Sudhansu K

    2011-12-13

    An effective bidirectional communication between an implantation-competent blastocyst and the receptive uterus is a prerequisite for mammalian reproduction. The blastocyst will implant only when this molecular cross-talk is established. Here we show that the muscle segment homeobox gene (Msh) family members Msx1 and Msx2, which are two highly conserved genes critical for epithelial-mesenchymal interactions during development, also play crucial roles in embryo implantation. Loss of Msx1/Msx2 expression correlates with altered uterine luminal epithelial cell polarity and affects E-cadherin/β-catenin complex formation through the control of Wnt5a expression. Application of Wnt5a in vitro compromised blastocyst invasion and trophoblast outgrowth on cultured uterine epithelial cells. The finding that Msx1/Msx2 genes are critical for conferring uterine receptivity and readiness to implantation could have clinical significance, because compromised uterine receptivity is a major cause of pregnancy failure in IVF programs. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. A new role for muscle segment homeobox genes in mammalian embryonic diapause.

    Science.gov (United States)

    Cha, Jeeyeon; Sun, Xiaofei; Bartos, Amanda; Fenelon, Jane; Lefèvre, Pavine; Daikoku, Takiko; Shaw, Geoff; Maxson, Robert; Murphy, Bruce D; Renfree, Marilyn B; Dey, Sudhansu K

    2013-04-24

    Mammalian embryonic diapause is a phenomenon defined by the temporary arrest in blastocyst growth and metabolic activity within the uterus which synchronously becomes quiescent to blastocyst activation and implantation. This reproductive strategy temporally uncouples conception from parturition until environmental or maternal conditions are favourable for the survival of the mother and newborn. The underlying molecular mechanism by which the uterus and embryo temporarily achieve quiescence, maintain blastocyst survival and then resume blastocyst activation with subsequent implantation remains unknown. Here, we show that uterine expression of Msx1 or Msx2, members of an ancient, highly conserved homeobox gene family, persists in three unrelated mammalian species during diapause, followed by rapid downregulation with blastocyst activation and implantation. Mice with uterine inactivation of Msx1 and Msx2 fail to achieve diapause and reactivation. Remarkably, the North American mink and Australian tammar wallaby share similar expression patterns of MSX1 or MSX2 as in mice-it persists during diapause and is rapidly downregulated upon blastocyst activation and implantation. Evidence from mouse studies suggests that the effects of Msx genes in diapause are mediated through Wnt5a, a known transcriptional target of uterine Msx. These studies provide strong evidence that the Msx gene family constitutes a common conserved molecular mediator in the uterus during embryonic diapause to improve female reproductive fitness.

  13. The murine homeobox gene Msx-3 shows highly restricted expression in the developing neural tube.

    Science.gov (United States)

    Shimeld, S M; McKay, I J; Sharpe, P T

    1996-04-01

    The mouse homeobox-genes Msx-1 and Msx-2 are expressed in several areas of the developing embryo, including the neural tube, neural crest, facial processes and limb buds. Here we report the characterisation of a third mouse Msx gene, which we designate Msx-3. The embryonic expression of Msx-3 was found to differ from that of Msx-1 and -2 in that it was confined to the dorsal neural tube. In embryos with 5-8 somites a segmental pattern of expression was observed in the hindbrain, with rhombomeres 3 and 5 lacking Msx-3 while other rhombomeres expressed Msx-3. This pattern was transient, however, such that in embryos with 18 or more somites expression was continuous throughout the dorsal hindbrain and anterior dorsal spinal cord. Differentiation of dorsal cell types in the neural tube can be induced by addition of members of the Tgf-beta family. Additionally, Msx-1 and -2 have been shown to be activated by addition of the Tgf-beta family member Bmp-4. To determine if Bmp-4 could activate Msx-3, we incubated embryonic hindbrain explants with exogenous Bmp-4. The dorsal expression of Msx-3 was seen to expand into more ventral regions of the neurectoderm in Bmp-4-treated cultures, implying that Bmp-4 may be able to mimic an in vivo signal that induces Msx-3.

  14. NKL homeobox gene MSX1 acts like a tumor suppressor in NK-cell leukemia.

    Science.gov (United States)

    Nagel, Stefan; Pommerenke, Claudia; Meyer, Corinna; Kaufmann, Maren; MacLeod, Roderick A F; Drexler, Hans G

    2017-09-15

    NKL homeobox gene MSX1 is physiologically expressed in lymphoid progenitors and subsequently downregulated in developing T- and B-cells. In contrast, elevated expression levels of MSX1 persist in mature natural killer (NK)-cells, indicating a functional role in this compartment. While T-cell acute lymphoblastic leukemia (T-ALL) subsets exhibit aberrant overexpression of MSX1, we show here that in malignant NK-cells the level of MSX1 transcripts is aberrantly downregulated. Chromosomal deletions at 4p16 hosting the MSX1 locus have been described in NK-cell leukemia patients. However, NK-cell lines analyzed here showed normal MSX1 gene configurations, indicating that this aberration might be uncommon. To identify alternative MSX1 regulatory mechanisms we compared expression profiling data of primary normal NK-cells and malignant NK-cell lines. This procedure revealed several deregulated genes including overexpressed IRF4, MIR155HG and MIR17HG and downregulated AUTS2, EP300, GATA3 and HHEX. As shown recently, chromatin-modulator AUTS2 is overexpressed in T-ALL subsets where it mediates aberrant transcriptional activation of MSX1. Here, our data demonstrate that in malignant NK-cell lines AUTS2 performed MSX1 activation as well, but in accordance with downregulated MSX1 transcription therein we detected reduced AUTS2 expression, a small genomic deletion at 7q11 removing exons 3 and 4, and truncating mutations in exon 1. Moreover, genomic profiling and chromosomal analyses of NK-cell lines demonstrated amplification of IRF4 at 6p25 and deletion of PRDM1 at 6q21, highlighting their potential oncogenic impact. Functional analyses performed via knockdown or forced expression of these genes revealed regulatory network disturbances effecting downregulation of MSX1 which may underlie malignant development in NK-cells.

  15. Expression of an Msx homeobox gene in ascidians: insights into the archetypal chordate expression pattern.

    Science.gov (United States)

    Ma, L; Swalla, B J; Zhou, J; Dobias, S L; Bell, J R; Chen, J; Maxson, R E; Jeffery, W R

    1996-03-01

    The Msx homeobox genes are expressed in complex patterns during vertebrate development in conjunction with inductive tissue interactions. As a means of understanding the archetypal role of Msx genes in chordates, we have isolated and characterized an Msx gene in ascidians, protochordates with a relatively simple body plan. The Mocu Msx-a and McMsx-a genes, isolated from the ascidians Molgula oculata and Molgula citrina, respectively, have homeodomains that place them in the msh-like subclass of Msx genes. Therefore, the Molgula Msx-a genes are most closely related to the msh genes previously identified in a number of invertebrates. Southern blot analysis suggests that there are one or two copies of the Msx-a gene in the Molgula genome. Northern blot and RNase protection analysis indicate that Msx-a transcripts are restricted to the developmental stages of the life cycle. In situ hybridization showed that Msx-a mRNA first appears just before gastrulation in the mesoderm (presumptive notochord and muscle) and ectoderm (neural plate) cells. Transcript levels decline in mesoderm cells after the completion of gastrulation, but are enhanced in the folding neural plate during neurulation. Later, Msx-a mRNA is also expressed in the posterior ectoderm and in a subset of the tail muscle cells. The ectoderm and mesoderm cells that express Msx-a are undergoing morphogenetic movements during gastrulation, neurulation, and tail formation. Msx-a expression ceases after these cells stop migrating. The ascidian M. citrina, in which adult tissues and organs begin to develop precociously in the larva, was used to study Msx-a expression during adult development. Msx-a transcripts are expressed in the heart primordium and the rudiments of the ampullae, epidermal protrusions with diverse functions in the juvenile. The heart and ampullae develop in regions where mesenchyme cells interact with endodermal or epidermal epithelia. A comparison of the expression patterns of the Molgula genes

  16. Homeobox gene Dlx-2 is implicated in metabolic stress-induced necrosis

    Directory of Open Access Journals (Sweden)

    Lim Sung-Chul

    2011-09-01

    Full Text Available Abstract Background In contrast to tumor-suppressive apoptosis and autophagic cell death, necrosis promotes tumor progression by releasing the pro-inflammatory and tumor-promoting cytokine high mobility group box 1 (HMGB1, and its presence in tumor patients is associated with poor prognosis. Thus, necrosis has important clinical implications in tumor development; however, its molecular mechanism remains poorly understood. Results In the present study, we show that Distal-less 2 (Dlx-2, a homeobox gene of the Dlx family that is involved in embryonic development, is induced in cancer cell lines dependently of reactive oxygen species (ROS in response to glucose deprivation (GD, one of the metabolic stresses occurring in solid tumors. Increased Dlx-2 expression was also detected in the inner regions, which experience metabolic stress, of human tumors and of a multicellular tumor spheroid, an in vitro model of solid tumors. Dlx-2 short hairpin RNA (shRNA inhibited metabolic stress-induced increase in propidium iodide-positive cell population and HMGB1 and lactate dehydrogenase (LDH release, indicating the important role(s of Dlx-2 in metabolic stress-induced necrosis. Dlx-2 shRNA appeared to exert its anti-necrotic effects by preventing metabolic stress-induced increases in mitochondrial ROS, which are responsible for triggering necrosis. Conclusions These results suggest that Dlx-2 may be involved in tumor progression via the regulation of metabolic stress-induced necrosis.

  17. The homeobox gene Hex regulates hepatocyte differentiation from embryonic stem cell-derived endoderm.

    Science.gov (United States)

    Kubo, Atsushi; Kim, Yon Hui; Irion, Stefan; Kasuda, Shogo; Takeuchi, Mitsuaki; Ohashi, Kazuo; Iwano, Masayuki; Dohi, Yoshiko; Saito, Yoshihiko; Snodgrass, Ralph; Keller, Gordon

    2010-02-01

    We investigated the role of the hematopoietically expressed homeobox (Hex) in the differentiation and development of hepatocytes within embryonic stem cell (ESC)-derived embryoid bodies (EBs). Analyses of hepatic endoderm derived from Hex(-/-) EBs revealed a dramatic reduction in the levels of albumin (Alb) and alpha-fetoprotein (Afp) expression. In contrast, stage-specific forced expression of Hex in EBs from wild-type ESCs led to the up-regulation of Alb and Afp expression and secretion of Alb and transferrin. These inductive effects were restricted to c-kit(+) endoderm-enriched EB-derived populations, suggesting that Hex functions at the level of hepatic specification of endoderm in this model. Microarray analysis revealed that Hex regulated the expression of a broad spectrum of hepatocyte-related genes, including fibrinogens, apolipoproteins, and cytochromes. When added to the endoderm-induced EBs, bone morphogenetic protein 4 acted synergistically with Hex in the induction of expression of Alb, Afp, carbamoyl phosphate synthetase, transcription factor 1, and CCAAT/enhancer binding protein alpha. These findings indicate that Hex plays a pivotal role during induction of liver development from endoderm in this in vitro model and suggest that this strategy may provide important insight into the generation of functional hepatocytes from ESCs.

  18. Differential induction of four msx homeobox genes during fin development and regeneration in zebrafish.

    Science.gov (United States)

    Akimenko, M A; Johnson, S L; Westerfield, M; Ekker, M

    1995-02-01

    To study the genetic regulation of growth control and pattern formation during fin development and regeneration, we have analysed the expression of four homeobox genes, msxA, msxB, msxC and msxD in zebrafish fins. The median fin fold, which gives rise to the unpaired fins, expresses these four msx genes during development. Transcripts of the genes are also present in cells of the presumptive pectoral fin buds. The most distal cells, the apical ectodermal ridge of the paired fins and the cleft and flanking cells of the median fin fold express all these msx genes with the exception of msxC. Mesenchymal cells underlying the most distal cells express all four genes. Expression of the msx genes in the fin fold and fin buds is transient and, by 3 days after fertilization, msx expression in the median fin fold falls below levels detectable by in situ hybridization. Although the fins of adult zebrafish normally have levels of msx transcripts undetectable by in situ hybridization, expression of all four genes is strongly reinduced during regeneration of both paired and unpaired fins. Induction of msx gene expression in regenerating caudal fins occurs as early as 30 hours postamputation. As the blastema forms, the levels of expression increase and reach a maximum between the third and fifth days. Then, msx expression progressively declines and disappears by day 12 when the caudal fin has grown back to its normal size. In the regenerating fin, the blastema cells that develop at the tip of each fin ray express msxB and msxC. Cells of the overlying epithelium express msxA and msxD, but do not express msxB or msxC. Amputations at various levels along the proximodistal axis of the fin suggest that msxB expression depends upon the position of the blastema, with cells of the rapidly proliferating proximal blastema expressing higher levels than the cells of the less rapidly proliferating distal blastema. Expression of msxC and msxD is independent of the position of the blastema cell

  19. Lim homeobox genes in the Ctenophore Mnemiopsis leidyi: the evolution of neural cell type specification

    Directory of Open Access Journals (Sweden)

    Simmons David K

    2012-01-01

    Full Text Available Abstract Background Nervous systems are thought to be important to the evolutionary success and diversification of metazoans, yet little is known about the origin of simple nervous systems at the base of the animal tree. Recent data suggest that ctenophores, a group of macroscopic pelagic marine invertebrates, are the most ancient group of animals that possess a definitive nervous system consisting of a distributed nerve net and an apical statocyst. This study reports on details of the evolution of the neural cell type specifying transcription factor family of LIM homeobox containing genes (Lhx, which have highly conserved functions in neural specification in bilaterian animals. Results Using next generation sequencing, the first draft of the genome of the ctenophore Mnemiopsis leidyi has been generated. The Lhx genes in all animals are represented by seven subfamilies (Lhx1/5, Lhx3/4, Lmx, Islet, Lhx2/9, Lhx6/8, and LMO of which four were found to be represented in the ctenophore lineage (Lhx1/5, Lhx3/4, Lmx, and Islet. Interestingly, the ctenophore Lhx gene complement is more similar to the sponge complement (sponges do not possess neurons than to either the cnidarian-bilaterian or placozoan Lhx complements. Using whole mount in situ hybridization, the Lhx gene expression patterns were examined and found to be expressed around the blastopore and in cells that give rise to the apical organ and putative neural sensory cells. Conclusion This research gives us a first look at neural cell type specification in the ctenophore M. leidyi. Within M. leidyi, Lhx genes are expressed in overlapping domains within proposed neural cellular and sensory cell territories. These data suggest that Lhx genes likely played a conserved role in the patterning of sensory cells in the ancestor of sponges and ctenophores, and may provide a link to the expression of Lhx orthologs in sponge larval photoreceptive cells. Lhx genes were later co-opted into patterning more

  20. Analysis of homeobox gene action may reveal novel angiogenic pathways in normal placental vasculature and in clinical pregnancy disorders associated with abnormal placental angiogenesis.

    Directory of Open Access Journals (Sweden)

    Padma eMurthi

    2014-06-01

    Full Text Available Homeobox genes are essential for both the development of the blood and lymphatic vascular systems, as well as for their maintenance in the adult. Homeobox genes comprise an important family of transcription factors, which are characterised by a well conserved DNA binding motif; the homeodomain. The specificity of the homeodomain allows the transcription factor to bind to the promoter regions of batteries of target genes and thereby regulates their expression. Target genes identified for homeodomain proteins have been shown to control fundamental cell processes such as proliferation, differentiation and apoptosis. We and others have reported that homeobox genes are expressed in the placental vasculature, but our knowledge of their downstream target genes is limited. This review highlights the importance of studying the cellular and molecular mechanisms by which homeobox genes and their downstream targets may regulate important vascular cellular processes such as proliferation, migration, and endothelial tube formation, which are essential for placental vasculogenesis and angiogenesis. A better understanding of the molecular targets of homeobox genes may lead to new therapies for aberrant angiogenesis associated with clinically important pregnancy pathologies, including fetal growth restriction and preeclampsia.

  1. Muscle segment homeobox genes direct embryonic diapause by limiting inflammation in the uterus

    Energy Technology Data Exchange (ETDEWEB)

    Cha, Jeeyeon; Burnum-Johnson, Kristin E.; Bartos, Amanda; Li, Yingju; Baker, Erin Shammel; Tilton, Susan C.; Webb-Robertson, Bobbie-Jo M.; Piehowski, Paul D.; Monroe, Matthew E.; Jegga, Anil; Murata, Shigeo; Hirota, Yasushi; Dey, Sudhansu K.

    2015-06-11

    Embryonic diapause (delayed implantation) is a reproductive strategy widespread in the animal kingdom. Under this condition, embryos at the blastocyst stage become dormant simultaneously with uterine quiescence until environmental or physiological conditions are favorable for the survival of the mother and newborn. Under favorable conditions, activation of the blastocyst and uterus ensues with implantation and progression of pregnancy. Although endocrine factors are known to participate in this process, the underlying molecular mechanism coordinating this phenomenon is not clearly understood. We recently found that uterine muscle segment homeobox (Msx) transcription factors are critical for the initiation and maintenance of delayed implantation in mice. To better understand why Msx genes are critical for delayed implantation, we compared uterine proteomics profiles between littermate floxed (Msx1/Msx2f/f) mice and mice with uterine deletion of Msx genes (Msx1/Msx2d/d) under delayed conditions. In Msx1/Msx2d/d uteri, pathways including protein translation, ubiquitin-proteasome system, inflammation, chaperone-mediated protein folding, and endoplasmic reticulum (ER) stress were enriched, and computational modeling showed intersection of these pathways on inflammatory responses. Indeed, increases in the ubiquitin-proteasome system and inflammation conformed to proteotoxic and ER stress in Msx1/Msx2d/d uteri under delayed conditions. Interestingly, treatment with a proteasome inhibitor bortezomib further exacerbated ER stress in Msx1/Msx2d/d uteri with aggravated inflammatory response, deteriorating rate of blastocyst recovery and failure to sustain delayed implantation. This study highlights a previously unrecognized role for Msx in preventing proteotoxic stress and inflammatory responses to coordinate embryo dormancy and uterine quiescence during embryonic diapause.

  2. Uterine inactivation of muscle segment homeobox (Msx) genes alters epithelial cell junction proteins during embryo implantation.

    Science.gov (United States)

    Sun, Xiaofei; Park, Craig B; Deng, Wenbo; Potter, S Steven; Dey, Sudhansu K

    2016-04-01

    Embryo implantation requires that the uterus differentiate into the receptive state. Failure to attain uterine receptivity will impede blastocyst attachment and result in a compromised pregnancy. The molecular mechanism by which the uterus transitions from the prereceptive to the receptive stage is complex, involving an intricate interplay of various molecules. We recently found that mice with uterine deletion ofMsxgenes (Msx1(d/d)/Msx2(d/d)) are infertile because of implantation failure associated with heightened apicobasal polarity of luminal epithelial cells during the receptive period. However, information on Msx's roles in regulating epithelial polarity remains limited. To gain further insight, we analyzed cell-type-specific gene expression by RNA sequencing of separated luminal epithelial and stromal cells by laser capture microdissection fromMsx1(d/d)/Msx2(d/d)and floxed mouse uteri on d 4 of pseudopregnancy. We found that claudin-1, a tight junction protein, and small proline-rich (Sprr2) protein, a major component of cornified envelopes in keratinized epidermis, were substantially up-regulated inMsx1(d/d)/Msx2(d/d)uterine epithelia. These factors also exhibited unique epithelial expression patterns at the implantation chamber (crypt) inMsx1(f/f)/Msx2(f/f)females; the patterns were lost inMsx1(d/d)/Msx2(d/d)epithelia on d 5, suggesting important roles during implantation. The results suggest thatMsxgenes play important roles during uterine receptivity including modulation of epithelial junctional activity.-Sun, X., Park, C. B., Deng, W., Potter, S. S., Dey, S. K. Uterine inactivation of muscle segment homeobox (Msx) genes alters epithelial cell junction proteins during embryo implantation. © FASEB.

  3. T-box and homeobox genes from the ctenophore Pleurobrachia pileus: comparison of Brachyury, Tbx2/3 and Tlx in basal metazoans and bilaterians.

    Science.gov (United States)

    Martinelli, Cosimo; Spring, Jürg

    2005-09-12

    Most animals are classified as Bilateria and only four phyla are still extant as outgroups, namely Porifera, Placozoa, Cnidaria and Ctenophora. These non-bilaterians were not considered to have a mesoderm and hence mesoderm-specific genes. However, the T-box gene Brachyury could be isolated from sponges, placozoans and cnidarians. Here, we describe the first Brachyury and a Tbx2/3 homologue from a ctenophore. In addition, analysing T-box and homeobox genes under comparable conditions in all four basal phyla lead to the discovery of novel T-box genes in sponges and cnidarians and a Tlx homeobox gene in the ctenophore Pleurobrachia pileus. The conservation of the T-box and the homeobox genes suggest that distinct subfamilies with different roles in bilaterians were already split in non-bilaterians.

  4. Correlation of expression of BP1, a homeobox gene, with estrogen receptor status in breast cancer

    International Nuclear Information System (INIS)

    Fu, Sidney W; Poola, Indira; Stephan, Dietrich A; Berg, Patricia E; Schwartz, Arnold; Stevenson, Holly; Pinzone, Joseph J; Davenport, Gregory J; Orenstein, Jan M; Gutierrez, Peter; Simmens, Samuel J; Abraham, Jessy

    2003-01-01

    BP1 is a novel homeobox gene cloned in our laboratory. Our previous studies in leukemia demonstrated that BP1 has oncogenic properties, including as a modulator of cell survival. Here BP1 expression was examined in breast cancer, and the relationship between BP1 expression and clinicopathological data was determined. Total RNA was isolated from cell lines, tumors, and matched normal adjacent tissue or tissue from autopsy. Reverse transcription polymerase chain reaction was performed to evaluate BP1 expression. Statistical analysis was accomplished with SAS. Analysis of 46 invasive ductal breast tumors demonstrated BP1 expression in 80% of them, compared with a lack of expression in six normal breast tissues and low-level expression in one normal breast tissue. Remarkably, 100% of tumors that were negative for the estrogen receptor (ER) were BP1-positive, whereas 73% of ER-positive tumors expressed BP1 (P = 0.03). BP1 expression was also associated with race: 89% of the tumors of African American women were BP1-positive, whereas 57% of those from Caucasian women expressed BP1 (P = 0.04). However, there was no significant difference in BP1 expression between grades I, II, and III tumors. Interestingly, BP1 mRNA expression was correlated with the ability of malignant cell lines to cause breast cancer in mice. Because BP1 is expressed abnormally in breast tumors, it could provide a useful target for therapy, particularly in patients with ER-negative tumors. The frequent expression of BP1 in all tumor grades suggests that activation of BP1 is an early event

  5. Establishment of canine hemangiosarcoma xenograft models expressing endothelial growth factors, their receptors, and angiogenesis-associated homeobox genes

    International Nuclear Information System (INIS)

    Kodama, Atsushi; Yanai, Tokuma; Sakai, Hiroki; Matsuura, Satoko; Murakami, Mami; Murai, Atsuko; Mori, Takashi; Maruo, Kouji; Kimura, Tohru; Masegi, Toshiaki

    2009-01-01

    Human hemangiosarcoma (HSA) tends to have a poor prognosis; its tumorigenesis has not been elucidated, as there is a dearth of HSA clinical specimens and no experimental model for HSA. However, the incidence of spontaneous HSA is relatively high in canines; therefore, canine HSA has been useful in the study of human HSA. Recently, the production of angiogenic growth factors and their receptors in human and canine HSA has been reported. Moreover, the growth-factor environment of HSA is very similar to that of pathophysiological angiogenesis, which some homeobox genes regulate in the transcription of angiogenic molecules. In the present study, we established 6 xenograft canine HSA tumors and detected the expression of growth factors, their receptors, and angiogenic homeobox genes. Six primary canine HSAs were xenografted to nude mice subcutaneously and serially transplanted. Subsequently, the expressions of vascular endothelial growth factor (VEGF)-A, basic fibroblast growth factors (bFGF), flt-1 and flk-1 (receptors of VEGF-A), FGFR-1, and angiogenic homeobox genes HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 were investigated in original and xenograft tumors by histopathology, immunostaining, and reverse transcription polymerase chain reaction (RT-PCR), using canine-specific primer sets. Histopathologically, xenograft tumors comprised a proliferation of neoplastic cells that were varied in shape, from spindle-shaped and polygonal to ovoid; some vascular-like structures and vascular clefts of channels were observed, similar to those in the original tumors. The expression of endothelial markers (CD31 and vWF) was detected in xenograft tumors by immunohistochemistry and RT-PCR. Moreover, the expression of VEGF-A, bFGF, flt-1, flk-1, FGFR-1, HoxA9, HoxB3, HoxB7, HoxD3, Pbx1, and Meis1 was detected in xenograft tumors. Interestingly, expressions of bFGF tended to be higher in 3 of the xenograft HSA tumors than in the other tumors. We established 6 xenograft canine HSA

  6. Comparative Analysis of WUSCHEL-Related Homeobox Genes Revealed Their Parent-of-Origin and Cell Type-Specific Expression Pattern During Early Embryogenesis in Tobacco

    Directory of Open Access Journals (Sweden)

    Xuemei Zhou

    2018-03-01

    Full Text Available WUSCHEL-related homeobox (WOX gene is a plant-specific clade of homeobox transcription factors. Increasing evidences reveal that WOXs play critical roles in early embryogenesis, which involves zygote development, initiation of zygote division, and apical or basal cell lineage establishment. However, how WOXs regulate these developmental events remains largely unknown, and even detailed expression pattern in gametes and early proembryos is not yet available. Here, 13 WOX family genes were identified in Nicotiana tabacum genome. Comparative analysis of 13 WOX family genes with their homologs in Arabidopsis thaliana reveals relatively conserved expression pattern of WUS and WOX5 in shoot/root apical meristem. Whereas variations were also found, e.g., lacking homolog of WOX8 (a marker for suspensor cell in tobacco genome and the expression of WOX2/WOX9 in both apical cell and basal cell. Transient transcriptional activity analysis revealed that WOXs in WUS clade have repressive activities for their target's transcription, whereas WOXs in ancient and intermediate clade have activation activities, giving a molecular basis for the phylogenetic classification of tobacco WOXs into three major clades. Expression pattern analysis revealed that some WOXs (e.g., WOX 13a expressed in both male and female gametes and some WOXs (e.g., WOX 11 and WOX 13b displayed the characteristics of parent-of-origin genes. Interestingly, some WOXs (e.g., WOX2 and WOX9, which are essential for early embryo patterning, were de novo transcribed in zygote, indicating relevant mechanism for embryo pattern formation is only established in zygote right after fertilization and not carried in by gametes. We also found that most WOXs displayed a stage-specific and cell type-specific expression pattern. Taken together, this work provides a detailed landscape of WOXs in tobacco during fertilization and early embryogenesis, which will facilitate the understanding of their specific roles

  7. An EG-VEGF-dependent decrease in homeobox gene NKX3.1 contributes to cytotrophoblast dysfunction: a possible mechanism in human fetal growth restriction.

    Science.gov (United States)

    Murthi, P; Brouillet, S; Pratt, A; Borg, Aj; Kalionis, B; Goffin, F; Tsatsaris, V; Munaut, C; Feige, Jj; Benharouga, M; Fournier, T; Alfaidy, N

    2015-07-21

    Idiopathic fetal growth restriction (FGR) is frequently associated with placental insufficiency. Previous reports have provided evidence that EG-VEGF (endocrine gland derived-vascular endothelial growth factor), a placental secreted protein, is expressed during the first trimester of pregnancy, controls both trophoblast proliferation and invasion, and its increased expression is associated with human FGR. In this study, we hypothesise that EG-VEGF-dependent change in placental homeobox gene expressions contribute to trophoblast dysfunction in idiopathic FGR. The changes in EG-VEGF-dependent homeobox gene expressions were determined using a Homeobox gene cDNA array on placental explants of 8-12 weeks' gestation after stimulation with EG-VEGF in vitro for 24 hours. The Homeobox gene array identified a >5-fold increase in HOXA9, HOXC8, HOXC10, HOXD1, HOXD8, HOXD9 and HOXD11, while NKX 3.1 showed a >2 fold-decrease in mRNA expression compared to untreated controls. Homeobox gene NKX3.1 was selected as a candidate because it is a downstream target of EG-VEGF and its expression and functional role are largely unknown in control and idiopathic FGR-affected placentae. Real-time PCR and immunoblotting showed a significant decrease in NKX3.1 mRNA and protein levels, respectively, in placentae from FGR compared to control pregnancies. Gene inactivation in vitro using short-interference RNA specific for NKX3.1 demonstrated an increase in BeWo cell differentiation and a decrease in HTR8-SVneo proliferation. We conclude that the decreased expression of homeobox gene NKX3.1 down-stream of EG-VEGF may contribute to the trophoblast dysfunction associated with idiopathic FGR pregnancies.

  8. The evolution of Msx gene function: expression and regulation of a sea urchin Msx class homeobox gene.

    Science.gov (United States)

    Dobias, S L; Ma, L; Wu, H; Bell, J R; Maxson, R

    1997-01-01

    Msx- class homeobox genes, characterized by a distinct and highly conserved homeodomain, have been identified in a wide variety of metazoans from vertebrates to coelenterates. Although there is evidence that they participate in inductive tissue interactions that underlie vertebrate organogenesis, including those that pattern the neural crest, there is little information about their function in simple deuterostomes. Both to learn more about the ancient function of Msx genes, and to shed light on the evolution of developmental mechanisms within the lineage that gave rise to vertebrates, we have isolated and characterized Msx genes from ascidians and echinoderms. Here we describe the sequence and expression of a sea urchin (Strongylocentrotus purpouratus) Msx gene whose homeodomain is very similar to that of vertebrate Msx2. This gene, designated SpMsx, is first expressed in blastula stage embryos, apparently in a non-localized manner. Subsequently, during the early phases of gastrulation, SpMsx transcripts are expressed intensely in the invaginating archenteron and secondary mesenchyme, and at reduced levels in the ectoderm. In the latter part of gastrulation, SpMsx transcripts are concentrated in the oral ectoderm and gut, and continue to be expressed at those sites through the remainder of embryonic development. That vertebrate Msx genes are regulated by inductive tissue interactions and growth factors suggested to us that the restriction of SpMsx gene expression to the oral ectoderm and derivatives of the vegetal plate might similarly be regulated by the series of signaling events that pattern these embryonic territories. As a first test of this hypothesis, we examined the influence of exogastrulation and cell-dissociation on SpMsx gene expression. In experimentally-induced exogastrulae, SpMsx transcripts were distributed normally in the oral ectoderm, evaginated gut, and secondary mesenchyme. However, when embryos were dissociated into their component cells, Sp

  9. The human homeobox genes MSX-1, MSX-2, and MOX-1 are differentially expressed in the dermis and epidermis in fetal and adult skin.

    Science.gov (United States)

    Stelnicki, E J; Kömüves, L G; Holmes, D; Clavin, W; Harrison, M R; Adzick, N S; Largman, C

    1997-10-01

    In order to identify homeobox genes which may regulate skin development and possibly mediate scarless fetal wound healing we have screened amplified human fetal skin cDNAs by polymerase chain reaction (PCR) using degenerate oligonucleotide primers designed against highly conserved regions within the homeobox. We identified three non-HOX homeobox genes, MSX-1, MSX-2, and MOX-1, which were differentially expressed in fetal and adult human skin. MSX-1 and MSX-2 were detected in the epidermis, hair follicles, and fibroblasts of the developing fetal skin by in situ hybridization. In contrast, MSX-1 and MSX-2 expression in adult skin was confined to epithelially derived structures. Immunohistochemical analysis of these two genes suggested that their respective homeoproteins may be differentially regulated. While Msx-1 was detected in the cell nucleus of both fetal and adult skin; Msx-2 was detected as a diffuse cytoplasmic signal in fetal epidermis and portions of the hair follicle and dermis, but was localized to the nucleus in adult epidermis. MOX-1 was expressed in a pattern similar to MSX early in gestation but then was restricted exclusively to follicular cells in the innermost layer of the outer root sheath by 21 weeks of development. Furthermore, MOX-1 expression was completely absent in adult cutaneous tissue. These data imply that each of these homeobox genes plays a specific role in skin development.

  10. Functional analysis of rice HOMEOBOX4 (Oshox4) gene reveals a negative function in gibberellin responses.

    Science.gov (United States)

    Dai, Mingqiu; Hu, Yongfeng; Ma, Qian; Zhao, Yu; Zhou, Dao-Xiu

    2008-02-01

    The homeodomain-leucine zipper (HD-Zip) putative transcription factor genes are divided into 4 families. In this work, we studied the function of a rice HD-Zip I gene, H OME O BO X4 (Oshox4). Oshox4 transcripts were detected in leaf and floral organ primordia but excluded from the shoot apical meristem and the protein was nuclear localized. Over-expression of Oshox4 in rice induced a semi-dwarf phenotype that could not be complemented by applied GA3. The over-expression plants accumulated elevated levels of bioactive GA, while the GA catabolic gene GA2ox3 was upregulated in the transgenic plants. In addition, over-expression of Oshox4 blocked GA-dependent alpha-amylase production. However, down-regulation of Oshox4 in RNAi transgenic plants induced no phenotypic alteration. Interestingly, the expression of YAB1 that is involved in the negative feedback regulation of the GA biosynthesis was upregulated in the Oshox4 over-expressing plants. One-hybrid assays showed that Oshox4 could interact with YAB1 promoter in yeast. In addition, Oshox4 expression was upregulated by GA. These data together suggest that Oshox4 may be involved in the negative regulation of GA signalling and may play a role to fine tune GA responses in rice.

  11. Transcriptional activation of prostate specific homeobox gene NKX3-1 in subsets of T-cell lymphoblastic leukemia (T-ALL.

    Directory of Open Access Journals (Sweden)

    Stefan Nagel

    Full Text Available Homeobox genes encode transcription factors impacting key developmental processes including embryogenesis, organogenesis, and cell differentiation. Reflecting their tight transcriptional control, homeobox genes are often embedded in large non-coding, cis-regulatory regions, containing tissue specific elements. In T-cell acute lymphoblastic leukemia (T-ALL homeobox genes are frequently deregulated by chromosomal aberrations, notably translocations adding T-cell specific activatory elements. NKX3-1 is a prostate specific homeobox gene activated in T-ALL patients expressing oncogenic TAL1 or displaying immature T-cell characteristics. After investigating regulation of NKX3-1 in primary cells and cell lines, we report its ectopic expression in T-ALL cells independent of chromosomal rearrangements. Using siRNAs and expression profiling, we exploited NKX3-1 positive T-ALL cell lines as tools to investigate aberrant activatory mechanisms. Our data confirmed NKX3-1 activation by TAL1/GATA3/LMO and identified LYL1 as an alternative activator in immature T-ALL cells devoid of GATA3. Moreover, we showed that NKX3-1 is directly activated by early T-cell homeodomain factor MSX2. These activators were regulated by MLL and/or by IL7-, BMP4- and IGF2-signalling. Finally, we demonstrated homeobox gene SIX6 as a direct leukemic target of NKX3-1 in T-ALL. In conclusion, we identified three major mechanisms of NKX3-1 regulation in T-ALL cell lines which are represented by activators TAL1, LYL1 and MSX2, corresponding to particular T-ALL subtypes described in patients. These results may contribute to the understanding of leukemic transcriptional networks underlying disturbed T-cell differentiation in T-ALL.

  12. [Association of muscle segment homeobox gene 1 polymorphisms with nonsyndromic cleft lip with or without cleft palate].

    Science.gov (United States)

    Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng

    2008-06-01

    Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.

  13. Increased methylation and decreased expression of homeobox genes TLX1, HOXA10 and DLX5 in human placenta are associated with trophoblast differentiation.

    Science.gov (United States)

    Novakovic, Boris; Fournier, Thierry; Harris, Lynda K; James, Joanna; Roberts, Claire T; Yong, Hannah E J; Kalionis, Bill; Evain-Brion, Danièle; Ebeling, Peter R; Wallace, Euan M; Saffery, Richard; Murthi, Padma

    2017-07-03

    Homeobox genes regulate embryonic and placental development, and are widely expressed in the human placenta, but their regulatory control by DNA methylation is unclear. DNA methylation analysis was performed on human placentae from first, second and third trimesters to determine methylation patterns of homeobox gene promoters across gestation. Most homeobox genes were hypo-methylated throughout gestation, suggesting that DNA methylation is not the primary mechanism involved in regulating HOX genes expression in the placenta. Nevertheless, several genes showed variable methylation patterns across gestation, with a general trend towards an increase in methylation over gestation. Three genes (TLX1, HOXA10 and DLX5) showed inverse gains of methylation with decreasing mRNA expression throughout pregnancy, supporting a role for DNA methylation in their regulation. Proteins encoded by these genes were primarily localised to the syncytiotrophoblast layer, and showed decreased expression later in gestation. siRNA mediated downregulation of DLX5, TLX1 and HOXA10 in primary term villous cytotrophoblast resulted in decreased proliferation and increased expression of differentiation markers, including ERVW-1. Our data suggest that loss of DLX5, TLX1 and HOXA10 expression in late gestation is required for proper placental differentiation and function.

  14. Biomineralization, life-time of odontogenic cells and differential expression of the two homeobox genes MSX-1 and DLX-2 in transgenic mice.

    Science.gov (United States)

    Lézot, F; Thomas, B; Hotton, D; Forest, N; Orestes-Cardoso, S; Robert, B; Sharpe, P; Berdal, A

    2000-03-01

    Msx and Dlx homeobox genes encode for transcription factors that control early morphogenesis. More specifically, Msx-1, Msx-2, and Dlx-2 homeobox genes contribute to the initial patterning of the dentition. The present study is devoted to the potential role of those homeobox genes during the late formation of mineralized tissues, using the rodent incisor as an experimental system. The continuously erupting mandibular incisor allows (1) the coinvestigation of the whole sequences of amelogenesis and dentinogenesis, aligned along the main dental axis in a single sample in situ and (2) the differential characterization of transcripts generated by epithelial and ectomesenchymal odontogenic cells. Northern blot experiments on microdissected cells showed the continuing expression of Msx-2 and Dlx-2 in the later stages of dental biomineralization, differentially in epithelial and ectomesenchymal compartments. Transgenic mice produced with LacZ reporter constructs for Dlx-2 and Msx-1 were used to detect different components of the gene expression patterns with the sensitive beta-galactosidase histoenzymology. The results show a prominent epithelial involvement of Dlx-2, with stage-specific variations in the cells involved in enamel formation. Quantitative analyses identified specific modulations of Dlx-2 expression in ameloblasts depending on the anatomical sites of the incisor, showing more specifically an inverse linear relationship between the Dlx-2 promoter activity level and enamel thickness. This investigation extends the role of homeoproteins to postmitotic stages, which would control secretory cell activity, in a site-specific manner as shown here for Dlx-2.

  15. Proper development of relay somatic sensory neurons and D2/D4 interneurons requires homeobox genes Rnx/Tlx-3 and Tlx-1.

    Science.gov (United States)

    Qian, Ying; Shirasawa, Senji; Chen, Chih-Li; Cheng, Leping; Ma, Qiufu

    2002-05-15

    Trigeminal nuclei and the dorsal spinal cord are first-order relay stations for processing somatic sensory information such as touch, pain, and temperature. The origins and development of these neurons are poorly understood. Here we show that relay somatic sensory neurons and D2/D4 dorsal interneurons likely derive from Mash1-positive neural precursors, and depend on two related homeobox genes, Rnx and Tlx-1, for proper formation. Rnx and Tlx-1 maintain expression of Drg11, a homeobox gene critical for the development of pain circuitry, and are essential for the ingrowth of trkA+ nociceptive/thermoceptive sensory afferents to their central targets. We showed previously that Rnx is necessary for proper formation of the nucleus of solitary tract, the target for visceral sensory afferents. Together, our studies demonstrate a central role for Rnx and Tlx-1 in the development of two major classes of relay sensory neurons, somatic and visceral.

  16. Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome.

    Science.gov (United States)

    Amiel, Jeanne; Laudier, Béatrice; Attié-Bitach, Tania; Trang, Ha; de Pontual, Loïc; Gener, Blanca; Trochet, Delphine; Etchevers, Heather; Ray, Pierre; Simonneau, Michel; Vekemans, Michel; Munnich, Arnold; Gaultier, Claude; Lyonnet, Stanislas

    2003-04-01

    Congenital central hypoventilation syndrome (CCHS or Ondine's curse; OMIM 209880) is a life-threatening disorder involving an impaired ventilatory response to hypercarbia and hypoxemia. This core phenotype is associated with lower-penetrance anomalies of the autonomic nervous system (ANS) including Hirschsprung disease and tumors of neural-crest derivatives such as ganglioneuromas and neuroblastomas. In mice, the development of ANS reflex circuits is dependent on the paired-like homeobox gene Phox2b. Thus, we regarded its human ortholog, PHOX2B, as a candidate gene in CCHS. We found heterozygous de novo mutations in PHOX2B in 18 of 29 individuals with CCHS. Most mutations consisted of 5-9 alanine expansions within a 20-residue polyalanine tract probably resulting from non-homologous recombination. We show that PHOX2B is expressed in both the central and the peripheral ANS during human embryonic development. Our data support an essential role of PHOX2B in the normal patterning of the autonomous ventilation system and, more generally, of the ANS in humans.

  17. Regulation, overexpression, and target gene identification of Potato Homeobox 15 (POTH15) – a class-I KNOX gene in potato

    Science.gov (United States)

    Mahajan, Ameya S.; Kondhare, Kirtikumar R.; Rajabhoj, Mohit P.; Kumar, Amit; Ghate, Tejashree; Ravindran, Nevedha; Habib, Farhat; Siddappa, Sundaresha; Banerjee, Anjan K.

    2016-01-01

    Potato Homeobox 15 (POTH15) is a KNOX-I (Knotted1-like homeobox) family gene in potato that is orthologous to Shoot Meristemless (STM) in Arabidopsis. Despite numerous reports on KNOX genes from different species, studies in potato are limited. Here, we describe photoperiodic regulation of POTH15, its overexpression phenotype, and identification of its potential targets in potato (Solanum tuberosum ssp. andigena). qRT-PCR analysis showed a higher abundance of POTH15 mRNA in shoot tips and stolons under tuber-inducing short-day conditions. POTH15 promoter activity was detected in apical and axillary meristems, stolon tips, tuber eyes, and meristems of tuber sprouts, indicating its role in meristem maintenance and leaf development. POTH15 overexpression altered multiple morphological traits including leaf and stem development, leaflet number, and number of nodes and branches. In particular, the rachis of the leaf was completely reduced and leaves appeared as a bouquet of leaflets. Comparative transcriptomic analysis of 35S::GUS and two POTH15 overexpression lines identified more than 6000 differentially expressed genes, including 2014 common genes between the two overexpression lines. Functional analysis of these genes revealed their involvement in responses to hormones, biotic/abiotic stresses, transcription regulation, and signal transduction. qRT-PCR of selected candidate target genes validated their differential expression in both overexpression lines. Out of 200 randomly chosen POTH15 targets, 173 were found to have at least one tandem TGAC core motif, characteristic of KNOX interaction, within 3.0kb in the upstream sequence of the transcription start site. Overall, this study provides insights to the role of POTH15 in controlling diverse developmental processes in potato. PMID:27217546

  18. Bisphenol-A induces expression of HOXC6, an estrogen-regulated homeobox-containing gene associated with breast cancer.

    Science.gov (United States)

    Hussain, Imran; Bhan, Arunoday; Ansari, Khairul I; Deb, Paromita; Bobzean, Samara A M; Perrotti, Linda I; Mandal, Subhrangsu S

    2015-06-01

    HOXC6 is a homeobox-containing gene associated with mammary gland development and is overexpressed in variety of cancers including breast and prostate cancers. Here, we have examined the expression of HOXC6 in breast cancer tissue, investigated its transcriptional regulation via estradiol (E2) and bisphenol-A (BPA, an estrogenic endocrine disruptor) in vitro and in vivo. We observed that HOXC6 is differentially over-expressed in breast cancer tissue. E2 induces HOXC6 expression in cultured breast cancer cells and in mammary glands of Sprague Dawley rats. HOXC6 expression is also induced upon exposure to BPA both in vitro and in vivo. Estrogen-receptor-alpha (ERα) and ER-coregulators such as MLL-histone methylases are bound to the HOXC6 promoter upon exposure to E2 or BPA and that resulted in increased histone H3K4-trimethylation, histone acetylation, and recruitment of RNA polymerase II at the HOXC6 promoter. HOXC6 overexpression induces expression of tumor growth factors and facilitates growth 3D-colony formation, indicating its potential roles in tumor growth. Our studies demonstrate that HOXC6, which is a critical player in mammary gland development, is upregulated in multiple cases of breast cancer, and is transcriptionally regulated by E2 and BPA, in vitro and in vivo. Published by Elsevier B.V.

  19. Hematopoietically-expressed homeobox gene three widely-evaluated polymorphisms and risk for diabetes: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Xiaobo Li

    Full Text Available BACKGROUND: The hematopoietically-expressed homeobox (HHEX gene is identified as a promising candidate for type 2 diabetes by genome-wide association studies, triggering plenty of subsequent replications; however, the results are conflicting. We therefore conducted a meta-analysis of three widely-evaluated polymorphisms in HHEX gene and diabetes risk. METHODOLOGY/PRINCIPAL FINDINGS: A random-effects model was adopted irrespective of heterogeneity. Data and study quality were assessed in duplicate. There were 49 studies (cases/controls: 57931/74658 for rs1111875, 18 studies (18227/30366 for rs5015480 and 26 studies (25725/30579 for rs7923837, respectively. Overall analyses indicated that rs1111875-C allele (odds ratio [OR] = 1.16; 95% confidence interval [CI]: 1.13-1.2; P<0.0005, rs5015480-C allele (OR = 1.16; 95% CI: 1.06-1.26; P = 0.001 and rs7923837-G allele (OR = 1.18; 95% CI: 1.12-1.24; P<0.0005 conferred significantly increased risk for type 2 diabetes, yet accompanying moderate to strong evidence of heterogeneity. Despite vast divergence in allele distributions, subgroup analyses by ethnicity showed comparable risk estimates between Asians and Caucasians for three examined polymorphisms. Moreover, results of studies with hospital-based controls deviated greatly from that of all qualified studies, especially for rs7923837-G allele carrying a doubled risk (OR = 1.37 versus 1.18. Furthermore, when only large studies (≥ 500 case-patients were considered, risk effects were identical to the overall estimates for three examined polymorphisms. The Begg's funnel plot and Egger's test indicated low probability of publication bias. CONCLUSIONS: Our results provide clarification to the significant association of rs1111875, rs5015480 and rs7923837 in HHEX gene with type 2 diabetes.

  20. Rapid evolution and copy number variation of primate RHOXF2, an X-linked homeobox gene involved in male reproduction and possibly brain function.

    Science.gov (United States)

    Niu, Ao-lei; Wang, Yin-qiu; Zhang, Hui; Liao, Cheng-hong; Wang, Jin-kai; Zhang, Rui; Che, Jun; Su, Bing

    2011-10-12

    Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV) sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. RHOXF2 is a fast-evolving homeobox gene in primates. The rapid evolution and copy number changes of RHOXF2 had been driven by

  1. Rapid evolution and copy number variation of primate RHOXF2, an X-linked homeobox gene involved in male reproduction and possibly brain function

    Directory of Open Access Journals (Sweden)

    Zhang Rui

    2011-10-01

    Full Text Available Abstract Background Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. Results We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. Conclusions RHOXF2 is a fast-evolving homeobox gene in primates. The rapid

  2. Complex epigenetic regulation of engrailed-2 (EN-2) homeobox gene in the autism cerebellum.

    Science.gov (United States)

    James, S J; Shpyleva, Svitlana; Melnyk, Stepan; Pavliv, Oleksandra; Pogribny, I P

    2013-02-19

    The elucidation of epigenetic alterations in the autism brain has potential to provide new insights into the molecular mechanisms underlying abnormal gene expression in this disorder. Given strong evidence that engrailed-2 (EN-2) is a developmentally expressed gene relevant to cerebellar abnormalities and autism, the epigenetic evaluation of this candidate gene was undertaken in 26 case and control post-mortem cerebellar samples. Assessments included global DNA methylation, EN-2 promoter methylation, EN-2 gene expression and EN-2 protein levels. Chromatin immunoprecipitation was used to evaluate trimethylation status of histone H3 lysine 27 (H3K27) associated with gene downregulation and histone H3 lysine 4 (H3K4) associated with gene activation. The results revealed an unusual pattern of global and EN-2 promoter region DNA hypermethylation accompanied by significant increases in EN-2 gene expression and protein levels. Consistent with EN-2 overexpression, histone H3K27 trimethylation mark in the EN-2 promoter was significantly decreased in the autism samples relative to matched controls. Supporting a link between reduced histone H3K27 trimethylation and increased EN-2 gene expression, the mean level of histone H3K4 trimethylation was elevated in the autism cerebellar samples. Together, these results suggest that the normal EN-2 downregulation that signals Purkinje cell maturation during late prenatal and early-postnatal development may not have occurred in some individuals with autism and that the postnatal persistence of EN-2 overexpression may contribute to autism cerebellar abnormalities.

  3. Ectopic Expression of Homeobox Gene NKX2-1 in Diffuse Large B-Cell Lymphoma Is Mediated by Aberrant Chromatin Modifications

    Science.gov (United States)

    Nagel, Stefan; Ehrentraut, Stefan; Tomasch, Jürgen; Quentmeier, Hilmar; Meyer, Corinna; Kaufmann, Maren; Drexler, Hans G.; MacLeod, Roderick A. F.

    2013-01-01

    Homeobox genes encode transcription factors ubiquitously involved in basic developmental processes, deregulation of which promotes cell transformation in multiple cancers including hematopoietic malignancies. In particular, NKL-family homeobox genes TLX1, TLX3 and NKX2-5 are ectopically activated by chromosomal rearrangements in T-cell neoplasias. Here, using transcriptional microarray profiling and RQ-PCR we identified ectopic expression of NKL-family member NKX2-1, in a diffuse large B-cell lymphoma (DLBCL) cell line SU-DHL-5. Moreover, in silico analysis demonstrated NKX2-1 overexpression in 5% of examined DLBCL patient samples. NKX2-1 is physiologically expressed in lung and thyroid tissues where it regulates differentiation. Chromosomal and genomic analyses excluded rearrangements at the NKX2-1 locus in SU-DHL-5, implying alternative activation. Comparative expression profiling implicated several candidate genes in NKX2-1 regulation, variously encoding transcription factors, chromatin modifiers and signaling components. Accordingly, siRNA-mediated knockdown and overexpression studies confirmed involvement of transcription factor HEY1, histone methyltransferase MLL and ubiquitinated histone H2B in NKX2-1 deregulation. Chromosomal aberrations targeting MLL at 11q23 and the histone gene cluster HIST1 at 6p22 which we observed in SU-DHL-5 may, therefore, represent fundamental mutations mediating an aberrant chromatin structure at NKX2-1. Taken together, we identified ectopic expression of NKX2-1 in DLBCL cells, representing the central player in an oncogenic regulative network compromising B-cell differentiation. Thus, our data extend the paradigm of NKL homeobox gene deregulation in lymphoid malignancies. PMID:23637834

  4. [Expression of homeobox gene Msx-1, Msx-2 and Dlx-2 during murine mandibular first molar development].

    Science.gov (United States)

    Ma, Li; Chen, Zhi; Song, Guang-tai; Fan, Ming-wen; Zhang, Qi; Wang, Zhi-feng

    2003-11-01

    To observe the expression of homeobox gene Msx-1, Msx-2 and Dlx-2 during murine mandibular first molar development. The murine heads or mandibles on embryonic days 11-18 (E11-18) and postnatal day 1-3 (P1-3) were removed, fixed and embedded, 5 micro m serial sections were cut in the coronal plane. Msx-1, Msx-2 and Dlx-2 RNA probes were synthesized by in vitro transcription and labeled with digoxigenin. Msx-1, Msx-2 and Dlx-2 mRNA expression was observed after in situ hybridization. During molar development Msx-1 transcripts appeared only in mesenchymal cells, not in epithelial cells. Msx-2 and Dlx-2 both expressed in the epithelial and mesenchymal cells. At the initiation stage of the molar development Msx-2 and Dlx-2 had similar expression. At the bud stage (E13-14) Msx-2 mRNA signaling was intensive in the enamel organ and slight in the dental mesenchyme; Dlx-2 signaling was stronger in the dental papilla. At cap stage (E15-16) Msx-2 showed prominent mRNA signaling in enamel knot and Dlx-2 was maximal in the dental papilla. At the late bell stage (P2-3) Msx-2 transcripts were observed in odontoblasts but not labeled in ameloblasts, and Dlx-2 transcripts appeared in ameloblasts but no labeling was seen in odontoblasts. Msx-1, Msx-2 and Dlx-2 are expressed in various patterns during murine mandibular first molar development, suggesting they possibly play a role in the interaction between the epithelium and mesenchyme during the molar development.

  5. The homeobox gene mirror links EGF signalling to embryonic dorso-ventral axis formation through notch activation.

    Science.gov (United States)

    Jordan, K C; Clegg, N J; Blasi, J A; Morimoto, A M; Sen, J; Stein, D; McNeill, H; Deng, W M; Tworoger, M; Ruohola-Baker, H

    2000-04-01

    Recent studies in vertebrates and Drosophila melanogaster have revealed that Fringe-mediated activation of the Notch pathway has a role in patterning cell layers during organogenesis. In these processes, a homeobox-containing transcription factor is responsible for spatially regulating fringe (fng) expression and thus directing activation of the Notch pathway along the fng expression border. Here we show that this may be a general mechanism for patterning epithelial cell layers. At three stages in Drosophila oogenesis, mirror (mirr) and fng have complementary expression patterns in the follicle-cell epithelial layer, and at all three stages loss of mirr enlarges, and ectopic expression of mirr restricts, fng expression, with consequences for follicle-cell patterning. These morphological changes are similar to those caused by Notch mutations. Ectopic expression of mirr in the posterior follicle cells induces a stripe of rhomboid (rho) expression and represses pipe (pip), a gene with a role in the establishment of the dorsal-ventral axis, at a distance. Ectopic Notch activation has a similar long-range effect on pip. Our results suggest that Mirror and Notch induce secretion of diffusible morphogens and we have identified TGF-beta (encoded by dpp) as such a molecule in germarium. We also found that mirr expression in dorsal follicle cells is induced by the EGF-receptor (EGFR) pathway and that mirr then represses pip expression in all but the ventral follicle cells, connecting EGFR activation in the dorsal follicle cells to repression of pip in the dorsal and lateral follicle cells. Our results suggest that the differentiation of ventral follicle cells is not a direct consequence of germline signalling, but depends on long-range signals from dorsal follicle cells, and provide a link between early and late events in Drosophila embryonic dorsal-ventral axis formation.

  6. vox homeobox gene: a novel regulator of midbrain-hindbrain boundary development in medaka fish?

    Czech Academy of Sciences Publication Activity Database

    Fabian, Peter; Pantzartzi, Chrysoula; Kozmiková, Iryna; Kozmik, Zbyněk

    2016-01-01

    Roč. 226, č. 2 (2016), s. 99-107 ISSN 0949-944X R&D Projects: GA MŠk LO1419 Institutional support: RVO:68378050 Keywords : Midbrain-hindbrain boundary * vox * medaka * Heat shock element * fgf8 * Gene regulatory network Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.422, year: 2016

  7. Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER

    Science.gov (United States)

    Mary E. Byrne; Andrew T. Groover; Joseph R. Fontana; Robert A. Martienssen

    2003-01-01

    Lateral organs in plants arise from the meristem in a stereotypical pattern known as phyllotaxy. Spiral patterns result from initiation of successive organs at a fixed angle of divergence but variable patterns of physical contact. Such patterns ultimately give rise to individual leaves and flowers at positions related to each other by consecutive terms in the...

  8. Mouse transgenesis identifies conserved functional enhancers and cis-regulatory motif in the vertebrate LIM homeobox gene Lhx2 locus.

    Directory of Open Access Journals (Sweden)

    Alison P Lee

    Full Text Available The vertebrate Lhx2 is a member of the LIM homeobox family of transcription factors. It is essential for the normal development of the forebrain, eye, olfactory system and liver as well for the differentiation of lymphoid cells. However, despite the highly restricted spatio-temporal expression pattern of Lhx2, nothing is known about its transcriptional regulation. In mammals and chicken, Crb2, Dennd1a and Lhx2 constitute a conserved linkage block, while the intervening Dennd1a is lost in the fugu Lhx2 locus. To identify functional enhancers of Lhx2, we predicted conserved noncoding elements (CNEs in the human, mouse and fugu Crb2-Lhx2 loci and assayed their function in transgenic mouse at E11.5. Four of the eight CNE constructs tested functioned as tissue-specific enhancers in specific regions of the central nervous system and the dorsal root ganglia (DRG, recapitulating partial and overlapping expression patterns of Lhx2 and Crb2 genes. There was considerable overlap in the expression domains of the CNEs, which suggests that the CNEs are either redundant enhancers or regulating different genes in the locus. Using a large set of CNEs (810 CNEs associated with transcription factor-encoding genes that express predominantly in the central nervous system, we predicted four over-represented 8-mer motifs that are likely to be associated with expression in the central nervous system. Mutation of one of them in a CNE that drove reporter expression in the neural tube and DRG abolished expression in both domains indicating that this motif is essential for expression in these domains. The failure of the four functional enhancers to recapitulate the complete expression pattern of Lhx2 at E11.5 indicates that there must be other Lhx2 enhancers that are either located outside the region investigated or divergent in mammals and fishes. Other approaches such as sequence comparison between multiple mammals are required to identify and characterize such enhancers.

  9. A novel phenotype of a hepatocyte nuclear factor homeobox A (HNF1A) gene mutation, presenting with neonatal cholestasis

    NARCIS (Netherlands)

    de Vries, Aleida G. M.; Bakker-van Waarde, Willie M.; Dassel, Anne C. M.; Losekoot, Monique; Duiker, Evelien W.; Gouw, Annette S. H.; Bodewes, Frank A. J. A.

    We report a novel phenotype of a hepatocyte nuclear factor homeobox A (HNF1A) mutation (heterozygote c.130dup, p.Leu44fs) presenting with transient neonatal cholestasis, subsequently followed by persistent elevation of transaminases, maturity-onset diabetes of the young (MODY) type 3 and

  10. Uterine inactivation of muscle segment homeobox (Msx) genes alters epithelial cell junction proteins during embryo implantation

    OpenAIRE

    Sun, Xiaofei; Park, Craig B.; Deng, Wenbo; Potter, S. Steven; Dey, Sudhansu K.

    2015-01-01

    Embryo implantation requires that the uterus differentiate into the receptive state. Failure to attain uterine receptivity will impede blastocyst attachment and result in a compromised pregnancy. The molecular mechanism by which the uterus transitions from the prereceptive to the receptive stage is complex, involving an intricate interplay of various molecules. We recently found that mice with uterine deletion of Msx genes (Msx1d/d/Msx2d/d) are infertile because of implantation failure associ...

  11. Inhibition of Breast Cancer-Induced Angiogenesis by a Diverged Homeobox Gene

    Science.gov (United States)

    2005-05-01

    Frizzled homolog 2 (FZD2) Signal transduction 30.4 ɘ.0001 NM 025151 Rab coupling protein ( RCP ) Signal transduction 30.1 0.0026 A1678679 Bone morphogenetic...with smooth muscle a actin, whereas Prx2 of the aorta, declines in the neonate and lymphatic development is the observation expression is highly...Fold change P Up-regulated Genes L37882 Frizzled homologue 2 (FZD2) Signal transduction 30.4 ɘ.0001 NM_025151 Rab coupling protein ( RCP ) Signal

  12. Regulated expression of homeobox genes Msx-1 and Msx-2 in mouse mammary gland development suggests a role in hormone action and epithelial-stromal interactions.

    Science.gov (United States)

    Friedmann, Y; Daniel, C W

    1996-07-10

    The murine homeobox genes Msx-1 and Msx-2 are related to the Drosophila msh gene and are expressed in a variety of tissues during mouse embryogenesis. We now report the developmentally regulated expression of Msx-1 and Msx-2 in the mouse mammary gland and show that their expression patterns point toward significant functional roles. Msx-1 and Msx-2 transcripts were present in glands of virgin mice and in glands of mice in early pregnancy, but transcripts decreased dramatically during late pregnancy. Low levels of Msx-1 transcripts were detected in glands from lactating animals and during the first days of involution, whereas Msx-2 expression was not detected during lactation or early involution. Expression of both genes increased gradually as involution progressed. Msx-2 but not Msx-1 expression was decreased following ovariectomy or following exposure to anti-estrogen implanted directly into the gland. Hormonal regulation of Msx-2 expression was confirmed when transcripts returned to normal levels after estrogen was administered to ovariectomized animals. In situ molecular hybridization for Msx-1 showed transcripts localized to the mammary epithelium, whereas Msx-2 expression was confined to the periductal stroma. Mammary stroma from which mammary epithelium had been removed did not transcribe detectable amounts of Msx-2, showing that expression is regulated by contiguous mammary epithelium, and indicating a role for these homeobox genes in mesenchymal-epithelial interactions during mammary development.

  13. Cross-talk between Msx/Dlx homeobox genes and vitamin D during tooth mineralization.

    Science.gov (United States)

    Lézot, F; Descroix, V; Mesbah, M; Hotton, D; Blin, C; Papagerakis, P; Mauro, N; Kato, S; MacDougall, M; Sharpe, P; Berdal, A

    2002-01-01

    Rickets is associated with site-specific disorders of enamel and dentin formation, which may reflect the impact of vitamin D on a morphogenetic pathway. This study is devoted to potential cross-talk between vitamin D and Msx/Dlx transcription factors. We raised the question of a potential link between tooth defects seen in mice with rickets and Msx2 gene misexpression, using mutant mice lacking the nuclear vitamin D receptor as an animal model. Our data showed a modulation of Msx2 expression. In order to search for a functional impact of this Msx2 misexpression secondary to rickets, we focused our attention on osteocalcin as a target gene for both vitamin D and Msx2. Combining Msx2 overexpression and vitamin D addition in vitro, we showed an inhibitory effect on osteocalcin expression in immortalized MO6-G3 odontoblasts. Finally, in the same cells, such combinations appeared to modulate VDR expression outlining the existence of complex cross-regulations between vitamin D and Msx/Dix pathways.

  14. Regulatory sequences driving expression of the sea urchin Otp homeobox gene in oral ectoderm cells.

    Science.gov (United States)

    Cavalieri, Vincenzo; Bernardo, Maria Di; Spinelli, Giovanni

    2007-01-01

    PlOtp (Orthopedia), a homeodomain-containing transcription factor, has been recently characterized as a key regulator of the morphogenesis of the skeletal system in the embryo of the sea urchin Paracentrotus lividus. Otp acts as a positive regulator in a subset of oral ectodermal cells which transmit short-range signals to the underlying primary mesenchyme cells where skeletal synthesis is initiated. To shed some light on the molecular mechanisms involved in such a process, we begun a functional analysis of the cis-regulatory sequences of the Otp gene. Congruent with the spatial expression profile of the endogenous Otp gene, we found that while a DNA region from -494 to +358 is shown to drive in vivo GFP reporter expression in the oral ectoderm, but also in the foregut, a larger region spanning from -2044 to +358 is needed to give firmly established tissue specificity. Microinjection of PCR-amplified DNA constructs, truncated in the 5' regulatory region, and determination of GFP mRNA level in injected embryos allowed the identification of a 5'-flanking fragment of 184bp in length, essential for expression of the transgene in the oral ectoderm of pluteus stage embryos. Finally, we conducted DNAse I-footprinting assays in nuclear extracts for the 184bp region and detected two protected sequences. Data bank search indicates that these sites contain consensus binding sites for transcription factors.

  15. Developmental and daily expression of the Pax4 and Pax6 homeobox genes in the rat retina: localization of Pax4 in photoreceptor cells

    DEFF Research Database (Denmark)

    Rath, Martin F; Bailey, Michael J; Kim, Jong-So

    2009-01-01

    Pax4 is a homeobox gene encoding Pax4, a transcription factor that is essential for embryonic development of the endocrine pancreas. In the pancreas, Pax4 counters the effects of the related transcription factor, Pax6, which is known to be essential for eye morphogenesis. In this study, we have...... in the foetal eye. Histological analysis revealed that Pax4 mRNA is exclusively expressed in the retinal photoreceptors, whereas Pax6 mRNA and protein are present in the inner nuclear layer and in the ganglion cell layer of the mature retina. In the adult retina, Pax4 transcripts exhibit a diurnal rhythm...

  16. A neuroanatomical and physiological study of the non-image forming visual system of the cone-rod homeobox gene (Crx) knock out mouse

    DEFF Research Database (Denmark)

    Rovsing, Louise; Rath, Martin F; Lund-Andersen, Casper

    2010-01-01

    The anatomy and physiology of the non-image forming visual system was investigated in a visually blind cone-rod homeobox gene (Crx) knock-out mouse (Crx(-)(/)(-)), which lacks the outer segments of the photoreceptors. We show that the suprachiasmatic nuclei (SCN) in the Crx(-/-) mouse exhibit...... melanopsin neurons or the SCN may be necessary for a normal function of the non-image forming system of the mouse. However, a change in the SCN of the Crx(-/-) mouse might also explain the observed circadian differences between the knock out mouse and wild type mouse....

  17. Regulation and functions of the lms homeobox gene during development of embryonic lateral transverse muscles and direct flight muscles in Drosophila.

    Directory of Open Access Journals (Sweden)

    Dominik Müller

    Full Text Available BACKGROUND: Patterning and differentiation of developing musculatures require elaborate networks of transcriptional regulation. In Drosophila, significant progress has been made into identifying the regulators of muscle development and defining their interactive networks. One major family of transcription factors involved in these processes consists of homeodomain proteins. In flies, several members of this family serve as muscle identity genes to specify the fates of individual muscles, or groups thereof, during embryonic and/or adult muscle development. Herein, we report on the expression and function of a new Drosophila homeobox gene during both embryonic and adult muscle development. METHODOLOGY/PRINCIPAL FINDINGS: The newly described homeobox gene, termed lateral muscles scarcer (lms, which has yet uncharacterized orthologs in other invertebrates and primitive chordates but not in vertebrates, is expressed exclusively in subsets of developing muscle tissues. In embryos, lms is expressed specifically in the four lateral transverse (LT muscles and their founder cells in each hemisegment, whereas in larval wing imaginal discs, it is expressed in myoblasts that develop into direct flight muscles (DFMs, which are important for proper wing positioning. We have analyzed the regulatory inputs of various other muscle identity genes with overlapping or complementary expression patterns towards the cell type specific regulation of lms expression. Further we demonstrate that lms null mutants exhibit reduced numbers of embryonic LT muscles, and null mutant adults feature held-out-wing phenotypes. We provide a detailed description of the pattern and morphology of the direct flight muscles in the wild type and lms mutant flies by using the recently-developed ultramicroscopy and show that, in the mutants, all DFMs are present and present normal morphologies. CONCLUSIONS/SIGNIFICANCE: We have identified the homeobox gene lms as a new muscle identity gene

  18. Differential expression of homeobox-containing genes Msx-1 and Msx-2 and homeoprotein Msx-2 expression during chick craniofacial development.

    Science.gov (United States)

    Nishikawa, K; Nakanishi, T; Aoki, C; Hattori, T; Takahashi, K; Taniguchi, S

    1994-03-01

    The expression pattern of chick Msx-1 and Msx-2 homeobox genes in craniofacial primordia was examined by in situ hybridization using cRNA probes. Both genes were expressed in the distal region of the facial primordia, where the distribution of Msx-2 expression was restricted distally within the Msx-1 expression domain. On the contrary, Msx-2 expression in the lateral choroid plexus and cranial skull was broader and more intensive than Msx-1 expression. Our findings suggest that these two genes cooperate to play differential roles in craniofacial development. Msx-2 protein was detected immunohistochemically, and its localization essentially corresponded to the mRNA expression pattern, substantiating the involvement of Msx-2 protein as a transcriptional regulator in developing limb and face.

  19. Deoxyribonucleic-binding homeobox proteins are augmented in human cancer

    DEFF Research Database (Denmark)

    Wewer, U M; Mercurio, A M; Chung, S Y

    1990-01-01

    Homeobox genes encode sequence-specific DNA-binding proteins that are involved in the regulation of gene expression during embryonic development. In this study, we examined the expression of homeobox proteins in human cancer. Antiserum was obtained against a synthetic peptide derived from...... was then isolated and used to elicit a rabbit antiserum. In immunostaining, both antisera reacted with the nuclei of cultured tumor cells. In tissue sections of human carcinoma, nuclear immunoreactivity was observed in the tumor cells in 40 of 42 cases examined. Adjacent normal epithelial tissue obtained from......, the presence of the homeobox transcript in human carcinoma was documented by in situ hybridization and RNase protection mapping. These results demonstrate that human cancer is associated with the expression of homeobox proteins. Such homeobox proteins, as well as other regulatory proteins, could be involved...

  20. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  1. [Comparative study of expression of homeobox gene Msx-1, Msx-2 mRNA during the hard tissue formation of mouse tooth development].

    Science.gov (United States)

    Wang, Y; Wang, J; Gao, Y

    2001-07-01

    To observe and compare the expression pattern of Msx-1, Msx-2 mRNA during the different stages of hard tissue formation in the first mandibular molar of mouse and investigate the relationship between the two genes. First mandibular molar germs from 1, 3, 7 and 14-days old mouse were separated and reverse transcription-polymerase chain reaction was performed on the total RNA of them using Msx-1, Msx-2 specific primers separately. Expression of both genes were detected during the different stages of hard tissue formation in the mouse first mandibular molars, but there was some interesting differences in the quantitiy between the two genes. Msx-1 transcripts appeared at the 1 day postnatally, and increase through 3 day, 7 day, then maximally expressed at 14 days postnatally; while Msx-2 mRNA was seen and expressed maximally at the 3 days postnatally, then there was a gradual reduction at 7 days, and 14 days postnatally. The homeobox gene Msx-1, Msx-2 may play a role in the events of the hard tissue formation. The complementary expression pattern of them during the specific stage of hard tissue formation indicates that there may be some functional redundancy between them during the biomineralization.

  2. Tlx-1 and Tlx-3 homeobox gene expression in cranial sensory ganglia and hindbrain of the chick embryo: markers of patterned connectivity.

    Science.gov (United States)

    Logan, C; Wingate, R J; McKay, I J; Lumsden, A

    1998-07-15

    Recent evidence suggests that in vertebrates the formation of distinct neuronal cell types is controlled by specific families of homeodomain transcription factors. Furthermore, the expression domains of a number of these genes correlates with functionally integrated neuronal populations. We have isolated two members of the divergent T-cell leukemia translocation (HOX11/Tlx) homeobox gene family from chick, Tlx-1 and Tlx-3, and show that they are expressed in differentiating neurons of both the peripheral and central nervous systems. In the peripheral nervous system, Tlx-1 and Tlx-3 are expressed in overlapping domains within the placodally derived components of a number of cranial sensory ganglia. Tlx-3, unlike Tlx-1, is also expressed in neural crest-derived dorsal root and sympathetic ganglia. In the CNS, both genes are expressed in longitudinal columns of neurons at specific dorsoventral levels of the hindbrain. Each column has distinct anterior and/or posterior limits that respect inter-rhombomeric boundaries. Tlx-3 is also expressed in D2 and D3 neurons of the spinal cord. Tlx-1 and Tlx-3 expression patterns within the peripheral and central nervous systems suggest that Tlx proteins may be involved not only in the differentiation and/or survival of specific neuronal populations but also in the establishment of neuronal circuitry. Furthermore, by analogy with the LIM genes, Tlx family members potentially define sensory columns early within the developing hindbrain in a combinatorial manner.

  3. Rice homeobox transcription factor HOX1a positively regulates gibberellin responses by directly suppressing EL1.

    Science.gov (United States)

    Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei

    2011-11-01

    Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.

  4. Dominant Drop mutants are gain-of-function alleles of the muscle segment homeobox gene (msh) whose overexpression leads to the arrest of eye development.

    Science.gov (United States)

    Mozer, B A

    2001-05-15

    Dominant Drop (Dr) mutations are nearly eyeless and have additional recessive phenotypes including lethality and patterning defects in eye and sensory bristles due to cis-regulatory lesions in the cell cycle regulator string (stg). Genetic analysis demonstrates that the dominant small eye phenotype is the result of separate gain-of-function mutations in the closely linked muscle segment homeobox (msh) gene, encoding a homeodomain transcription factor required for patterning of muscle and nervous system. Reversion of the Dr(Mio) allele was coincident with the generation of lethal loss-of-function mutations in msh in cis, suggesting that the dominant eye phenotype is the result of ectopic expression. Molecular genetic analysis revealed that two dominant Dr alleles contain lesions upstream of the msh transcription start site. In the Dr(Mio) mutant, a 3S18 retrotransposon insertion is the target of second-site mutations (P-element insertions or deletions) which suppress the dominant eye phenotype following reversion. The pattern of 3S18 expression and the absence of msh in eye imaginal discs suggest that transcriptional activation of the msh promoter accounts for ectopic expression. Dr dominant mutations arrest eye development by blocking the progression of the morphogenetic furrow leading to photoreceptor cell loss via apoptosis. Gal4-mediated ubiquitous expression of msh in third-instar larvae was sufficient to arrest the morphogenetic furrow in the eye imaginal disc and resulted in lethality prior to eclosion. Dominant mutations in the human msx2 gene, one of the vertebrate homologs of msh, are associated with craniosynostosis, a disease affecting cranial development. The Dr mutations are the first example of gain-of-function mutations in the msh/msx gene family identified in a genetically tractible model organism and may serve as a useful tool to identify additional genes that regulate this class of homeodomain proteins. Copyright 2001 Academic Press.

  5. The LIM and POU homeobox genes ttx-3 and unc-86 act as terminal selectors in distinct cholinergic and serotonergic neuron types.

    Science.gov (United States)

    Zhang, Feifan; Bhattacharya, Abhishek; Nelson, Jessica C; Abe, Namiko; Gordon, Patricia; Lloret-Fernandez, Carla; Maicas, Miren; Flames, Nuria; Mann, Richard S; Colón-Ramos, Daniel A; Hobert, Oliver

    2014-01-01

    Transcription factors that drive neuron type-specific terminal differentiation programs in the developing nervous system are often expressed in several distinct neuronal cell types, but to what extent they have similar or distinct activities in individual neuronal cell types is generally not well explored. We investigate this problem using, as a starting point, the C. elegans LIM homeodomain transcription factor ttx-3, which acts as a terminal selector to drive the terminal differentiation program of the cholinergic AIY interneuron class. Using a panel of different terminal differentiation markers, including neurotransmitter synthesizing enzymes, neurotransmitter receptors and neuropeptides, we show that ttx-3 also controls the terminal differentiation program of two additional, distinct neuron types, namely the cholinergic AIA interneurons and the serotonergic NSM neurons. We show that the type of differentiation program that is controlled by ttx-3 in different neuron types is specified by a distinct set of collaborating transcription factors. One of the collaborating transcription factors is the POU homeobox gene unc-86, which collaborates with ttx-3 to determine the identity of the serotonergic NSM neurons. unc-86 in turn operates independently of ttx-3 in the anterior ganglion where it collaborates with the ARID-type transcription factor cfi-1 to determine the cholinergic identity of the IL2 sensory and URA motor neurons. In conclusion, transcription factors operate as terminal selectors in distinct combinations in different neuron types, defining neuron type-specific identity features.

  6. Genome-wide association mapping in dogs enables identification of the homeobox gene, NKX2-8, as a genetic component of neural tube defects in humans.

    Directory of Open Access Journals (Sweden)

    Noa Safra

    Full Text Available Neural tube defects (NTDs is a general term for central nervous system malformations secondary to a failure of closure or development of the neural tube. The resulting pathologies may involve the brain, spinal cord and/or vertebral column, in addition to associated structures such as soft tissue or skin. The condition is reported among the more common birth defects in humans, leading to significant infant morbidity and mortality. The etiology remains poorly understood but genetic, nutritional, environmental factors, or a combination of these, are known to play a role in the development of NTDs. The variable conditions associated with NTDs occur naturally in dogs, and have been previously reported in the Weimaraner breed. Taking advantage of the strong linkage-disequilibrium within dog breeds we performed genome-wide association analysis and mapped a genomic region for spinal dysraphism, a presumed NTD, using 4 affected and 96 unaffected Weimaraners. The associated region on canine chromosome 8 (pgenome  =3.0 × 10(-5, after 100,000 permutations, encodes 18 genes, including NKX2-8, a homeobox gene which is expressed in the developing neural tube. Sequencing NKX2-8 in affected Weimaraners revealed a G to AA frameshift mutation within exon 2 of the gene, resulting in a premature stop codon that is predicted to produce a truncated protein. The exons of NKX2-8 were sequenced in human patients with spina bifida and rare variants (rs61755040 and rs10135525 were found to be significantly over-represented (p=0.036. This is the first documentation of a potential role for NKX2-8 in the etiology of NTDs, made possible by investigating the molecular basis of naturally occurring mutations in dogs.

  7. Ancient expansion of the hox cluster in lepidoptera generated four homeobox genes implicated in extra-embryonic tissue formation.

    Directory of Open Access Journals (Sweden)

    Laura Ferguson

    2014-10-01

    Full Text Available Gene duplications within the conserved Hox cluster are rare in animal evolution, but in Lepidoptera an array of divergent Hox-related genes (Shx genes has been reported between pb and zen. Here, we use genome sequencing of five lepidopteran species (Polygonia c-album, Pararge aegeria, Callimorpha dominula, Cameraria ohridella, Hepialus sylvina plus a caddisfly outgroup (Glyphotaelius pellucidus to trace the evolution of the lepidopteran Shx genes. We demonstrate that Shx genes originated by tandem duplication of zen early in the evolution of large clade Ditrysia; Shx are not found in a caddisfly and a member of the basally diverging Hepialidae (swift moths. Four distinct Shx genes were generated early in ditrysian evolution, and were stably retained in all descendent Lepidoptera except the silkmoth which has additional duplications. Despite extensive sequence divergence, molecular modelling indicates that all four Shx genes have the potential to encode stable homeodomains. The four Shx genes have distinct spatiotemporal expression patterns in early development of the Speckled Wood butterfly (Pararge aegeria, with ShxC demarcating the future sites of extraembryonic tissue formation via strikingly localised maternal RNA in the oocyte. All four genes are also expressed in presumptive serosal cells, prior to the onset of zen expression. Lepidopteran Shx genes represent an unusual example of Hox cluster expansion and integration of novel genes into ancient developmental regulatory networks.

  8. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    Science.gov (United States)

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  9. A novel role of BELL1-like homeobox genes, PENNYWISE and POUND-FOOLISH, in floral patterning.

    Science.gov (United States)

    Yu, Lifeng; Patibanda, Varun; Smith, Harley M S

    2009-02-01

    Flowers are determinate shoots comprised of perianth and reproductive organs displayed in a whorled phyllotactic pattern. Floral organ identity genes display region-specific expression patterns in the developing flower. In Arabidopsis, floral organ identity genes are activated by LEAFY (LFY), which functions with region-specific co-regulators, UNUSUAL FLORAL ORGANS (UFO) and WUSCHEL (WUS), to up-regulate homeotic genes in specific whorls of the flower. PENNYWISE (PNY) and POUND-FOOLISH (PNF) are redundant functioning BELL1-like homeodomain proteins that are expressed in shoot and floral meristems. During flower development, PNY functions with a co-repressor complex to down-regulate the homeotic gene, AGAMOUS (AG), in the outer whorls of the flower. However, the function of PNY as well as PNF in regulating floral organ identity in the central whorls of the flower is not known. In this report, we show that combining mutations in PNY and PNF enhance the floral patterning phenotypes of weak and strong alleles of lfy, indicating that these BELL1-like homeodomain proteins play a role in the specification of petals, stamens and carpels during flower development. Expression studies show that PNY and PNF positively regulate the homeotic genes, APETALA3 and AG, in the inner whorls of the flower. Moreover, PNY and PNF function in parallel with LFY, UFO and WUS to regulate homeotic gene expression. Since PNY and PNF interact with the KNOTTED1-like homeodomain proteins, SHOOTMERISTEMLESS (STM) and KNOTTED-LIKE from ARABIDOPSIS THALIANA2 (KNAT2) that regulate floral development, we propose that PNY/PNF-STM and PNY/PNF-KNAT2 complexes function in the inner whorls to regulate flower patterning events.

  10. Hematopoietically expressed homeobox (HHEX) gene polymorphism (rs5015480) is associated with increased risk of gestational diabetes mellitus.

    Science.gov (United States)

    Tarnowski, M; Malinowski, D; Safranow, K; Dziedziejko, V; Czerewaty, M; Pawlik, A

    2017-06-01

    Gestational diabetes mellitus (GDM) is a metabolic disorder that occurs during pregnancy. HHEX and PROX1 are genetic loci associated with diabetes mellitus type 2. HHEX and PROX1 play significant roles in carbohydrate intolerance and diabetes because these transcription factors may be involved in the regulation of insulin secretion and in glucose and lipid metabolism. The aim of this study was to examine the association between HHEX (rs5015480) and PROX1 (rs340874) gene polymorphisms and GDM. This study included 204 pregnant women with GDM and 207 pregnant women with the normal glucose tolerance (NGT). The diagnosis of GDM was based on a 75-g oral glucose tolerance test at 24-28 weeks' gestation. There was a statistically significant prevalence of the HHEX rs5015480 CC genotype and C allele among women with GDM (C vs T allele, p = 0.021, odds ratio OR = 1.40, 95% CI: 1.05-1.87). Statistically significant higher increase of body mass and BMI during pregnancy was found in women with the HHEX rs5015480 CC genotype. The results of our study suggest an association between the HHEX gene rs5015480 polymorphism and risk of GDM. The HHEX gene rs5015480 C allele may be a risk allele of GDM that is associated with increased BMI during pregnancy. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Functional Investigation of a Non-coding Variant Associated with Adolescent Idiopathic Scoliosis in Zebrafish: Elevated Expression of the Ladybird Homeobox Gene Causes Body Axis Deformation.

    Directory of Open Access Journals (Sweden)

    Long Guo

    2016-01-01

    Full Text Available Previously, we identified an adolescent idiopathic scoliosis susceptibility locus near human ladybird homeobox 1 (LBX1 and FLJ41350 by a genome-wide association study. Here, we characterized the associated non-coding variant and investigated the function of these genes. A chromosome conformation capture assay revealed that the genome region with the most significantly associated single nucleotide polymorphism (rs11190870 physically interacted with the promoter region of LBX1-FLJ41350. The promoter in the direction of LBX1, combined with a 590-bp region including rs11190870, had higher transcriptional activity with the risk allele than that with the non-risk allele in HEK 293T cells. The ubiquitous overexpression of human LBX1 or either of the zebrafish lbx genes (lbx1a, lbx1b, and lbx2, but not FLJ41350, in zebrafish embryos caused body curvature followed by death prior to vertebral column formation. Such body axis deformation was not observed in transcription activator-like effector nucleases mediated knockout zebrafish of lbx1b or lbx2. Mosaic expression of lbx1b driven by the GATA2 minimal promoter and the lbx1b enhancer in zebrafish significantly alleviated the embryonic lethal phenotype to allow observation of the later onset of the spinal curvature with or without vertebral malformation. Deformation of the embryonic body axis by lbx1b overexpression was associated with defects in convergent extension, which is a component of the main axis-elongation machinery in gastrulating embryos. In embryos overexpressing lbx1b, wnt5b, a ligand of the non-canonical Wnt/planar cell polarity (PCP pathway, was significantly downregulated. Injection of mRNA for wnt5b or RhoA, a key downstream effector of Wnt/PCP signaling, rescued the defective convergent extension phenotype and attenuated the lbx1b-induced curvature of the body axis. Thus, our study presents a novel pathological feature of LBX1 and its zebrafish homologs in body axis deformation at

  12. Plant gene technology: social considerations

    African Journals Online (AJOL)

    Administrator

    The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...

  13. MEIS homeobox genes in neuroblastoma

    NARCIS (Netherlands)

    Geerts, Dirk; Revet, Ingrid; Jorritsma, Gerda; Schilderink, Nathalie; Versteeg, Rogier

    2005-01-01

    The common pediatric tumor neuroblastoma originates from primitive neural crest-derived precursor cells of the peripheral nervous system. Neuroblastoma especially affects very young children, and can already be present at birth. Its early onset and cellular origin predict the involvement of

  14. Timing the Generation of Distinct Retinal Cells by Homeobox Proteins

    Science.gov (United States)

    Decembrini, Sarah; Andreazzoli, Massimiliano; Vignali, Robert; Barsacchi, Giuseppina; Cremisi, Federico

    2006-01-01

    The reason why different types of vertebrate nerve cells are generated in a particular sequence is still poorly understood. In the vertebrate retina, homeobox genes play a crucial role in establishing different cell identities. Here we provide evidence of a cellular clock that sequentially activates distinct homeobox genes in embryonic retinal cells, linking the identity of a retinal cell to its time of generation. By in situ expression analysis, we found that the three Xenopus homeobox genes Xotx5b, Xvsx1, and Xotx2 are initially transcribed but not translated in early retinal progenitors. Their translation requires cell cycle progression and is sequentially activated in photoreceptors (Xotx5b) and bipolar cells (Xvsx1 and Xotx2). Furthermore, by in vivo lipofection of “sensors” in which green fluorescent protein translation is under control of the 3′ untranslated region (UTR), we found that the 3′ UTRs of Xotx5b, Xvsx1, and Xotx2 are sufficient to drive a spatiotemporal pattern of translation matching that of the corresponding proteins and consistent with the time of generation of photoreceptors (Xotx5b) and bipolar cells (Xvsx1 and Xotx2). The block of cell cycle progression of single early retinal progenitors impairs their differentiation as photoreceptors and bipolar cells, but is rescued by the lipofection of Xotx5b and Xvsx1 coding sequences, respectively. This is the first evidence to our knowledge that vertebrate homeobox proteins can work as effectors of a cellular clock to establish distinct cell identities. PMID:16903786

  15. Timing the generation of distinct retinal cells by homeobox proteins.

    Directory of Open Access Journals (Sweden)

    Sarah Decembrini

    2006-09-01

    Full Text Available The reason why different types of vertebrate nerve cells are generated in a particular sequence is still poorly understood. In the vertebrate retina, homeobox genes play a crucial role in establishing different cell identities. Here we provide evidence of a cellular clock that sequentially activates distinct homeobox genes in embryonic retinal cells, linking the identity of a retinal cell to its time of generation. By in situ expression analysis, we found that the three Xenopus homeobox genes Xotx5b, Xvsx1, and Xotx2 are initially transcribed but not translated in early retinal progenitors. Their translation requires cell cycle progression and is sequentially activated in photoreceptors (Xotx5b and bipolar cells (Xvsx1 and Xotx2. Furthermore, by in vivo lipofection of "sensors" in which green fluorescent protein translation is under control of the 3' untranslated region (UTR, we found that the 3' UTRs of Xotx5b, Xvsx1, and Xotx2 are sufficient to drive a spatiotemporal pattern of translation matching that of the corresponding proteins and consistent with the time of generation of photoreceptors (Xotx5b and bipolar cells (Xvsx1 and Xotx2. The block of cell cycle progression of single early retinal progenitors impairs their differentiation as photoreceptors and bipolar cells, but is rescued by the lipofection of Xotx5b and Xvsx1 coding sequences, respectively. This is the first evidence to our knowledge that vertebrate homeobox proteins can work as effectors of a cellular clock to establish distinct cell identities.

  16. Capsicum annuum homeobox 1 (CaHB1) is a nuclear factor that has roles in plant development, salt tolerance, and pathogen defense

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sang-Keun; Yoon, Joonseon [Department of Plant Science, College of Agriculture and Life Sciences, Seoul National University, Seou1 151-742 (Korea, Republic of); Choi, Gyung Ja [Screening Division, Korea Research Institute of Chemical Technology, Daejeon 305-600 (Korea, Republic of); Jang, Hyun A; Kwon, Suk-Yoon [Korea Research Institute of Bioscience and Biotechnology, Yusung, Daejeon 305-600 (Korea, Republic of); Choi, Doil, E-mail: doil@snu.ac.kr [Department of Plant Science, College of Agriculture and Life Sciences, Seoul National University, Seou1 151-742 (Korea, Republic of)

    2013-12-06

    Highlights: •The CaHB1 is a nuclear factor, belonging to HD-Zip proteins. •SA and ET, as signal molecules, modulate CaHB1-mediated responses. •Overexpression of CaHB1 in tomato resulted in a thicker cell wall. •CaHB1-transgenic tomato confers resistance to Phytophthora infestans. •CaHB1 enhanced tolerance to saline stress in tomato. -- Abstract: Homeodomain-leucine zipper (HD-Zip) family proteins are unique to plants, but little is known about their role in defense responses. CaHB1 is a nuclear factor in peppers, belonging to subfamily II of HD-Zip proteins. Here, we determined the role of CaHB1 in the defense response. CaHB1 expression was induced when pepper plants were challenged with Phytophthora capsici, a plant pathogen to which peppers are susceptible, or environmental stresses such as drought and salt stimuli. CaHB1 was also highly expressed in pepper leaves following application of SA, whereas ethephon and MeJA had a moderate effect. To further investigate the function of CaHB1 in plants, we performed gain-of-function study by overexpression of CaHB1 in tomato. CaHB1-transgenic tomatoes showed significant growth enhancement including increased leaf thickness and enlarged cell size (1.8-fold larger than control plants). Microscopic analysis revealed that leaves from CaHB1-transgenic plants had thicker cell walls and cuticle layers than those from controls. Moreover, CaHB1-transgenic plants displayed enhanced resistance against Phytophthora infestans and increased tolerance to salt stress. Additionally, RT-PCR analysis of CaHB1-transgenic tomatoes revealed constitutive up-regulation of multiple genes involved in plant defense and osmotic stress. Therefore, our findings suggest roles for CaHB1 in development, salt stress, and pathogen defense.

  17. Capsicum annuum homeobox 1 (CaHB1) is a nuclear factor that has roles in plant development, salt tolerance, and pathogen defense

    International Nuclear Information System (INIS)

    Oh, Sang-Keun; Yoon, Joonseon; Choi, Gyung Ja; Jang, Hyun A; Kwon, Suk-Yoon; Choi, Doil

    2013-01-01

    Highlights: •The CaHB1 is a nuclear factor, belonging to HD-Zip proteins. •SA and ET, as signal molecules, modulate CaHB1-mediated responses. •Overexpression of CaHB1 in tomato resulted in a thicker cell wall. •CaHB1-transgenic tomato confers resistance to Phytophthora infestans. •CaHB1 enhanced tolerance to saline stress in tomato. -- Abstract: Homeodomain-leucine zipper (HD-Zip) family proteins are unique to plants, but little is known about their role in defense responses. CaHB1 is a nuclear factor in peppers, belonging to subfamily II of HD-Zip proteins. Here, we determined the role of CaHB1 in the defense response. CaHB1 expression was induced when pepper plants were challenged with Phytophthora capsici, a plant pathogen to which peppers are susceptible, or environmental stresses such as drought and salt stimuli. CaHB1 was also highly expressed in pepper leaves following application of SA, whereas ethephon and MeJA had a moderate effect. To further investigate the function of CaHB1 in plants, we performed gain-of-function study by overexpression of CaHB1 in tomato. CaHB1-transgenic tomatoes showed significant growth enhancement including increased leaf thickness and enlarged cell size (1.8-fold larger than control plants). Microscopic analysis revealed that leaves from CaHB1-transgenic plants had thicker cell walls and cuticle layers than those from controls. Moreover, CaHB1-transgenic plants displayed enhanced resistance against Phytophthora infestans and increased tolerance to salt stress. Additionally, RT-PCR analysis of CaHB1-transgenic tomatoes revealed constitutive up-regulation of multiple genes involved in plant defense and osmotic stress. Therefore, our findings suggest roles for CaHB1 in development, salt stress, and pathogen defense

  18. Plant domestication and gene banks

    International Nuclear Information System (INIS)

    Perrino, P.

    1989-01-01

    At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs

  19. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  20. XLMR in MRX families 29, 32, 33 and 38 results from the dup24 mutation in the ARX (Aristaless related homeobox gene

    Directory of Open Access Journals (Sweden)

    MacMillan Andrée

    2005-04-01

    Full Text Available Abstract Background X-linked mental retardation (XLMR is the leading cause of mental retardation in males. Mutations in the ARX gene in Xp22.1 have been found in numerous families with both nonsyndromic and syndromic XLMR. The most frequent mutation in this gene is a 24 bp duplication in exon 2. Based on this fact, a panel of XLMR families linked to Xp22 was tested for this particular ARX mutation. Methods Genomic DNA from XLMR families linked to Xp22.1 was amplified for exon 2 in ARX using a Cy5 labeled primer pair. The resulting amplicons were sized using the ALFexpress automated sequencer. Results A panel of 11 families with X-linked mental retardation was screened for the ARX 24dup mutation. Four nonsyndromic XLMR families – MRX29, MRX32, MRX33 and MRX38 – were found to have this particular gene mutation. Conclusion We have identified 4 additional XLMR families with the ARX dup24 mutation from a panel of 11 XLMR families linked to Xp22.1. This finding makes the ARX dup24 mutation the most common mutation in nonsyndromic XLMR families linked to Xp22.1. As this mutation can be readily tested for using an automated sequencer, screening should be considered for any male with nonsyndromic MR of unknown etiology.

  1. The Lotus japonicus ndx gene family is involved in nodule function and maintenance

    DEFF Research Database (Denmark)

    Grønlund, Mette; Gustafsen, Camilla; Jensen, Dorthe Bødker

    2003-01-01

    To elucidate the function of the ndx homeobox genes during the Rhizobium-legume symbiosis, two Lotus japonicus ndr genes were expressed in the antisense orientation under the control of the nodule-expressed promoter Psenod12 in transgenic Lotus japonicus plants. Many of the transformants obtained...

  2. JGI Plant Genomics Gene Annotation Pipeline

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese

    2014-07-14

    Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.

  3. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  4. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  5. Genes of the most conserved WOX clade in plants affect root and flower development in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Moreau Hervé

    2008-10-01

    Full Text Available Abstract Background The Wuschel related homeobox (WOX family proteins are key regulators implicated in the determination of cell fate in plants by preventing cell differentiation. A recent WOX phylogeny, based on WOX homeodomains, showed that all of the Physcomitrella patens and Selaginella moellendorffii WOX proteins clustered into a single orthologous group. We hypothesized that members of this group might preferentially share a significant part of their function in phylogenetically distant organisms. Hence, we first validated the limits of the WOX13 orthologous group (WOX13 OG using the occurrence of other clade specific signatures and conserved intron insertion sites. Secondly, a functional analysis using expression data and mutants was undertaken. Results The WOX13 OG contained the most conserved plant WOX proteins including the only WOX detected in the highly proliferating basal unicellular and photosynthetic organism Ostreococcus tauri. A large expansion of the WOX family was observed after the separation of mosses from other land plants and before monocots and dicots have arisen. In Arabidopsis thaliana, AtWOX13 was dynamically expressed during primary and lateral root initiation and development, in gynoecium and during embryo development. AtWOX13 appeared to affect the floral transition. An intriguing clade, represented by the functional AtWOX14 gene inside the WOX13 OG, was only found in the Brassicaceae. Compared to AtWOX13, the gene expression profile of AtWOX14 was restricted to the early stages of lateral root formation and specific to developing anthers. A mutational insertion upstream of the AtWOX14 homeodomain sequence led to abnormal root development, a delay in the floral transition and premature anther differentiation. Conclusion Our data provide evidence in favor of the WOX13 OG as the clade containing the most conserved WOX genes and established a functional link to organ initiation and development in Arabidopsis, most

  6. Major gene mutations and domestication of plants

    International Nuclear Information System (INIS)

    Ashri, A.

    1989-01-01

    From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

  7. Transfer of engineered genes from crop to wild plants

    DEFF Research Database (Denmark)

    Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.

    1996-01-01

    The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...

  8. Use of NAP gene to manipulate leaf senescence in plants

    Science.gov (United States)

    Gan, Susheng; Guo, Yongfeng

    2013-04-16

    The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.

  9. Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2013-12-01

    Full Text Available Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules and/or by the plant roots (e.g. flavonoids, ethanol and methanol, respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones and plant exudates (including ethanol in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF, adaptation to stressful environment (crtI, phoU and sss, to interactions with plant metabolism compounds (acdS and pathogenicity (patatin and phoU. Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization, which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction.

  10. Fungal and plant gene expression in arbuscular mycorrhizal symbiosis.

    Science.gov (United States)

    Balestrini, Raffaella; Lanfranco, Luisa

    2006-11-01

    Arbuscular mycorrhizas (AMs) are a unique example of symbiosis between two eukaryotes, soil fungi and plants. This association induces important physiological changes in each partner that lead to reciprocal benefits, mainly in nutrient supply. The symbiosis results from modifications in plant and fungal cell organization caused by specific changes in gene expression. Recently, much effort has gone into studying these gene expression patterns to identify a wider spectrum of genes involved. We aim in this review to describe AM symbiosis in terms of current knowledge on plant and fungal gene expression profiles.

  11. Diversification of Root Hair Development Genes in Vascular Plants.

    Science.gov (United States)

    Huang, Ling; Shi, Xinhui; Wang, Wenjia; Ryu, Kook Hui; Schiefelbein, John

    2017-07-01

    The molecular genetic program for root hair development has been studied intensively in Arabidopsis ( Arabidopsis thaliana ). To understand the extent to which this program might operate in other plants, we conducted a large-scale comparative analysis of root hair development genes from diverse vascular plants, including eudicots, monocots, and a lycophyte. Combining phylogenetics and transcriptomics, we discovered conservation of a core set of root hair genes across all vascular plants, which may derive from an ancient program for unidirectional cell growth coopted for root hair development during vascular plant evolution. Interestingly, we also discovered preferential diversification in the structure and expression of root hair development genes, relative to other root hair- and root-expressed genes, among these species. These differences enabled the definition of sets of genes and gene functions that were acquired or lost in specific lineages during vascular plant evolution. In particular, we found substantial divergence in the structure and expression of genes used for root hair patterning, suggesting that the Arabidopsis transcriptional regulatory mechanism is not shared by other species. To our knowledge, this study provides the first comprehensive view of gene expression in a single plant cell type across multiple species. © 2017 American Society of Plant Biologists. All Rights Reserved.

  12. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  13. Divergence and Conservative Evolution of XTNX Genes in Land Plants

    Directory of Open Access Journals (Sweden)

    Yan-Mei Zhang

    2017-10-01

    Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.

  14. Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

    International Nuclear Information System (INIS)

    Yousaf, Sohail; Afzal, Muhammad; Reichenauer, Thomas G.; Brady, Carrie L.; Sessitsch, Angela

    2011-01-01

    The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: → E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. → E. ludwigii strains efficiently expressed alkane degradation genes in plants. → E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. → E. ludwigii interacted more effectively with Italian ryegrass than with other plants. → Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

  15. Hydrocarbon degradation, plant colonization and gene expression of alkane degradation genes by endophytic Enterobacter ludwigii strains

    Energy Technology Data Exchange (ETDEWEB)

    Yousaf, Sohail [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); Afzal, Muhammad [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad (Pakistan); Reichenauer, Thomas G. [AIT Austrian Institute of Technology GmbH, Environmental Resources and Technologies Unit, A-2444 Seibersdorf (Austria); Brady, Carrie L. [Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria (South Africa); Sessitsch, Angela, E-mail: angela.sessitsch@ait.ac.at [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria)

    2011-10-15

    The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: > E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. > E. ludwigii strains efficiently expressed alkane degradation genes in plants. > E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. > E. ludwigii interacted more effectively with Italian ryegrass than with other plants. > Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.

  16. Plant isoflavone and isoflavanone O-methyltransferase genes

    Science.gov (United States)

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  17. Hypothalamic neurosecretory and circadian vasopressinergic neuronal systems in the blind cone-rod homeobox knock out mouse (Crx(-/-) ) and the 129sv wild type mouse

    DEFF Research Database (Denmark)

    Rovsing, Louise; Rath, Martin Fredensborg; Møller, Morten

    2013-01-01

    circadian AVP-rhythm. We have in this study of the brown 129sv mouse and the visual blind cone-rod homeobox gene knock out mouse (Crx(-/-) ) with degeneration of the retinal rods and cones, but a preserved non-image forming optic system, studied the temporal Avp-expression in both the neurosecretory...

  18. Expression of streptavidin gene in bacteria and plants

    International Nuclear Information System (INIS)

    Guan, Xueni; Wurtele, E.S.; Nikolau, B.J.

    1990-01-01

    Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot

  19. Dwarf Tiller1, a Wuschel-related homeobox transcription factor, is required for tiller growth in rice.

    Directory of Open Access Journals (Sweden)

    Wenfei Wang

    2014-03-01

    Full Text Available Unlike many wild grasses, domesticated rice cultivars have uniform culm height and panicle size among tillers and the main shoot, which is an important trait for grain yield. However, the genetic basis of this trait remains unknown. Here, we report that Dwarf Tiller1 (DWT1 controls the developmental uniformity of the main shoot and tillers in rice (Oryza sativa. Most dwt1 mutant plants develop main shoots with normal height and larger panicles, but dwarf tillers bearing smaller panicles compared with those of the wild type. In addition, dwt1 tillers have shorter internodes with fewer and un-elongated cells compared with the wild type, indicating that DWT1 affects cell division and cell elongation. Map-based cloning revealed that DWT1 encodes a Wuschel-related homeobox (WOX transcription factor homologous to the Arabidopsis WOX8 and WOX9. The DWT1 gene is highly expressed in young panicles, but undetectable in the internodes, suggesting that DWT1 expression is spatially or temporally separated from its effect on the internode growth. Transcriptomic analysis revealed altered expression of genes involved in cell division and cell elongation, cytokinin/gibberellin homeostasis and signaling in dwt1 shorter internodes. Moreover, the non-elongating internodes of dwt1 are insensitive to exogenous gibberellin (GA treatment, and some of the slender rice1 (slr1 dwt1 double mutant exhibits defective internodes similar to the dwt1 single mutant, suggesting that the DWT1 activity in the internode elongation is directly or indirectly associated with GA signaling. This study reveals a genetic pathway synchronizing the development of tillers and the main shoot, and a new function of WOX genes in balancing branch growth in rice.

  20. DWARF TILLER1, a WUSCHEL-Related Homeobox Transcription Factor, Is Required for Tiller Growth in Rice

    Science.gov (United States)

    Wang, Wenfei; Li, Gang; Zhao, Jun; Chu, Huangwei; Lin, Wenhui; Zhang, Dabing; Wang, Zhiyong; Liang, Wanqi

    2014-01-01

    Unlike many wild grasses, domesticated rice cultivars have uniform culm height and panicle size among tillers and the main shoot, which is an important trait for grain yield. However, the genetic basis of this trait remains unknown. Here, we report that DWARF TILLER1 (DWT1) controls the developmental uniformity of the main shoot and tillers in rice (Oryza sativa). Most dwt1 mutant plants develop main shoots with normal height and larger panicles, but dwarf tillers bearing smaller panicles compared with those of the wild type. In addition, dwt1 tillers have shorter internodes with fewer and un-elongated cells compared with the wild type, indicating that DWT1 affects cell division and cell elongation. Map-based cloning revealed that DWT1 encodes a WUSCHEL-related homeobox (WOX) transcription factor homologous to the Arabidopsis WOX8 and WOX9. The DWT1 gene is highly expressed in young panicles, but undetectable in the internodes, suggesting that DWT1 expression is spatially or temporally separated from its effect on the internode growth. Transcriptomic analysis revealed altered expression of genes involved in cell division and cell elongation, cytokinin/gibberellin homeostasis and signaling in dwt1 shorter internodes. Moreover, the non-elongating internodes of dwt1 are insensitive to exogenous gibberellin (GA) treatment, and some of the slender rice1 (slr1) dwt1 double mutant exhibits defective internodes similar to the dwt1 single mutant, suggesting that the DWT1 activity in the internode elongation is directly or indirectly associated with GA signaling. This study reveals a genetic pathway synchronizing the development of tillers and the main shoot, and a new function of WOX genes in balancing branch growth in rice. PMID:24625559

  1. Localizing genes using linkage disequilibrium in plants: integrating ...

    African Journals Online (AJOL)

    GREGO

    2007-03-19

    Mar 19, 2007 ... Localizing genes using linkage disequilibrium in plants: integrating lessons ... reduce that association as a function of the marker distance from the QTL. ..... the gene locus enhanced the resolution power of asso- ciation tests .... agents, such as insects, birds, water and wind, so mating is determined by a ...

  2. Alteration of plant meristem function by manipulation of the Retinoblastoma-like plant RRB gene

    Science.gov (United States)

    Durfee, Tim [Madison, WI; Feiler, Heidi [Albany, CA; Gruissem, Wilhelm [Forch, CH; Jenkins, Susan [Martinez, CA; Roe, Judith [Manhattan, KS; Zambryski, Patricia [Berkeley, CA

    2007-01-16

    This invention provides methods and compositions for altering the growth, organization, and differentiation of plant tissues. The invention is based on the discovery that, in plants, genetically altering the levels of Retinoblastoma-related gene (RRB) activity produces dramatic effects on the growth, proliferation, organization, and differentiation of plant meristem.

  3. QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD

    Science.gov (United States)

    Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...

  4. Plant improvement by known-function genes

    Directory of Open Access Journals (Sweden)

    Jesús Quiroz Chávez

    2012-09-01

    Full Text Available Plant molecular improvement by recombinant DNA technology represents an advantage to obtain new varieties or traits. This technique is promised for genetic improvement of crop plants. Lines with increased yield, quality, disease resistance, or tolerant to abiotic stress have been obtained, with clear advantages for producers, marketers and consumers. However, they have several limitations in its application to agriculture because of its risk and hazards. The aim of the document is to show the advantages and disadvantages of GM crop plant, to develop represent an opportunity to have new exotic traits.

  5. Plant Genes Involved in Symbiotic Sinal Perception/Signal Transduction

    DEFF Research Database (Denmark)

    Binder, A; Soyano, T; Hayashi, H

    2014-01-01

    to nodule primordia formation, and the infection thread initiation in the root hairs guiding bacteria towards dividing cortical cells. This chapter focuses on the plant genes involved in the recognition of the symbiotic signal produced by rhizobia, and the downstream genes, which are part of a complex...... symbiotic signalling pathway that leads to the generation of calcium spiking in the nuclear regions and activation of transcription factors controlling symbiotic genes induction...

  6. Emerging use of gene expression microarrays in plant physiology.

    Science.gov (United States)

    Wullschleger, Stan D; Difazio, Stephen P

    2003-01-01

    Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

  7. Emerging Use of Gene Expression Microarrays in Plant Physiology

    Directory of Open Access Journals (Sweden)

    Stephen P. Difazio

    2006-04-01

    Full Text Available Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.

  8. Repressor-mediated tissue-specific gene expression in plants

    Science.gov (United States)

    Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

    2009-02-17

    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  9. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  10. Homeobox transcription factor muscle segment homeobox 2 (Msx2) correlates with good prognosis in breast cancer patients and induces apoptosis in vitro.

    LENUS (Irish Health Repository)

    Lanigan, Fiona

    2010-01-01

    The homeobox-containing transcription factor muscle segment homeobox 2 (Msx2) plays an important role in mammary gland development. However, the clinical implications of Msx2 expression in breast cancer are unclear. The aims of this study were to investigate the potential clinical value of Msx2 as a breast cancer biomarker and to clarify its functional role in vitro.

  11. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  12. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile

    2008-12-01

    Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  13. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  14. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  15. Zinc-fingers and homeoboxes 1 (ZHX1) binds DNA methyltransferase (DNMT) 3B to enhance DNMT3B-mediated transcriptional repression

    International Nuclear Information System (INIS)

    Kim, Sung-Hak; Park, Jinah; Choi, Moon-Chang; Kim, Hwang-Phill; Park, Jung-Hyun; Jung, Yeonjoo; Lee, Ju-Hee; Oh, Do-Youn; Im, Seock-Ah; Bang, Yung-Jue; Kim, Tae-You

    2007-01-01

    DNA methyltransferases (DNMT) 3B is a de novo DNMT that represses transcription independent of DNMT activity. In order to gain a better insight into DNMT3B-mediated transcriptional repression, we performed a yeast two-hybrid analysis using DNMT3B as a bait. Of the various binding candidates, ZHX1, a member of zinc-finger and homeobox protein, was found to interact with DNMT3B in vivo and in vitro. N-terminal PWWP domain of DNMT3B was required for its interaction with homeobox motifs of ZHX1. ZHX1 contains nuclear localization signal at C-terminal homeobox motif, and both ZHX1 and DNMT3B were co-localized in nucleus. Furthermore, we found that ZHX1 enhanced the transcriptional repression mediated by DNMT3B when DNMT3B is directly targeted to DNA. These results showed for First the direct linkage between DNMT and zinc-fingers homeoboxes protein, leading to enhanced gene silencing by DNMT3B

  16. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  17. Plant gene bank and vegetable varieties biodiversity in Smederevska Palanka

    Directory of Open Access Journals (Sweden)

    Pavlović Nenad

    2011-01-01

    Full Text Available Biodiversity protection and preservation of genetic variability is based on the fact that plant varieties are irreplaceable in production process and that they are more and more jeopardized by urban and industrial development. The most common way of preserving and at the same time the safest way is a storage in a gene bank. Prior to storage comes collecting, studying and replanting for Institute Gene Bank, Central State Gene Bank and for Regional Gene Banks. Institute for Vegetable Crops in Smederevska Palanka preserves a wide variety of vegetable germplasm. This is, so called, work collection, used as a gene resource for breeding purposes. Seed samples are stored at 4±2°C and 50% relative humidity. At the moment, the collection has 2265 samples. Almost all samples have the passport data, but only 10% of samples have been further characterized and evaluated.

  18. Gene Discovery and Functional Analyses in the Model Plant Arabidopsis

    DEFF Research Database (Denmark)

    Feng, Cai-ping; Mundy, J.

    2006-01-01

    The present mini-review describes newer methods and strategies, including transposon and T-DNA insertions, TILLING, Deleteagene, and RNA interference, to functionally analyze genes of interest in the model plant Arabidopsis. The relative advantages and disadvantages of the systems are also discus...

  19. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Science.gov (United States)

    2010-01-01

    Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests

  20. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    Directory of Open Access Journals (Sweden)

    Hao Weilong

    2010-12-01

    Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native

  1. Gene expression from plants grown on the International Space Station

    Science.gov (United States)

    Stimpson, Alexander; Pereira, Rhea; Kiss, John Z.; Correll, Melanie

    Three experiments were performed on the International Space Station (ISS) in 2006 as part of the TROPI experiments. These experiments were performed to study graviTROPIsm and photoTROPIsm responses of Arabidopsis in microgravity (µg). Seedlings were grown with a variety of light and gravitational treatments for approximately five days. The frozen samples were returned to Earth during three space shuttle missions in 2007 and stored at -80° C. Due to the limited amount of plant biomass returned, new protocols were developed to minimize the amount of material needed for RNA extraction as a preparation for microarray analysis. Using these new protocols, RNA was extracted from several sets of seedlings grown in red light followed by blue light with one sample from 1.0g treatment and the other at µg. Using a 2-fold change criterion, microarray (Affymetrix, GeneChip) results showed that 613 genes were upregulated in the µg sample while 757 genes were downregulated. Upregulated genes in response to µg included transcription factors from the WRKY (15 genes), MYB (3) and ZF (8) families as well as those that are involved in auxin responses (10). Downregulated genes also included transcription factors such as MYB (5) and Zinc finger (10) but interestingly only two WRKY family genes were down-regulated during the µg treatment. Studies are underway to compare these results with other samples to identify the genes involved in the gravity and light signal transduction pathways (this project is Supported By: NASA NCC2-1200).

  2. Agrobacterium-mediated gene transfer in plants and biosafety considerations.

    Science.gov (United States)

    Mehrotra, Shweta; Goyal, Vinod

    2012-12-01

    Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.

  3. pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature

    Science.gov (United States)

    Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.

    2015-01-01

    Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475

  4. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  5. Endophytic Herbaspirillum seropedicae expresses nif genes in gramineous plants.

    Science.gov (United States)

    Roncato-Maccari, Lauren D B; Ramos, Humberto J O; Pedrosa, Fabio O; Alquini, Yedo; Chubatsu, Leda S; Yates, Marshall G; Rigo, Liu U; Steffens, Maria Berenice R; Souza, Emanuel M

    2003-07-01

    Abstract The interactions between maize, sorghum, wheat and rice plants and Herbaspirillum seropedicae were examined microscopically following inoculation with the H. seropedicae LR15 strain, a Nif(+) (Pnif::gusA) mutant obtained by the insertion of a gusA-kanamycin cassette into the nifH gene of the H. seropedicae wild-type strain. The expression of the Pnif::gusA fusion was followed during the association of the diazotroph with the gramineous species. Histochemical analysis of seedlings of maize, sorghum, wheat and rice grown in vermiculite showed that strain LR15 colonized root surfaces and inner tissues. In early steps of the endophytic association, H. seropedicae colonized root exudation sites, such as axils of secondary roots and intercellular spaces of the root cortex; it then occupied the vascular tissue and there expressed nif genes. The expression of nif genes occurred in roots, stems and leaves as detected by the GUS reporter system. The expression of nif genes was also observed in bacterial colonies located in the external mucilaginous root material, 8 days after inoculation. Moreover, the colonization of plant tissue by H. seropedicae did not depend on the nitrogen-fixing ability, since similar numbers of cells were isolated from roots or shoots of the plants inoculated with Nif(+) or Nif(-) strains.

  6. Effector gene birth in plant parasitic nematodes: Neofunctionalization of a housekeeping glutathione synthetase gene

    Science.gov (United States)

    Lilley, Catherine J.; Maqbool, Abbas; Wu, Duqing; Yusup, Hazijah B.; Jones, Laura M.; Birch, Paul R. J.; Urwin, Peter E.

    2018-01-01

    Plant pathogens and parasites are a major threat to global food security. Plant parasitism has arisen four times independently within the phylum Nematoda, resulting in at least one parasite of every major food crop in the world. Some species within the most economically important order (Tylenchida) secrete proteins termed effectors into their host during infection to re-programme host development and immunity. The precise detail of how nematodes evolve new effectors is not clear. Here we reconstruct the evolutionary history of a novel effector gene family. We show that during the evolution of plant parasitism in the Tylenchida, the housekeeping glutathione synthetase (GS) gene was extensively replicated. New GS paralogues acquired multiple dorsal gland promoter elements, altered spatial expression to the secretory dorsal gland, altered temporal expression to primarily parasitic stages, and gained a signal peptide for secretion. The gene products are delivered into the host plant cell during infection, giving rise to “GS-like effectors”. Remarkably, by solving the structure of GS-like effectors we show that during this process they have also diversified in biochemical activity, and likely represent the founding members of a novel class of GS-like enzyme. Our results demonstrate the re-purposing of an endogenous housekeeping gene to form a family of effectors with modified functions. We anticipate that our discovery will be a blueprint to understand the evolution of other plant-parasitic nematode effectors, and the foundation to uncover a novel enzymatic function. PMID:29641602

  7. Signal Network Analysis of Plant Genes Responding to Ionizing Radiation

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon

    2012-12-01

    In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication

  8. Gene Delivery into Plant Cells for Recombinant Protein Production

    Directory of Open Access Journals (Sweden)

    Qiang Chen

    2015-01-01

    Full Text Available Recombinant proteins are primarily produced from cultures of mammalian, insect, and bacteria cells. In recent years, the development of deconstructed virus-based vectors has allowed plants to become a viable platform for recombinant protein production, with advantages in versatility, speed, cost, scalability, and safety over the current production paradigms. In this paper, we review the recent progress in the methodology of agroinfiltration, a solution to overcome the challenge of transgene delivery into plant cells for large-scale manufacturing of recombinant proteins. General gene delivery methodologies in plants are first summarized, followed by extensive discussion on the application and scalability of each agroinfiltration method. New development of a spray-based agroinfiltration and its application on field-grown plants is highlighted. The discussion of agroinfiltration vectors focuses on their applications for producing complex and heteromultimeric proteins and is updated with the development of bridge vectors. Progress on agroinfiltration in Nicotiana and non-Nicotiana plant hosts is subsequently showcased in context of their applications for producing high-value human biologics and low-cost and high-volume industrial enzymes. These new advancements in agroinfiltration greatly enhance the robustness and scalability of transgene delivery in plants, facilitating the adoption of plant transient expression systems for manufacturing recombinant proteins with a broad range of applications.

  9. Smad4-dependent suppressor pituitary homeobox 2 promotes PPP2R2A-mediated inhibition of Akt pathway in pancreatic cancer

    OpenAIRE

    Wang, Qi; Li, Juanjuan; Wu, Wei; Shen, Ruizhe; Jiang, He; Qian, Yuting; Tang, Yanping; Bai, Tingting; Wu, Sheng; Wei, Lumin; Zang, Yi; Zhang, Ji; Wang, Lifu

    2016-01-01

    The importance of Pituitary homeobox 2 (Pitx2) in malignancy remains enigmatic, and Pitx2 has not been previously implicated in pancreatic ductal adenocarcinoma (PDAC). In this study, we performed gene expression profiling of human PDAC tissues and identified Pitx2 as a promising candidate. Pitx2 expression was decreased from 2.6- to 19-fold in human PDAC tissues from microarray units. Immunochemistry staining showed that Pitx2 expression was moderate to intense in normal pancreatic and pancr...

  10. Major intrinsic proteins (MIPs) in plants: a complex gene family with major impacts on plant phenotype.

    Science.gov (United States)

    Forrest, Kerrie L; Bhave, Mrinal

    2007-10-01

    The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.

  11. Actin gene identification from selected medicinal plants for their use as internal controls for gene expression studies

    International Nuclear Information System (INIS)

    Mufti, F.U.D.; Banaras, S.

    2015-01-01

    Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)

  12. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  13. Evolution, diversification and expression of KNOX proteins in plants

    Directory of Open Access Journals (Sweden)

    Jie eGao

    2015-10-01

    Full Text Available The KNOX (KNOTTED1-like homeobox transcription factors play a pivotal role in leaf and meristem development. The majority of these proteins are characterized by the KNOX1, KNOX2, ELK and homeobox domains whereas the proteins of the KNATM family contain only the KNOX domains. We carried out an extensive inventory of these proteins and here report on a total of 394 KNOX proteins from 48 species. The land plant proteins fall into two classes (I and II as previously shown where the class I family seems to be most closely related to the green algae homologs. The KNATM proteins are restricted to Eudicots and some species have multiple paralogs of this protein. Certain plants are characterized by a significant increase in the number of KNOX paralogs; one example is Glycine max. Through the analysis of public gene expression data we show that the class II proteins of this plant have a relatively broad expression specificity as compared to class I proteins, consistent with previous studies of other plants. In G. max, class I protein are mainly distributed in axis tissues and KNATM paralogs are overall poorly expressed; highest expression is in the early plumular axis. Overall, analysis of gene expression in G. max demonstrates clearly that the expansion in gene number is associated with functional diversification.

  14. The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.

    Science.gov (United States)

    Masle, Josette; Gilmore, Scott R; Farquhar, Graham D

    2005-08-11

    Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.

  15. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  16. Plant responses to environmental stresses-from gene to biotechnology.

    Science.gov (United States)

    Ahanger, Mohammad Abass; Akram, Nudrat Aisha; Ashraf, Muhammad; Alyemeni, Mohammed Nasser; Wijaya, Leonard; Ahmad, Parvaiz

    2017-07-01

    Increasing global population, urbanization and industrialization are increasing the rate of conversion of arable land into wasteland. Supplying food to an ever-increasing population is one of the biggest challenges that agriculturalists and plant scientists are currently confronting. Environmental stresses make this situation even graver. Despite the induction of several tolerance mechanisms, sensitive plants often fail to survive under environmental extremes. New technological approaches are imperative. Conventional breeding methods have a limited potential to improve plant genomes against environmental stress. Recently, genetic engineering has contributed enormously to the development of genetically modified varieties of different crops such as cotton, maize, rice, canola and soybean. The identification of stress-responsive genes and their subsequent introgression or overexpression within sensitive crop species are now being widely carried out by plant scientists. Engineering of important tolerance pathways, like antioxidant enzymes, osmolyte accumulation, membrane-localized transporters for efficient compartmentation of deleterious ions and accumulation of essential elements and resistance against pests or pathogens is also an area that has been intensively researched. In this review, the role of biotechnology and its successes, prospects and challenges in developing stress-tolerant crop cultivars are discussed.

  17. Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants

    Science.gov (United States)

    Basyuni, M.; Wati, R.

    2018-03-01

    The present study evaluates the bioinformatics methods to analyze twenty-four predicted polyprenol reductase genes from higher plants on GenBank as well as predicted the structure, composition, similarity, subcellular localization, and phylogenetic. The physicochemical properties of plant polyprenol showed diversity among the observed genes. The percentage of the secondary structure of plant polyprenol genes followed the ratio order of α helix > random coil > extended chain structure. The values of chloroplast but not signal peptide were too low, indicated that few chloroplast transit peptide in plant polyprenol reductase genes. The possibility of the potential transit peptide showed variation among the plant polyprenol reductase, suggested the importance of understanding the variety of peptide components of plant polyprenol genes. To clarify this finding, a phylogenetic tree was drawn. The phylogenetic tree shows several branches in the tree, suggested that plant polyprenol reductase genes grouped into divergent clusters in the tree.

  18. DELLA genes restrict inflorescence meristem function independently of plant height.

    Science.gov (United States)

    Serrano-Mislata, Antonio; Bencivenga, Stefano; Bush, Max; Schiessl, Katharina; Boden, Scott; Sablowski, Robert

    2017-09-01

    DELLA proteins associate with transcription factors to control plant growth in response to gibberellin 1 . Semi-dwarf DELLA mutants with improved harvest index and decreased lodging greatly improved global food security during the 'green revolution' in the 1960-1970s 2 . However, DELLA mutants are pleiotropic and the developmental basis for their effects on plant architecture remains poorly understood. Here, we show that DELLA proteins have genetically separable roles in controlling stem growth and the size of the inflorescence meristem, where flowers initiate. Quantitative three-dimensional image analysis, combined with a genome-wide screen for DELLA-bound loci in the inflorescence tip, revealed that DELLAs limit meristem size in Arabidopsis by directly upregulating the cell-cycle inhibitor KRP2 in the underlying rib meristem, without affecting the canonical WUSCHEL-CLAVATA meristem size regulators 3 . Mutation of KRP2 in a DELLA semi-dwarf background restored meristem size, but not stem growth, and accelerated flower production. In barley, secondary mutations in the DELLA gain-of-function mutant Sln1d 4 also uncoupled meristem and inflorescence size from plant height. Our work reveals an unexpected and conserved role for DELLA genes in controlling shoot meristem function and suggests how dissection of pleiotropic DELLA functions could unlock further yield gains in semi-dwarf mutants.

  19. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  20. The compact Selaginella genome identifies changes in gene content associated with the evolution of vascular plants

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.; Banks, Jo Ann; Nishiyama, Tomoaki; Hasebe, Mitsuyasu; Bowman, John L.; Gribskov, Michael; dePamphilis, Claude; Albert, Victor A.; Aono, Naoki; Aoyama, Tsuyoshi; Ambrose, Barbara A.; Ashton, Neil W.; Axtell, Michael J.; Barker, Elizabeth; Barker, Michael S.; Bennetzen, Jeffrey L.; Bonawitz, Nicholas D.; Chapple, Clint; Cheng, Chaoyang; Correa, Luiz Gustavo Guedes; Dacre, Michael; DeBarry, Jeremy; Dreyer, Ingo; Elias, Marek; Engstrom, Eric M.; Estelle, Mark; Feng, Liang; Finet, Cedric; Floyd, Sandra K.; Frommer, Wolf B.; Fujita, Tomomichi; Gramzow, Lydia; Gutensohn, Michael; Harholt, Jesper; Hattori, Mitsuru; Heyl, Alexander; Hirai, Tadayoshi; Hiwatashi, Yuji; Ishikawa, Masaki; Iwata, Mineko; Karol, Kenneth G.; Koehler, Barbara; Kolukisaoglu, Uener; Kubo, Minoru; Kurata, Tetsuya; Lalonde, Sylvie; Li, Kejie; Li, Ying; Litt, Amy; Lyons, Eric; Manning, Gerard; Maruyama, Takeshi; Michael, Todd P.; Mikami, Koji; Miyazaki, Saori; Morinaga, Shin-ichi; Murata, Takashi; Mueller-Roeber, Bernd; Nelson, David R.; Obara, Mari; Oguri, Yasuko; Olmstead, Richard G.; Onodera, Naoko; Petersen, Bent Larsen; Pils, Birgit; Prigge, Michael; Rensing, Stefan A.; Riano-Pachon, Diego Mauricio; Roberts, Alison W.; Sato, Yoshikatsu; Scheller, Henrik Vibe; Schulz, Burkhard; Schulz, Christian; Shakirov, Eugene V.; Shibagaki, Nakako; Shinohara, Naoki; Shippen, Dorothy E.; Sorensen, Iben; Sotooka, Ryo; Sugimoto, Nagisa; Sugita, Mamoru; Sumikawa, Naomi; Tanurdzic, Milos; Theilsen, Gunter; Ulvskov, Peter; Wakazuki, Sachiko; Weng, Jing-Ke; Willats, William W.G.T.; Wipf, Daniel; Wolf, Paul G.; Yang, Lixing; Zimmer, Andreas D.; Zhu, Qihui; Mitros, Therese; Hellsten, Uffe; Loque, Dominique; Otillar, Robert; Salamov, Asaf; Schmutz, Jeremy; Shapiro, Harris; Lindquist, Erika; Lucas, Susan; Rokhsar, Daniel

    2011-04-28

    We report the genome sequence of the nonseed vascular plant, Selaginella moellendorffii, and by comparative genomics identify genes that likely played important roles in the early evolution of vascular plants and their subsequent evolution

  1. Ferritin gene organization: differences between plants and animals suggest possible kingdom-specific selective constraints.

    Science.gov (United States)

    Proudhon, D; Wei, J; Briat, J; Theil, E C

    1996-03-01

    Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may

  2. New insights on the evolution of Leafy cotyledon1 (LEC1) type genes in vascular plants.

    Science.gov (United States)

    Cagliari, Alexandro; Turchetto-Zolet, Andreia Carina; Korbes, Ana Paula; Maraschin, Felipe Dos Santos; Margis, Rogerio; Margis-Pinheiro, Marcia

    2014-01-01

    NF-Y is a conserved oligomeric transcription factor found in all eukaryotes. In plants, this regulator evolved with a broad diversification of the genes coding for its three subunits (NF-YA, NF-YB and NF-YC). The NF-YB members can be divided into Leafy Cotyledon1 (LEC1) and non-LEC1 types. Here we presented a comparative genomic study using phylogenetic analyses to validate an evolutionary model for the origin of LEC-type genes in plants and their emergence from non-LEC1-type genes. We identified LEC1-type members in all vascular plant genomes, but not in amoebozoa, algae, fungi, metazoa and non-vascular plant representatives, which present exclusively non-LEC1-type genes as constituents of their NF-YB subunits. The non-synonymous to synonymous nucleotide substitution rates (Ka/Ks) between LEC1 and non-LEC1-type genes indicate the presence of positive selection acting on LEC1-type members to the fixation of LEC1-specific amino acid residues. The phylogenetic analyses demonstrated that plant LEC1-type genes are evolutionary divergent from the non-LEC1-type genes of plants, fungi, amoebozoa, algae and animals. Our results point to a scenario in which LEC1-type genes have originated in vascular plants after gene expansion in plants. We suggest that processes of neofunctionalization and/or subfunctionalization were responsible for the emergence of a versatile role for LEC1-type genes in vascular plants, especially in seed plants. LEC1-type genes besides being phylogenetic divergent also present different expression profile when compared with non-LEC1-type genes. Altogether, our data provide new insights about the LEC1 and non-LEC1 evolutionary relationship during the vascular plant evolution. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. The MSX1 homeobox transcription factor is a downstream target of PHOX2B and activates the Delta-Notch pathway in neuroblastoma

    International Nuclear Information System (INIS)

    Revet, Ingrid; Huizenga, Gerda; Chan, Alvin; Koster, Jan; Volckmann, Richard; Sluis, Peter van; Ora, Ingrid; Versteeg, Rogier; Geerts, Dirk

    2008-01-01

    Neuroblastoma is an embryonal tumour of the peripheral sympathetic nervous system (SNS). One of the master regulator genes for peripheral SNS differentiation, the homeobox transcription factor PHOX2B, is mutated in familiar and sporadic neuroblastomas. Here we report that inducible expression of PHOX2B in the neuroblastoma cell line SJNB-8 down-regulates MSX1, a homeobox gene important for embryonic neural crest development. Inducible expression of MSX1 in SJNB-8 caused inhibition of both cell proliferation and colony formation in soft agar. Affymetrix micro-array and Northern blot analysis demonstrated that MSX1 strongly up-regulated the Delta-Notch pathway genes DLK1, NOTCH3, and HEY1. In addition, the proneural gene NEUROD1 was down-regulated. Western blot analysis showed that MSX1 induction caused cleavage of the NOTCH3 protein to its activated form, further confirming activation of the Delta-Notch pathway. These experiments describe for the first time regulation of the Delta-Notch pathway by MSX1, and connect these genes to the PHOX2B oncogene, indicative of a role in neuroblastoma biology. Affymetrix micro-array analysis of a neuroblastic tumour series consisting of neuroblastomas and the more benign ganglioneuromas showed that MSX1, NOTCH3 and HEY1 are more highly expressed in ganglioneuromas. This suggests a block in differentiation of these tumours at distinct developmental stages or lineages

  4. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  5. Data mining and influential analysis of gene expression data for plant resistance gene identification in tomato (Solanum lycopersicum

    Directory of Open Access Journals (Sweden)

    Francisco Torres-Avilés

    2014-03-01

    Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.

  6. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  7. Horizontal transfer of a subtilisin gene from plants into an ancestor of the plant pathogenic fungal genus Colletotrichum.

    Science.gov (United States)

    Armijos Jaramillo, Vinicio Danilo; Vargas, Walter Alberto; Sukno, Serenella Ana; Thon, Michael R

    2013-01-01

    The genus Colletotrichum contains a large number of phytopathogenic fungi that produce enormous economic losses around the world. The effect of horizontal gene transfer (HGT) has not been studied yet in these organisms. Inter-Kingdom HGT into fungal genomes has been reported in the past but knowledge about the HGT between plants and fungi is particularly limited. We describe a gene in the genome of several species of the genus Colletotrichum with a strong resemblance to subtilisins typically found in plant genomes. Subtilisins are an important group of serine proteases, widely distributed in all of the kingdoms of life. Our hypothesis is that the gene was acquired by Colletotrichum spp. through (HGT) from plants to a Colletotrichum ancestor. We provide evidence to support this hypothesis in the form of phylogenetic analyses as well as a characterization of the similarity of the subtilisin at the primary, secondary and tertiary structural levels. The remarkable level of structural conservation of Colletotrichum plant-like subtilisin (CPLS) with plant subtilisins and the differences with the rest of Colletotrichum subtilisins suggests the possibility of molecular mimicry. Our phylogenetic analysis indicates that the HGT event would have occurred approximately 150-155 million years ago, after the divergence of the Colletotrichum lineage from other fungi. Gene expression analysis shows that the gene is modulated during the infection of maize by C. graminicola suggesting that it has a role in plant disease. Furthermore, the upregulation of the CPLS coincides with the downregulation of several plant genes encoding subtilisins. Based on the known roles of subtilisins in plant pathogenic fungi and the gene expression pattern that we observed, we postulate that the CPLSs have an important role in plant infection.

  8. Exploring Plant Co-Expression and Gene-Gene Interactions with CORNET 3.0.

    Science.gov (United States)

    Van Bel, Michiel; Coppens, Frederik

    2017-01-01

    Selecting and filtering a reference expression and interaction dataset when studying specific pathways and regulatory interactions can be a very time-consuming and error-prone task. In order to reduce the duplicated efforts required to amass such datasets, we have created the CORNET (CORrelation NETworks) platform which allows for easy access to a wide variety of data types: coexpression data, protein-protein interactions, regulatory interactions, and functional annotations. The CORNET platform outputs its results in either text format or through the Cytoscape framework, which is automatically launched by the CORNET website.CORNET 3.0 is the third iteration of the web platform designed for the user exploration of the coexpression space of plant genomes, with a focus on the model species Arabidopsis thaliana. Here we describe the platform: the tools, data, and best practices when using the platform. We indicate how the platform can be used to infer networks from a set of input genes, such as upregulated genes from an expression experiment. By exploring the network, new target and regulator genes can be discovered, allowing for follow-up experiments and more in-depth study. We also indicate how to avoid common pitfalls when evaluating the networks and how to avoid over interpretation of the results.All CORNET versions are available at http://bioinformatics.psb.ugent.be/cornet/ .

  9. Phylogenetics and evolution of Trx SET genes in fully sequenced land plants.

    Science.gov (United States)

    Zhu, Xinyu; Chen, Caoyi; Wang, Baohua

    2012-04-01

    Plant Trx SET proteins are involved in H3K4 methylation and play a key role in plant floral development. Genes encoding Trx SET proteins constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. To investigate the evolutionary history of the Trx SET gene family, we made a comprehensive evolutionary analysis on this gene family from 13 major representatives of green plants. A novel clustering (here named as cpTrx clade), which included the III-1, III-2, and III-4 orthologous groups, previously resolved was identified. Our analysis showed that plant Trx proteins possessed a variety of domain organizations and gene structures among paralogs. Additional domains such as PHD, PWWP, and FYR were early integrated into primordial SET-PostSET domain organization of cpTrx clade. We suggested that the PostSET domain was lost in some members of III-4 orthologous group during the evolution of land plants. At least four classes of gene structures had been formed at the early evolutionary stage of land plants. Three intronless orphan Trx SET genes from the Physcomitrella patens (moss) were identified, and supposedly, their parental genes have been eliminated from the genome. The structural differences among evolutionary groups of plant Trx SET genes with different functions were described, contributing to the design of further experimental studies.

  10. Phylogenomic analysis demonstrates a pattern of rare and ancient horizontal gene transfer between plants and fungi.

    Science.gov (United States)

    Richards, Thomas A; Soanes, Darren M; Foster, Peter G; Leonard, Guy; Thornton, Christopher R; Talbot, Nicholas J

    2009-07-01

    Horizontal gene transfer (HGT) describes the transmission of genetic material across species boundaries and is an important evolutionary phenomenon in the ancestry of many microbes. The role of HGT in plant evolutionary history is, however, largely unexplored. Here, we compare the genomes of six plant species with those of 159 prokaryotic and eukaryotic species and identify 1689 genes that show the highest similarity to corresponding genes from fungi. We constructed a phylogeny for all 1689 genes identified and all homolog groups available from the rice (Oryza sativa) genome (3177 gene families) and used these to define 14 candidate plant-fungi HGT events. Comprehensive phylogenetic analyses of these 14 data sets, using methods that account for site rate heterogeneity, demonstrated support for nine HGT events, demonstrating an infrequent pattern of HGT between plants and fungi. Five HGTs were fungi-to-plant transfers and four were plant-to-fungi HGTs. None of the fungal-to-plant HGTs involved angiosperm recipients. These results alter the current view of organismal barriers to HGT, suggesting that phagotrophy, the consumption of a whole cell by another, is not necessarily a prerequisite for HGT between eukaryotes. Putative functional annotation of the HGT candidate genes suggests that two fungi-to-plant transfers have added phenotypes important for life in a soil environment. Our study suggests that genetic exchange between plants and fungi is exceedingly rare, particularly among the angiosperms, but has occurred during their evolutionary history and added important metabolic traits to plant lineages.

  11. Transgenic rice plants harboring an introduced potato proteinase inhibitor II gene are insect resistant.

    Science.gov (United States)

    Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R

    1996-04-01

    We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.

  12. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

    Science.gov (United States)

    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

    1995-09-01

    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  13. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  14. A plant defensin gene from Orychophragmus violaceus can improve ...

    African Journals Online (AJOL)

    Quantitative RT-PCR showed that the expression of Ovd in the sense plant line was stronger than non-transformed plant and antisense plant. The lesion size on detached leaves of the transgenic plants and nontransformed control caused by Sclerotinia sclerotiorum mycelia was examined. Lesion size was reduced in sense ...

  15. The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses

    Directory of Open Access Journals (Sweden)

    Yuling Bai

    2018-06-01

    Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.

  16. Expression of TLP-3 gene without signal peptide in tobacco plants ...

    African Journals Online (AJOL)

    Expression of TLP-3 gene without signal peptide in tobacco plants using Agrobacterium mediated transformation. ... Plants are exploited as a source of food by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. So paying attention to their protection is very important.

  17. plantiSMASH: automated identification, annotation and expression analysis of plant biosynthetic gene clusters

    DEFF Research Database (Denmark)

    Kautsar, Satria A.; Suarez Duran, Hernando G.; Blin, Kai

    2017-01-01

    exploration of the nature and dynamics of gene clustering in plant metabolism. Moreover, spurred by the continuing decrease in costs of plant genome sequencing, they will allow genome mining technologies to be applied to plant natural product discovery. The plantiSMASH web server, precalculated results...

  18. Gene expression in plant lipid metabolism in Arabidopsis seedlings.

    Directory of Open Access Journals (Sweden)

    An-Shan Hsiao

    Full Text Available Events in plant lipid metabolism are important during seedling establishment. As it has not been experimentally verified whether lipid metabolism in 2- and 5-day-old Arabidopsis thaliana seedlings is diurnally-controlled, quantitative real-time PCR analysis was used to investigate the expression of target genes in acyl-lipid transfer, β-oxidation and triacylglycerol (TAG synthesis and hydrolysis in wild-type Arabidopsis WS and Col-0. In both WS and Col-0, ACYL-COA-BINDING PROTEIN3 (ACBP3, DIACYLGLYCEROL ACYLTRANSFERASE1 (DGAT1 and DGAT3 showed diurnal control in 2- and 5-day-old seedlings. Also, COMATOSE (CTS was diurnally regulated in 2-day-old seedlings and LONG-CHAIN ACYL-COA SYNTHETASE6 (LACS6 in 5-day-old seedlings in both WS and Col-0. Subsequently, the effect of CIRCADIAN CLOCK ASSOCIATED1 (CCA1 and LATE ELONGATED HYPOCOTYL (LHY from the core clock system was examined using the cca1lhy mutant and CCA1-overexpressing (CCA1-OX lines versus wild-type WS and Col-0, respectively. Results revealed differential gene expression in lipid metabolism between 2- and 5-day-old mutant and wild-type WS seedlings, as well as between CCA1-OX and wild-type Col-0. Of the ACBPs, ACBP3 displayed the most significant changes between cca1lhy and WS and between CCA1-OX and Col-0, consistent with previous reports that ACBP3 is greatly affected by light/dark cycling. Evidence of oil body retention in 4- and 5-day-old seedlings of the cca1lhy mutant in comparison to WS indicated the effect of cca1lhy on storage lipid reserve mobilization. Lipid profiling revealed differences in primary lipid metabolism, namely in TAG, fatty acid methyl ester and acyl-CoA contents amongst cca1lhy, CCA1-OX, and wild-type seedlings. Taken together, this study demonstrates that lipid metabolism is subject to diurnal regulation in the early stages of seedling development in Arabidopsis.

  19. PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.

    Science.gov (United States)

    Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R

    2018-01-04

    The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Plant interactions with multiple insect herbivores: from community to genes

    NARCIS (Netherlands)

    Stam, J.M.; Kroes, A.; Li, Y.; Gols, R.; Loon, van J.J.A.; Poelman, E.H.; Dicke, M.

    2014-01-01

    Every plant is a member of a complex insect community that consists of tens to hundreds of species that belong to different trophic levels. The dynamics of this community are critically influenced by the plant, which mediates interactions between community members that can occur on the plant

  1. Phytoplasma adapt to the diverse environments of their plant and insect hosts by altering gene expression

    DEFF Research Database (Denmark)

    Makarova, Olga; MacLean, Allyson M.; Nicolaisen, Mogens

    2015-01-01

    a role in host adaptation. 74 genes were up-regulated in insects and included genes involved in stress response, phospholipid synthesis, malate and pyruvate metabolism, hemolysin and transporter genes, multiple copies of thymidylate kinase, sigma factor and Zn-proteases genes. In plants, 34 genes...... encoding an immune dominant membrane protein, membrane-associated proteins, and multidrug resistance ABC-type transporters, were up-regulated. Differential regulation of gene expression thus appears to play an important role in host adaptation of phytoplasmas....

  2. Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

    Directory of Open Access Journals (Sweden)

    O.I. Grabelnych

    2017-02-01

    Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

  3. The rules of gene expression in plants: Organ identity and gene body methylation are key factors for regulation of gene expression in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Gutiérrez Rodrigo A

    2008-09-01

    Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant

  4. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  5. Homeobox A7 stimulates breast cancer cell proliferation by up-regulating estrogen receptor-alpha

    International Nuclear Information System (INIS)

    Zhang, Yu; Cheng, Jung-Chien; Huang, He-Feng; Leung, Peter C.K.

    2013-01-01

    Highlights: •HOXA7 regulates MCF7 cell proliferation. •HOXA7 up-regulates ERα expression. •HOXA7 mediates estrogen-induced MCF7 cell proliferation. -- Abstract: Breast cancer is the most common hormone-dependent malignancy in women. Homeobox (HOX) transcription factors regulate many cellular functions, including cell migration, proliferation and differentiation. The aberrant expression of HOX genes has been reported to be associated with human reproductive cancers. Estradiol (E2) and its nuclear receptors, estrogen receptor (ER)-alpha and ER-beta, are known to play critical roles in the regulation of breast cancer cell growth. However, an understanding of the potential relationship between HOXA7 and ER in breast cancer cells is limited. In this study, our results demonstrate that knockdown of HOXA7 in MCF7 cells significantly decreased cell proliferation and ERα expression. In addition, HOXA7 knockdown attenuated E2-induced cell proliferation as well as progesterone receptor (PR) expression. The stimulatory effects of E2 on cell proliferation and PR expression were abolished by co-treatment with ICI 182780, a selective ERα antagonist. In contrast, overexpression of HOXA7 significantly stimulated cell proliferation and ERα expression. Moreover, E2-induced cell proliferation, as well as PR expression, was enhanced by the overexpression of HOXA7. Neither knockdown nor overexpression of HOXA7 affected the ER-beta levels. Our results demonstrate a novel mechanistic role for HOXA7 in modulating breast cancer cell proliferation via regulation of ERα expression. This finding contributes to our understanding of the role HOXA7 plays in regulating the proliferation of ER-positive cancer cells

  6. Homeobox A7 stimulates breast cancer cell proliferation by up-regulating estrogen receptor-alpha

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yu [Department of Reproductive Endocrinology, Women’s Hospital, School of Medicine, Zhejiang University, Hangzhou 310006 (China); Department of Obstetrics and Gynaecology, Child and Family Research Institute, University of British Columbia, Vancouver, British Columbia V5Z 4H4 (Canada); Cheng, Jung-Chien [Department of Obstetrics and Gynaecology, Child and Family Research Institute, University of British Columbia, Vancouver, British Columbia V5Z 4H4 (Canada); Huang, He-Feng, E-mail: huanghefg@hotmail.com [Department of Reproductive Endocrinology, Women’s Hospital, School of Medicine, Zhejiang University, Hangzhou 310006 (China); Leung, Peter C.K., E-mail: peter.leung@ubc.ca [Department of Reproductive Endocrinology, Women’s Hospital, School of Medicine, Zhejiang University, Hangzhou 310006 (China); Department of Obstetrics and Gynaecology, Child and Family Research Institute, University of British Columbia, Vancouver, British Columbia V5Z 4H4 (Canada)

    2013-11-01

    Highlights: •HOXA7 regulates MCF7 cell proliferation. •HOXA7 up-regulates ERα expression. •HOXA7 mediates estrogen-induced MCF7 cell proliferation. -- Abstract: Breast cancer is the most common hormone-dependent malignancy in women. Homeobox (HOX) transcription factors regulate many cellular functions, including cell migration, proliferation and differentiation. The aberrant expression of HOX genes has been reported to be associated with human reproductive cancers. Estradiol (E2) and its nuclear receptors, estrogen receptor (ER)-alpha and ER-beta, are known to play critical roles in the regulation of breast cancer cell growth. However, an understanding of the potential relationship between HOXA7 and ER in breast cancer cells is limited. In this study, our results demonstrate that knockdown of HOXA7 in MCF7 cells significantly decreased cell proliferation and ERα expression. In addition, HOXA7 knockdown attenuated E2-induced cell proliferation as well as progesterone receptor (PR) expression. The stimulatory effects of E2 on cell proliferation and PR expression were abolished by co-treatment with ICI 182780, a selective ERα antagonist. In contrast, overexpression of HOXA7 significantly stimulated cell proliferation and ERα expression. Moreover, E2-induced cell proliferation, as well as PR expression, was enhanced by the overexpression of HOXA7. Neither knockdown nor overexpression of HOXA7 affected the ER-beta levels. Our results demonstrate a novel mechanistic role for HOXA7 in modulating breast cancer cell proliferation via regulation of ERα expression. This finding contributes to our understanding of the role HOXA7 plays in regulating the proliferation of ER-positive cancer cells.

  7. High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes

    DEFF Research Database (Denmark)

    Wang, Wen; Zheng, Hongkung; Fan, Chuanzhu

    2006-01-01

    Retroposition is widely found to play essential roles in origination of new mammalian and other animal genes. However, the scarcity of retrogenes in plants has led to the assumption that plant genomes rarely evolve new gene duplicates by retroposition, despite abundant retrotransposons in plants......, confirming a previously observed role of retroelements in generating plant retrogenes. Substitution analyses revealed that the vast majority are subject to negative selection, suggesting, along with expression data and evidence of age, that they are likely functional retrogenes. In addition, 42...

  8. MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.

    Directory of Open Access Journals (Sweden)

    Dan Chen

    Full Text Available The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR, Homeobox A1 (HOXA1, CTD small phosphatase-like (CTDSPL, N-myristoyltransferase 1 (NMT1, Transmembrane protein 30A (TMEM30A, and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5. HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2 and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and

  9. MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.

    Science.gov (United States)

    Chen, Dan; Chen, Zujian; Jin, Yi; Dragas, Dragan; Zhang, Leitao; Adjei, Barima S; Wang, Anxun; Dai, Yang; Zhou, Xiaofeng

    2013-01-01

    The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR), Homeobox A1 (HOXA1), CTD small phosphatase-like (CTDSPL), N-myristoyltransferase 1 (NMT1), Transmembrane protein 30A (TMEM30A), and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5). HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP) assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2) and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and migration during

  10. Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.

    Science.gov (United States)

    Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji

    2018-02-15

    Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Functional network analysis of genes differentially expressed during xylogenesis in soc1ful woody Arabidopsis plants.

    Science.gov (United States)

    Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic

    2016-06-01

    Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.

  12. Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

    Science.gov (United States)

    Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

    2015-09-29

    The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

  13. Genetically transformed tobacco plants expressing synthetic EPSPS gene confer tolerance against glyphosate herbicide.

    Science.gov (United States)

    Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid

    2017-04-01

    Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.

  14. Analysis of common SHOX gene sequence variants and ∼4.9-kb ...

    Indian Academy of Sciences (India)

    [Solc R., Hirschfeldova K., Kebrdlova V. and Baxova A. 2014 Analysis of common SHOX gene sequence variants ... based on a Gibbs sampling strategy were done using .... SHOX (short stature homeobox) are an important cause of growth.

  15. Novel enabling technologies of gene isolation and plant transformation for improved crop protection

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2013-02-04

    Meeting the needs of agricultural producers requires the continued development of improved transgenic crop protection products. The completed project focused on developing novel enabling technologies of gene discovery and plant transformation to facilitate the generation of such products.

  16. Expression of TLP-3 gene without signal peptide in tobacco plants ...

    African Journals Online (AJOL)

    Administrator

    2011-06-06

    Jun 6, 2011 ... African Journal of Biotechnology Vol. ... group of plant proteins which accumulate as a result of different types ... across the plasma membranes, the rapid production of ..... transformation and RT-PCR analysis confirm the gene.

  17. Plant-bacteria partnership: phytoremediation of hydrocarbons contaminated soil and expression of catabolic genes

    Directory of Open Access Journals (Sweden)

    Hamna Saleem

    2016-01-01

    Full Text Available Petroleum hydrocarbons are harmful to living organisms when they are exposed in natural environment. Once they come in contact, it is not an easy to remove them because many of their constituents are persistent in nature. To achieve this target, different approaches have been exploited by using plants, bacteria, and plant-bacteria together. Among them, combined use of plants and bacteria has gained tremendous attention as bacteria possess set of catabolic genes which produce catabolic enzymes to decontaminate hydrocarbons. In return, plant ooze out root exudates containing nutrients and necessary metabolites which facilitate the microbial colonization in plant rhizosphere. This results into high gene abundance and gene expression in the rhizosphere and, thus, leads to enhanced degradation. Moreover, high proportions of beneficial bacteria helps plant to gain more biomass due to their plant growth promoting activities and production of phytohromones. This review focuses functioning and mechanisms of catabolic genes responsible for degradation of straight chain and aromatic hydrocarbons with their potential of degradation in bioremediation. With the understanding of expression mechanisms, rate of degradation can be enhanced by adjusting environmental factors and acclimatizing plant associated bacteria in plant rhizosphere.

  18. The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool

    Directory of Open Access Journals (Sweden)

    Nan Zhao

    2018-02-01

    Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.

  19. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Expression of β-nerve growth factor and homeobox A10 in experimental cryptorchidism treated with exogenous nerve growth factor.

    Science.gov (United States)

    Xian, Hua; Xian, Yun; Liu, Lili; Wang, Yongjun; He, Jianghong; Huang, Jianfei

    2015-04-01

    With the exception of standard inguinal orchidopexy, treatment of cryptorchidism with human chorionic gonadotropin has been performed for several years; however, its side effects have limited its application. The β‑nerve growth factor (NGF) and homeobox A10 (HoxA10) genes are closely associated with the development of the testes. To the best of our knowledge, whether exogenous NGF alters the endogenous levels of NGF and HoxA10 in cryptorchidism in rats remains to be elucidated. The aim of the present study was to evaluate the gene and protein expression of NGF and HoxA10 in experimental cryptorchidism following treatment with exogenous NGF. A unilateral mechanical cryptorchidism model in Sprague-Dawley rats was established and different concentrations of exogenous NGF were administered to observe the effects of NGF on cryptorchidism. Changes in the gene and protein expression levels of NGF and HoxA10 in the cryptorchid tissues of each group were identified using one step reverse transcription-quantitative polymerase chain reaction, in situ hybridization with digoxigenin‑labeled‑β‑NGF RNA probes, immunofluorescence and immunohistochemistry, respectively. The expression levels of NGF and HoxA10 were markedly higher in the group treated with a high dose of exogenous NGF compared with the group treated with a low dose of exogenous NGF and the group treated with human chorionic gonadotropin. These results confirmed the potential therapeutic effect of exogenous NGF in human cryptorchidism.

  1. Delivery of gene biotechnologies to plants: Pathogen and pest control

    Science.gov (United States)

    Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

  2. Molecular Evolution and Expression Divergence of HMT Gene Family in Plants

    Directory of Open Access Journals (Sweden)

    Man Zhao

    2018-04-01

    Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.

  3. In Silico Identification, Phylogenetic and Bioinformatic Analysis of Argonaute Genes in Plants

    Directory of Open Access Journals (Sweden)

    Khaled Mirzaei

    2014-01-01

    Full Text Available Argonaute protein family is the key players in pathways of gene silencing and small regulatory RNAs in different organisms. Argonaute proteins can bind small noncoding RNAs and control protein synthesis, affect messenger RNA stability, and even participate in the production of new forms of small RNAs. The aim of this study was to characterize and perform bioinformatic analysis of Argonaute proteins in 32 plant species that their genome was sequenced. A total of 437 Argonaute genes were identified and were analyzed based on lengths, gene structure, and protein structure. Results showed that Argonaute proteins were highly conserved across plant kingdom. Phylogenic analysis divided plant Argonautes into three classes. Argonaute proteins have three conserved domains PAZ, MID and PIWI. In addition to three conserved domains namely, PAZ, MID, and PIWI, we identified few more domains in AGO of some plant species. Expression profile analysis of Argonaute proteins showed that expression of these genes varies in most of tissues, which means that these proteins are involved in regulation of most pathways of the plant system. Numbers of alternative transcripts of Argonaute genes were highly variable among the plants. A thorough analysis of large number of putative Argonaute genes revealed several interesting aspects associated with this protein and brought novel information with promising usefulness for both basic and biotechnological applications.

  4. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  5. Exploring two plant hosts for expression of diterpenoid pathway genes

    DEFF Research Database (Denmark)

    Bach, Søren Spanner

    Plants produce more than 10.000 diterpenoid compounds of which the large majority is involved in specialized metabolism, while a few are involved in general metabolism. Specialized metabolism diterpenoids have functions in interactions of plants with other organisms and selected ones are utilized....... Since only small changes in the amino acid sequence can influence the roduct outcome of a diterpene synthase (diTPS), prediction of the catalytic activity diTPS of a is not possible purely based on phylogenetic relationship. Thus, functional characterization is required in to determine the catalytic...... and aracterization of diTPSs deriving from the plant kingdom, a plant expression host offers several advantages such as the presence of all relevant compartments (plastids and endoplasmic reticulum) and the universal C5 building blocks for isoprenoid biosynthesis. In addition, a plant based xpression host...

  6. Macro optical projection tomography for large scale 3D imaging of plant structures and gene activity.

    Science.gov (United States)

    Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S

    2017-01-01

    Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  7. UV-C-Induced alleviation of transcriptional gene silencing through plant-plant communication: Key roles of jasmonic acid and salicylic acid pathways.

    Science.gov (United States)

    Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po

    2016-08-01

    Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Silencing of meiosis-critical genes for engineering male sterility in plants

    Science.gov (United States)

    Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

  9. Plants, genes and justice : an inquiry into fair and equitable benefit-sharing

    NARCIS (Netherlands)

    Jonge, de B.

    2009-01-01

    Since the advent of biotechnology, plant genetic resources have become more valuable as possible sources for new products and inventions. With knowledge about the genetic make-up and functioning of a plant, biotechnologists can identify and isolate genes with interesting traits which, after long

  10. The complexity of nitrogen metabolism and nitrogen-regulated gene expression in plant pathogenic fungi

    NARCIS (Netherlands)

    Bolton, M.D.; Thomma, B.P.H.J.

    2008-01-01

    Plant pathogens secrete effector molecules that contribute to the establishment of disease in their plant hosts. The identification of cellular cues that regulate effector gene expression is an important aspect of understanding the infection process. Nutritional status in the cell has been

  11. A new hemoglobin gene from soybean: a role for hemoglobin in all plants

    DEFF Research Database (Denmark)

    Anderson, C R; Jensen, E O; LLewellyn, D J

    1996-01-01

    We have isolated a new hemoglobin gene from soybean. It is expressed in cotyledons, stems of seedlings, roots, young leaves, and in some cells in the nodules that are associated with the nitrogen-fixing Bradyrhizobium symbiont. This contrasts with the expression of the leghemoglobins, which...... are active only in the infected cells of the nodules. The deduced protein sequence of the new gene shows only 58% similarity to one of the soybean leghemoglobins, but 85-87% similarity to hemoglobins from the nonlegumes Parasponia, Casuarina, and barley. The pattern of expression and the gene sequence...... indicate that this new gene is a nonsymbiotic legume hemoglobin. The finding of this gene in legumes and similar genes in other species strengthens our previous suggestion that genomes of all plants contain hemoglobin genes. The specialized leghemoglobin gene family may have arisen from a preexisting...

  12. Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

    Science.gov (United States)

    Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

    2017-09-30

    Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

  13. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants

    OpenAIRE

    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong

    2010-01-01

    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  14. Horizontal gene transfer of a plastid gene in the non-photosynthetic flowering plants Orobanche and Phelipanche (Orobanchaceae).

    Science.gov (United States)

    Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M

    2007-06-01

    Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.

  15. Plant reference genes for development and stress response studies

    Indian Academy of Sciences (India)

    Joyous T Joseph

    2018-02-09

    Feb 9, 2018 ... HKGs are constitutive genes required for the maintenance of basic cellular functions like cell ... abiotic, biotic, and developmental factors affecting the cells in which they express. ..... expression. Theory Biosci. 131 215–223.

  16. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  17. The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)

    Energy Technology Data Exchange (ETDEWEB)

    Karen S. Browning; Marie Petrocek; Bonnie Bartel

    2006-06-01

    The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.

  18. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Directory of Open Access Journals (Sweden)

    Aaron E Walworth

    Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of

  19. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants

    Science.gov (United States)

    Walworth, Aaron E.; Chai, Benli; Song, Guo-qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all

  20. Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.

    Science.gov (United States)

    Walworth, Aaron E; Chai, Benli; Song, Guo-Qing

    2016-01-01

    In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these

  1. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  2. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  3. Proliferation and osteo/odontogenic differentiation of stem cells from apical papilla regulated by Zinc fingers and homeoboxes 2: An in vitro study

    International Nuclear Information System (INIS)

    Wan, Fang; Gao, Lifen; Lu, Yating; Ma, Hongxin; Wang, Hongxing; Liang, Xiaohong; Wang, Yan; Ma, Chunhong

    2016-01-01

    In the process of tooth root development, stem cells from the apical papilla (SCAPs) can differentiate into odontoblasts and form root dentin, however, molecules regulating SCAPs differentiation have not been elucidated. Zinc fingers and homeoboxes 2 (ZHX2) is a novel transcriptional inhibitor. It is reported to modulate the development of nerve cells, liver cells, B cells, red blood cells, and so on. However, the role of ZHX2 in tooth root development remains unclear. In this study, we explored the potential role of ZHX2 in the process of SCAPs differentiation. The results showed that overexpression of ZHX2 upregulated the expression of osteo/odontogenic related genes and ALP activity, inhibited the proliferation of SCAPs. Consistently, ZHX2 knockdown reduced SCAPs mineralization and promoted SCAPs proliferation. These results indicated that ZHX2 plays a critical role in the proliferation and osteo/odontogenic differentiation of SCAPs. - Highlights: • Zinc fingers and homeoboxes 2 (ZHX2) is a novel transcriptional inhibitor. • we found another new biological function of ZHX2 for the first time. • ZHX2 inhibit SCAPs proliferation. • ZHX2 promote the osteo/odontogenic differentiation of SCAPs.

  4. Proliferation and osteo/odontogenic differentiation of stem cells from apical papilla regulated by Zinc fingers and homeoboxes 2: An in vitro study

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Fang [Department of Immunology, Key Laboratory for Experimental Teratology of Ministry of Education, Shandong Provincial Key Laboratory of Infection & Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan, Shandong 250012 (China); VIP Center, Shandong Provincial Key Laboratory of Oral Biomedicine, School and Hospital of Stomatology, Shandong University, 44 Wenhua Xi Road, Jinan, Shandong 250012 (China); Gao, Lifen [Department of Immunology, Key Laboratory for Experimental Teratology of Ministry of Education, Shandong Provincial Key Laboratory of Infection & Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan, Shandong 250012 (China); Lu, Yating [VIP Center, Shandong Provincial Key Laboratory of Oral Biomedicine, School and Hospital of Stomatology, Shandong University, 44 Wenhua Xi Road, Jinan, Shandong 250012 (China); Ma, Hongxin; Wang, Hongxing; Liang, Xiaohong [Department of Immunology, Key Laboratory for Experimental Teratology of Ministry of Education, Shandong Provincial Key Laboratory of Infection & Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan, Shandong 250012 (China); Wang, Yan, E-mail: wangyan1965@sdu.edu.cn [VIP Center, Shandong Provincial Key Laboratory of Oral Biomedicine, School and Hospital of Stomatology, Shandong University, 44 Wenhua Xi Road, Jinan, Shandong 250012 (China); Ma, Chunhong, E-mail: machunhong@sdu.edu.cn [Department of Immunology, Key Laboratory for Experimental Teratology of Ministry of Education, Shandong Provincial Key Laboratory of Infection & Immunology, Shandong University School of Medicine, 44 Wenhua Xi Road, Jinan, Shandong 250012 (China)

    2016-01-15

    In the process of tooth root development, stem cells from the apical papilla (SCAPs) can differentiate into odontoblasts and form root dentin, however, molecules regulating SCAPs differentiation have not been elucidated. Zinc fingers and homeoboxes 2 (ZHX2) is a novel transcriptional inhibitor. It is reported to modulate the development of nerve cells, liver cells, B cells, red blood cells, and so on. However, the role of ZHX2 in tooth root development remains unclear. In this study, we explored the potential role of ZHX2 in the process of SCAPs differentiation. The results showed that overexpression of ZHX2 upregulated the expression of osteo/odontogenic related genes and ALP activity, inhibited the proliferation of SCAPs. Consistently, ZHX2 knockdown reduced SCAPs mineralization and promoted SCAPs proliferation. These results indicated that ZHX2 plays a critical role in the proliferation and osteo/odontogenic differentiation of SCAPs. - Highlights: • Zinc fingers and homeoboxes 2 (ZHX2) is a novel transcriptional inhibitor. • we found another new biological function of ZHX2 for the first time. • ZHX2 inhibit SCAPs proliferation. • ZHX2 promote the osteo/odontogenic differentiation of SCAPs.

  5. Elucidating gene function and function evolution through comparison of co-expression networks in plants

    Directory of Open Access Journals (Sweden)

    Marek eMutwil

    2014-08-01

    Full Text Available The analysis of gene expression data has shown that transcriptionally coordinated (co-expressed genes are often functionally related, enabling scientists to use expression data in gene function prediction. This Focused Review discusses our original paper (Large-scale co-expression approach to dissect secondary cell wall formation across plant species, Frontiers in Plant Science 2:23. In this paper we applied cross-species analysis to co-expression networks of genes involved in cellulose biosynthesis. We show that the co-expression networks from different species are highly similar, indicating that whole biological pathways are conserved across species. This finding has two important implications. First, the analysis can transfer gene function annotation from well-studied plants, such as Arabidopsis, to other, uncharacterized plant species. As the analysis finds genes that have similar sequence and similar expression pattern across different organisms, functionally equivalent genes can be identified. Second, since co-expression analyses are often noisy, a comparative analysis should have higher performance, as parts of co-expression networks that are conserved are more likely to be functionally relevant. In this Focused Review, we outline the comparative analysis done in the original paper and comment on the recent advances and approaches that allow comparative analyses of co-function networks. We hypothesize that, in comparison to simple co-expression analysis, comparative analysis would yield more accurate gene function predictions. Finally, by combining comparative analysis with genomic information of green plants, we propose a possible composition of cellulose biosynthesis machinery during earlier stages of plant evolution.

  6. Lactococcus lactis Metabolism and Gene Expression during Growth on Plant Tissues

    Science.gov (United States)

    Golomb, Benjamin L.

    2014-01-01

    Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484

  7. The homeobox transcription factor HOXA9 is a regulator of SHOX in U2OS cells and chicken micromass cultures.

    Directory of Open Access Journals (Sweden)

    Claudia Durand

    Full Text Available The homeobox gene SHOX encodes for a transcription factor that plays an important role during limb development. Mutations or deletions of SHOX in humans cause short stature in Turner, Langer and Leri-Weill syndrome as well as idiopathic short stature. During embryonic development, SHOX is expressed in a complex spatio-temporal pattern that requires the presence of specific regulatory mechanisms. Up to now, it was known that SHOX is regulated by two upstream promoters and several enhancers on either side of the gene, but no regulators have been identified that can activate or repress the transcription of SHOX by binding to these regulatory elements. We have now identified the homeodomain protein HOXA9 as a positive regulator of SHOX expression in U2OS cells. Using luciferase assays, chromatin immunoprecipitation and electrophoretic mobility shift assays, we could narrow down the HOXA9 binding site to two AT-rich sequences of 31 bp within the SHOX promoter 2. Virus-induced Hoxa9 overexpression in a chicken micromass model validated the regulation of Shox by Hoxa9 (negative regulation. As Hoxa9 and Shox are both expressed in overlapping regions of the developing limb buds, a regulatory relationship of Hoxa9 and Shox during the process of limb development can be assumed.

  8. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    Science.gov (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  9. Coordinations between gene modules control the operation of plant amino acid metabolic networks

    Directory of Open Access Journals (Sweden)

    Galili Gad

    2009-01-01

    Full Text Available Abstract Background Being sessile organisms, plants should adjust their metabolism to dynamic changes in their environment. Such adjustments need particular coordination in branched metabolic networks in which a given metabolite can be converted into multiple other metabolites via different enzymatic chains. In the present report, we developed a novel "Gene Coordination" bioinformatics approach and use it to elucidate adjustable transcriptional interactions of two branched amino acid metabolic networks in plants in response to environmental stresses, using publicly available microarray results. Results Using our "Gene Coordination" approach, we have identified in Arabidopsis plants two oppositely regulated groups of "highly coordinated" genes within the branched Asp-family network of Arabidopsis plants, which metabolizes the amino acids Lys, Met, Thr, Ile and Gly, as well as a single group of "highly coordinated" genes within the branched aromatic amino acid metabolic network, which metabolizes the amino acids Trp, Phe and Tyr. These genes possess highly coordinated adjustable negative and positive expression responses to various stress cues, which apparently regulate adjustable metabolic shifts between competing branches of these networks. We also provide evidence implying that these highly coordinated genes are central to impose intra- and inter-network interactions between the Asp-family and aromatic amino acid metabolic networks as well as differential system interactions with other growth promoting and stress-associated genome-wide genes. Conclusion Our novel Gene Coordination elucidates that branched amino acid metabolic networks in plants are regulated by specific groups of highly coordinated genes that possess adjustable intra-network, inter-network and genome-wide transcriptional interactions. We also hypothesize that such transcriptional interactions enable regulatory metabolic adjustments needed for adaptation to the stresses.

  10. Physiological and gene expression responses of sunflower (Helianthus annuus L.) plants differ according to irrigation placement.

    Science.gov (United States)

    Aguado, Ana; Capote, Nieves; Romero, Fernando; Dodd, Ian C; Colmenero-Flores, José M

    2014-10-01

    To investigate effects of soil moisture heterogeneity on plant physiology and gene expression in roots and leaves, three treatments were implemented in sunflower plants growing with roots split between two compartments: a control (C) treatment supplying 100% of plant evapotranspiration, and two treatments receiving 50% of plant evapotranspiration, either evenly distributed to both compartments (deficit irrigation - DI) or unevenly distributed to ensure distinct wet and dry compartments (partial rootzone drying - PRD). Plants receiving the same amount of water responded differently under the two irrigation systems. After 3 days, evapotranspiration was similar in C and DI, but 20% less in PRD, concomitant with decreased leaf water potential (Ψleaf) and increased leaf xylem ABA concentration. Six water-stress responsive genes were highly induced in roots growing in the drying soil compartment of PRD plants, and their expression was best correlated with local soil water content. On the other hand, foliar gene expression differed significantly from that of the root and correlated better with xylem ABA concentration and Ψleaf. While the PRD irrigation strategy triggered stronger physiological and molecular responses, suggesting a more intense and systemic stress reaction due to local dehydration of the dry compartment of PRD plants, the DI strategy resulted in similar water savings without strongly inducing these responses. Correlating physiological and molecular responses in PRD/DI plants may provide insights into the severity and location of water deficits and may enable a better understanding of long-distance signalling mechanisms. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. A plant defensin gene from Orychophragmus violaceus can improve ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-16

    Nov 16, 2009 ... seedlings and plants from attacking of soil-bore patho- gens (Terras et al., ..... The boxes were covered with plastic film and then kept at. 20°C in dark. ... form four structure-stabilizing disulfide bridges as reported before which ...

  12. Identification of plant genes for abiotic stress resistance

    NARCIS (Netherlands)

    Dixit, S.A.

    2008-01-01

    As water and salt stresses occur frequently and can affect many habitats, plants have developed several strategies to cope with these challenges: either adaptation mechanisms, which allow them to survive the adverse conditions, or specific growth habits to avoid stress conditions. Stress-tolerant

  13. Controversy Associated With the Common Component of Most Transgenic Plants – Kanamycin Resistance Marker Gene

    Directory of Open Access Journals (Sweden)

    Srećko Jelenić

    2003-01-01

    Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.

  14. Transcriptomic Analysis Using Olive Varieties and Breeding Progenies Identifies Candidate Genes Involved in Plant Architecture.

    Science.gov (United States)

    González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R

    2016-01-01

    Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.

  15. GeneBins: a database for classifying gene expression data, with application to plant genome arrays

    Directory of Open Access Journals (Sweden)

    Weiller Georg

    2007-03-01

    Full Text Available Abstract Background To interpret microarray experiments, several ontological analysis tools have been developed. However, current tools are limited to specific organisms. Results We developed a bioinformatics system to assign the probe set sequences of any organism to a hierarchical functional classification modelled on KEGG ontology. The GeneBins database currently supports the functional classification of expression data from four Affymetrix arrays; Arabidopsis thaliana, Oryza sativa, Glycine max and Medicago truncatula. An online analysis tool to identify relevant functions is also provided. Conclusion GeneBins provides resources to interpret gene expression results from microarray experiments. It is available at http://bioinfoserver.rsbs.anu.edu.au/utils/GeneBins/

  16. The ALDH21 gene found in lower plants and some vascular plants codes for a NADP+ -dependent succinic semialdehyde dehydrogenase.

    Science.gov (United States)

    Kopečná, Martina; Vigouroux, Armelle; Vilím, Jan; Končitíková, Radka; Briozzo, Pierre; Hájková, Eva; Jašková, Lenka; von Schwartzenberg, Klaus; Šebela, Marek; Moréra, Solange; Kopečný, David

    2017-10-01

    Lower plant species including some green algae, non-vascular plants (bryophytes) as well as the oldest vascular plants (lycopods) and ferns (monilophytes) possess a unique aldehyde dehydrogenase (ALDH) gene named ALDH21, which is upregulated during dehydration. However, the gene is absent in flowering plants. Here, we show that ALDH21 from the moss Physcomitrella patens codes for a tetrameric NADP + -dependent succinic semialdehyde dehydrogenase (SSALDH), which converts succinic semialdehyde, an intermediate of the γ-aminobutyric acid (GABA) shunt pathway, into succinate in the cytosol. NAD + is a very poor coenzyme for ALDH21 unlike for mitochondrial SSALDHs (ALDH5), which are the closest related ALDH members. Structural comparison between the apoform and the coenzyme complex reveal that NADP + binding induces a conformational change of the loop carrying Arg-228, which seals the NADP + in the coenzyme cavity via its 2'-phosphate and α-phosphate groups. The crystal structure with the bound product succinate shows that its carboxylate group establishes salt bridges with both Arg-121 and Arg-457, and a hydrogen bond with Tyr-296. While both arginine residues are pre-formed for substrate/product binding, Tyr-296 moves by more than 1 Å. Both R121A and R457A variants are almost inactive, demonstrating a key role of each arginine in catalysis. Our study implies that bryophytes but presumably also some green algae, lycopods and ferns, which carry both ALDH21 and ALDH5 genes, can oxidize SSAL to succinate in both cytosol and mitochondria, indicating a more diverse GABA shunt pathway compared with higher plants carrying only the mitochondrial ALDH5. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  17. Design of Knowledge Bases for Plant Gene Regulatory Networks.

    Science.gov (United States)

    Mukundi, Eric; Gomez-Cano, Fabio; Ouma, Wilberforce Zachary; Grotewold, Erich

    2017-01-01

    Developing a knowledge base that contains all the information necessary for the researcher studying gene regulation in a particular organism can be accomplished in four stages. This begins with defining the data scope. We describe here the necessary information and resources, and outline the methods for obtaining data. The second stage consists of designing the schema, which involves defining the entire arrangement of the database in a systematic plan. The third stage is the implementation, defined by actualization of the database by using software according to a predefined schema. The final stage is development, where the database is made available to users in a web-accessible system. The result is a knowledgebase that integrates all the information pertaining to gene regulation, and which is easily expandable and transferable.

  18. Gene expression in mycorrhizal orchid protocorms suggests a friendly plant-fungus relationship.

    Science.gov (United States)

    Perotto, Silvia; Rodda, Marco; Benetti, Alex; Sillo, Fabiano; Ercole, Enrico; Rodda, Michele; Girlanda, Mariangela; Murat, Claude; Balestrini, Raffaella

    2014-06-01

    Orchids fully depend on symbiotic interactions with specific soil fungi for seed germination and early development. Germinated seeds give rise to a protocorm, a heterotrophic organ that acquires nutrients, including organic carbon, from the mycorrhizal partner. It has long been debated if this interaction is mutualistic or antagonistic. To investigate the molecular bases of the orchid response to mycorrhizal invasion, we developed a symbiotic in vitro system between Serapias vomeracea, a Mediterranean green meadow orchid, and the rhizoctonia-like fungus Tulasnella calospora. 454 pyrosequencing was used to generate an inventory of plant and fungal genes expressed in mycorrhizal protocorms, and plant genes could be reliably identified with a customized bioinformatic pipeline. A small panel of plant genes was selected and expression was assessed by real-time quantitative PCR in mycorrhizal and non-mycorrhizal protocorm tissues. Among these genes were some markers of mutualistic (e.g. nodulins) as well as antagonistic (e.g. pathogenesis-related and wound/stress-induced) genes. None of the pathogenesis or wound/stress-related genes were significantly up-regulated in mycorrhizal tissues, suggesting that fungal colonization does not trigger strong plant defence responses. In addition, the highest expression fold change in mycorrhizal tissues was found for a nodulin-like gene similar to the plastocyanin domain-containing ENOD55. Another nodulin-like gene significantly more expressed in the symbiotic tissues of mycorrhizal protocorms was similar to a sugar transporter of the SWEET family. Two genes coding for mannose-binding lectins were significantly up-regulated in the presence of the mycorrhizal fungus, but their role in the symbiosis is unclear.

  19. Domestication of transposable elements into MicroRNA genes in plants.

    Directory of Open Access Journals (Sweden)

    Yang Li

    Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.

  20. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  1. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    Energy Technology Data Exchange (ETDEWEB)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P. [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Eapen, Susan, E-mail: eapenhome@yahoo.com [Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2011-08-15

    Highlights: {yields} Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. {yields} Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. {yields} Using in vitro T{sub 1} seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. {yields} This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of {sup 14}C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T{sub 0} and T{sub 1}) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  2. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene

    International Nuclear Information System (INIS)

    Dixit, Prachy; Mukherjee, Prasun K.; Sherkhane, Pramod D.; Kale, Sharad P.; Eapen, Susan

    2011-01-01

    Highlights: → Transgenic plants expressing a TvGST gene were tested for tolerance, uptake and degradation of anthracene. → Transgenic plants were more tolerant to anthracene and take up more anthracene from soil and solutions compared to control plants. → Using in vitro T 1 seedlings, we showed that anthracene-a three fused benzene ring compound was phytodegraded to naphthalene derivatives, having two benzene rings. → This is the first time that a transgenic plant was shown to have the potential to phytodegrade anthracene. - Abstract: Plants can be used for remediation of polyaromatic hydrocarbons, which are known to be a major concern for human health. Metabolism of xenobiotic compounds in plants occurs in three phases and glutathione transferases (GST) mediate phase II of xenobiotic transformation. Plants, although have GSTs, they are not very efficient for degradation of exogenous recalcitrant xenobiotics including polyaromatic hydrocarbons. Hence, heterologous expression of efficient GSTs in plants may improve their remediation and degradation potential of xenobiotics. In the present study, we investigated the potential of transgenic tobacco plants expressing a Trichoderma virens GST for tolerance, remediation and degradation of anthracene-a recalcitrant polyaromatic hydrocarbon. Transgenic plants with fungal GST showed enhanced tolerance to anthracene compared to control plants. Remediation of 14 C uniformly labeled anthracene from solutions and soil by transgenic tobacco plants was higher compared to wild-type plants. Transgenic plants (T 0 and T 1 ) degraded anthracene to naphthalene derivatives, while no such degradation was observed in wild-type plants. The present work has shown that in planta expression of a fungal GST in tobacco imparted enhanced tolerance as well as higher remediation potential of anthracene compared to wild-type plants.

  3. Implication of the changing concept of genes on plant breeder’s work

    Directory of Open Access Journals (Sweden)

    Marco Aurélio D. Dias

    2011-01-01

    Full Text Available The recent genome sequencing of some species has accumulated evidence that for a large number of traits, thecontrol and action of genes are far more complex than previously thought. This article discusses possible implications of newinsights into the gene concept on the work of plant breeders. Apparently, the successful application of biotechnological techniques is not as simple as once assumed. The evident changes in the available concept of genes confirmed what the past experience had shown,i.e, selection should focus on the phenotype, under the same conditions as the plant is to be cultivated in. Advanced vocationaltraining of plant breeders must be continuously maintained, focusing on phenotype-based selection in as accurate as possibleexperiments.

  4. Impact of Bee Species and Plant Density on Alfalfa Pollination and Potential for Gene Flow

    Directory of Open Access Journals (Sweden)

    Johanne Brunet

    2010-01-01

    Full Text Available In outcrossing crops like alfalfa, various bee species can contribute to pollination and gene flow in seed production fields. With the increasing use of transgenic crops, it becomes important to determine the role of these distinct pollinators on alfalfa pollination and gene flow. The current study examines the relative contribution of honeybees, three bumble bee species, and three solitary bee species to pollination and gene flow in alfalfa. Two wild solitary bee species and one wild bumble bee species were best at tripping flowers, while the two managed pollinators commonly used in alfalfa seed production, honeybees and leaf cutting bees, had the lowest tripping rate. Honeybees had the greatest potential for gene flow and risk of transgene escape relative to the other pollinators. For honeybees, gene flow and risk of transgene escape were not affected by plant density although for the three bumble bee species gene flow and risk of transgene escape were the greatest in high-density fields.

  5. Transcriptomic changes reveal gene networks responding to the overexpression of a blueberry DWARF AND DELAYED FLOWERING 1 gene in transgenic blueberry plants.

    Science.gov (United States)

    Song, Guo-Qing; Gao, Xuan

    2017-06-19

    Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.

  6. Origin and diversification of leucine-rich repeat receptor-like protein kinase (LRR-RLK) genes in plants

    OpenAIRE

    Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng

    2017-01-01

    Background Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution...

  7. MADS goes genomic in conifers: towards determining the ancestral set of MADS-box genes in seed plants.

    Science.gov (United States)

    Gramzow, Lydia; Weilandt, Lisa; Theißen, Günter

    2014-11-01

    MADS-box genes comprise a gene family coding for transcription factors. This gene family expanded greatly during land plant evolution such that the number of MADS-box genes ranges from one or two in green algae to around 100 in angiosperms. Given the crucial functions of MADS-box genes for nearly all aspects of plant development, the expansion of this gene family probably contributed to the increasing complexity of plants. However, the expansion of MADS-box genes during one important step of land plant evolution, namely the origin of seed plants, remains poorly understood due to the previous lack of whole-genome data for gymnosperms. The newly available genome sequences of Picea abies, Picea glauca and Pinus taeda were used to identify the complete set of MADS-box genes in these conifers. In addition, MADS-box genes were identified in the growing number of transcriptomes available for gymnosperms. With these datasets, phylogenies were constructed to determine the ancestral set of MADS-box genes of seed plants and to infer the ancestral functions of these genes. Type I MADS-box genes are under-represented in gymnosperms and only a minimum of two Type I MADS-box genes have been present in the most recent common ancestor (MRCA) of seed plants. In contrast, a large number of Type II MADS-box genes were found in gymnosperms. The MRCA of extant seed plants probably possessed at least 11-14 Type II MADS-box genes. In gymnosperms two duplications of Type II MADS-box genes were found, such that the MRCA of extant gymnosperms had at least 14-16 Type II MADS-box genes. The implied ancestral set of MADS-box genes for seed plants shows simplicity for Type I MADS-box genes and remarkable complexity for Type II MADS-box genes in terms of phylogeny and putative functions. The analysis of transcriptome data reveals that gymnosperm MADS-box genes are expressed in a great variety of tissues, indicating diverse roles of MADS-box genes for the development of gymnosperms. This study is

  8. Overexpression of the AtSHI gene in poinsettia, Euphorbia pulcherrima, results in compact plants

    DEFF Research Database (Denmark)

    Islam, M. Ashraful; Lütken, Henrik Vlk; Haugslien, Sissel

    2013-01-01

    of the AtSHI gene into poinsettia by genetic engineering can be an effective approach in controlling plant height without negatively affecting flowering time. This can help to reduce or avoid the use of toxic growth retardants of environmental and human health concern. This is the first report that At......Euphorbia pulcherrima, poinsettia, is a non-food and non-feed vegetatively propagated ornamental plant. Appropriate plant height is one of the most important traits in poinsettia production and is commonly achieved by application of chemical growth retardants. To produce compact poinsettia plants...... integration of transgene was verified by PCR and Southern blot analysis. Reduced plant height (21–52%) and internode lengths (31–49%) were obtained in the transgenic lines compared to control plants. This correlates positively with the AtSHI transcript levels, with the highest levels in the most dwarfed...

  9. Expression of kenaf mitochondrial chimeric genes HM184 causes male sterility in transgenic tobacco plants.

    Science.gov (United States)

    Zhao, Yanhong; Liao, Xiaofang; Huang, Zhipeng; Chen, Peng; Zhou, Bujin; Liu, Dongmei; Kong, Xiangjun; Zhou, Ruiyang

    2015-08-01

    Chimeric genes resulting from the rearrangement of a mitochondrial genome were generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS). In the study, earlier we reported that identifying a 47 bp deletion at 3'- flanking of atp9 that was linked to male sterile cytoplasm in kenaf. The truncated fragment was fused with atp9, a mitochondrial transit signal (MTS) and/or GFP, comprised two chimeric genes MTS-HM184-GFP and MTS-HM184. The plant expression vector pBI121 containing chimeric genes were then introduced to tobacco plants by Agrobacterium-mediated T-DNA transformation. The result showed that certain transgenic plants were male sterility or semi-sterility, while some were not. The expression analysis further demonstrated that higher level of expression were showed in the sterility plants, while no expression or less expression in fertility plants, the levels of expression of semi-sterility were in between. And the sterile plant (containing MTS-HM184-GFP) had abnormal anther produced malformed/shriveled pollen grains stained negative that failed to germinate (0%), the corresponding fruits was shrunken, the semi-sterile plants having normal anther shape produced about 10-50% normal pollen grains, the corresponding fruits were not full, and the germination rate was 58%. Meanwhile these transgenic plants which altered on fertility were further analyzed in phenotype. As a result, the metamorphosis leaves were observed in the seedling stage, the plant height of transgenic plants was shorter than wild type. The growth duration of transgenic tobacco was delayed 30-45 days compared to the wild type. The copy numbers of target genes of transgenic tobacco were analyzed using the real-time quantitative method. The results showed that these transgenic plants targeting-expression in mitochondrial containing MTS-HM184-GFP had 1 copy and 2 copies, the other two plants containing MTS-HM184 both had 3 copies, but 0 copy in wild type. In

  10. ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

    Directory of Open Access Journals (Sweden)

    Dominika Ďurechová

    2013-02-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

  11. Seeing the forest for the trees: annotating small RNA producing genes in plants.

    Science.gov (United States)

    Coruh, Ceyda; Shahid, Saima; Axtell, Michael J

    2014-04-01

    A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. [Viability of 7 kinds of medicinal plant seeds stored in medium-term gene bank of the National Medicinal Plant Gene Bank].

    Science.gov (United States)

    Jin, Yue; Yang, Cheng-Min; Wei, Jian-He

    2016-05-01

    In order to evaluate seed viability of Platycodon grandiflorum, Schizonepeta tenuifolia, Andrographis paniculat, Codonopsis pilosula, Scutellaria baicalensis, Leonurus japonicus, Rabdosia rubescens, stored in the medium-term gene bank of the National Medicinal Plant Gene Bank for 4 years, we tested seed germination rate of 7 species of medicinal plant and analyzed the change of significance of levels of the germination rate in pre and post store. Seed germination rates of 7 species of medicinal plants were all decreased after 4 years, and the decrease of S. tenuifolia and S. baicalensis germination rates were much smaller than other species. The higher initial germination rate of P. grandiflorum, C. pilosula, R. rubescens seed has the smaller decline of germination rate, but the data of A. paniculata showed the opposite trend. The rate decline of the germination of S. tenuifolia and S. baicalensis was roughly the same in different germination rate interval. The results showed that low temperature storage could effectively prolong the seed longevity, and maintain the seed vigor. Moreover, it is necessary to study on the storage characteristics of the main medicinal plant seeds, and establish the monitoring plan and regeneration standard. Copyright© by the Chinese Pharmaceutical Association.

  13. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  14. Construction and comparison of gene co-expression networks shows complex plant immune responses

    Directory of Open Access Journals (Sweden)

    Luis Guillermo Leal

    2014-10-01

    Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.

  15. An ant-plant mutualism through the lens of cGMP-dependent kinase genes.

    Science.gov (United States)

    Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E

    2017-09-13

    In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).

  16. Arabidopsis Vacuolar Pyrophosphatase gene (AVP1) induces drought and salt tolerance in Nicotiana tabacum plants (abstract)

    International Nuclear Information System (INIS)

    Arif, A.; Mohsin, A.M.; Shafiq, S.; Zafar, Y.; Hameed, S.M.; Arif, M.; Javed, M.; Gaxiola, R.A.

    2005-01-01

    Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na

  17. Silicon Regulates Potential Genes Involved in Major Physiological Processes in Plants to Combat Stress

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2017-08-01

    Full Text Available Silicon (Si, the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.

  18. Diversity of alkane hydroxylase genes on the rhizoplane of grasses planted in petroleum-contaminated soils

    OpenAIRE

    Tsuboi, Shun; Yamamura, Shigeki; Nakajima-Kambe, Toshiaki; Iwasaki, Kazuhiro

    2015-01-01

    The study investigated the diversity and genotypic features of alkane hydroxylase genes on rhizoplanes of grasses planted in artificial petroleum-contaminated soils to acquire new insights into the bacterial communities responsible for petroleum degradation in phytoremediation. Four types of grass (Cynodon dactylon, two phenotypes of Zoysia japonica, and Z. matrella) were used. The concentrations of total petroleum hydrocarbon effectively decreased in the grass-planted systems compared with t...

  19. Identification of WOX family genes in Selaginella kraussiana for studies on stem cells and regeneration in lycophytes

    Directory of Open Access Journals (Sweden)

    Yachao eGe

    2016-02-01

    Full Text Available Plant stem cells give rise to all tissues and organs and also serve as the source for plant regeneration. The organization of plant stem cells has undergone a progressive change from simple to complex during the evolution of vascular plants. Most studies on plant stem cells have focused on model angiosperms, the most recently diverged branch of vascular plants. However, our knowledge of stem cell function in other vascular plants is limited. Lycophytes and euphyllophytes (ferns, gymnosperms, and angiosperms are two existing branches of vascular plants that separated more than 400 million years ago. Lycophytes retain many of the features of early vascular plants. Based on genome and transcriptome data, we identified WUSCHEL-RELATED HOMEOBOX (WOX genes in Selaginella kraussiana, a model lycophyte that is convenient for in vitro culture and observations of organ formation and regeneration. WOX genes are key players controlling stem cells in plants. Our results showed that the S. kraussiana genome encodes at least eight members of the WOX family, which represent an early stage of WOX family evolution. Identification of WOX genes in S. kraussiana could be a useful tool for molecular studies on the function of stem cells in lycophytes.

  20. [The obtainment and characteristics of Kalanchoe pinnata L. plants expressing the artificial gene of the cecropin P1 antimicrobial peptide].

    Science.gov (United States)

    Zakharchenko, N S; Rukavtsova, E B; Shevchuk, T V; Furs, O V; Pigoleva, S V; Lebedeva, A A; Chulina, I A; Baidakova, L K; Bur'yanov, Ya I

    2016-01-01

    Kalanchoe pinnata L. plants bearing an artificial CP1 gene encoding the cecropin P1 antimicrobial peptide have been obtained. The presence of the CP1 gene in the plant genome has been confirmed by PCR. Cecropin P1 synthesis in transgenic plants has been shown by MALDI mass spectrometry and Western blotting. The obtained plants have been highly resistant to bacterial and fungal phytopathogens, and their extracts have demonstrated antimicrobial activity towards human and animal pathogens. It has been shown that transgenic plants bearing the CP1 gene can be colonized by the beneficial associative microorganisms Methylovorus mays.

  1. Estrogen-dependent expression of sine oculis homeobox 1 in the mouse uterus during the estrous cycle

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Sijeong [Department of Biomedical Science, CHA University, Seongnam-si, Gyeonggi-do 13488 (Korea, Republic of); Kwon, Hwang [Fertility Center of CHA Bundang Medical Center, Seongnam-si, Gyeonggi-do 13496 (Korea, Republic of); Yoon, Hyemin [Department of Biomedical Science, CHA University, Seongnam-si, Gyeonggi-do 13488 (Korea, Republic of); Park, Miseon [Fertility Center of CHA Gangnam Medical Center, Seoul 06135 (Korea, Republic of); Kim, Hye-Ryun; Song, Haengseok [Department of Biomedical Science, CHA University, Seongnam-si, Gyeonggi-do 13488 (Korea, Republic of); Hong, Kwonho, E-mail: kwonho.hong@dankook.ac.kr [Department of Nanobiomedical Science & BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan-si, Chungcheongnam-do 31116 (Korea, Republic of); Choi, Youngsok, E-mail: youngsokchoi@cha.ac.kr [Department of Biomedical Science, CHA University, Seongnam-si, Gyeonggi-do 13488 (Korea, Republic of); Fertility Center of CHA Gangnam Medical Center, Seoul 06135 (Korea, Republic of)

    2016-04-08

    The sine oculis homeobox 1 (SIX1) is a member of the Six gene family. SIX1 is involved in tissue development by regulating proliferation, apoptosis, and differentiation. However, function of SIX1 in the uterus remains unknown. Here, we found that Six1 expression is regulated along the estrous cycle in mouse uterus. Six1 expression was significantly increased at estrus stage and decreased at the rest of stages. SIX1 is detected in the luminal and glandular epithelium of uterine endometrium at the estrus stage. Estrogen injection increased Six1 expression in the ovariectomized mouse uterus, whereas progesterone had no effect on its expression. Estrogen receptor antagonist inhibited estrogen-induced Six1 expression. Our findings imply that SIX1 may play a role as an important regulator to orchestrate the dynamic of uterine endometrium in response to estrogen level during the estrous cycle. These results will give us a better understanding of uterine biology. - Highlights: • Six1 expression is regulated during the estrous cycle in mouse uterus. • Six1 is highly expressed at the estrus stage of estrous cycle. • SIX1 is detected in luminal/glandular epithelium of the uterus at the estrus stage. • Estrogen stimulates Six1 expression in an estrogen receptor-dependent manner.

  2. Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))

    1991-10-01

    Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.

  3. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  4. Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.

    Science.gov (United States)

    Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella

    2017-10-01

    Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.

    Science.gov (United States)

    Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan

    2016-09-26

    Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.

  6. Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants

    Science.gov (United States)

    Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.

    2005-04-01

    This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.

  7. Reference Gene Selection in the Desert Plant Eremosparton songoricum

    Directory of Open Access Journals (Sweden)

    Dao-Yuan Zhang

    2012-06-01

    Full Text Available Eremosparton songoricum (Litv. Vass. (E. songoricum is a rare and extremely drought-tolerant desert plant that holds promise as a model organism for the identification of genes associated with water deficit stress. Here, we cloned and evaluated the expression of eight candidate reference genes using quantitative real-time reverse transcriptase polymerase chain reactions. The expression of these candidate reference genes was analyzed in a diverse set of 20 samples including various E. songoricum plant tissues exposed to multiple environmental stresses. GeNorm analysis indicated that expression stability varied between the reference genes in the different experimental conditions, but the two most stable reference genes were sufficient for normalization in most conditions. EsEF and Esα-TUB were sufficient for various stress conditions, EsEF and EsACT were suitable for samples of differing germination stages, and EsGAPDHand EsUBQ were most stable across multiple adult tissue samples. The Es18S gene was unsuitable as a reference gene in our analysis. In addition, the expression level of the drought-stress related transcription factor EsDREB2 verified the utility of E. songoricum reference genes and indicated that no single gene was adequate for normalization on its own. This is the first systematic report on the selection of reference genes in E. songoricum, and these data will facilitate future work on gene expression in this species.

  8. Using a periclinal chimera to unravel layer-specific gene expression in plants.

    Science.gov (United States)

    Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J

    2013-09-01

    Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.

  9. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    NARCIS (Netherlands)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Rocha, Da Martine; Bajew, Simon; Neilson, Roy; Sokolova, Elena; Silva, Da Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Hans; Jones, John T.; Eves-van den Akker, Sebastian

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been

  10. Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.

    Directory of Open Access Journals (Sweden)

    Heike Hadrys

    Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.

  11. Cadmium resistance in tobacco plants expressing the MuSI gene

    OpenAIRE

    Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

    2011-01-01

    MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI t...

  12. Reduced homeobox protein MSX1 in human endometrial tissue is linked to infertility.

    Science.gov (United States)

    Bolnick, Alan D; Bolnick, Jay M; Kilburn, Brian A; Stewart, Tamika; Oakes, Jonathan; Rodriguez-Kovacs, Javier; Kohan-Ghadr, Hamid-Reza; Dai, Jing; Diamond, Michael P; Hirota, Yasushi; Drewlo, Sascha; Dey, Sudhansu K; Armant, D Randall

    2016-09-01

    Is protein expression of the muscle segment homeobox gene family member MSX1 altered in the human secretory endometrium by cell type, developmental stage or fertility? MSX1 protein levels, normally elevated in the secretory phase endometrium, were significantly reduced in endometrial biopsies obtained from women of infertile couples. Molecular changes in the endometrium are important for fertility in both animals and humans. Msx1 is expressed in the preimplantation mouse uterus and regulates uterine receptivity for implantation. The MSX protein persists a short time, after its message has been down-regulated. Microarray analysis of the human endometrium reveals a similar pattern of MSX1 mRNA expression that peaks before the receptive period, with depressed expression at implantation. Targeted deletion of uterine Msx1 and Msx2 in mice prevents the loss of epithelial cell polarity during implantation and causes infertility. MSX1 mRNA and cell type-specific levels of MSX1 protein were quantified from two retrospective cohorts during the human endometrial cycle. MSX1 protein expression patterns were compared between fertile and infertile couples. Selected samples were dual-labeled by immunofluorescence microscopy to localize E-cadherin and β-catenin in epithelial cells. MSX1 mRNA was quantified by PCR in endometrium from hysterectomies (n = 14) determined by endometrial dating to be in the late-proliferative (cycle days 10-13), early-secretory (cycle days 14-19) or mid-secretory (cycle days 20-24) phase. MSX1 protein was localized using high-throughput, semi-quantitative immunohistochemistry with sectioned endometrial biopsy tissues from fertile (n = 89) and infertile (n = 89) couples. Image analysis measured stain intensity specifically within the luminal epithelium, glands and stroma during the early-, mid- and late- (cycle days 25-28) secretory phases. MSX1 transcript increased 5-fold (P MSX1 protein displayed strong nuclear localization in the luminal epithelium

  13. Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Kenneth W. Berendzen

    2013-04-01

    Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.

  14. Bioinformatics analysis of the oxidosqualene cyclase gene and the amino acid sequence in mangrove plants

    Science.gov (United States)

    Basyuni, M.; Wati, R.

    2017-01-01

    This study described the bioinformatics methods to analyze seven oxidosqualene cyclase (OSC) genes from mangrove plants on DDBJ/EMBL/GenBank as well as predicted the structure, composition, similarity, subcellular localization and phylogenetic. The physical and chemical properties of seven mangrove OSC showed variation among the genes. The percentage of the secondary structure of seven mangrove OSC genes followed the order of a helix > random coil > extended chain structure. The values of chloroplast or signal peptide were too low, indicated that no chloroplast transit peptide or signal peptide of secretion pathway in mangrove OSC genes. The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the mangrove OSC gene, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, Kandelia KcMS join with Bruguiera BgLUS, Rhizophora RsM1 was close to Bruguiera BgbAS, and Rhizophora RcCAS join with Kandelia KcCAS. The present study, therefore, supported the previous results that plant OSC genes form distinct clusters in the tree.

  15. Viral vectors for gene modification of plants as chem/bio sensors.

    Energy Technology Data Exchange (ETDEWEB)

    Manginell, Monica; Harper, Jason C.; Arango, Dulce C.; Brozik, Susan Marie; Dolan, Patricia L.

    2006-11-01

    Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport. We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing

  16. A role for the transcription factor NK2 homeobox 1 in schizophrenia: Convergent evidence from animal and human studies

    Directory of Open Access Journals (Sweden)

    Eva Albertsen Malt

    2016-03-01

    Full Text Available Schizophrenia is a highly heritable disorder with diverse mental and somatic symptoms. The molecular mechanisms leading from genes to disease pathology in schizophrenia remain largely unknown. Genome-wide association studies have shown that common single-nucleotide polymorphisms associated with specific diseases are enriched in the recognition sequences of transcription factors that regulate physiological processes relevant to the disease. We have used a bottom-up approach and tracked a developmental trajectory from embryology to physiological processes and behavior and recognized that the transcription factor NK2 homeobox 1 (NKX2-1 possesses properties of particular interest for schizophrenia. NKX2-1 is selectively expressed from prenatal development to adulthood in the brain, thyroid gland, parathyroid gland, lungs, skin, and enteric ganglia, and has key functions at the interface of the brain, the endocrine-, and the immune system. In the developing brain, NKX2-1-expressing progenitor cells differentiate into distinct subclasses of forebrain GABAergic and cholinergic neurons, astrocytes, and oligodendrocytes. The transcription factor is highly expressed in mature limbic circuits related to context-dependent goal-directed patterns of behavior, social interaction and reproduction, fear responses, responses to light, and other homeostatic processes. It is essential for development and mature function of the thyroid gland and the respiratory system, and is involved in calcium metabolism and immune responses. NKX2-1 interacts with a number of genes identified as susceptibility genes for schizophrenia. We suggest that NKX2-1 may lie at the core of several dose dependent pathways that are dysregulated in schizophrenia. We correlate the symptoms seen in schizophrenia with the temporal and spatial activities of NKX2-1 in order to highlight promising future research areas.

  17. Homeobox A7 increases cell proliferation by up-regulation of epidermal growth factor receptor expression in human granulosa cells

    Directory of Open Access Journals (Sweden)

    Yanase Toshihiko

    2010-06-01

    Full Text Available Abstract Background Homeobox (HOX genes encode transcription factors, which regulate cell proliferation, differentiation, adhesion, and migration. The deregulation of HOX genes is frequently associated with human reproductive system disorders. However, knowledge regarding the role of HOX genes in human granulosa cells is limited. Methods To determine the role of HOXA7 in the regulation and associated mechanisms of cell proliferation in human granulosa cells, HOXA7 and epidermal growth factor receptor (EGFR expressions were examined in primary granulosa cells (hGCs, an immortalized human granulosa cell line, SVOG, and a granulosa tumor cell line, KGN, by real-time PCR and Western blotting. To manipulate the expression of HOXA7, the HOXA7 specific siRNA was used to knockdown HOXA7 in KGN. Conversely, HOXA7 was overexpressed in SVOG by transfection with the pcDNA3.1-HOAX7 vector. Cell proliferation was measured by the MTT assay. Results Our results show that HOXA7 and EGFR were overexpressed in KGN cells compared to hGCs and SVOG cells. Knockdown of HOXA7 in KGN cells significantly decreased cell proliferation and EGFR expression. Overexpression of HOXA7 in SVOG cells significantly promoted cell growth and EGFR expression. Moreover, the EGF-induced KGN proliferation was abrogated, and the activation of downstream signaling was diminished when HOXA7 was knocked down. Overexpression of HOXA7 in SVOG cells had an opposite effect. Conclusions Our present study reveals a novel mechanistic role for HOXA7 in modulating granulosa cell proliferation via the regulation of EGFR. This finding contributes to the knowledge of the pro-proliferation effect of HOXA7 in granulosa cell growth and differentiation.

  18. Obtaining of transgenic papaya plants var. Maradol roja that carry out the rice oryzacystatin gene

    Directory of Open Access Journals (Sweden)

    Milady F. Mendoza

    2004-10-01

    Full Text Available Papaya (Carica papaya L., is severely affected by Papaya Ringspot virus, which belongs to plant potyvirus group. A recent strategy for pest control produced by this virus is the transformation with genes encoding cysteine proteinase inhibitors. Rice oryzacistatin gene encoding for cystatins, was inserted in a pCAMBIA binary vector, for genetic transformation of papaya somatic embryos var. Maradol roja, mediated by gene gun. Gene integration was confirmed by means of polimerase chain reaction using the primers designed from gene bar sequence. Forty out of eighty in vitro transgenic papaya lines amplified a 402 fragment which correspond to the expecting size. Key words: Carica papaya, genetic engineering, potyvirus, proteinase inhibitor

  19. Enhanced water stress tolerance of transgenic maize plants over-expressing LEA Rab28 gene.

    Science.gov (United States)

    Amara, Imen; Capellades, Montserrat; Ludevid, M Dolors; Pagès, Montserrat; Goday, Adela

    2013-06-15

    Late Embryogenesis Abundant (LEA) proteins participate in plant stress responses and contribute to the acquisition of desiccation tolerance. In this report Rab28 LEA gene has been over-expressed in maize plants under a constitutive maize promoter. The expression of Rab28 transcripts led to the accumulation and stability of Rab28 protein in the transgenic plants. Native Rab28 protein is localized to nucleoli in wild type maize embryo cells; here we find by whole-mount immunocytochemistry that in root cells of Rab28 transgenic and wild-type plants the protein is also associated to nucleolar structures. Transgenic plants were tested for stress tolerance and resulted in sustained growth under polyethyleneglycol (PEG)-mediated dehydration compared to wild-type controls. Under osmotic stress transgenic seedlings showed increased leaf and root areas, higher relative water content (RWC), reduced chlorophyll loss and lower Malondialdehyde (MDA) production in relation to wild-type plants. Moreover, transgenic seeds exhibited higher germination rates than wild-type seeds under water deficit. Overall, our results highlight the presence of transgenic Rab28 protein in nucleolar structures and point to the potential of group 5 LEA Rab28 gene as candidate to enhance stress tolerance in maize plants. Copyright © 2013 Elsevier GmbH. All rights reserved.

  20. Repression of Lateral Organ Boundary Genes by PENNYWISE and POUND-FOOLISH Is Essential for Meristem Maintenance and Flowering in Arabidopsis.

    Science.gov (United States)

    Khan, Madiha; Ragni, Laura; Tabb, Paul; Salasini, Brenda C; Chatfield, Steven; Datla, Raju; Lock, John; Kuai, Xiahezi; Després, Charles; Proveniers, Marcel; Yongguo, Cao; Xiang, Daoquan; Morin, Halima; Rullière, Jean-Pierre; Citerne, Sylvie; Hepworth, Shelley R; Pautot, Véronique

    2015-11-01

    In the model plant Arabidopsis (Arabidopsis thaliana), endogenous and environmental signals acting on the shoot apical meristem cause acquisition of inflorescence meristem fate. This results in changed patterns of aerial development seen as the transition from making leaves to the production of flowers separated by elongated internodes. Two related BEL1-like homeobox genes, PENNYWISE (PNY) and POUND-FOOLISH (PNF), fulfill this transition. Loss of function of these genes impairs stem cell maintenance and blocks internode elongation and flowering. We show here that pny pnf apices misexpress lateral organ boundary genes BLADE-ON-PETIOLE1/2 (BOP1/2) and KNOTTED-LIKE FROM ARABIDOPSIS THALIANA6 (KNAT6) together with ARABIDOPSIS THALIANA HOMEOBOX GENE1 (ATH1). Inactivation of genes in this module fully rescues pny pnf defects. We further show that BOP1 directly activates ATH1, whereas activation of KNAT6 is indirect. The pny pnf restoration correlates with renewed accumulation of transcripts conferring floral meristem identity, including FD, SQUAMOSA PROMOTER-BINDING PROTEIN LIKE genes, LEAFY, and APETALA1. To gain insight into how this module blocks flowering, we analyzed the transcriptome of BOP1-overexpressing plants. Our data suggest a central role for the microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE-microRNA172 module in integrating stress signals conferred in part by promotion of jasmonic acid biosynthesis. These data reveal a potential mechanism by which repression of lateral organ boundary genes by PNY-PNF is essential for flowering. © 2015 American Society of Plant Biologists. All Rights Reserved.

  1. Proliferation and osteo/odontogenic differentiation of stem cells from apical papilla regulated by Zinc fingers and homeoboxes 2: An in vitro study.

    Science.gov (United States)

    Wan, Fang; Gao, Lifen; Lu, Yating; Ma, Hongxin; Wang, Hongxing; Liang, Xiaohong; Wang, Yan; Ma, Chunhong

    2016-01-15

    In the process of tooth root development, stem cells from the apical papilla (SCAPs) can differentiate into odontoblasts and form root dentin, however, molecules regulating SCAPs differentiation have not been elucidated. Zinc fingers and homeoboxes 2 (ZHX2) is a novel transcriptional inhibitor. It is reported to modulate the development of nerve cells, liver cells, B cells, red blood cells, and so on. However, the role of ZHX2 in tooth root development remains unclear. In this study, we explored the potential role of ZHX2 in the process of SCAPs differentiation. The results showed that overexpression of ZHX2 upregulated the expression of osteo/odontogenic related genes and ALP activity, inhibited the proliferation of SCAPs. Consistently, ZHX2 knockdown reduced SCAPs mineralization and promoted SCAPs proliferation. These results indicated that ZHX2 plays a critical role in the proliferation and osteo/odontogenic differentiation of SCAPs. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  3. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  4. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  5. Ethical perception of cross-species gene transfer in plant | Amin ...

    African Journals Online (AJOL)

    Plants can be genetically modified through a variety of methods in the hope that it will be improved in some way to increase the yield and quality of a crop, or to add nutritional value or shelf life. The development of genetically modified (GM) rice to enrich its nutritional value, such as Vitamin C might involve gene transfer ...

  6. Identifying new sex-linked genes through BAC sequencing in the dioecious plant Silene latifolia

    Czech Academy of Sciences Publication Activity Database

    Blavet, Nicolas; Blavet, Hana; Muyle, A.; Käfer, J.; Cegan, R.; Deschamps, C.; Zemp, N.; Mousset, S.; Aubourg, S.; Bergero, R.; Charlesworth, D.; Hobza, Roman; Widmer, A.; Marais, G.A.B.

    2015-01-01

    Roč. 16, JUL 25 (2015), s. 546 ISSN 1471-2164 R&D Projects: GA ČR GAP501/12/2220 Institutional support: RVO:61389030 Keywords : Sex chromosomes * Sex-linked genes * Plant Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.867, year: 2015

  7. Evolutionary history of the phl gene cluster in the plant-associated bacterium Pseudomonas fluorescens

    NARCIS (Netherlands)

    Moynihan, J.A.; Morrissey, J.P.; Coppoolse, E.; Stiekema, W.J.; O'Gara, F.; Boyd, E.F.

    2009-01-01

    Pseudomonas fluorescens is of agricultural and economic importance as a biological control agent largely because of its plant-association and production of secondary metabolites, in particular 2, 4-diacetylphloroglucinol (2, 4-DAPG). This polyketide, which is encoded by the eight gene phl cluster,

  8. An efficient marker-free vector for clean gene transfer into plants ...

    African Journals Online (AJOL)

    A marker-free vector, pBINMF, for clean gene transfer was constructed based on the binary vector pBINPLUS. Vector pBINMF, carrying only a multiple cloning site (MCS) between the left and the right T-DNA border, was suitable to directly generate marker-free transgenic plants (MFTPs) without any vector sequences ...

  9. NDH expression marks major transitions in plant evolution and reveals coordinate intracellular gene loss.

    Science.gov (United States)

    Ruhlman, Tracey A; Chang, Wan-Jung; Chen, Jeremy J W; Huang, Yao-Ting; Chan, Ming-Tsair; Zhang, Jin; Liao, De-Chih; Blazier, John C; Jin, Xiaohua; Shih, Ming-Che; Jansen, Robert K; Lin, Choun-Sea

    2015-04-11

    Key innovations have facilitated novel niche utilization, such as the movement of the algal predecessors of land plants into terrestrial habitats where drastic fluctuations in light intensity, ultraviolet radiation and water limitation required a number of adaptations. The NDH (NADH dehydrogenase-like) complex of Viridiplantae plastids participates in adapting the photosynthetic response to environmental stress, suggesting its involvement in the transition to terrestrial habitats. Although relatively rare, the loss or pseudogenization of plastid NDH genes is widely distributed across diverse lineages of photoautotrophic seed plants and mutants/transgenics lacking NDH function demonstrate little difference from wild type under non-stressed conditions. This study analyzes large transcriptomic and genomic datasets to evaluate the persistence and loss of NDH expression across plants. Nuclear expression profiles showed accretion of the NDH gene complement at key transitions in land plant evolution, such as the transition to land and at the base of the angiosperm lineage. While detection of transcripts for a selection of non-NDH, photosynthesis related proteins was independent of the state of NDH, coordinate, lineage-specific loss of plastid NDH genes and expression of nuclear-encoded NDH subunits was documented in Pinaceae, gnetophytes, Orchidaceae and Geraniales confirming the independent and complete loss of NDH in these diverse seed plant taxa. The broad phylogenetic distribution of NDH loss and the subtle phenotypes of mutants suggest that the NDH complex is of limited biological significance in contemporary plants. While NDH activity appears dispensable under favorable conditions, there were likely sufficiently frequent episodes of abiotic stress affecting terrestrial habitats to allow the retention of NDH activity. These findings reveal genetic factors influencing plant/environment interactions in a changing climate through 450 million years of land plant

  10. Overexpression of the AtSHI gene in poinsettia, Euphorbia pulcherrima, results in compact plants.

    Directory of Open Access Journals (Sweden)

    M Ashraful Islam

    Full Text Available Euphorbia pulcherrima, poinsettia, is a non-food and non-feed vegetatively propagated ornamental plant. Appropriate plant height is one of the most important traits in poinsettia production and is commonly achieved by application of chemical growth retardants. To produce compact poinsettia plants with desirable height and reduce the utilization of growth retardants, the Arabidopsis SHORT INTERNODE (AtSHI gene controlled by the cauliflower mosaic virus 35S promoter was introduced into poinsettia by Agrobacterium-mediated transformation. Three independent transgenic lines were produced and stable integration of transgene was verified by PCR and Southern blot analysis. Reduced plant height (21-52% and internode lengths (31-49% were obtained in the transgenic lines compared to control plants. This correlates positively with the AtSHI transcript levels, with the highest levels in the most dwarfed transgenic line (TL1. The indole-3-acetic acid (IAA content appeared lower (11-31% reduction in the transgenic lines compared to the wild type (WT controls, with the lowest level (31% reduction in TL1. Total internode numbers, bract numbers and bract area were significantly reduced in all transgenic lines in comparison with the WT controls. Only TL1 showed significantly lower plant diameter, total leaf area and total dry weight, whereas none of the AtSHI expressing lines showed altered timing of flower initiation, cyathia abscission or bract necrosis. This study demonstrated that introduction of the AtSHI gene into poinsettia by genetic engineering can be an effective approach in controlling plant height without negatively affecting flowering time. This can help to reduce or avoid the use of toxic growth retardants of environmental and human health concern. This is the first report that AtSHI gene was overexpressed in poinsettia and transgenic poinsettia plants with compact growth were produced.

  11. A contribution to the study of plant development evolution based on gene co-expression networks

    Directory of Open Access Journals (Sweden)

    Francisco J. Romero-Campero

    2013-08-01

    Full Text Available Phototrophic eukaryotes are among the most successful organisms on Earth due to their unparalleled efficiency at capturing light energy and fixing carbon dioxide to produce organic molecules. A conserved and efficient network of light-dependent regulatory modules could be at the bases of this success. This regulatory system conferred early advantages to phototrophic eukaryotes that allowed for specialization, complex developmental processes and modern plant characteristics. We have studied light-dependent gene regulatory modules from algae to plants employing integrative-omics approaches based on gene co-expression networks. Our study reveals some remarkably conserved ways in which eukaryotic phototrophs deal with day length and light signaling. Here we describe how a family of Arabidopsis transcription factors involved in photoperiod response has evolved from a single algal gene according to the innovation, amplification and divergence theory of gene evolution by duplication. These modifications of the gene co-expression networks from the ancient unicellular green algae Chlamydomonas reinhardtii to the modern brassica Arabidopsis thaliana may hint on the evolution and specialization of plants and other organisms.

  12. The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys

    Directory of Open Access Journals (Sweden)

    Anna V. Shchennikova

    2018-01-01

    Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.

  13. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA

    Science.gov (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi

    2013-01-01

    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  14. Gene stacking of multiple traits for high yield of fermentable sugars in plant biomass

    DEFF Research Database (Denmark)

    Aznar, Aude; Chalvin, Camille; Shih, Patrick M.

    2018-01-01

    the ratio of C6 to C5 sugars in the cell wall and decreasing the lignin content are two important targets in engineering of plants that are more suitable for downstream processing for second-generation biofuel production.Results: We have studied the basic mechanisms of cell wall biosynthesis and identified...... genes involved in biosynthesis of pectic galactan, including the GALS1 galactan synthase and the UDP-galactose/UDP-rhamnose transporter URGT1. We have engineered plants with a more suitable biomass composition by applying these findings, in conjunction with synthetic biology and gene stacking tools...... to vessels where this polysaccharide is essential. Finally, the high galactan and low xylan traits were stacked with the low lignin trait obtained by expressing the QsuB gene encoding dehydroshikimate dehydratase in lignifying cells.Conclusion: The results show that approaches to increasing C6 sugar content...

  15. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  16. A Comparison of Selective Pressures in Plant X-Linked and Autosomal Genes.

    Science.gov (United States)

    Krasovec, Marc; Nevado, Bruno; Filatov, Dmitry A

    2018-05-03

    Selection is expected to work differently in autosomal and X-linked genes because of their ploidy difference and the exposure of recessive X-linked mutations to haploid selection in males. However, it is not clear whether these expectations apply to recently evolved sex chromosomes, where many genes retain functional X- and Y-linked gametologs. We took advantage of the recently evolved sex chromosomes in the plant Silene latifolia and its closely related species to compare the selective pressures between hemizygous and non-hemizygous X-linked genes as well as between X-linked genes and autosomal genes. Our analysis, based on over 1000 genes, demonstrated that, similar to animals, X-linked genes in Silene evolve significantly faster than autosomal genes—the so-called faster-X effect. Contrary to expectations, faster-X divergence was detectable only for non-hemizygous X-linked genes. Our phylogeny-based analyses of selection revealed no evidence for faster adaptation in X-linked genes compared to autosomal genes. On the other hand, partial relaxation of purifying selection was apparent on the X-chromosome compared to the autosomes, consistent with a smaller genetic diversity in S. latifolia X-linked genes (π x = 0.016; π aut = 0.023). Thus, the faster-X divergence in S. latifolia appears to be a consequence of the smaller effective population size rather than of a faster adaptive evolution on the X-chromosome. We argue that this may be a general feature of “young” sex chromosomes, where the majority of X-linked genes are not hemizygous, preventing haploid selection in heterogametic sex.

  17. Using The Corngrass1 Gene To Enhance The Biofuel Properties Of Crop Plants

    Energy Technology Data Exchange (ETDEWEB)

    Hake, Sarah [USDA Agricultural Research Service, Washington DC (United States); Chuck, George [USDA Agricultural Research Service, Washington DC (United States)

    2015-10-29

    The development of novel plant germplasm is vital to addressing our increasing bioenergy demands. The major hurdle to digesting plant biomass is the complex structure of the cell walls, the substrate of fermentation. Plant cell walls are inaccessible matrices of macromolecules that are polymerized with lignin, making fermentation difficult. Overcoming this hurdle is a major goal toward developing usable bioenergy crop plants. Our project seeks to enhance the biofuel properties of perennial grass species using the Corngrass1 (Cg1) gene and its targets. Dominant maize Cg1 mutants produce increased biomass by continuously initiating extra axillary meristems and leaves. We cloned Cg1 and showed that its phenotype is caused by over expression of a unique miR156 microRNA gene that negatively regulates SPL transcription factors. We transferred the Cg1 phenotype to other plants by expressing the gene behind constitutive promoters in four different species, including the monocots, Brachypodium and switchgrass, and dicots, Arabidopsis and poplar. All transformants displayed a similar range of phenotypes, including increased biomass from extended leaf production, and increased vegetative branching. Field grown switchgrass transformants showed that overall lignin content was reduced, the ratio of glucans to xylans was increased, and surprisingly, that starch levels were greatly increased. The goals of this project are to control the tissue and temporal expression of Cg1 by using different promoters to drive its expression, elucidate the function of the SPL targets of Cg1 by generating gain and loss of function alleles, and isolate downstream targets of select SPL genes using deep sequencing and chromatin immunoprecipitation. We believe it is possible to control biomass accumulation, cell wall properties, and sugar levels through manipulation of either the Cg1 gene and/or its SPL targets.

  18. Slow food: insect prey and chitin induce phytohormone accumulation and gene expression in carnivorous Nepenthes plants.

    Science.gov (United States)

    Yilamujiang, Ayufu; Reichelt, Michael; Mithöfer, Axel

    2016-08-01

    Carnivorous Nepenthes plants use modified leaves forming pitfall traps to capture and digest prey, mainly insects, for additional nutrient supply. These traps, so called pitchers, contain a plant-derived fluid composed of many hydrolytic enzymes and defence-related proteins. In this study, the prey-induced induction of corresponding genes of those proteins and a role for phytohormones in this process was analysed. Tissue from insect prey-fed, chitin- and phytohormone-challenged pitchers was harvested and analysed for selected gene expressions by a quantitative PCR technique. Phytohormone levels were determined by LC-MS/MS. Nepenthesin proteolytic activities were measured in the digestive fluid using a fluorescence substrate. Insect prey in the pitchers induced the accumulation of phytohormones such as jasmonates as well as the transcription of studied genes encoding a chitinase 3 and a protease (nepenthesin I), whereas a defence-related protein (PR-1) gene was not induced. Treatment with chitin as a component of the insects' exoskeleton triggered the accumulation of jasmonates, the expression of nepenthesin I and chitinase 3 genes similar to jasmonic acid treatment, and induced protease activity in the fluid. All detectable responses were slowly induced. The results suggest that upon insect prey catch a sequence of signals is initiated: (1) insect-derived chitin, (2) jasmonate as endogenous phytohormone signal, (3) the induction of digestive gene expression and (4) protein expression. This resembles a similar hierarchy of events as described from plant pathogen/herbivore interactions, supporting the idea that carnivory evolved from plant defences. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

    International Nuclear Information System (INIS)

    Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

    2013-05-01

    Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application

  20. High-throughput identification of ionizing radiation-sensitive plant genes and development of radiation indicator plant and radiation sensing Genechip

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee

    2013-05-15

    Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application.

  1. Overexpression of cotton RAV1 gene in Arabidopsis confers transgenic plants high salinity and drought sensitivity.

    Science.gov (United States)

    Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao

    2015-01-01

    RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.

  2. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    International Nuclear Information System (INIS)

    Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng

    2016-01-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  3. Overexpression of an Arabidopsis heterogeneous nuclear ribonucleoprotein gene, AtRNP1, affects plant growth and reduces plant tolerance to drought and salt stresses

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhenyu, E-mail: wzy72609@163.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Wang, Bing, E-mail: wangbing@ibcas.ac.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Liu, Erlong, E-mail: liuel14@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Chen, Ni, E-mail: 63710156@qq.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhang, Wei, E-mail: wzhang1216@yahoo.com [Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444 (China); Liu, Heng, E-mail: hengliu@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China)

    2016-04-01

    Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.

  4. Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.

    Science.gov (United States)

    Vozárová, Z; Žilová, M; Šubr, Z

    2015-12-01

    Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.

  5. Genes under positive selection in a model plant pathogenic fungus, Botrytis.

    Science.gov (United States)

    Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian

    2012-07-01

    The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

    Science.gov (United States)

    Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

    2015-09-01

    In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

  7. Remote sensing of gene expression in Planta: transgenic plants as monitors of exogenous stress perception in extraterrestrial environments

    Science.gov (United States)

    Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.

    2002-01-01

    Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.

  8. Cadmium resistance in tobacco plants expressing the MuSI gene.

    Science.gov (United States)

    Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon

    2011-10-01

    MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI transgenic tobacco plants absorbed less Cd than wild-type plants. Cd translocation from roots to shoots was reduced in the transgenic plants, thereby avoiding Cd toxicity. The number of short trichomes in the leaves of wild-type tobacco plants was increased by Cd treatment, while this was unchanged in MuSI transgenic tobacco. These results suggest that MuSI transgenic tobacco plants have enhanced tolerance to Cd via reduced Cd uptake and/or increased Cd immobilization in the roots, resulting in less Cd translocation to the shoots.

  9. Fibroblast and keratinocyte gene expression following exposure to the extracts of holy basil plant (Ocimum tenuiflorum, malabar nut plant (Justicia adhatoda, and emblic myrobalan plant (Phyllanthus emblica

    Directory of Open Access Journals (Sweden)

    Takao Someya

    2018-04-01

    Full Text Available This data article provides gene expression profiles, determined by using real-time PCR, of fibroblasts and keratinocytes treated with 0.01% and 0.001% extracts of holy basil plant (Ocimum tenuiflorum, sri lankan local name “maduruthala”, 0.1% and 0.01% extracts of malabar nut plant (Justicia adhatoda, sri lankan local name “adayhoda” and 0.003% and 0.001% extracts of emblic myrobalan plant (Phyllanthus emblica, sri lankan local name “nelli”, harvested in Sri Lanka. For fibroblasts, the dataset includes expression profiles for genes encoding hyaluronan synthase 1 (HAS1, hyaluronan synthase 2 (HAS2, hyaluronidase-1 (HYAL1, hyaluronidase-2 (HYAL2, versican, aggrecan, CD44, collagen, type I, alpha 1 (COL1A1, collagen, type III, alpha 1 (COL3A1, collagen, type VII, alpha 1 (COL7A1, matrix metalloproteinase 1 (MMP1, acid ceramidase, basic fibroblast growth factor (bFGF, fibroblast growth factor-7 (FGF7, vascular endothelial growth factor (VEGF, interleukin-1 alpha (IL-1α, cyclooxygenase-2 (cox2, transforming growth factor beta (TGF-β, and aquaporin 3 (AQP3. For keratinocytes, the expression profiles are for genes encoding HAS1, HAS2, HYAL1, HYAL2, versican, CD44, IL-1α, cox2, TGF-β, AQP3, Laminin5, collagen, type XVII, alpha 1 (COL17A1, integrin alpha-6 (ITGA6, ceramide synthase 3 (CERS3, elongation of very long chain fatty acids protein 1 (ELOVL1, elongation of very long chain fatty acids protein 4 (ELOVL4, filaggrin (FLG, transglutaminase 1 (TGM1, and keratin 1 (KRT1. The expression profiles are provided as bar graphs. Keywords: Real-time PCR, Gene expression profile, Fibroblast, Keratinocyte, Holy basil extract, Ocimum tenuiflorum, Maduruthala, Malabar nut plant extract, Justicia adhatoda, Adayhoda, Emblic myrobalan extract, Phyllanthus emblica, Nelli

  10. The zinc finger E-box-binding homeobox 1 (Zeb1) promotes the conversion of mouse fibroblasts into functional neurons.

    Science.gov (United States)

    Yan, Long; Li, Yue; Shi, Zixiao; Lu, Xiaoyin; Ma, Jiao; Hu, Baoyang; Jiao, Jianwei; Wang, Hongmei

    2017-08-04

    The zinc finger E-box-binding transcription factor Zeb1 plays a pivotal role in the epithelial-mesenchymal transition. Numerous studies have focused on the molecular mechanisms by which Zeb1 contributes to this process. However, the functions of Zeb1 beyond the epithelial-mesenchymal transition remain largely elusive. Using a transdifferentiation system to convert mouse embryonic fibroblasts (MEFs) into functional neurons via the neuronal transcription factors achaete-scute family bHLH (basic helix-loop-helix) transcription factor1 ( Ascl1 ), POU class 3 homeobox 2 (POU3F2/ Brn2 ), and neurogenin 2 (Neurog2, Ngn2 ) (ABN), we found that Zeb1 was up-regulated during the early stages of transdifferentiation. Knocking down Zeb1 dramatically attenuated the transdifferentiation efficiency, whereas Zeb1 overexpression obviously increased the efficiency of transdifferentiation from MEFs to neurons. Interestingly, Zeb1 improved the transdifferentiation efficiency induced by even a single transcription factor ( e.g. Asc1 or Ngn2 ). Zeb1 also rapidly promoted the maturation of induced neuron cells to functional neurons and improved the formation of neuronal patterns and electrophysiological characteristics. Induced neuron cells could form functional synapse in vivo after transplantation. Genome-wide RNA arrays showed that Zeb1 overexpression up-regulated the expression of neuron-specific genes and down-regulated the expression of epithelial-specific genes during conversion. Taken together, our results reveal a new role for Zeb1 in the transdifferentiation of MEFs into neurons. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  12. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

    Science.gov (United States)

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

    2016-11-01

    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  13. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions

    Science.gov (United States)

    Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio

    2018-01-01

    Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216

  14. Genome mining of Streptomyces scabrisporus NF3 reveals symbiotic features including genes related to plant interactions.

    Directory of Open Access Journals (Sweden)

    Corina Diana Ceapă

    Full Text Available Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.

  15. Testing Transgenic Aspen Plants with bar Gene for Herbicide Resistance under Semi-natural Conditions.

    Science.gov (United States)

    Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I

    2016-01-01

    Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.

  16. Studies on gene expressions analyses for Arabidopsis thaliana plants stimulated by space flight condition

    Science.gov (United States)

    Lu, Jinying; Liu, Min; Pan, Yi; Li, Huasheng

    We carried out whole-genome microarray to screen the transcript profile of Arabidopsis thaliana seedlings after three treatment: space microgravity condition( Seedlings grown in microgravity state of space flight of SIMBOX on Shenzhou-8), 1g centrifugal force in space(Seedlings grown in 1g centrifugal force state of space flight of SIMBOX on Shenzhou-8) and ground control. The result of microarray analysis is as followed: There were 368 genes significantly differentially expressed in space microgravity condition compared with that in 1g centrifuge space condition. Space radiation caused 246 genes significantly differentially expressed between seedlings in 1g centrifuge space condition and ground control. Space conditions (including microgravity and radiation) caused 621 genes significantly differentially expressed between seedlings in space microgravity condition and ground control. Microgravity and radiation as a single factor can cause plant gene expression change, but two factors synergism can produce some new effects on plant gene expression. The function of differential expression genes were analyst by bioinformatics, and we found the expression of genes related with stress were more different, such as the dehydration of protein (dehydrin Xero2) expression is up-regulated 57 times; low-temperature-induced protein expression is up-regulated in 49 times; heat shock protein expression is up-regulated 20 times; transcription factor DREB2A expression increase 25 times; protein phosphatase 2C expression is up-regulated 14 times; transcription factor NAM-like protein expression is up-regulated 13 times; cell wall metabolism related genes (xyloglucan, endo-1, 4-beta-D-glucanase) expression is down-regulated in 15 times. The results provide scientific data for the mechanism of space mutation.

  17. Rate variation in parasitic plants: correlated and uncorrelated patterns among plastid genes of different function

    Directory of Open Access Journals (Sweden)

    dePamphilis Claude W

    2005-02-01

    Full Text Available Abstract Background The analysis of synonymous and nonsynonymous rates of DNA change can help in the choice among competing explanations for rate variation, such as differences in constraint, mutation rate, or the strength of genetic drift. Nonphotosynthetic plants of the Orobanchaceae have increased rates of DNA change. In this study 38 taxa of Orobanchaceae and relatives were used and 3 plastid genes were sequenced for each taxon. Results Phylogenetic reconstructions of relative rates of sequence evolution for three plastid genes (rbcL, matK and rps2 show significant rate heterogeneity among lineages and among genes. Many of the non-photosynthetic plants have increases in both synonymous and nonsynonymous rates, indicating that both (1 selection is relaxed, and (2 there has been a change in the rate at which mutations are entering the population in these species. However, rate increases are not always immediate upon loss of photosynthesis. Overall there is a poor correlation of synonymous and nonsynonymous rates. There is, however, a strong correlation of synonymous rates across the 3 genes studied and the lineage-speccific pattern for each gene is strikingly similar. This indicates that the causes of synonymous rate variation are affecting the whole plastid genome in a similar way. There is a weaker correlation across genes for nonsynonymous rates. Here the picture is more complex, as could be expected if there are many causes of variation, differing from taxon to taxon and gene to gene. Conclusions The distinctive pattern of rate increases in Orobanchaceae has at least two causes. It is clear that there is a relaxation of constraint in many (though not all non-photosynthetic lineages. However, there is also some force affecting synonymous sites as well. At this point, it is not possible to tell whether it is generation time, speciation rate, mutation rate, DNA repair efficiency or some combination of these factors.

  18. Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

    Science.gov (United States)

    Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

    2016-01-01

    Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

  19. Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses

    Directory of Open Access Journals (Sweden)

    Magdalena eMazur

    2012-09-01

    Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.

  20. Bioaerosols from a food waste composting plant affect human airway epithelial cell remodeling genes.

    Science.gov (United States)

    Chang, Min-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-12-24

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 10(2) conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5-10 μm) having higher endotoxin levels than did fine particles (0.5-2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21 WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers.

  1. Bioaerosols from a Food Waste Composting Plant Affect Human Airway Epithelial Cell Remodeling Genes

    Science.gov (United States)

    Chang, Ming-Wei; Lee, Chung-Ru; Hung, Hsueh-Fen; Teng, Kuo-Sheng; Huang, Hsin; Chuang, Chun-Yu

    2013-01-01

    The composting procedure in food waste plants generates airborne bioaerosols that have the potential to damage human airway epithelial cells. Persistent inflammation and repair responses induce airway remodeling and damage to the respiratory system. This study elucidated the expression changes of airway remodeling genes in human lung mucoepidermoid NCI-H292 cells exposed to bioaerosols from a composting plant. Different types of microorganisms were detectable in the composting plant, using the agar culture method. Real-time polymerase chain reaction was used to quantify the level of Aspergillus fumigatus and the profile of remodeling genes. The real-time PCR results indicated that the amount of A. fumigatus in the composting hall was less than 102 conidia. The endotoxins in the field bioaerosols were determined using a limulus amebocyte lysate test. The endotoxin levels depended on the type of particulate matter (PM), with coarse particles (2.5–10 μm) having higher endotoxin levels than did fine particles (0.5–2.5 μm). After exposure to the conditioned medium of field bioaerosol samples, NCI-H292 cells showed increased pro-inflammatory interleukin (IL)-6 release and activated epidermal growth factor receptor (EGFR), transforming growth factor (TGF)-β1 and cyclin-dependent kinase inhibitor 1 (p21WAF1/CIP1) gene expression, but not of matrix metallopeptidase (MMP)-9. Airborne endotoxin levels were higher inside the composting hall than they were in other areas, and they were associated with PM. This suggested that airborne bioaerosols in the composting plant contained endotoxins and microorganisms besides A. fumigatus that cause the inflammatory cytokine secretion and augment the expression of remodeling genes in NCI-H292 cells. It is thus necessary to monitor potentially hazardous materials from bioaerosols in food composting plants, which could affect the health of workers. PMID:24368426

  2. Disruption of plant carotenoid biosynthesis through virus-induced gene silencing affects oviposition behaviour of the butterfly Pieris rapae

    NARCIS (Netherlands)

    Zheng, S.J.; Snoeren, T.A.L.; Hogewoning, S.W.; Loon, van J.J.A.; Dicke, M.

    2010-01-01

    Optical plant characteristics are important cues to plant-feeding insects. In this article, we demonstrate for the first time that silencing the phytoene desaturase (PDS) gene, encoding a key enzyme in plant carotenoid biosynthesis, affects insect oviposition site selection behaviour. Virus-induced

  3. Phenotypic performance of transgenic potato (Solanum tuberosum L.) plants with pyramided rice cystatin genes (OCI and OCII)

    Science.gov (United States)

    The evaluation of transgenic plants commonly carried out under controlled conditions in culture rooms and greenhouses can give valuable information about the influence of introduced genes on transgenic plant phenotype. However, an overall assessment of plant performance can only be made by testing t...

  4. Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa

    Science.gov (United States)

    Basyuni, M.; Sumardi

    2017-01-01

    This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.

  5. Plant-Mediated Changes in Soil N-Cycling Genes during Revegetation of Copper Mine Tailings

    Directory of Open Access Journals (Sweden)

    Yang Li

    2017-11-01

    Full Text Available Nitrogen limitation represents a major bottleneck during the revegetation of mine tailings. However, controls over key nitrogen-cycling genes in rhizospheric soils under differential vegetation management remain poorly understood. The abundance and transcriptional activity of nitrogen-cycling genes and the enzymatic activity of nitrogen transformation are mediated differentially during revegetation of mine tailings by Imperata cylindrica and Chrysopogon zizanioides plants. Results showed that the highest total organic carbon (TOC, total nitrogen (TN, and NH4+-N contents were found in the rhizosphere of I. cylindrica. The nifH gene abundances differed between I. cylindrica and C. zizanioides, and were higher in I. cylindrica which demonstrated by 3.39-fold higher mRNA transcript abundance of the nifH gene and a 2.15-fold higher nitrogen fixation rate in the rhizosphere. In addition, C. zizanioides exhibited a 4.94-fold higher transcript abundance of the archaeal amoA gene and the highest nitrification rate (1.706 ± 0.293 μg N-NO2- g−1 h−1 in the rhizosphere. In conclusion, I. cylindrica and C. zizanioides stimulated the abundances and activities of nifH gene and archaeal amoA gene, respectively. In addition, I. cylindrica appears to be capable of enhancing nitrogen fixation and exhibited accelerated nitrogen accumulation, which may be particularly useful for the rehabilitation of mine tailings.

  6. Metagenomic profiling of antibiotic resistance genes and mobile genetic elements in a tannery wastewater treatment plant.

    Directory of Open Access Journals (Sweden)

    Zhu Wang

    Full Text Available Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs and mobile genetic elements (MGEs in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP. Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns.

  7. Identification and Expression Profiling of Radiation-sensitive Genes Using Plant Model System, Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Kim, Dong-Sub; Kang, Si-Yong; Lee, Geung-Joo; Kim, Jin-Baek

    2008-06-01

    The purpose of this study is to characterize genes specifically expressed in response to ionizing energy (gamma-rays) of acute irradiation and elucidate signalling mechanisms via functional analysis of isolated genes in Arabidopsis thaliana. Recent improvements in DNA microarray technologies and bioinformatics have made it possible to look for common features of ionizing radiation-responsive genes and their regulatory regions. It has produced massive quantities of gene expression and other functional genomics data, and its application will increase in plant genomics. In this study, we used oligonucleotide microarrays to detect the Arabidopsis genes expressed differentially by a gamma-irradiation during the vegetative (VT, 21 DAG) and reproductive (RT, 28 DAG) stages. Wild-type (Ler) Arabidopsis was irradiated with gamma-rays with 100 and 800 Gy doses. Among the 21,500 genes represented in the Agilent chip, approximately 13,500 ( ∼ 61.4 %) responsive genes to ν -irradiation were expressed with signal intensity greater than 192 when compared to the combined control (non-irradiated vegetative and reproductive pool). Expression patterns of several radiation inducible genes were confirmed by RT-PCR and Northern blotting. Our microarray results may contribute to an overall understanding of the type and quantities of genes that are expressed by an acute gamma-irradiation. In addition, to investigate the oxidative damage caused by irradiation, RT-PCR analysis for the expression of antioxidant isoenzyme genes, and a Transmission Electron Microscope (TEM) observation for visualizing the H 2 O 2 scavenging activity in leaves were applied

  8. Identification and Expression Profiling of Radiation-sensitive Genes Using Plant Model System, Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Sub; Kang, Si-Yong; Lee, Geung-Joo; Kim, Jin-Baek

    2008-06-15

    The purpose of this study is to characterize genes specifically expressed in response to ionizing energy (gamma-rays) of acute irradiation and elucidate signalling mechanisms via functional analysis of isolated genes in Arabidopsis thaliana. Recent improvements in DNA microarray technologies and bioinformatics have made it possible to look for common features of ionizing radiation-responsive genes and their regulatory regions. It has produced massive quantities of gene expression and other functional genomics data, and its application will increase in plant genomics. In this study, we used oligonucleotide microarrays to detect the Arabidopsis genes expressed differentially by a gamma-irradiation during the vegetative (VT, 21 DAG) and reproductive (RT, 28 DAG) stages. Wild-type (Ler) Arabidopsis was irradiated with gamma-rays with 100 and 800 Gy doses. Among the 21,500 genes represented in the Agilent chip, approximately 13,500 ({sup {approx}}61.4 %) responsive genes to {nu} -irradiation were expressed with signal intensity greater than 192 when compared to the combined control (non-irradiated vegetative and reproductive pool). Expression patterns of several radiation inducible genes were confirmed by RT-PCR and Northern blotting. Our microarray results may contribute to an overall understanding of the type and quantities of genes that are expressed by an acute gamma-irradiation. In addition, to investigate the oxidative damage caused by irradiation, RT-PCR analysis for the expression of antioxidant isoenzyme genes, and a Transmission Electron Microscope (TEM) observation for visualizing the H{sub 2}O{sub 2} scavenging activity in leaves were applied.

  9. Plant nodulation inducers enhance horizontal gene transfer of Azorhizobium caulinodans symbiosis island.

    Science.gov (United States)

    Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun

    2016-11-29

    Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.

  10. Uterine Msx-1 and Wnt4 signaling becomes aberrant in mice with the loss of leukemia inhibitory factor or Hoxa-10: evidence for a novel cytokine-homeobox-Wnt signaling in implantation.

    Science.gov (United States)

    Daikoku, Takiko; Song, Haengseok; Guo, Yong; Riesewijk, Anne; Mosselman, Sietse; Das, Sanjoy K; Dey, Sudhansu K

    2004-05-01

    Successful implantation absolutely depends on the reciprocal interaction between the implantation-competent blastocyst and the receptive uterus. Expression and gene targeting studies have shown that leukemia inhibitory factor (LIF), a cytokine of the IL-6 family, and Hoxa-10, an abdominalB-like homeobox gene, are crucial to implantation and decidualization in mice. Using these mutant mice, we sought to determine the importance of Msx-1 (another homeobox gene formerly known as Hox-7.1) and of Wnt4 (a ligand of the Wnt family) signaling in implantation because of their reported functions during development. We observed that Msx-1, Wnt4, and a Wnt antagonist sFRP4 are differentially expressed in the mouse uterus during the periimplantation period, suggesting their role in implantation. In addition, we observed an aberrant uterine expression of Msx-1 and sFRP4 in Lif mutant mice, and of Wnt4 and sFRP4 in Hoxa-10 mutant mice, further reinforcing the importance of these signaling pathways in implantation. Collectively, the present results provide evidence for a novel cytokine-homeotic-Wnt signaling network in implantation.

  11. Less is more: strategies to remove marker genes from transgenic plants.

    Science.gov (United States)

    Yau, Yuan-Yeu; Stewart, C Neal

    2013-04-23

    Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.

  12. Less is more: strategies to remove marker genes from transgenic plants

    Science.gov (United States)

    2013-01-01

    Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583

  13. Transgenic Alfalfa Plants Expressing the Sweetpotato Orange Gene Exhibit Enhanced Abiotic Stress Tolerance

    Science.gov (United States)

    Wang, Zhi; Ke, Qingbo; Kim, Myoung Duck; Kim, Sun Ha; Ji, Chang Yoon; Jeong, Jae Cheol; Lee, Haeng-Soon; Park, Woo Sung; Ahn, Mi-Jeong; Li, Hongbing; Xu, Bingcheng; Deng, Xiping; Lee, Sang-Hoon; Lim, Yong Pyo; Kwak, Sang-Soo

    2015-01-01

    Alfalfa (Medicago sativa L.), a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr) is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye) under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants), three lines (SOR2, SOR3, and SOR8) selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV)-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands. PMID:25946429

  14. Plant responses to environmental stress: regulation and functions of the Arabidopsis TCH genes

    Science.gov (United States)

    Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.; McIntire, L. V. (Principal Investigator)

    1997-01-01

    Expression of the Arabidopsis TCH genes is markedly upregulated in response to a variety of environmental stimuli including the seemingly innocuous stimulus of touch. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicates that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that at least a subset of the TCH proteins may collaborate in cell wall biogenesis.

  15. HOXB4 Gene Expression Is Regulated by CDX2 in Intestinal Epithelial Cells

    DEFF Research Database (Denmark)

    Jørgensen, Steffen; Coshun, Mehmet; Mikkelsen Homburg, Keld

    2016-01-01

    analysis and expression data from Caco2 cells also suggests a role for CDX2 in the regulation of HOXB4 gene expression in the intestinal epithelium. Thus, the aim of this study was to investigate whether HOXB4 gene expression is regulated by CDX2 in the intestinal epithelium. We demonstrated binding of CDX......The mammalian Caudal-related homeobox transcription factor 2 (CDX2) plays a key role in the homeobox regulatory network and is essential in regulating the expression of several homeobox (HOX) genes during embryonic development, particularly in the gut. Genome-wide CDX2 chromatin immunoprecipitation......2 to four different CDX2 binding sites in an enhancer region located upstream of the HOXB4 transcription start site. Mutations in the CDX2 binding sites reduced HOXB4 gene activity, and knock down of endogenous CDX2 expression by shRNA reduced HOXB4 gene expression. This is the first report...

  16. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes.

    Science.gov (United States)

    Danchin, Etienne G J; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Guzeeva, Elena Sokolova; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T; den Akker, Sebastian Eves-van

    2017-10-23

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus , representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus , respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  17. The rice YABBY4 gene regulates plant growth and development through modulating the gibberellin pathway.

    Science.gov (United States)

    Yang, Chao; Ma, Yamei; Li, Jianxiong

    2016-10-01

    YABBY genes encode seed plant-specific transcription factors that play pivotal roles in diverse aspects of leaf, shoot, and flower development. Members of the YABBY gene family are primarily expressed in lateral organs in a polar manner and function to specify abaxial cell fate in dicotyledons, but this polar expression is not conserved in monocotyledons. The function of YABBY genes is therefore not well understood in monocotyledons. Here we show that overexpression of the rice (Oryza sativa L.) YABBY4 gene (OsYABBY4) leads to a semi-dwarf phenotype, abnormal development in the uppermost internode, an increased number of floral organs, and insensitivity to gibberellin (GA) treatment. We report on an important role for OsYABBY4 in negative control of the expression of a GA biosynthetic gene by binding to the promoter region of the gibberellin 20-oxidase 2 gene (GA20ox2), which is a direct target of SLR1 (the sole DELLA protein negatively controlling GA responses in rice). OsYABBY4 also suppresses the expression level of SLR1 and interacts with SLR1 protein. The interaction inhibits GA-dependent degradation of SLR1 and therefore leads to GA insensitivity. These data together suggest that OsYABBY4 serves as a DNA-binding intermediate protein for SLR1 and is associated with the GA signaling pathway regulating gene expression during plant growth and development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  18. Weighted Gene Co-expression Network Analysis of the Dioscin Rich Medicinal Plant Dioscorea nipponica

    Directory of Open Access Journals (Sweden)

    Wei Sun

    2017-06-01

    Full Text Available Dioscorea contains critically important species which can be used as staple foods or sources of bioactive substances, including Dioscorea nipponica, which has been used to develop highly successful drugs to treat cardiovascular disease. Its major active ingredients are thought to be sterol compounds such as diosgenin, which has been called “medicinal gold” because of its valuable properties. However, reliance on naturally growing plants as a production system limits the potential use of D. nipponica, raising interest in engineering metabolic pathways to enhance the production of secondary metabolites. However, the biosynthetic pathway of diosgenin is still poorly understood, and D. nipponica is poorly characterized at a molecular level, hindering in-depth investigation. In the present work, the RNAs from five organs and seven methyl jasmonate treated D. nipponica rhizomes were sequenced using the Illumina high-throughput sequencing platform, yielding 52 gigabases of data, which were pooled and assembled into a reference transcriptome. Four hundred and eighty two genes were found to be highly expressed in the rhizomes, and these genes are mainly involved in stress response and transcriptional regulation. Based on their expression patterns, 36 genes were selected for further investigation as candidate genes involved in dioscin biosynthesis. Constructing co-expression networks based on significant changes in gene expression revealed 15 gene modules. Of these, four modules with properties correlating to dioscin regulation and biosynthesis, consisting of 4,665 genes in total, were selected for further functional investigation. These results improve our understanding of dioscin biosynthesis in this important medicinal plant and will help guide more intensive investigations.

  19. Limited gene dispersal and spatial genetic structure as stabilizing factors in an ant-plant mutualism.

    Science.gov (United States)

    Malé, P-J G; Leroy, C; Humblot, P; Dejean, A; Quilichini, A; Orivel, J

    2016-12-01

    Comparative studies of the population genetics of closely associated species are necessary to properly understand the evolution of these relationships because gene flow between populations affects the partners' evolutionary potential at the local scale. As a consequence (at least for antagonistic interactions), asymmetries in the strength of the genetic structures of the partner populations can result in one partner having a co-evolutionary advantage. Here, we assess the population genetic structure of partners engaged in a species-specific and obligatory mutualism: the Neotropical ant-plant, Hirtella physophora, and its ant associate, Allomerus decemarticulatus. Although the ant cannot complete its life cycle elsewhere than on H. physophora and the plant cannot live for long without the protection provided by A. decemarticulatus, these species also have antagonistic interactions: the ants have been shown to benefit from castrating their host plant and the plant is able to retaliate against too virulent ant colonies. We found similar short dispersal distances for both partners, resulting in the local transmission of the association and, thus, inbred populations in which too virulent castrating ants face the risk of local extinction due to the absence of H. physophora offspring. On the other hand, we show that the plant populations probably experienced greater gene flow than did the ant populations, thus enhancing the evolutionary potential of the plants. We conclude that such levels of spatial structure in the partners' populations can increase the stability of the mutualistic relationship. Indeed, the local transmission of the association enables partial alignments of the partners' interests, and population connectivity allows the plant retaliation mechanisms to be locally adapted to the castration behaviour of their symbionts. © 2016 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2016 European Society For Evolutionary Biology.

  20. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    Science.gov (United States)

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  1. ESTs, cDNA microarrays, and gene expression profiling: tools for dissecting plant physiology and development.

    Science.gov (United States)

    Alba, Rob; Fei, Zhangjun; Payton, Paxton; Liu, Yang; Moore, Shanna L; Debbie, Paul; Cohn, Jonathan; D'Ascenzo, Mark; Gordon, Jeffrey S; Rose, Jocelyn K C; Martin, Gregory; Tanksley, Steven D; Bouzayen, Mondher; Jahn, Molly M; Giovannoni, Jim

    2004-09-01

    Gene expression profiling holds tremendous promise for dissecting the regulatory mechanisms and transcriptional networks that underlie biological processes. Here we provide details of approaches used by others and ourselves for gene expression profiling in plants with emphasis on cDNA microarrays and discussion of both experimental design and downstream analysis. We focus on methods and techniques emphasizing fabrication of cDNA microarrays, fluorescent labeling, cDNA hybridization, experimental design, and data processing. We include specific examples that demonstrate how this technology can be used to further our understanding of plant physiology and development (specifically fruit development and ripening) and for comparative genomics by comparing transcriptome activity in tomato and pepper fruit.

  2. Fate of antibiotic resistance genes within the microbial communities of three waste water treatment plants

    OpenAIRE

    Di Cesare, Andrea; Eckert, Ester; D'Urso, Silvia; Doppelbauer, Julia; Corno, Gianluca

    2016-01-01

    Although Waste Water Treatment Plant (WWTP) are designed to reduce the biological pollution of urban waters, they lack a specific action against antibiotic resistance bacteria (ARB) or antibiotic resistance genes (ARGs). Nowadays, it is well documented that WWTPs constitute a reservoir of antibiotic resistances and, in some cases, they can be a favorable environment for the selection of ARB. This represent a serious concern for the public health, because the effluents of the WWTPs can be reus...

  3. De Novo Deep Transcriptome Analysis of Medicinal Plants for Gene Discovery in Biosynthesis of Plant Natural Products.

    Science.gov (United States)

    Han, R; Rai, A; Nakamura, M; Suzuki, H; Takahashi, H; Yamazaki, M; Saito, K

    2016-01-01

    Study on transcriptome, the entire pool of transcripts in an organism or single cells at certain physiological or pathological stage, is indispensable in unraveling the connection and regulation between DNA and protein. Before the advent of deep sequencing, microarray was the main approach to handle transcripts. Despite obvious shortcomings, including limited dynamic range and difficulties to compare the results from distinct experiments, microarray was widely applied. During the past decade, next-generation sequencing (NGS) has revolutionized our understanding of genomics in a fast, high-throughput, cost-effective, and tractable manner. By adopting NGS, efficiency and fruitful outcomes concerning the efforts to elucidate genes responsible for producing active compounds in medicinal plants were profoundly enhanced. The whole process involves steps, from the plant material sampling, to cDNA library preparation, to deep sequencing, and then bioinformatics takes over to assemble enormous-yet fragmentary-data from which to comb and extract information. The unprecedentedly rapid development of such technologies provides so many choices to facilitate the task, which can cause confusion when choosing the suitable methodology for specific purposes. Here, we review the general approaches for deep transcriptome analysis and then focus on their application in discovering biosynthetic pathways of medicinal plants that produce important secondary metabolites. © 2016 Elsevier Inc. All rights reserved.

  4. Evolution of Parallel Spindles Like genes in plants and highlight of unique domain architecture#

    Directory of Open Access Journals (Sweden)

    Consiglio Federica M

    2011-03-01

    Full Text Available Abstract Background Polyploidy has long been recognized as playing an important role in plant evolution. In flowering plants, the major route of polyploidization is suggested to be sexual through gametes with somatic chromosome number (2n. Parallel Spindle1 gene in Arabidopsis thaliana (AtPS1 was recently demonstrated to control spindle orientation in the 2nd division of meiosis and, when mutated, to induce 2n pollen. Interestingly, AtPS1 encodes a protein with a FHA domain and PINc domain putatively involved in RNA decay (i.e. Nonsense Mediated mRNA Decay. In potato, 2n pollen depending on parallel spindles was described long time ago but the responsible gene has never been isolated. The knowledge derived from AtPS1 as well as the availability of genome sequences makes it possible to isolate potato PSLike (PSL and to highlight the evolution of PSL family in plants. Results Our work leading to the first characterization of PSLs in potato showed a greater PSL complexity in this species respect to Arabidopsis thaliana. Indeed, a genomic PSL locus and seven cDNAs affected by alternative splicing have been cloned. In addition, the occurrence of at least two other PSL loci in potato was suggested by the sequence comparison of alternatively spliced transcripts. Phylogenetic analysis on 20 Viridaeplantae showed the wide distribution of PSLs throughout the species and the occurrence of multiple copies only in potato and soybean. The analysis of PSLFHA and PSLPINc domains evidenced that, in terms of secondary structure, a major degree of variability occurred in PINc domain respect to FHA. In terms of specific active sites, both domains showed diversification among plant species that could be related to a functional diversification among PSL genes. In addition, some specific active sites were strongly conserved among plants as supported by sequence alignment and by evidence of negative selection evaluated as difference between non-synonymous and

  5. Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.

    Directory of Open Access Journals (Sweden)

    Kazuhiro Hayashi

    Full Text Available Coenzyme Q (CoQ is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9 that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.

  6. Plant-Derived Transcription Factors for Orthologous Regulation of Gene Expression in the Yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Naseri, Gita; Balazadeh, Salma; Machens, Fabian; Kamranfar, Iman; Messerschmidt, Katrin; Mueller-Roeber, Bernd

    2017-09-15

    Control of gene expression by transcription factors (TFs) is central in many synthetic biology projects for which a tailored expression of one or multiple genes is often needed. As TFs from evolutionary distant organisms are unlikely to affect gene expression in a host of choice, they represent excellent candidates for establishing orthogonal control systems. To establish orthogonal regulators for use in yeast (Saccharomyces cerevisiae), we chose TFs from the plant Arabidopsis thaliana. We established a library of 106 different combinations of chromosomally integrated TFs, activation domains (yeast GAL4 AD, herpes simplex virus VP64, and plant EDLL) and synthetic promoters harboring cognate cis-regulatory motifs driving a yEGFP reporter. Transcriptional output of the different driver/reporter combinations varied over a wide spectrum, with EDLL being a considerably stronger transcription activation domain in yeast than the GAL4 activation domain, in particular when fused to Arabidopsis NAC TFs. Notably, the strength of several NAC-EDLL fusions exceeded that of the strong yeast TDH3 promoter by 6- to 10-fold. We furthermore show that plant TFs can be used to build regulatory systems encoded by centromeric or episomal plasmids. Our library of TF-DNA binding site combinations offers an excellent tool for diverse synthetic biology applications in yeast.

  7. Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

    Science.gov (United States)

    Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.

    2013-01-01

    Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276

  8. Solanum venturii, a suitable model system for virus-induced gene silencing studies in potato reveals StMKK6 as an important player in plant immunity

    NARCIS (Netherlands)

    Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana

    2016-01-01

    Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,

  9. A moso bamboo WRKY gene PeWRKY83 confers salinity tolerance in transgenic Arabidopsis plants.

    Science.gov (United States)

    Wu, Min; Liu, Huanlong; Han, Guomin; Cai, Ronghao; Pan, Feng; Xiang, Yan

    2017-09-15

    The WRKY family are transcription factors, involved in plant development, and response to biotic and abiotic stresses. Moso bamboo is an important bamboo that has high ecological, economic and cultural value and is widely distributed in the south of China. In this study, we performed a genome-wide identification of WRKY members in moso bamboo and identified 89 members. By comparative analysis in six grass genomes, we found the WRKY gene family may have experienced or be experiencing purifying selection. Based on relative expression levels among WRKY IIc members under three abiotic stresses, PeWRKY83 functioned as a transcription factor and was selected for detailed analysis. The transgenic Arabidopsis of PeWRKY83 showed superior physiological properties compared with the WT under salt stress. Overexpression plants were less sensitive to ABA at both germination and postgermination stages and accumulated more endogenous ABA under salt stress conditions. Further studies demonstrated that overexpression of PeWRKY83 could regulate the expression of some ABA biosynthesis genes (AtAAO3, AtNCED2, AtNCED3), signaling genes (AtABI1, AtPP2CA) and responsive genes (AtRD29A, AtRD29B, AtABF1) under salt stress. Together, these results suggested that PeWRKY83 functions as a novel WRKY-related TF which plays a positive role in salt tolerance by regulating stress-induced ABA synthesis.

  10. Phylogenetic analysis reveals conservation and diversification of micro RNA166 genes among diverse plant species.

    Science.gov (United States)

    Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K

    2014-01-01

    Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.

    Science.gov (United States)

    Kumar, Rahul

    2016-01-01

    Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.

  12. MicroRNA-141 inhibits migration of gastric cancer by targeting zinc finger E-box-binding homeobox 2.

    Science.gov (United States)

    Du, Ying; Wang, Lingfei; Wu, Honghai; Zhang, Yiyin; Wang, Kan; Wu, Dingting

    2015-09-01

    Human microRNA (miR)-141 is a member of the miR‑200 family, which has been reported to be downregulated in gastric cancer, and involved in the proliferation of gastric cancer cells. However, little is currently known regarding its role in the migration of gastric cancer. The present study investigated the function of miR‑141 in gastric cancer cell migration, and evaluated the contribution of zinc finger E‑box‑binding homeobox 1 and 2 (ZEB1/2) in miR‑141 mediated migration of gastric cancer cells. The expression levels of miR‑141 and its potential ZEB1/2 targets were examined by quantitative polymerase chain reaction (qPCR) and western blotting, respectively. The migration of SGC‑7901 and HGC‑27 gastric cancer cells, which had been transfected with an miRNA precursor, was examined by cell migration and wound healing assays. A luciferase activity assay was used to validate whether ZEB1/2 was a direct target of miR‑141. The results demonstrated that overexpression of miR‑141 markedly inhibited the migration of gastric cancer cells in vitro. Forced overexpression of miR‑141 significantly reduced the luciferase activity of the 3'‑untranslated region of ZEB2 in gastric cancer cells. Furthermore, the mRNA and protein expression levels of ZEB2 were reduced in cells overexpressing miR‑141, whereas the protein expression levels of E‑cadherin were increased. In gastric tumor samples the expression levels of ZEB2 were inversely correlated with the expression of miR‑141. These results suggest that miR‑141 may be involved in the inhibition of gastric cancer cell migration, and that ZEB2 is a target gene of miR-141.

  13. Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata

    Science.gov (United States)

    Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.

    2018-03-01

    It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.

  14. Overexpression of yeast ArDH gene in chloroplasts confers salinity tolerance in plants (abstract)

    International Nuclear Information System (INIS)

    Khan, M.S.; Kanwal, B.; Khalid, A.M.; Zafar, Y.; Malik, K.A.

    2005-01-01

    Water stress due to salinity and drought is the main limiting factor for plant growth, productivity and quality. A common response to water deficit is the accumulation of osmoprotectants such as sugars and amino acids. In yeast, arabitol dehydrogenase is found responsible for the production of arabitol from ribulose-5-phosphate. All plants synthesize ribulose-5-phosphate via pentose pathway in chloroplasts.. Therefore, osmotolerance of the plants could be enhanced through metabolic engineering of chloroplasts by introducing ArDH gene into the plastome, which is responsible for the conversion of ribulose-5- phosphate to arabitol. Here we report high-level expression of arabitol dehydrogenase (ArDH) in chloroplasts. Homoplasmic transgenic plants were recovered on spectinomycin-containing regeneration medium. Transformed tobacco plants survived whereas non-transformed were severely stressed or killed when two weeks old seedlings were exposed to NaCl (up to 400 mM), suggesting a role for arabitol in salt tolerance. Seedlings survived up to five weeks on medium containing high salt concentrations (350-400 mM). Nevertheless, seedlings remained green and grew normal on concentrations up to 350 mM NaCl for several weeks. Hypothesis that membranes are protected under stress conditions due to the arabitol accumulation in chloroplasts, seedlings were grown in liquid medium containing polyethylene glycol (PEG, up to 6%). Seedlings were tolerant to 6% PEG, suggesting that ArDH enzyme protects membranes integrity under stress. Therefore, it is concluded that ArDH gene could be expressed in crop plants to withstand abiotic stresses. (author)

  15. Expression of the Galanthus nivalis agglutinin (GNA) gene in transgenic potato plants confers resistance to aphids.

    Science.gov (United States)

    Mi, Xiaoxiao; Liu, Xue; Yan, Haolu; Liang, Lina; Zhou, Xiangyan; Yang, Jiangwei; Si, Huaijun; Zhang, Ning

    2017-01-01

    Aphids, the largest group of sap-sucking pests, cause significant yield losses in agricultural crops worldwide every year. The massive use of pesticides to combat this pest causes severe damage to the environment, putting in risk the human health. In this study, transgenic potato plants expressing Galanthus nivalis agglutinin (GNA) gene were developed using CaMV 35S and ST-LS1 promoters generating six transgenic lines (35S1-35S3 and ST1-ST3 corresponding to the first and second promoter, respectively). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the GNA gene was expressed in leaves, stems and roots of transgenic plants under the control of the CaMV 35S promoter, while it was only expressed in leaves and stems under the control of the ST-LS1 promoter. The levels of aphid mortality after 5 days of the inoculation in the assessed transgenic lines ranged from 20 to 53.3%. The range of the aphid population in transgenic plants 15 days after inoculation was between 17.0±1.43 (ST2) and 36.6±0.99 (35S3) aphids per plant, which corresponds to 24.9-53.5% of the aphid population in non-transformed plants. The results of our study suggest that GNA expressed in transgenic potato plants confers a potential tolerance to aphid attack, which appears to be an alternative against the use of pesticides in the future. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  16. The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.

    Science.gov (United States)

    Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J

    2017-05-01

    The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.

  17. A nucleotide metabolite controls stress-responsive gene expression and plant development.

    Directory of Open Access Journals (Sweden)

    Hao Chen

    Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt

  18. A nucleotide metabolite controls stress-responsive gene expression and plant development

    KAUST Repository

    Chen, Hao

    2011-10-19

    Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target

  19. [Expression of plant antimicrobial peptide pro-SmAMP2 gene increases resistance of transgenic potato plants to Alternaria and Fusarium pathogens].

    Science.gov (United States)

    Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A

    2016-09-01

    The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.

  20. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  1. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  2. Interspecific RNA interference of SHOOT MERISTEMLESS-like disrupts Cuscuta pentagona plant parasitism.

    Science.gov (United States)

    Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima

    2012-07-01

    Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.

  3. Integration of Genome-Wide TF Binding and Gene Expression Data to Characterize Gene Regulatory Networks in Plant Development.

    Science.gov (United States)

    Chen, Dijun; Kaufmann, Kerstin

    2017-01-01

    Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.

  4. Environmental control of plant nuclear gene expression by chloroplast redox signals

    Directory of Open Access Journals (Sweden)

    Jeannette ePfalz

    2012-11-01

    Full Text Available Plant photosynthesis takes place in specialised cell organelles, the chloroplasts, which perform all essential steps of this process. The proteins involved in photosynthesis are encoded by genes located on the plastid and nuclear genomes. Proper function and regulation of light harvesting and energy fixation thus requires a tight coordination of the gene expression machineries in the two genetic compartments. This is achieved by a bi-directional exchange of information between nucleus and plastids. Signals emerging from plastids report the functional and developmental state of the organelle to the nucleus and initiate distinct nuclear gene expression profiles, which trigger responses that support or improve plastid functions. Recent research indicated that this signalling is absolutely essential for plant growth and development. Reduction/oxidation (redox signals from photosynthesis are key players in this information network since they do report functional disturbances in photosynthesis, the primary energy source of plants. Such disturbances are caused by environmental fluctuations for instance in illumination, temperature or water availability. These environmental changes affect the linear electron flow of photosynthesis and result in changes of the redox state of the components involved (e.g. the plastoquinone pool or coupled to it (e.g. the thioredoxin pool. Thus, the changes in redox state directly reflect the environmental impact and serve as immediate plastidial signals to the nucleus. The triggered responses range from counterbalancing reactions within the physiological range up to severe stress responses including cell death. This review focuses on physiological redox signals from photosynthetic electron transport, their relation to the environment, potential transduction pathways to the nucleus and their impact on nuclear gene expression.

  5. Spatial analyses of mono, di and trinucleotide trends in plant genes.

    Directory of Open Access Journals (Sweden)

    Andrea Porceddu

    Full Text Available Genomic DNA sequences display compositional heterogeneity on many scales. In this paper we analyzed tendencies and anomalies in the occurence of mono, di and trinucleotides in structural regions of plant genes. Representation of these trends as a function of position along genic sequences highlighted compositional features peculiar of either monocots or eudicots that were remarkably uniform within these two evolutionary clades. The most evident of these features appeared in the form of gradient of base content along the direction of transcription. The robustness of such a representation was validated in sequences sub-datasets generated considering structural and compositional features such as total length of cds, overall GC content and genic orientation in the genome. Piecewise regression analyses indicated that the gradients could be conveniently approximated to a two segmented model where a first region featuring a steep slope is followed by a second segment fitting a milder variation. In general, monocots species showed steeper segments than eudicots. The guanine gradient was the most distinctive feature between the two evolutionary clades, being moderately increasing in eudicots and firmly decreasing in monocots. Single gene investigation revealed that a high proportion of genes show compositional trends compatible with a segmented model suggesting that these features are essential attributes of gene organization. Dinucleotide and trinucleotide biases were referred to expectation based on a random union of the component elements. The average bias at dinucleotide level identified a significant undererpresentation of some dinucleotide and the overrepresention of others. The bias at trinucleotide level was on average low. Finally, the analysis of bryophyte coding sequences showed mononucleotide, dinucleotide and trinucleotide compositional trends resembling those of higher plants. This finding suggested that the emergenge of compositional bias

  6. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  7. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  8. Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae

    Science.gov (United States)

    Melis, Anastasios; Mitra, Mautusi

    2010-06-29

    The invention provides method and compositions to minimize the chlorophyll antenna size of photosynthesis by decreasing TLA1 gene expression, thereby improving solar conversion efficiencies and photosynthetic productivity in plants, e.g., green microalgae, under bright sunlight conditions.

  9. Muscle Segment Homeobox Genes Direct Embryonic Diapause by Limiting Inflammation in the Uterus*

    Science.gov (United States)

    Cha, Jeeyeon; Burnum-Johnson, Kristin E.; Bartos, Amanda; Li, Yingju; Baker, Erin S.; Tilton, Susan C.; Webb-Robertson, Bobbie-Jo M.; Piehowski, Paul D.; Monroe, Matthew E.; Jegga, Anil G.; Murata, Shigeo; Hirota, Yasushi; Dey, Sudhansu K.

    2015-01-01

    Embryonic diapause is a reproductive strategy widespread in the animal kingdom. This phenomenon is defined by a temporary arrest in blastocyst growth and metabolic activity within a quiescent uterus without implantation until the environmental and maternal milieu become favorable for pregnancy to progress. We found that uterine Msx expression persists during diapause across species; their inactivation in the mouse uterus results in termination of diapause with the development of implantation-like responses (“pseudoimplantation”) that ultimately succumbed to resorption. To understand the cause of this failure, we compared proteome profiles between floxed and Msx-deleted uteri. In deleted uteri, several functional networks, including transcription/translation, ubiquitin-proteasome, inflammation, and endoplasmic reticulum stress, were dysregulated. Computational modeling predicted intersection of these pathways on an enhanced inflammatory signature. Further studies showed that this signature was reflected in increased phosphorylated IκB levels and nuclear NFκB in deleted uteri. This was associated with enhanced proteasome activity and endoplasmic reticulum stress. Interestingly, treatment with anti-inflammatory glucocorticoid (dexamethasone) reduced the inflammatory signature with improvement of the diapause phenotype. These findings highlight an unexpected role of uterine Msx in limiting aberrant inflammatory responses to maintain embryonic diapause. PMID:25931120

  10. Muscle Segment Homeobox Genes Direct Embryonic Diapause by Limiting Inflammation in the Uterus.

    Science.gov (United States)

    Cha, Jeeyeon; Burnum-Johnson, Kristin E; Bartos, Amanda; Li, Yingju; Baker, Erin S; Tilton, Susan C; Webb-Robertson, Bobbie-Jo M; Piehowski, Paul D; Monroe, Matthew E; Jegga, Anil G; Murata, Shigeo; Hirota, Yasushi; Dey, Sudhansu K

    2015-06-12

    Embryonic diapause is a reproductive strategy widespread in the animal kingdom. This phenomenon is defined by a temporary arrest in blastocyst growth and metabolic activity within a quiescent uterus without implantation until the environmental and maternal milieu become favorable for pregnancy to progress. We found that uterine Msx expression persists during diapause across species; their inactivation in the mouse uterus results in termination of diapause with the development of implantation-like responses ("pseudoimplantation") that ultimately succumbed to resorption. To understand the cause of this failure, we compared proteome profiles between floxed and Msx-deleted uteri. In deleted uteri, several functional networks, including transcription/translation, ubiquitin-proteasome, inflammation, and endoplasmic reticulum stress, were dysregulated. Computational modeling predicted intersection of these pathways on an enhanced inflammatory signature. Further studies showed that this signature was reflected in increased phosphorylated IκB levels and nuclear NFκB in deleted uteri. This was associated with enhanced proteasome activity and endoplasmic reticulum stress. Interestingly, treatment with anti-inflammatory glucocorticoid (dexamethasone) reduced the inflammatory signature with improvement of the diapause phenotype. These findings highlight an unexpected role of uterine Msx in limiting aberrant inflammatory responses to maintain embryonic diapause. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Gastrointestinal differentiation marker Cytokeratin 20 is regulated by homeobox gene CDX1

    DEFF Research Database (Denmark)

    Chan, Carol W M; Wong, Newton A; Liu, Ying

    2009-01-01

    colorectal cancer cell lines. Deletion and mutation analysis of the KRT20 promoter showed that the minimum regulatory region for the control of KRT20 expression by CDX1 is within 246 bp upstream of the KRT20 transcription start site. ChIP analysis confirmed that CDX1 binds to the predicted CDX elements...... in this region of the KRT20 promoter in vivo. In addition, immunohistochemistry showed expression of CDX1 parallels that of KRT20 in the normal crypt, which further supports their close relationship. In summary, our observations strongly imply that KRT20 is directly regulated by CDX1, and therefore suggest...... a role for CDX1 in maintaining differentiation in intestinal epithelial cells. Because a key feature of the development of a cancer is an unbalanced program of proliferation and differentiation, dysregulation of CDX1 may be an advantage for the development of a colorectal carcinoma. This could, therefore...

  12. Homeobox gene expression in adult dorsal root ganglia: Is regeneration a recapitulation of development?

    NARCIS (Netherlands)

    Vogelaar, C.F.

    2003-01-01

    Neurons of the peripheral nervous system are able to regenerate their peripheral axons after injury, leading to complete recovery of sensory and motor function. The sciatic nerve crush model is frequently used to study peripheral nerve regeneration. Sensory neurons in the dorsal root ganglia (DRGs)

  13. Expression of the homeobox genes OTX2 and OTX1 in the early developing human brain

    DEFF Research Database (Denmark)

    Larsen, Karen B; Lutterodt, Melissa C; Møllgård, Kjeld

    2010-01-01

    , and choroid plexus, with a minor expression in the basal telencephalon. The expression of OTX2 in the hippocampal anlage was strong, with no expression in the adjacent neocortex. Contrarily, the OTX1 expression was predominantly located in the proliferative zones of the neocortex. At later stages, the OTX2...... in the neocortex, and OTX2 in the archicortex, diencephalon, rostral brain stem, and cerebellum....

  14. Plant and fungal gene expression in mycorrhizal protocorms of the orchid Serapias vomeracea colonized by Tulasnella calospora.

    Science.gov (United States)

    Balestrini, Raffaella; Nerva, Luca; Sillo, Fabiano; Girlanda, Mariangela; Perotto, Silvia

    2014-01-01

    Little is known on the molecular bases of plant-fungal interactions in orchid mycorrhiza. We developed a model system to investigate gene expression in mycorrhizal protocorms of Serapias vomeracea colonised by Tulasnella calospora. Our recent results with a small panel of genes as indicators of plant response to mycorrhizal colonization indicate that genes related with plant defense were not significantly up-regulated in mycorrhizal tissues. Here, we used laser microdissection to investigate whether expression of some orchid genes was restricted to specific cell types. Results showed that SvNod1, a S. vomeracea nodulin-like protein containing a plastocyanin-like domain, is expressed only in protocorm cells containing intracellular fungal hyphae. In addition, we investigated a family of fungal zinc metallopeptidases (M36). This gene family has expanded in the T. calospora genome and RNA-Seq experiments indicate that some members of the M36 metallopeptidases family are differentially regulated in orchid mycorrhizal protocorms.

  15. Gene expression and plant hormone levels in two contrasting rice genotypes responding to brown planthopper infestation.

    Science.gov (United States)

    Li, Changyan; Luo, Chao; Zhou, Zaihui; Wang, Rui; Ling, Fei; Xiao, Langtao; Lin, Yongjun; Chen, Hao

    2017-02-28

    The brown planthopper (BPH; Nilaparvata lugens Stål) is a destructive piercing-sucking insect pest of rice. The plant hormones salicylic acid (SA) and jasmonic acid (JA) play important roles in plant-pest interactions. Many isolated rice genes that modulate BPH resistance are involved in the metabolism or signaling pathways of SA, JA and ethylene. 'Rathu Heenati' (RH) is a rice cultivar with a high-level, broad-spectrum resistance to all BPH biotypes. Here, RH was used as the research material, while a BPH-susceptible rice cultivar 'Taichung Native 1' (TN1) was the control. A cDNA microarray analysis illuminated the resistance response at the genome level of RH under BPH infestation. The levels of SA and JA in RH and TN1 seedlings after BPH infestation were also determined. The expression pattern clustering indicated that 1467 differential probe sets may be associated with constitutive resistance and 67 with the BPH infestation-responsive resistance of RH. A Venn diagram analysis revealed 192 RH-specific and BPH-inducible probe sets. Finally, 23 BPH resistance-related gene candidates were selected based on the expression pattern clustering and Venn diagram analysis. In RH, the SA content significantly increased and the JA content significantly decreased after BPH infestation, with the former occurring prior to the latter. In RH, the differential genes in the SA pathway were synthesis-related and were up-regulated after BPH infestation. The differential genes in the JA pathway were also up-regulated. They were jasmonate ZIM-domain transcription factors, which are important negative regulators of the JA pathway. Comparatively, genes involved in the ET pathway were less affected by a BPH infestation in RH. DNA sequence analysis revealed that most BPH infestation-inducible genes may be regulated by the genetic background in a trans-acting manner, instead of by their promoters. We profiled the analysis of the global gene expression in RH and TN1 under BPH infestation

  16. Msh homeobox 1 (Msx1)- and Msx2-overexpressing bone marrow-derived mesenchymal stem cells resemble blastema cells and enhance regeneration in mice.

    Science.gov (United States)

    Taghiyar, Leila; Hesaraki, Mahdi; Sayahpour, Forough Azam; Satarian, Leila; Hosseini, Samaneh; Aghdami, Naser; Baghaban Eslaminejad, Mohamadreza

    2017-06-23

    Amputation of the proximal region in mammals is not followed by regeneration because blastema cells (BCs) and expression of regenerative genes, such as Msh homeobox ( Msx ) genes, are absent in this animal group. The lack of BCs and positional information in other cells is therefore the main obstacle to therapeutic approaches for limb regeneration. Hence, this study aimed to create blastema-like cells (BlCs) by overexpressing Msx1 and Msx2 genes in mouse bone marrow-derived mesenchymal stem cells (mBMSCs) to regenerate a proximally amputated digit tip. We transduced mBMSCs with Msx1 and Msx2 genes and compared osteogenic activity and expression levels of several Msx -regulated genes ( Bmp4 , Fgf8 , and keratin 14 ( K14 )) in BlC groups, including MSX1, MSX2, and MSX1/2 (in a 1:1 ratio) with those in mBMSCs and BCs in vitro and in vivo following injection into the amputation site. We found that Msx gene overexpression increased expression of specific blastemal markers and enhanced the proliferation rate and osteogenesis of BlCs compared with mBMSCs and BCs via activation of Fgf8 and Bmp4 Histological analyses indicated full regrowth of digit tips in the Msx -overexpressing groups, particularly in MSX1/2, through endochondral ossification 6 weeks post-injection. In contrast, mBMSCs and BCs formed abnormal bone and nail. Full digit tip was regenerated only in the MSX1/2 group and was related to boosted Bmp4, Fgf8 , and K14 gene expression and to limb-patterning properties resulting from Msx1 and Msx2 overexpression. We propose that Msx -transduced cells that can regenerate epithelial and mesenchymal tissues may potentially be utilized in limb regeneration. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Gene expression profiling--Opening the black box of plant ecosystem responses to global change

    Energy Technology Data Exchange (ETDEWEB)

    Leakey, A.D.B.; Ainsworth, E.A.; Bernard, S.M.; Markelz, R.J.C.; Ort, D.R.; Placella, S.A.P.; Rogers, A.; Smith, M.D.; Sudderth, E.A.; Weston, D.J.; Wullschleger, S.D.; Yuan, S.

    2009-11-01

    The use of genomic techniques to address ecological questions is emerging as the field of genomic ecology. Experimentation under environmentally realistic conditions to investigate the molecular response of plants to meaningful changes in growth conditions and ecological interactions is the defining feature of genomic ecology. Since the impact of global change factors on plant performance are mediated by direct effects at the molecular, biochemical and physiological scales, gene expression analysis promises important advances in understanding factors that have previously been consigned to the 'black box' of unknown mechanism. Various tools and approaches are available for assessing gene expression in model and non-model species as part of global change biology studies. Each approach has its own unique advantages and constraints. A first generation of genomic ecology studies in managed ecosystems and mesocosms have provided a testbed for the approach and have begun to reveal how the experimental design and data analysis of gene expression studies can be tailored for use in an ecological context.

  18. Not just gene expression: 3D implications of chromatin modifications during sexual plant reproduction.

    Science.gov (United States)

    Dukowic-Schulze, Stefanie; Liu, Chang; Chen, Changbin

    2018-01-01

    DNA methylation and histone modifications are epigenetic changes on a DNA molecule that alter the three-dimensional (3D) structure locally as well as globally, impacting chromatin looping and packaging on a larger scale. Epigenetic marks thus inform higher-order chromosome organization and placement in the nucleus. Conventional epigenetic marks are joined by chromatin modifiers like cohesins, condensins and membrane-anchoring complexes to support particularly 3D chromosome organization. The most popular consequences of epigenetic modifications are gene expression changes, but chromatin modifications have implications beyond this, particularly in actively dividing cells and during sexual reproduction. In this opinion paper, we will focus on epigenetic mechanisms and chromatin modifications during meiosis as part of plant sexual reproduction where 3D management of chromosomes and re-organization of chromatin are defining features and prime tasks in reproductive cells, not limited to modulating gene expression. Meiotic chromosome organization, pairing and synapsis of homologous chromosomes as well as distribution of meiotic double-strand breaks and resulting crossovers are presumably highly influenced by epigenetic mechanisms. Special mobile small RNAs have been described in anthers, where these so-called phasiRNAs seem to direct DNA methylation in meiotic cells. Intriguingly, many of the mentioned developmental processes make use of epigenetic changes and small RNAs in a manner other than gene expression changes. Widening our approaches and opening our mind to thinking three-dimensionally regarding epigenetics in plant development holds high promise for new discoveries and could give us a boost for further knowledge.

  19. Arabidopsis female gametophyte gene expression map reveals similarities between plant and animal gametes.

    Science.gov (United States)

    Wuest, Samuel E; Vijverberg, Kitty; Schmidt, Anja; Weiss, Manuel; Gheyselinck, Jacqueline; Lohr, Miriam; Wellmer, Frank; Rahnenführer, Jörg; von Mering, Christian; Grossniklaus, Ueli

    2010-03-23

    The development of multicellular organisms is controlled by differential gene expression whereby cells adopt distinct fates. A spatially resolved view of gene expression allows the elucidation of transcriptional networks that are linked to cellular identity and function. The haploid female gametophyte of flowering plants is a highly reduced organism: at maturity, it often consists of as few as three cell types derived from a common precursor [1, 2]. However, because of its inaccessibility and small size, we know little about the molecular basis of cell specification and differentiation in the female gametophyte. Here we report expression profiles of all cell types in the mature Arabidopsis female gametophyte. Differentially expressed posttranscriptional regulatory modules and metabolic pathways characterize the distinct cell types. Several transcription factor families are overrepresented in the female gametophyte in comparison to other plant tissues, e.g., type I MADS domain, RWP-RK, and reproductive meristem transcription factors. PAZ/Piwi-domain encoding genes are upregulated in the egg, indicating a role of epigenetic regulation through small RNA pathways-a feature paralleled in the germline of animals [3]. A comparison of human and Arabidopsis egg cells for enrichment of functional groups identified several similarities that may represent a consequence of coevolution or ancestral gametic features. 2010 Elsevier Ltd. All rights reserved.

  20. Agrobacterium rhizogenes rolB gene affects photosynthesis and chlorophyll content in transgenic tomato (Solanum lycopersicum L.) plants.

    Science.gov (United States)

    Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa

    2016-10-01

    Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  1. Advances in plant gene-targeted and functional markers: a review

    Directory of Open Access Journals (Sweden)

    Poczai Péter

    2013-02-01

    Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information

  2. Advances in plant gene-targeted and functional markers: a review

    Science.gov (United States)

    2013-01-01

    Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the

  3. Digital Gene Expression Analysis Based on De Novo Transcriptome Assembly Reveals New Genes Associated with Floral Organ Differentiation of the Orchid Plant Cymbidium ensifolium.

    Directory of Open Access Journals (Sweden)

    Fengxi Yang

    Full Text Available Cymbidium ensifolium belongs to the genus Cymbidium of the orchid family. Owing to its spectacular flower morphology, C. ensifolium has considerable ecological and cultural value. However, limited genetic data is available for this non-model plant, and the molecular mechanism underlying floral organ identity is still poorly understood. In this study, we characterize the floral transcriptome of C. ensifolium and present, for the first time, extensive sequence and transcript abundance data of individual floral organs. After sequencing, over 10 Gb clean sequence data were generated and assembled into 111,892 unigenes with an average length of 932.03 base pairs, including 1,227 clusters and 110,665 singletons. Assembled sequences were annotated with gene descriptions, gene ontology, clusters of orthologous group terms, the Kyoto Encyclopedia of Genes and Genomes, and the plant transcription factor database. From these annotations, 131 flowering-associated unigenes, 61 CONSTANS-LIKE (COL unigenes and 90 floral homeotic genes were identified. In addition, four digital gene expression libraries were constructed for the sepal, petal, labellum and gynostemium, and 1,058 genes corresponding to individual floral organ development were identified. Among them, eight MADS-box genes were further investigated by full-length cDNA sequence analysis and expression validation, which revealed two APETALA1/AGL9-like MADS-box genes preferentially expressed in the sepal and petal, two AGAMOUS-like genes particularly restricted to the gynostemium, and four DEF-like genes distinctively expressed in different floral organs. The spatial expression of these genes varied distinctly in different floral mutant corresponding to different floral morphogenesis, which validated the specialized roles of them in floral patterning and further supported the effectiveness of our in silico analysis. This dataset generated in our study provides new insights into the molecular mechanisms

  4. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Planting increases the abundance and structure complexity of soil core functional genes relevant to carbon and nitrogen cycling.

    Science.gov (United States)

    Wang, Feng; Liang, Yuting; Jiang, Yuji; Yang, Yunfeng; Xue, Kai; Xiong, Jinbo; Zhou, Jizhong; Sun, Bo

    2015-09-23

    Plants have an important impact on soil microbial communities and their functions. However, how plants determine the microbial composition and network interactions is still poorly understood. During a four-year field experiment, we investigated the functional gene composition of three types of soils (Phaeozem, Cambisols and Acrisol) under maize planting and bare fallow regimes located in cold temperate, warm temperate and subtropical regions, respectively. The core genes were identified using high-throughput functional gene microarray (GeoChip 3.0), and functional molecular ecological networks (fMENs) were subsequently developed with the random matrix theory (RMT)-based conceptual framework. Our results demonstrated that planting significantly (P soils and 83.5% of microbial alpha-diversity can be explained by the plant factor. Moreover, planting had significant impacts on the microbial community structure and the network interactions of the microbial communities. The calculated network complexity was higher under maize planting than under bare fallow regimes. The increase of the functional genes led to an increase in both soil respiration and nitrification potential with maize planting, indicating that changes in the soil microbial communities and network interactions influenced ecological functioning.

  6. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta.

    Science.gov (United States)

    McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; de Pamphilis, Claude W

    2007-10-24

    Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  7. Complete plastid genome sequences suggest strong selection for retention of photosynthetic genes in the parasitic plant genus Cuscuta

    Directory of Open Access Journals (Sweden)

    Kuehl Jennifer V

    2007-10-01

    Full Text Available Abstract Background Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Results Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Conclusion Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.

  8. Gene expression and activity of antioxidant enzymes in rice plants, cv. BRS AG, under saline stress.

    Science.gov (United States)

    Rossatto, Tatiana; do Amaral, Marcelo Nogueira; Benitez, Letícia Carvalho; Vighi, Isabel Lopes; Braga, Eugenia Jacira Bolacel; de Magalhães Júnior, Ariano Martins; Maia, Mara Andrade Colares; da Silva Pinto, Luciano

    2017-10-01

    The rice cultivar ( Oryza sativa L.) BRS AG, developed by Embrapa Clima Temperado, is the first cultivar designed for purposes other than human consumption. It may be used in ethanol production and animal feed. Different abiotic stresses negatively affect plant growth. Soil salinity is responsible for a serious reduction in productivity. Therefore, the objective of this study was to evaluate the gene expression and the activity of antioxidant enzymes (SOD, CAT, APX and GR) and identify their functions in controlling ROS levels in rice plants, cultivar BRS AG, after a saline stress period. The plants were grown in vitro with two NaCl concentrations (0 and 136 mM), collected at 10, 15 and 20 days of cultivation. The results indicated that the activity of the enzymes evaluated promotes protection against oxidative stress. Although, there was an increase of reactive oxygen species, there was no increase in MDA levels. Regarding genes encoding isoforms of antioxidant enzymes, it was observed that OsSOD3 - CU/Zn , OsSOD2 - Cu/Zn , OsSOD - Cu/Zn , OsSOD4 - Cu/Zn , OsSODCc1 - Cu/Zn , OsSOD - Fe , OsAPX1 , OsCATB and OsGR2 were the most responsive. The increase in the transcription of all genes among evaluated isoforms, except for OsAPX6 , which remained stable, contributed to the increase or the maintenance of enzyme activity. Thus, it is possible to infer that the cv. BRS AG has defense mechanisms against salt stress.

  9. Molecular Mapping of Reduced Plant Height Gene Rht24 in Bread Wheat.

    Science.gov (United States)

    Tian, Xiuling; Wen, Weie; Xie, Li; Fu, Luping; Xu, Dengan; Fu, Chao; Wang, Desen; Chen, Xinmin; Xia, Xianchun; Chen, Quanjia; He, Zhonghu; Cao, Shuanghe

    2017-01-01

    Height is an important trait related to plant architecture and yield potential in bread wheat ( Triticum aestivum L.). We previously identified a major quantitative trait locus QPH.caas-6A flanked by simple sequence repeat markers Xbarc103 and Xwmc256 that reduced height by 8.0-10.4%. Here QPH.caas-6A , designated as Rht24 , was confirmed using recombinant inbred lines (RILs) derived from a Jingdong 8/Aikang 58 cross. The target sequences of Xbarc103 and Xwmc256 were used as queries to BLAST against International Wheat Genome Sequence Consortium database and hit a super scaffold of approximately 208 Mb. Based on gene annotation of the scaffold, three gene-specific markers were developed to genotype the RILs, and Rht24 was narrowed to a 1.85 cM interval between TaAP2 and TaFAR . In addition, three single nucleotide polymorphism (SNP) markers linked to Rht24 were identified from SNP chip-based screening in combination with bulked segregant analysis. The allelic efficacy of Rht24 was validated in 242 elite wheat varieties using TaAP2 and TaFAR markers. These showed a significant association between genotypes and plant height. Rht24 reduced plant height by an average of 6.0-7.9 cm across environments and were significantly associated with an increased TGW of 2.0-3.4 g. The findings indicate that Rht24 is a common dwarfing gene in wheat breeding, and TaAP2 and TaFAR can be used for marker-assisted selection.

  10. Abundance of antibiotic resistance genes in five municipal wastewater treatment plants in the Monastir Governorate, Tunisia.

    Science.gov (United States)

    Rafraf, Ikbel Denden; Lekunberri, Itziar; Sànchez-Melsió, Alexandre; Aouni, Mahjoub; Borrego, Carles M; Balcázar, José Luis

    2016-12-01

    Antimicrobial resistance is a growing and significant threat to global public health, requiring better understanding of the sources and mechanisms involved in its emergence and spread. We investigated the abundance of antibiotic resistance genes (ARGs) before and after treatment in five wastewater treatment plants (WWTPs) located in different areas of the Monastir Governorate (Tunisia). Three of these WWTPs (Frina, Sahline and Zaouiet) use a conventional activated sludge process as secondary treatment, whereas the WWTP located in Beni Hassen applies an ultraviolet disinfection step after the activated sludge process and the WWTP located in Moknine treats wastewater using naturally aerated lagoons as a secondary treatment process. The abundance of six ARGs (bla CTX-M , bla TEM , qnrA, qnrS, sul I and ermB) and the class 1 integron-integrase gene (intI1) were determined by quantitative PCR. All ARGs and the intI1 gene were detected in the wastewater samples, except the bla CTX-M gene, which was not detected in both influent and effluent samples from Sahline and Beni Hassen WWTPs, and the qnrS gene, which was not detected neither in the WWTP influent in Moknine nor in the WWTP effluent in Beni Hassen. Although the relative concentration of ARGs was generally found to be similar between samples collected before and after the wastewater treatment, the abundance of bla CTX-M , bla TEM , and qnrS genes was higher in the effluent of the Frina WWTP which, unlike other WWTPs, not only receives domestic or industrial sewage but also untreated hospital waste. To the best of our knowledge, this study quantified for the first time the abundance of ARGs in different Tunisian WWTPs, and the results agree with previous studies suggesting that conventional wastewater treatment does not efficiently reduce ARGs. Therefore, these findings could be useful to improve the design or operation of WWTPs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Boolean Dynamic Modeling Approaches to Study Plant Gene Regulatory Networks: Integration, Validation, and Prediction.

    Science.gov (United States)

    Velderraín, José Dávila; Martínez-García, Juan Carlos; Álvarez-Buylla, Elena R

    2017-01-01

    Mathematical models based on dynamical systems theory are well-suited tools for the integration of available molecular experimental data into coherent frameworks in order to propose hypotheses about the cooperative regulatory mechanisms driving developmental processes. Computational analysis of the proposed models using well-established methods enables testing the hypotheses by contrasting predictions with observations. Within such framework, Boolean gene regulatory network dynamical models have been extensively used in modeling plant development. Boolean models are simple and intuitively appealing, ideal tools for collaborative efforts between theorists and experimentalists. In this chapter we present protocols used in our group for the study of diverse plant developmental processes. We focus on conceptual clarity and practical implementation, providing directions to the corresponding technical literature.

  12. A Complementary Bioinformatics Approach to Identify Potential Plant Cell Wall Glycosyltransferase-Encoding Genes

    DEFF Research Database (Denmark)

    Egelund, Jack; Skjøt, Michael; Geshi, Naomi

    2004-01-01

    Plant cell wall (CW) synthesizing enzymes can be divided into the glycan (i.e. cellulose and callose) synthases, which are multimembrane spanning proteins located at the plasma membrane, and the glycosyltransferases (GTs), which are Golgi localized single membrane spanning proteins, believed....... Although much is known with regard to composition and fine structures of the plant CW, only a handful of CW biosynthetic GT genes-all classified in the CAZy system-have been characterized. In an effort to identify CW GTs that have not yet been classified in the CAZy database, a simple bioinformatics...... approach was adopted. First, the entire Arabidopsis proteome was run through the Transmembrane Hidden Markov Model 2.0 server and proteins containing one or, more rarely, two transmembrane domains within the N-terminal 150 amino acids were collected. Second, these sequences were submitted...

  13. De novo assembly and characterization of the transcriptome of the parasitic weed dodder identifies genes associated with plant parasitism.

    Science.gov (United States)

    Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R

    2014-11-01

    Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. © 2014 American Society of Plant Biologists. All Rights Reserved.

  14. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Science.gov (United States)

    Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K

    2014-01-01

    Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  15. Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

    Directory of Open Access Journals (Sweden)

    Nidhi Thakur

    Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

  16. Enhanced iron and zinc accumulation in genetically engineered pineapple plants using soybean ferritin gene.

    Science.gov (United States)

    Mhatre, Minal; Srinivas, Lingam; Ganapathi, Thumballi R

    2011-12-01

    Pineapple (Ananas comosus L. Merr., cv. "Queen") leaf bases were transformed with Agrobacterium tumefaciens strain EHA 105 harboring the pSF and pEFESF plasmids with soybean ferritin cDNA. Four to eight percent of the co-cultivated leaf bases produced multiple shoots 6 weeks after transfer to Murashige and Skoog's medium supplemented with α-naphthalene acetic acid 1.8 mg/l, indole-3-butyric acid 2.0 mg/l, kinetin 2.0 mg/l, cefotaxime 400 mg/l, and kanamycin 50 mg/l. Putatively transformed shoots (1-2 cm) were selected and multiplied on medium of the same composition and elongated shoots (5 cm) were rooted on liquid rooting medium supplemented with cefotaxime 400 mg/l and kanamycin 100 mg/l. The rooted plants were analyzed through PCR, genomic Southern analysis, and reverse transcription PCR. The results clearly confirmed the integration and expression of soybean ferritin gene in the transformed plants. Atomic absorption spectroscopic analysis carried out with six independently transformed lines of pSF and pEFE-SF revealed a maximum of 5.03-fold increase in iron and 2.44-fold increase in zinc accumulation in the leaves of pSF-transformed plants. In pEFE-SF-transformed plants, a 3.65-fold increase in iron and 2.05-fold increase in zinc levels was observed. Few of the transgenic plants were hardened in the greenhouse and are being grown to maturity to determine the enhanced iron and zinc accumulation in the fruits. To the best of our knowledge this is the first report on the transformation of pineapple with soybean ferritin for enhanced accumulation of iron and zinc content in the transgenic plants.

  17. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants.

    Science.gov (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle

    2017-08-01

    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Feedback regulation of an Agrobacterium catalase gene katA involved in Agrobacterium-plant interaction.

    Science.gov (United States)

    Xu, X Q; Li, L P; Pan, S Q

    2001-11-01

    Catalases are known to detoxify H2O2, a major component of oxidative stress imposed on a cell. An Agrobacterium tumefaciens catalase encoded by a chromosomal gene katA has been implicated as an important virulence factor as it is involved in detoxification of H2O2 released during Agrobacterium-plant interaction. In this paper, we report a feedback regulation pathway that controls the expression of katA in A. tumefaciens cells. We observed that katA could be induced by plant tissue sections and by acidic pH on a minimal medium, which resembles the plant environment that the bacteria encounter during the course of infection. This represents a new regulatory factor for catalase induction in bacteria. More importantly, a feedback regulation was observed when the katA-gfp expression was studied in different genetic backgrounds. We found that introduction of a wild-type katA gene encoding a functional catalase into A. tumefaciens cells could repress the katA-gfp expression over 60-fold. The katA gene could be induced by H2O2 and the encoded catalase could detoxify H2O2. In addition, the katA-gfp expression of one bacterial cell could be repressed by other surrounding catalase-proficient bacterial cells. Furthermore, mutation at katA caused a 10-fold increase of the intracellular H2O2 concentration in the bacteria grown on an acidic pH medium. These results suggest that the endogenous H2O2 generated during A. tumefaciens cell growth could serve as the intracellular and intercellular inducer for the katA gene expression and that the acidic pH could pose an oxidative stress on the bacteria. Surprisingly, one mutated KatA protein, exhibiting no significant catalase activity as a result of the alteration of two important residues at the putative active site, could partially repress the katA-gfp expression. The feedback regulation of the katA gene by both catalase activity and KatA protein could presumably maintain an appropriated level of catalase activity and H2O2 inside A

  19. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Directory of Open Access Journals (Sweden)

    Etienne G.J. Danchin

    2017-10-01

    Full Text Available Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.

  20. The Transcriptomes of Xiphinema index and Longidorus elongatus Suggest Independent Acquisition of Some Plant Parasitism Genes by Horizontal Gene Transfer in Early-Branching Nematodes

    Science.gov (United States)

    Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Sokolova (Guzeeva), Elena; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T.

    2017-01-01

    Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum. PMID:29065523

  1. EVEN-SKIPPED HOMEOBOX 1 controls human ES cell differentiation by directly repressing GOOSECOID expression

    DEFF Research Database (Denmark)

    Kalisz, Mark; Winzi, Maria Karin; Bisgaard, Hanne Cathrine

    2012-01-01

    (EVX1) and GOOSECOID (GSC) regulate cell fate decisions in streak-like progenitors derived from human ES cells exposed to BMP4 and/or activin. We found that EVX1 repressed GSC expression and promoted formation of posterior streak-like progeny in response to BMP4, and conversely that GSC repressed EVX1...... expression and was required for development of anterior streak-like progeny in response to activin. Chromatin immunoprecipitation assays showed that EVX1 bound to the GSC 5'-flanking region in BMP4 treated human ES cells, and band shift assays identified two EVX1 binding sites in the GSC 5'-region......TGFß signaling patterns the primitive streak, yet little is known about transcriptional effectors that mediate the cell fate choices during streak-like development in mammalian embryos and in embryonic stem (ES) cells. Here we demonstrate that cross-antagonistic actions of EVEN-SKIPPED HOMEOBOX 1...

  2. The Identification of Genes Important in Pseudomonas syringae pv. phaseolicola Plant Colonisation Using In Vitro Screening of Transposon Libraries.

    Directory of Open Access Journals (Sweden)

    Bharani Manoharan

    Full Text Available The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph colonises the surface of common bean plants before moving into the interior of plant tissue, via wounds and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and forms microcolonies (biofilms around plant cells. If the pathogen can suppress the plant's natural resistance response, it will cause halo blight disease. The process of resistance suppression is fairly well understood, but the mechanisms used by the pathogen in colonisation are less clear. We hypothesised that we could apply in vitro genetic screens to look for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn mutant libraries of Pph strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony morphology, motility and biofilm formation. Identification of the insertion point of the Tn identified within the genome highlighted, as expected, a number of altered motility mutants bearing mutations in genes encoding various parts of the flagellum. Genes involved in nutrient biosynthesis, membrane associated proteins, and a number of conserved hypothetical protein (CHP genes were also identified. A mutation of one CHP gene caused a positive increase in in planta bacterial growth. This rapid and inexpensive screening method allows the discovery of genes important for in vitro traits that can be correlated to roles in the plant interaction.

  3. Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

    2016-01-01

    Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants.

  4. Interspecific RNA Interference of SHOOT MERISTEMLESS-Like Disrupts Cuscuta pentagona Plant Parasitism[C][W][OA

    Science.gov (United States)

    Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M.; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima

    2012-01-01

    Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA–mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection. PMID:22822208

  5. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    Science.gov (United States)

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  6. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  7. Apple latent spherical virus vectors for reliable and effective virus-induced gene silencing among a broad range of plants including tobacco, tomato, Arabidopsis thaliana, cucurbits, and legumes

    International Nuclear Information System (INIS)

    Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki

    2009-01-01

    Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.

  8. Gene expression analysis in rice plants after external radiation exposure in Iitate village

    Energy Technology Data Exchange (ETDEWEB)

    Hayashi, G.; Fukumoto, M. [Institute of Development, Aging and Cancer, Tohoku University (Japan); Imanaka, T. [Research Reactor Institute, Kyoto University (Japan); Shibato, J. [Department of Anatomy I, School of Medicine, Showa University (Japan); Kubo, A. [Center for Environmental Biology and Ecosystem Studies, National Institute for Environmental Studies (Japan); Kikuchi, S. [Plant Genome Research Unit, Agrogenomics Research Center, National Institute of Agrobiological Sciences (Japan); Rakwal, R. [Organization for Educational Initiatives, University of Tsukuba (Japan)

    2014-07-01

    Rice plants exposed to radiation respond to the stress by activating self-defense mechanisms. A well-established molecular approach to measure stress is by cataloging global gene expression profiles. Here, we examined the effect of radiation exposure in a cereal crop model plant - rice (Oryza sativa L.) cultivar Nipponbare - in the village of Iitate of Fukushima prefecture. Iitate village is a highly radio-contaminated site due to the Fukushima Daiichi nuclear power plant accident following the Great East Japan Earthquake. The experimental approach comprised of five steps. First, healthy rice seedlings were grown in the greenhouse facility at National Institute for Environmental Sciences. Post-germination at 30 deg. C similarly germinated seeds were placed in neat rows in seedling pots having commercial soil (JA Zen-Noh, Japan; http//www.zennoh.or.jp/) with recommended NPK (nitrogen, phosphorus, and potash) doses at a controlled (25 deg. C, 70% relative humidity and natural light condition) greenhouse. Second, the seedlings were transported from a controlled greenhouse in Tsukuba to Iitate Farm (ITF) and placed, with no direct contact with soil, in a low-level gamma field where the rate of Cs-137 was 700 kBq/m{sup 2}. Third, exposure periods were set at 6, 12, 24, 48, and 72 h after arrival at ITF, and rice leaves at the 3. position (from the base) from 6 to 10 seedlings were sampled in dry ice. As control, rice leaves were sampled at the start in Tsukuba and immediately at arrival upon ITF; to know the radiation levels during growth and transport of the rice to ITF, accumulated radiation dose was calculated using a MYDOSE mini electronic pocket dosimeter (model PDM-222-52, ALOKA, Japan). A sample set was also taken at 72 h from healthy rice seedlings in the greenhouse at Tsukuba. All samples were stored at -80 deg. C. Accumulated total dose for exposed rice seedlings at 72 h was 200 mSv. Fourth, gene expression analysis was initiated by grinding the leaves to a

  9. Genome-Wide Identification of the Alba Gene Family in Plants and Stress-Responsive Expression of the Rice Alba Genes.

    Science.gov (United States)

    Verma, Jitendra Kumar; Wardhan, Vijay; Singh, Deepali; Chakraborty, Subhra; Chakraborty, Niranjan

    2018-03-28

    Architectural proteins play key roles in genome construction and regulate the expression of many genes, albeit the modulation of genome plasticity by these proteins is largely unknown. A critical screening of the architectural proteins in five crop species, viz., Oryza sativa , Zea mays , Sorghum bicolor , Cicer arietinum , and Vitis vinifera , and in the model plant Arabidopsis thaliana along with evolutionary relevant species such as Chlamydomonas reinhardtii , Physcomitrella patens , and Amborella trichopoda , revealed 9, 20, 10, 7, 7, 6, 1, 4, and 4 Alba (acetylation lowers binding affinity) genes, respectively. A phylogenetic analysis of the genes and of their counterparts in other plant species indicated evolutionary conservation and diversification. In each group, the structural components of the genes and motifs showed significant conservation. The chromosomal location of the Alba genes of rice ( OsAlba ), showed an unequal distribution on 8 of its 12 chromosomes. The expression profiles of the OsAlba genes indicated a distinct tissue-specific expression in the seedling, vegetative, and reproductive stages. The quantitative real-time PCR (qRT-PCR) analysis of the OsAlba genes confirmed their stress-inducible expression under multivariate environmental conditions and phytohormone treatments. The evaluation of the regulatory elements in 68 Alba genes from the 9 species studied led to the identification of conserved motifs and overlapping microRNA (miRNA) target sites, suggesting the conservation of their function in related proteins and a divergence in their biological roles across species. The 3D structure and the prediction of putative ligands and their binding sites for OsAlba proteins offered a key insight into the structure-function relationship. These results provide a comprehensive overview of the subtle genetic diversification of the OsAlba genes, which will help in elucidating their functional role in plants.

  10. Expression of Aluminum-Induced Genes in Transgenic Arabidopsis Plants Can Ameliorate Aluminum Stress and/or Oxidative Stress1

    Science.gov (United States)

    Ezaki, Bunichi; Gardner, Richard C.; Ezaki, Yuka; Matsumoto, Hideaki

    2000-01-01

    To examine the biological role of Al-stress-induced genes, nine genes derived from Arabidopsis, tobacco (Nicotiana tabacum L.), wheat (Triticum aestivum L.), and yeast (Saccharomyces cerevisiae) were expressed in Arabidopsis ecotype Landsberg. Lines containing eight of these genes were phenotypically normal and were tested in root elongation assays for their sensitivity to Al, Cd, Cu, Na, Zn, and to oxidative stresses. An Arabidopsis blue-copper-binding protein gene (AtBCB), a tobacco glutathione S-transferase gene (parB), a tobacco peroxidase gene (NtPox), and a tobacco GDP-dissociation inhibitor gene (NtGDI1) conferred a degree of resistance to Al. Two of these genes, AtBCB and parB, and a peroxidase gene from Arabidopsis (AtPox) also showed increased resistance to oxidative stress induced by diamide, while parB conferred resistance to Cu and Na. Al content of Al-treated root tips was reduced in the four Al-resistant plant lines compared with wild-type Ler-0, as judged by morin staining. All four Al-resistant lines also showed reduced staining of roots with 2′,7′-dichloro fluorescein diacetate (H2DCFDA), an indicator of oxidative stress. We conclude that Al-induced genes can serve to protect against Al toxicity, and also provide genetic evidence for a link between Al stress and oxidative stress in plants. PMID:10712528

  11. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    Directory of Open Access Journals (Sweden)

    Tatsuya eKon

    2014-11-01

    Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

  12. [Induced expression of Serratia marcescens ribonuclease III gene in transgenic Nicotiana tabacum L. cv. SR1 tobacco plants].

    Science.gov (United States)

    Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K

    2016-11-01

    Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.

  13. Optimization of reload of nuclear power plants using ACO together with the GENES reactor physics code

    Energy Technology Data Exchange (ETDEWEB)

    Lima, Alan M.M. de; Freire, Fernando S.; Nicolau, Andressa S.; Schirru, Roberto, E-mail: alan@lmp.ufrj.br, E-mail: andressa@lmp.ufrj.br, E-mail: schirru@lmp.ufrj.br, E-mail: ffreire@eletronuclear.gov.br [Coordenacao de Pos-Graduacao e Pesquisa de Engenharia (PEN/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil); Eletrobras Termonuclear S.A. (ELETRONUCLEAR), Rio de Janeiro, RJ (Brazil)

    2017-11-01

    The Nuclear reload of a Pressurized Water Reactor (PWR) occurs whenever the burning of the fuel elements can no longer maintain the criticality of the reactor, that is, it cannot maintain the Nuclear power plant operates within its nominal power. Nuclear reactor reload optimization problem consists of finding a loading pattern of fuel assemblies in the reactor core in order to minimize the cost/benefit ratio, trying to obtain maximum power generation with a minimum of cost, since in all reloads an average of one third of the new fuel elements are purchased. This loading pattern must also satisfy constraints of symmetry and security. In practice, it consists of the placing 121 fuel elements in 121 core positions, in the case of the Angra 1 Brazilian Nuclear Power Plant (NPP), making this new arrangement provide the best cost/benefit ratio. It is an extremely complex problem, since it has around 1% of great places. A core of 121 fuel elements has approximately 10{sup 13} combinations and 10{sup 11} great locations. With this number of possible combinations it is impossible to test all, in order to choose the best. In this work a system called ACO-GENES is proposed in order to optimization the Nuclear Reactor Reload Problem. ACO is successfully used in combination problems, and it is expected that ACO-GENES will show a robust optimization system, since in addition to optimizing ACO, it allows important prior knowledge such as K infinite, burn, etc. After optimization by ACO-GENES, the best results will be validated by a licensed reactor physics code and will be compared with the actual results of the cycle. (author)

  14. Optimization of reload of nuclear power plants using ACO together with the GENES reactor physics code

    International Nuclear Information System (INIS)

    Lima, Alan M.M. de; Freire, Fernando S.; Nicolau, Andressa S.; Schirru, Roberto

    2017-01-01

    The Nuclear reload of a Pressurized Water Reactor (PWR) occurs whenever the burning of the fuel elements can no longer maintain the criticality of the reactor, that is, it cannot maintain the Nuclear power plant operates within its nominal power. Nuclear reactor reload optimization problem consists of finding a loading pattern of fuel assemblies in the reactor core in order to minimize the cost/benefit ratio, trying to obtain maximum power generation with a minimum of cost, since in all reloads an average of one third of the new fuel elements are purchased. This loading pattern must also satisfy constraints of symmetry and security. In practice, it consists of the placing 121 fuel elements in 121 core positions, in the case of the Angra 1 Brazilian Nuclear Power Plant (NPP), making this new arrangement provide the best cost/benefit ratio. It is an extremely complex problem, since it has around 1% of great places. A core of 121 fuel elements has approximately 10"1"3 combinations and 10"1"1 great locations. With this number of possible combinations it is impossible to test all, in order to choose the best. In this work a system called ACO-GENES is proposed in order to optimization the Nuclear Reactor Reload Problem. ACO is successfully used in combination problems, and it is expected that ACO-GENES will show a robust optimization system, since in addition to optimizing ACO, it allows important prior knowledge such as K infinite, burn, etc. After optimization by ACO-GENES, the best results will be validated by a licensed reactor physics code and will be compared with the actual results of the cycle. (author)

  15. The abundance and diversity of antibiotic resistance genes in the atmospheric environment of composting plants.

    Science.gov (United States)

    Gao, Min; Qiu, Tianlei; Sun, Yanmei; Wang, Xuming

    2018-07-01

    Composting is considered to reduce the introduction of antimicrobial resistance genes (ARGs) into the environment through land application of manure; however, the possible pollution of ARGs in the atmospheric environment of composting plants is unknown. In this study, 29 air samples including up- and downwind, composting, packaging, and office areas from 4 composting plants were collected. Dynamic concentrations of 22 subtypes of ARGs, class 1 integron (intl1), and 2 potential human pathogenic bacteria (HPB), and bacterial communities were investigated using droplet digital PCR and 16S rRNA gene sequencing, respectively. In this study, intl1 and 22 subtypes of ARGs (except tetQ) were detected in air of composting, packaging, office, and downwind areas. The highest concentration of 15 out of 22 subtypes of ARGs was detected in the packaging areas, and intl1 also had the maximum average concentration of 10 4  copies/m 3 , with up to (1.78 ± 0.49) × 10 -2 copies/16S rRNA copy. Non-metric multi-dimensional scaling of ARGs, potential HPBs, and bacterial components all indicated that the bioaerosol pollutant pattern in packaging areas was most similar to that in composting areas, followed by office, downwind, and upwind areas. The co-occurrence between ARGs and bacterial taxa assessed by Procrustes test, mantel test, and network analysis implied that aerosolized ARG fragments from composting and packaging areas contributed to the compositions of ARG aerosols in office and downwind areas. The results presented here show that atmoshperic environments of composting plants harbor abundant and diverse ARGs, which highlight the urgent need for comprehensive evaluation of potential human health and ecological risks of composts during both production as well as land application. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. Selectable genes for transformation of the fungal plant pathogen Glomerella cingulata f. sp. phaseoli (Colletotrichum lindemuthianum).

    Science.gov (United States)

    Rodriguez, R J; Yoder, O C

    1987-01-01

    Glomerella cingulata f. sp. phaseoli (Gcp) was transformed using either of two selectable markers: the amdS + gene of Aspergillus nidulans, which encodes acetamidase and permits growth on acetamide as the sole nitrogen source and the hygBR gene of Escherichia coli which encodes hygromycin B (Hy) phosphotransferase and permits growth in the presence of the antibiotic Hy. The amdS+ gene functioned in Gcp under control of A. nidulans regulatory signals and hygBR was expressed after fusion to a promoter from Cochliobolus heterostrophus, another filamentous ascomycete. Protoplasts to be transformed were generated with the digestive enzyme complex Novozym 234 and then were exposed to plasmid DNA in the presence of 10 mM CaCl2 and polyethylene glycol. Transformation occurred by integration of single or multiple copies of either the amdS+ or hygBR plasmid into the fungal genome. There was no evidence of autonomous plasmid replication. Transformants were mitotically stable on selective and nonselective media. However, transforming DNA in hygBR transformants was observed to occasionally rearrange during nonselective growth, resulting in fewer copies of the plasmid per genome. These transformants were capable of infecting bean (Phaseolus vulgaris), the Gcp host plant, and after recovery from infected tissue were found to have retained both the transforming DNA unrearranged in their genomes and the Hy resistance phenotype. All single-conidial cultures derived from both amdS+ and hygBR transformants had the transplanted phenotype, suggesting that transformants were homokaryons.

  17. Effect of plant extracts on H2O2-induced inflammatory gene expression in macrophages

    Science.gov (United States)

    Pomari, Elena; Stefanon, Bruno; Colitti, Monica

    2014-01-01

    Background Arctium lappa (AL), Camellia sinensis (CS), Echinacea angustifolia, Eleutherococcus senticosus, Panax ginseng (PG), and Vaccinium myrtillus (VM) are plants traditionally used in many herbal formulations for the treatment of various conditions. Although they are well known and already studied for their anti-inflammatory properties, their effects on H2O2-stimulated macrophages are a novel area of study. Materials and methods Cell viability was tested after treatment with increasing doses of H2O2 and/or plant extracts at different times of incubation to identify the optimal experimental conditions. The messenger (m)RNA expression of TNFα, COX2, IL1β, NFκB1, NFκB2, NOS2, NFE2L2, and PPARγ was analyzed in macrophages under H2O2 stimulation. The same genes were also quantified after plant extract treatment on cells pre-stimulated with H2O2. Results A noncytotoxic dose (200 μM) of H2O2 induced active mRNA expression of COX2, IL1β, NFE2L2, NFκB1, NFκB2, NOS2, and TNFα, while PPARγ was depressed. The expression of all genes tested was significantly (P<0.001) regulated by plant extracts after pre-stimulation with H2O2. COX2 was downregulated by AL, PG, and VM. All extracts depressed IL1β expression, but upregulated NFE2L2. NFκB1, NFκB2, and TNFα were downregulated by AL, CS, PG, and VM. NOS2 was inhibited by CS, PG, and VM. PPARγ was decreased only after treatment with E. angustifolia and E. senticosus. Conclusion The results of the present study indicate that the stimulation of H2O2 on RAW267.4 cells induced the transcription of proinflammatory mediators, showing that this could be an applicable system by which to activate macrophages. Plant extracts from AL, CS, PG, and VM possess in vitro anti-inflammatory activity on H2O2-stimulated macrophages by modulating key inflammation mediators. Further in vitro and in vivo investigation into molecular mechanisms modulated by herbal extracts should be undertaken to shed light on the development of novel

  18. Effect of plant extracts on H2O2-induced inflammatory gene expression in macrophages

    Directory of Open Access Journals (Sweden)

    Pomari E

    2014-06-01

    Full Text Available Elena Pomari, Bruno Stefanon, Monica Colitti Department of Agricultural and Environmental Sciences, University of Udine, Udine, Italy Background: Arctium lappa (AL, Camellia sinensis (CS, Echinacea angustifolia, Eleutherococcus senticosus, Panax ginseng (PG, and Vaccinium myrtillus (VM are plants traditionally used in many herbal formulations for the treatment of various conditions. Although they are well known and already studied for their anti-inflammatory properties, their effects on H2O2-stimulated macrophages are a novel area of study. Materials and methods: Cell viability was tested after treatment with increasing doses of H2O2 and/or plant extracts at different times of incubation to identify the optimal experimental conditions. The messenger (mRNA expression of TNFα, COX2, IL1β, NFκB1, NFκB2, NOS2, NFE2L2, and PPARγ was analyzed in macrophages under H2O2 stimulation. The same genes were also quantified after plant extract treatment on cells pre-stimulated with H2O2. Results: A noncytotoxic dose (200 µM of H2O2 induced active mRNA expression of COX2, IL1β, NFE2L2, NFκB1, NFκB2, NOS2, and TNFα, while PPARγ was depressed. The expression of all genes tested was significantly (P<0.001 regulated by plant extracts after pre-stimulation with H2O2. COX2 was downregulated by AL, PG, and VM. All extracts depressed IL1β expression, but upregulated NFE2L2. NFκB1, NFκB2, and TNFα were downregulated by AL, CS, PG, and VM. NOS2 was inhibited by CS, PG, and VM. PPARγ was decreased only after treatment with E. angustifolia and E. senticosus. Conclusion: The results of the present study indicate that the stimulation of H2O2 on RAW267.4 cells induced the transcription of proinflammatory mediators, showing that this could be an applicable system by which to activate macrophages. Plant extracts from AL, CS, PG, and VM possess in vitro anti-inflammatory activity on H2O2-stimulated macrophages by modulating key inflammation mediators. Further in

  19. Evolution of endogenous non-retroviral genes integrated into plant genomes

    Directory of Open Access Journals (Sweden)

    Hyosub Chu

    2014-08-01

    Full Text Available Numerous comparative genome analyses have revealed the wide extent of horizontal gene transfer (HGT in living organisms, which contributes to their evolution and genetic diversity. Viruses play important roles in HGT. Endogenous viral elements (EVEs are defined as viral DNA sequences present within the genomes of non-viral organisms. In eukaryotic cells, the majority of EVEs are derived from RNA viruses using reverse transcription. In contrast, endogenous non-retroviral elements (ENREs are poorly studied. However, the increasing availability of genomic data and the rapid development of bioinformatics tools have enabled the identification of several ENREs in various eukaryotic organisms. To date, a small number of ENREs integrated into plant genomes have been identified. Of the known non-retroviruses, most identified ENREs are derived from double-strand (ds RNA viruses, followed by single-strand (ss DNA and ssRNA viruses. At least eight virus families have been identified. Of these, viruses in the family Partitiviridae are dominant, followed by viruses of the families Chrysoviridae and Geminiviridae. The identified ENREs have been primarily identified in eudicots, followed by monocots. In this review, we briefly discuss the current view on non-retroviral sequences integrated into plant genomes that are associated with plant-virus evolution and their possible roles in antiviral resistance.

  20. Exploring the Role of Cell Wall-Related Genes and Polysaccharides during Plant Development.

    Science.gov (United States)

    Tucker, Matthew R; Lou, Haoyu; Aubert, Matthew K; Wilkinson, Laura G; Little, Alan; Houston, Kelly; Pinto, Sara C; Shirley, Neil J

    2018-05-31

    The majority of organs in plants are not established until after germination, when pluripotent stem cells in the growing apices give rise to daughter cells that proliferate and subsequently differentiate into new tissues and organ primordia. This remarkable capacity is not only restricted to the meristem, since maturing cells in many organs can also rapidly alter their identity depending on the cues they receive. One general feature of plant cell differentiation is a change in cell wall composition at the cell surface. Historically, this has been viewed as a downstream response to primary cues controlling differentiation, but a closer inspection of the wall suggests that it may play a much more active role. Specific polymers within the wall can act as substrates for modifications that impact receptor binding, signal mobility, and cell flexibility. Therefore, far from being a static barrier, the cell wall and its constituent polysaccharides can dictate signal transmission and perception, and directly contribute to a cell's capacity to differentiate. In this review, we re-visit the role of plant cell wall-related genes and polysaccharides during various stages of development, with a particular focus on how changes in cell wall machinery accompany the exit of cells from the stem cell niche.

  1. Antisense oligodeoxynucleotide inhibition as a potent diagnostic tool for gene function in plant biology

    Energy Technology Data Exchange (ETDEWEB)

    Jansson, Christer; Sun, Chuanxin; Ghebramedhin, Haile; Hoglund, Anna-Stina; Jansson, Christer

    2008-01-15

    Antisense oligodeoxynucleotide (ODN) inhibition emerges as an effective means for probing gene function in plant cells. Employing this method we have established the importance of the SUSIBA2 transcription factor for regulation of starch synthesis in barley endosperm, and arrived at a model for the role of the SUSIBAs in sugar signaling and source-sink commutation during cereal endosperm development. In this addendum we provide additional data demonstrating the suitability of the antisense ODN technology in studies on starch branching enzyme activities in barley leaves. We also comment on the mechanism for ODN uptake in plant cells. Antisense ODNs are short (12-25 nt-long) stretches of single-stranded ODNs that hybridize to the cognate mRNA in a sequence-specific manner, thereby inhibiting gene expression. They are naturally occurring in both prokaryotes and eukaryotes where they partake in gene regulation and defense against viral infection. The mechanisms for antisense ODN inhibition are not fully understood but it is generally considered that the ODN either sterically interferes with translation or promotes transcript degradation by RNase H activation. The earliest indication of the usefulness of antisense ODN technology for the purposes of molecular biology and medical therapy was the demonstration in 1978 that synthetic ODNs complementary to Raos sarcoma virus could inhibit virus replication in tissue cultures of chick embryo fibroblasts. Since then the antisense ODN technology has been widely used in animal sciences and as an important emerging therapeutic approach in clinical medicine. However, antisense ODN inhibition has been an under-exploited strategy for plant tissues, although the prospects for plant cells in suspension cultures to take up single-stranded ODNs was reported over a decade ago. In 2001, two reports from Malho and coworker demonstrated the use of cationic-complexed antisense ODNs to suppress expression of genes encoding pollen

  2. Evolution Analysis of the Aux/IAA Gene Family in Plants Shows Dual Origins and Variable Nuclear Localization Signals

    Directory of Open Access Journals (Sweden)

    Wentao Wu

    2017-10-01

    Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/I