Plant Genes Involved in Symbiotic Sinal Perception/Signal Transduction
DEFF Research Database (Denmark)
Binder, A; Soyano, T; Hayashi, H
2014-01-01
to nodule primordia formation, and the infection thread initiation in the root hairs guiding bacteria towards dividing cortical cells. This chapter focuses on the plant genes involved in the recognition of the symbiotic signal produced by rhizobia, and the downstream genes, which are part of a complex...... symbiotic signalling pathway that leads to the generation of calcium spiking in the nuclear regions and activation of transcription factors controlling symbiotic genes induction...
Directory of Open Access Journals (Sweden)
Abinaya Manivannan
2017-08-01
Full Text Available Silicon (Si, the quasi-essential element occurs as the second most abundant element in the earth's crust. Biological importance of Si in plant kingdom has become inevitable particularly under stressed environment. In general, plants are classified as high, medium, and low silicon accumulators based on the ability of roots to absorb Si. The uptake of Si directly influence the positive effects attributed to the plant but Si supplementation proves to mitigate stress and recover plant growth even in low accumulating plants like tomato. The application of Si in soil as well as soil-less cultivation systems have resulted in the enhancement of quantitative and qualitative traits of plants even under stressed environment. Silicon possesses several mechanisms to regulate the physiological, biochemical, and antioxidant metabolism in plants to combat abiotic and biotic stresses. Nevertheless, very few reports are available on the aspect of Si-mediated molecular regulation of genes with potential role in stress tolerance. The recent advancements in the era of genomics and transcriptomics have opened an avenue for the determination of molecular rationale associated with the Si amendment to the stress alleviation in plants. Therefore, the present endeavor has attempted to describe the recent discoveries related to the regulation of vital genes involved in photosynthesis, transcription regulation, defense, water transport, polyamine synthesis, and housekeeping genes during abiotic and biotic stress alleviation by Si. Furthermore, an overview of Si-mediated modulation of multiple genes involved in stress response pathways such as phenylpropanoid pathway, jasmonic acid pathway, ABA-dependent or independent regulatory pathway have been discussed in this review.
González-Plaza, Juan J; Ortiz-Martín, Inmaculada; Muñoz-Mérida, Antonio; García-López, Carmen; Sánchez-Sevilla, José F; Luque, Francisco; Trelles, Oswaldo; Bejarano, Eduardo R; De La Rosa, Raúl; Valpuesta, Victoriano; Beuzón, Carmen R
2016-01-01
Plant architecture is a critical trait in fruit crops that can significantly influence yield, pruning, planting density and harvesting. Little is known about how plant architecture is genetically determined in olive, were most of the existing varieties are traditional with an architecture poorly suited for modern growing and harvesting systems. In the present study, we have carried out microarray analysis of meristematic tissue to compare expression profiles of olive varieties displaying differences in architecture, as well as seedlings from their cross pooled on the basis of their sharing architecture-related phenotypes. The microarray used, previously developed by our group has already been applied to identify candidates genes involved in regulating juvenile to adult transition in the shoot apex of seedlings. Varieties with distinct architecture phenotypes and individuals from segregating progenies displaying opposite architecture features were used to link phenotype to expression. Here, we identify 2252 differentially expressed genes (DEGs) associated to differences in plant architecture. Microarray results were validated by quantitative RT-PCR carried out on genes with functional annotation likely related to plant architecture. Twelve of these genes were further analyzed in individual seedlings of the corresponding pool. We also examined Arabidopsis mutants in putative orthologs of these targeted candidate genes, finding altered architecture for most of them. This supports a functional conservation between species and potential biological relevance of the candidate genes identified. This study is the first to identify genes associated to plant architecture in olive, and the results obtained could be of great help in future programs aimed at selecting phenotypes adapted to modern cultivation practices in this species.
Directory of Open Access Journals (Sweden)
Jin-Hua Ran
Full Text Available Stomata play significant roles in plant evolution. A trio of closely related basic Helix-Loop-Helix (bHLH subgroup Ia genes, SPCH, MUTE and FAMA, mediate sequential steps of stomatal development, and their functions may be conserved in land plants. However, the evolutionary history of the putative SPCH/MUTE/FAMA genes is still greatly controversial, especially the phylogenetic positions of the bHLH Ia members from basal land plants. To better understand the evolutionary pattern and functional diversity of the bHLH genes involved in stomatal development, we made a comprehensive evolutionary analysis of the homologous genes from 54 species representing the major lineages of green plants. The phylogenetic analysis indicated: (1 All bHLH Ia genes from the two basal land plants Physcomitrella and Selaginella were closely related to the FAMA genes of seed plants; and (2 the gymnosperm 'SPCH' genes were sister to a clade comprising the angiosperm SPCH and MUTE genes, while the FAMA genes of gymnosperms and angiosperms had a sister relationship. The revealed phylogenetic relationships are also supported by the distribution of gene structures and previous functional studies. Therefore, we deduce that the function of FAMA might be ancestral in the bHLH Ia subgroup. In addition, the gymnosperm "SPCH" genes may represent an ancestral state and have a dual function of SPCH and MUTE, two genes that could have originated from a duplication event in the common ancestor of angiosperms. Moreover, in angiosperms, SPCHs have experienced more duplications and harbor more copies than MUTEs and FAMAs, which, together with variation of the stomatal development in the entry division, implies that SPCH might have contributed greatly to the diversity of stomatal development. Based on the above, we proposed a model for the correlation between the evolution of stomatal development and the genes involved in this developmental process in land plants.
Temporal expression of genes involved in the biosynthesis of ...
African Journals Online (AJOL)
Gibberellins (GAs) are a large family of endogenous plant growth regulators. Bioactive GAs influence nearly all processes during plant growth and development. In the present study, we cloned and identified 10 unique genes that are potentially involved in the biosynthesis of GAs, including one BpGGDP gene, two BpCPS ...
Araújo, Welington Luiz; Santos, Daiene Souza; Dini-Andreote, Francisco; Salgueiro-Londoño, Jennifer Katherine; Camargo-Neves, Aline Aparecida; Andreote, Fernando Dini; Dourado, Manuella Nóbrega
2015-10-01
The genus Methylobacterium is composed of pink-pigmented methylotrophic bacterial species that are widespread in natural environments, such as soils, stream water and plants. When in association with plants, this genus colonizes the host plant epiphytically and/or endophytically. This association is known to promote plant growth, induce plant systemic resistance and inhibit plant infection by phytopathogens. In the present study, we focused on evaluating the colonization of soybean seedling-roots by Methylobacterium mesophilicum strain SR1.6/6. We focused on the identification of the key genes involved in the initial step of soybean colonization by methylotrophic bacteria, which includes the plant exudate recognition and adaptation by planktonic bacteria. Visualization by scanning electron microscopy revealed that M. mesophilicum SR1.6/6 colonizes soybean roots surface effectively at 48 h after inoculation, suggesting a mechanism for root recognition and adaptation before this period. The colonization proceeds by the development of a mature biofilm on roots at 96 h after inoculation. Transcriptomic analysis of the planktonic bacteria (with plant) revealed the expression of several genes involved in membrane transport, thus confirming an initial metabolic activation of bacterial responses when in the presence of plant root exudates. Moreover, antioxidant genes were mostly expressed during the interaction with the plant exudates. Further evaluation of stress- and methylotrophic-related genes expression by qPCR showed that glutathione peroxidase and glutathione synthetase genes were up-regulated during the Methylobacterium-soybean interaction. These findings support that glutathione (GSH) is potentially a key molecule involved in cellular detoxification during plant root colonization. In addition to methylotrophic metabolism, antioxidant genes, mainly glutathione-related genes, play a key role during soybean exudate recognition and adaptation, the first step in
Norman, C; Vidal, S; Palva, E T
1999-07-01
Identification of Arabidopsis thaliana genes responsive to plant cell-wall-degrading enzymes of Erwinia carotovora subsp. carotovora led to the isolation of a cDNA clone with high sequence homology to the gene for allene oxide synthase, an enzyme involved in the biosynthesis of jasmonates. Expression of the corresponding gene was induced by the extracellular enzymes from this pathogen as well as by treatment with methyl jasmonate and short oligogalacturonides (OGAs). This suggests that OGAs are involved in the induction of the jasmonate pathway during plant defense response to E. carotovora subsp. carotovora attack.
Directory of Open Access Journals (Sweden)
Sara Mayo
2016-08-01
Full Text Available Bean production is affected by a wide diversity of fungal pathogens, among them Rhizoctonia solani is one of the most important. A strategy to control bean infectious diseases, mainly those caused by fungi, is based on the use of biocontrol agents that can reduce the negative effects of plant pathogens and also can promote positive responses in the plant. Trichoderma is a fungal genus that is able to induce the expression of genes involved in plant defence response and also to promote plant growth, root development and nutrient uptake. In this article, a strategy that combines in silico analysis and real time PCR to detect additional bean defence-related genes, regulated by the presence of Trichoderma velutinum and/or R. solani has been applied. Based in this strategy, from From the 48 bean genes initially analysed, 14 were selected, and only WRKY33, CH5b and hGS showed an up-regulatory response in the presence of T. velutinum. The other genes were or not affected (OSM34 or down-regulated by the presence of this fungus. R. solani infection resulted in a down-regulation of most of the genes analyzed, except PR1, OSM34 and CNGC2 that were not affected, and the presence of both, T. velutinum and R. solani, up-regulates hGS and down-regulates all the other genes analyzed, except CH5b which was not significantly affected.As conclusion, the strategy described in the present work has been shown to be effective to detect genes involved in plant defence, which respond to the presence of a biocontrol agent or to a pathogen and also to the presence of both. The selected genes show significant homology with previously described plant defence genes and they are expressed in bean leaves of plants treated with T. velutinum and/or infected with R. solani.
Wheat F-Box Protein Gene TaFBA1 Is Involved in Plant Tolerance to Heat Stress
Directory of Open Access Journals (Sweden)
Qinxue Li
2018-04-01
Full Text Available Adverse environmental conditions, including high temperature, often affect the growth and production of crops worldwide. F-box protein, a core component of the Skp1-Cullin-F-box (SCF E3 ligase complex, plays an important role in abiotic stress responses. A previously cloned gene from wheat, TaFBA1, encodes a homologous F-box protein. A Yeast two-Hybrid (Y2H assay showed that TaFBA1 interacted with other SCF proteins. We found that the expression of TaFBA1 could be induced by heat stress (45°C. Overexpression of TaFBA1 enhanced heat stress tolerance in transgenic tobacco, because growth inhibition was reduced and photosynthesis increased as compared with those in the wild type (WT plants. Furthermore, the accumulation of H2O2, O2-, and carbonyl protein decreased and cell damage was alleviated in transgenic plants under heat stress, which resulted in less oxidative damage. However, the transgenic plants contained more enzymatic antioxidants after heat stress, which might be related to the regulation of some antioxidant gene expressions. The qRT-PCR analysis showed that the overexpression of TaFBA1 upregulated the expression of genes involved in reactive oxygen species (ROS scavenging, proline biosynthesis, and abiotic stress responses. We identified the interaction of TaFBA1 with Triticum aestivum stress responsive protein 1 (TaASRP1 by Y2H assay and bimolecular fluorescence complementation (BiFC assay. The results suggested that TaFBA1 may improve enzymatic antioxidant levels and regulate gene expression by interacting with other proteins, such as TaASRP1, which leads to the enhanced heat stress tolerance seen in the transgenic plants.
Methylobacterium-plant interaction genes regulated by plant exudate and quorum sensing molecules
Directory of Open Access Journals (Sweden)
Manuella Nóbrega Dourado
2013-12-01
Full Text Available Bacteria from the genus Methylobacterium interact symbiotically (endophytically and epiphytically with different plant species. These interactions can promote plant growth or induce systemic resistance, increasing plant fitness. The plant colonization is guided by molecular communication between bacteria-bacteria and bacteria-plants, where the bacteria recognize specific exuded compounds by other bacteria (e.g. homoserine molecules and/or by the plant roots (e.g. flavonoids, ethanol and methanol, respectively. In this context, the aim of this study was to evaluate the effect of quorum sensing molecules (N-acyl-homoserine lactones and plant exudates (including ethanol in the expression of a series of bacterial genes involved in Methylobacterium-plant interaction. The selected genes are related to bacterial metabolism (mxaF, adaptation to stressful environment (crtI, phoU and sss, to interactions with plant metabolism compounds (acdS and pathogenicity (patatin and phoU. Under in vitro conditions, our results showed the differential expression of some important genes related to metabolism, stress and pathogenesis, thereby AHL molecules up-regulate all tested genes, except phoU, while plant exudates induce only mxaF gene expression. In the presence of plant exudates there is a lower bacterial density (due the endophytic and epiphytic colonization, which produce less AHL, leading to down regulation of genes when compared to the control. Therefore, bacterial density, more than plant exudate, influences the expression of genes related to plant-bacteria interaction.
Xu, X Q; Li, L P; Pan, S Q
2001-11-01
Catalases are known to detoxify H2O2, a major component of oxidative stress imposed on a cell. An Agrobacterium tumefaciens catalase encoded by a chromosomal gene katA has been implicated as an important virulence factor as it is involved in detoxification of H2O2 released during Agrobacterium-plant interaction. In this paper, we report a feedback regulation pathway that controls the expression of katA in A. tumefaciens cells. We observed that katA could be induced by plant tissue sections and by acidic pH on a minimal medium, which resembles the plant environment that the bacteria encounter during the course of infection. This represents a new regulatory factor for catalase induction in bacteria. More importantly, a feedback regulation was observed when the katA-gfp expression was studied in different genetic backgrounds. We found that introduction of a wild-type katA gene encoding a functional catalase into A. tumefaciens cells could repress the katA-gfp expression over 60-fold. The katA gene could be induced by H2O2 and the encoded catalase could detoxify H2O2. In addition, the katA-gfp expression of one bacterial cell could be repressed by other surrounding catalase-proficient bacterial cells. Furthermore, mutation at katA caused a 10-fold increase of the intracellular H2O2 concentration in the bacteria grown on an acidic pH medium. These results suggest that the endogenous H2O2 generated during A. tumefaciens cell growth could serve as the intracellular and intercellular inducer for the katA gene expression and that the acidic pH could pose an oxidative stress on the bacteria. Surprisingly, one mutated KatA protein, exhibiting no significant catalase activity as a result of the alteration of two important residues at the putative active site, could partially repress the katA-gfp expression. The feedback regulation of the katA gene by both catalase activity and KatA protein could presumably maintain an appropriated level of catalase activity and H2O2 inside A
Fungal and plant gene expression in arbuscular mycorrhizal symbiosis.
Balestrini, Raffaella; Lanfranco, Luisa
2006-11-01
Arbuscular mycorrhizas (AMs) are a unique example of symbiosis between two eukaryotes, soil fungi and plants. This association induces important physiological changes in each partner that lead to reciprocal benefits, mainly in nutrient supply. The symbiosis results from modifications in plant and fungal cell organization caused by specific changes in gene expression. Recently, much effort has gone into studying these gene expression patterns to identify a wider spectrum of genes involved. We aim in this review to describe AM symbiosis in terms of current knowledge on plant and fungal gene expression profiles.
Evolution of the YABBY gene family in seed plants.
Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L
2016-01-01
Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.
The involvement of wheat F-box protein gene TaFBA1 in the oxidative stress tolerance of plants.
Directory of Open Access Journals (Sweden)
Shu-Mei Zhou
Full Text Available As one of the largest gene families, F-box domain proteins have been found to play important roles in abiotic stress responses via the ubiquitin pathway. TaFBA1 encodes a homologous F-box protein contained in E3 ubiquitin ligases. In our previous study, we found that the overexpression of TaFBA1 enhanced drought tolerance in transgenic plants. To investigate the mechanisms involved, in this study, we investigated the tolerance of the transgenic plants to oxidative stress. Methyl viologen was used to induce oxidative stress conditions. Real-time PCR and western blot analysis revealed that TaFBA1 expression was up-regulated by oxidative stress treatments. Under oxidative stress conditions, the transgenic tobacco plants showed a higher germination rate, higher root length and less growth inhibition than wild type (WT. The enhanced oxidative stress tolerance of the transgenic plants was also indicated by lower reactive oxygen species (ROS accumulation, malondialdehyde (MDA content and cell membrane damage under oxidative stress compared with WT. Higher activities of antioxidant enzymes, including superoxide dismutase (SOD, catalase (CAT, ascorbate peroxidase (APX and peroxidase (POD, were observed in the transgenic plants than those in WT, which may be related to the upregulated expression of some antioxidant genes via the overexpression of TaFBA1. In others, some stress responsive elements were found in the promoter region of TaFBA1, and TaFBA1 was located in the nucleus, cytoplasm and plasma membrane. These results suggest that TaFBA1 plays an important role in the oxidative stress tolerance of plants. This is important for understanding the functions of F-box proteins in plants' tolerance to multiple stress conditions.
Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli
2013-07-01
Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Regulation of meiotic gene expression in plants
Directory of Open Access Journals (Sweden)
Adele eZhou
2014-08-01
Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.
Rong Tan, Li; Chen Lu, Yi; Jing Zhang, Jing; Luo, Fang; Yang, Hong
2015-09-01
Plant cytochrome P450 monooxygenases constitute one of the largest families of protein genes involved in plant growth, development and acclimation to biotic and abiotic stresses. However, whether these genes respond to organic toxic compounds and their biological functions for detoxifying toxic compounds such as herbicides in rice are poorly understood. The present study identified 201 genes encoding cytochrome P450s from an atrazine-exposed rice transcriptome through high-throughput sequencing. Of these, 69 cytochrome P450 genes were validated by microarray and some of them were confirmed by real time PCR. Activities of NADPH-cytochrome P450 reductase (CPR) and p-nitroanisole O-demethylase (PNOD) related to toxicity were determined and significantly induced by atrazine exposure. To dissect the mechanism underlying atrazine modification and detoxification by P450, metabolites (or derivatives) of atrazine in plants were analyzed by ultra performance liquid chromatography mass spectrometry (UPLC/MS). Major metabolites comprised desmethylatrazine (DMA), desethylatrazine (DEA), desisopropylatrazine (DIA), hydroxyatrazine (HA), hydroxyethylatrazine (HEA) and hydroxyisopropylatrazine (HIA). All of them were chemically modified by P450s. Furthermore, two specific inhibitors of piperonyl butoxide (PBO) and malathion (MAL) were used to assess the correlation between the P450s activity and rice responses including accumulation of atrazine in tissues, shoot and root growth and detoxification. Copyright © 2015 Elsevier Inc. All rights reserved.
2010-01-01
Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests
Directory of Open Access Journals (Sweden)
Hao Weilong
2010-12-01
Full Text Available Abstract Background Horizontal gene transfer (HGT is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native
Molecular hydrogen is involved in phytohormone signaling and stress responses in plants.
Directory of Open Access Journals (Sweden)
Jiqing Zeng
Full Text Available Molecular hydrogen (H2 metabolism in bacteria and algae has been well studied from an industrial perspective because H2 is viewed as a potential future energy source. A number of clinical trials have recently reported that H2 is a therapeutic antioxidant and signaling molecule. Although H2 metabolism in higher plants was reported in some early studies, its biological effects remain unclear. In this report, the biological effects of H2 and its involvement in plant hormone signaling pathways and stress responses were determined. Antioxidant enzyme activity was found to be increased and the transcription of corresponding genes altered when the effects of H2 on the germination of mung bean seeds treated with phytohormones was investigated. In addition, upregulation of several phytohormone receptor genes and genes that encode a few key factors involved in plant signaling pathways was detected in rice seedlings treated with HW. The transcription of putative rice hydrogenase genes, hydrogenase activity, and endogenous H2 production were also determined. H2 production was found to be induced by abscisic acid, ethylene, and jasmonate acid, salt, and drought stress and was consistent with hydrogenase activity and the expression of putative hydrogenase genes in rice seedlings. Together, these results suggest that H2 may have an effect on rice stress tolerance by modulating the output of hormone signaling pathways.
Lactococcus lactis Metabolism and Gene Expression during Growth on Plant Tissues
Golomb, Benjamin L.
2014-01-01
Lactic acid bacteria have been isolated from living, harvested, and fermented plant materials; however, the adaptations these bacteria possess for growth on plant tissues are largely unknown. In this study, we investigated plant habitat-specific traits of Lactococcus lactis during growth in an Arabidopsis thaliana leaf tissue lysate (ATL). L. lactis KF147, a strain originally isolated from plants, exhibited a higher growth rate and reached 7.9-fold-greater cell densities during growth in ATL than the dairy-associated strain L. lactis IL1403. Transcriptome profiling (RNA-seq) of KF147 identified 853 induced and 264 repressed genes during growth in ATL compared to that in GM17 laboratory culture medium. Genes induced in ATL included those involved in the arginine deiminase pathway and a total of 140 carbohydrate transport and metabolism genes, many of which are involved in xylose, arabinose, cellobiose, and hemicellulose metabolism. The induction of those genes corresponded with L. lactis KF147 nutrient consumption and production of metabolic end products in ATL as measured by gas chromatography-time of flight mass spectrometry (GC-TOF/MS) untargeted metabolomic profiling. To assess the importance of specific plant-inducible genes for L. lactis growth in ATL, xylose metabolism was targeted for gene knockout mutagenesis. Wild-type L. lactis strain KF147 but not an xylA deletion mutant was able to grow using xylose as the sole carbon source. However, both strains grew to similarly high levels in ATL, indicating redundancy in L. lactis carbohydrate metabolism on plant tissues. These findings show that certain strains of L. lactis are well adapted for growth on plants and possess specific traits relevant for plant-based food, fuel, and feed fermentations. PMID:25384484
Evolutionary diversification of plant shikimate kinase gene duplicates.
Directory of Open Access Journals (Sweden)
Geoffrey Fucile
2008-12-01
Full Text Available Shikimate kinase (SK; EC 2.7.1.71 catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.
PlantTribes: a gene and gene family resource for comparative genomics in plants
Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.
2007-01-01
The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...
International Nuclear Information System (INIS)
Zulfiqar, Asma; Paulose, Bibin; Chhikara, Sudesh; Dhankher, Om Parkash
2011-01-01
Chromium pollution is a serious environmental problem with few cost-effective remediation strategies available. Crambe abyssinica (a member of Brassicaseae), a non-food, fast growing high biomass crop, is an ideal candidate for phytoremediation of heavy metals contaminated soils. The present study used a PCR-Select Suppression Subtraction Hybridization approach in C. abyssinica to isolate differentially expressed genes in response to Cr exposure. A total of 72 differentially expressed subtracted cDNAs were sequenced and found to represent 43 genes. The subtracted cDNAs suggest that Cr stress significantly affects pathways related to stress/defense, ion transporters, sulfur assimilation, cell signaling, protein degradation, photosynthesis and cell metabolism. The regulation of these genes in response to Cr exposure was further confirmed by semi-quantitative RT-PCR. Characterization of these differentially expressed genes may enable the engineering of non-food, high-biomass plants, including C. abyssinica, for phytoremediation of Cr-contaminated soils and sediments. - Highlights: → Molecular mechanism of Cr uptake and detoxification in plants is not well known. → We identified differentially regulated genes upon Cr exposure in Crambe abyssinica. → 72 Cr-induced subtracted cDNAs were sequenced and found to represent 43 genes. → Pathways linked to stress, ion transport, and sulfur assimilation were affected. → This is the first Cr transcriptome study in a crop with phytoremediation potential. - This study describes the identification and isolation of differentially expressed genes involved in chromium metabolism and detoxification in a non-food industrial oil crop Crambe abyssinica.
Energy Technology Data Exchange (ETDEWEB)
Zulfiqar, Asma, E-mail: asmazulfiqar08@yahoo.com [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Paulose, Bibin, E-mail: bpaulose@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Chhikara, Sudesh, E-mail: sudesh@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States); Dhankher, Om Parkash, E-mail: parkash@psis.umass.edu [Department of Plant, Soil, and Insect Sciences, 270 Stockbridge Road, University of Massachusetts Amherst, MA 01003 (United States)
2011-10-15
Chromium pollution is a serious environmental problem with few cost-effective remediation strategies available. Crambe abyssinica (a member of Brassicaseae), a non-food, fast growing high biomass crop, is an ideal candidate for phytoremediation of heavy metals contaminated soils. The present study used a PCR-Select Suppression Subtraction Hybridization approach in C. abyssinica to isolate differentially expressed genes in response to Cr exposure. A total of 72 differentially expressed subtracted cDNAs were sequenced and found to represent 43 genes. The subtracted cDNAs suggest that Cr stress significantly affects pathways related to stress/defense, ion transporters, sulfur assimilation, cell signaling, protein degradation, photosynthesis and cell metabolism. The regulation of these genes in response to Cr exposure was further confirmed by semi-quantitative RT-PCR. Characterization of these differentially expressed genes may enable the engineering of non-food, high-biomass plants, including C. abyssinica, for phytoremediation of Cr-contaminated soils and sediments. - Highlights: > Molecular mechanism of Cr uptake and detoxification in plants is not well known. > We identified differentially regulated genes upon Cr exposure in Crambe abyssinica. > 72 Cr-induced subtracted cDNAs were sequenced and found to represent 43 genes. > Pathways linked to stress, ion transport, and sulfur assimilation were affected. > This is the first Cr transcriptome study in a crop with phytoremediation potential. - This study describes the identification and isolation of differentially expressed genes involved in chromium metabolism and detoxification in a non-food industrial oil crop Crambe abyssinica.
Phylogenetics and evolution of Trx SET genes in fully sequenced land plants.
Zhu, Xinyu; Chen, Caoyi; Wang, Baohua
2012-04-01
Plant Trx SET proteins are involved in H3K4 methylation and play a key role in plant floral development. Genes encoding Trx SET proteins constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. To investigate the evolutionary history of the Trx SET gene family, we made a comprehensive evolutionary analysis on this gene family from 13 major representatives of green plants. A novel clustering (here named as cpTrx clade), which included the III-1, III-2, and III-4 orthologous groups, previously resolved was identified. Our analysis showed that plant Trx proteins possessed a variety of domain organizations and gene structures among paralogs. Additional domains such as PHD, PWWP, and FYR were early integrated into primordial SET-PostSET domain organization of cpTrx clade. We suggested that the PostSET domain was lost in some members of III-4 orthologous group during the evolution of land plants. At least four classes of gene structures had been formed at the early evolutionary stage of land plants. Three intronless orphan Trx SET genes from the Physcomitrella patens (moss) were identified, and supposedly, their parental genes have been eliminated from the genome. The structural differences among evolutionary groups of plant Trx SET genes with different functions were described, contributing to the design of further experimental studies.
Identification and characterization of nuclear genes involved in photosynthesis in Populus
2014-01-01
Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936
Zhao, Ming-Ming; Zhang, Gang; Zhang, Da-Wei; Hsiao, Yu-Yun; Guo, Shun-Xing
2013-01-01
Dendrobiumofficinale (Orchidaceae) is one of the world's most endangered plants with great medicinal value. In nature, D. officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH) cDNA library of symbiotically germinated D. officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs) were clustered to 1074 Unigenes (including 902 singletons and 172 contigs), which were searched against the NCBI non-redundant (NR) protein database (E-value cutoff, e(-5)). Based on sequence similarity with known proteins, 579 differentially expressed genes in D. officinale were identified and classified into different functional categories by Gene Ontology (GO), Clusters of orthologous Groups of proteins (COGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS). The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs), which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS), were cloned from D. officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D. officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids.
Directory of Open Access Journals (Sweden)
Ming-Ming Zhao
Full Text Available Dendrobiumofficinale (Orchidaceae is one of the world's most endangered plants with great medicinal value. In nature, D. officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH cDNA library of symbiotically germinated D. officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs were clustered to 1074 Unigenes (including 902 singletons and 172 contigs, which were searched against the NCBI non-redundant (NR protein database (E-value cutoff, e(-5. Based on sequence similarity with known proteins, 579 differentially expressed genes in D. officinale were identified and classified into different functional categories by Gene Ontology (GO, Clusters of orthologous Groups of proteins (COGs and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS. The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs, which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS, were cloned from D. officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D. officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids.
ESTs Analysis Reveals Putative Genes Involved in Symbiotic Seed Germination in Dendrobium officinale
Zhao, Ming-Ming; Zhang, Gang; Zhang, Da-Wei; Hsiao, Yu-Yun; Guo, Shun-Xing
2013-01-01
Dendrobium officinale (Orchidaceae) is one of the world’s most endangered plants with great medicinal value. In nature, D . officinale seeds must establish symbiotic relationships with fungi to germinate. However, the molecular events involved in the interaction between fungus and plant during this process are poorly understood. To isolate the genes involved in symbiotic germination, a suppression subtractive hybridization (SSH) cDNA library of symbiotically germinated D . officinale seeds was constructed. From this library, 1437 expressed sequence tags (ESTs) were clustered to 1074 Unigenes (including 902 singletons and 172 contigs), which were searched against the NCBI non-redundant (NR) protein database (E-value cutoff, e-5). Based on sequence similarity with known proteins, 579 differentially expressed genes in D . officinale were identified and classified into different functional categories by Gene Ontology (GO), Clusters of orthologous Groups of proteins (COGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. The expression levels of 15 selected genes emblematic of symbiotic germination were confirmed via real-time quantitative PCR. These genes were classified into various categories, including defense and stress response, metabolism, transcriptional regulation, transport process and signal transduction pathways. All transcripts were upregulated in the symbiotically germinated seeds (SGS). The functions of these genes in symbiotic germination were predicted. Furthermore, two fungus-induced calcium-dependent protein kinases (CDPKs), which were upregulated 6.76- and 26.69-fold in SGS compared with un-germinated seeds (UGS), were cloned from D . officinale and characterized for the first time. This study provides the first global overview of genes putatively involved in D . officinale symbiotic seed germination and provides a foundation for further functional research regarding symbiotic relationships in orchids. PMID:23967335
International Nuclear Information System (INIS)
Perez Quintero, Alvaro; Lopez, Camilo
2013-01-01
MicroRNAs (miRNAs) are a group of small non coding MAS involved in the control of gene expression through the degradation of miRNAs in a sequence specific manner, miRNAs expression is dependent on RNA polymerase ii as most of the coding protein genes. The regulation of miRNAs expression is under the coordinated and combinatorial control of transcription factors (TFS). A bioinformatics approach was carried out to identify transcription factor binding sites (TFBS) in the promoter of miRNAs genes in 17 different plant species and the possible involvement of TF in antibacterial response was analyzed. In nine of the plants studied significant differences in TFBS distribution in the promoter of miRNAs were observed when compare to the promoter of protein coding genes. TFBS as CCA1, T-box y SORLREP3 were present on the promoters of the cassava miRNAs induced in response to the infection by the bacteria Xanthomonas axonopodis pv. manihotis. These TFBS are also present in the promoter of genes coding for proteins involved in circadian rhythm and light responses, suggesting a crosstalk between these process and immune plant responses. Taken together, the results here described give insight about the transcriptional mechanisms involved in the expression of miRNAs.
Gomes, Eriston V; Ulhoa, Cirano J; Cardoza, Rosa E; Silva, Roberto N; Gutiérrez, Santiago
2017-01-01
Several Trichoderma spp. are well known for their ability to: (i) act as important biocontrol agents against phytopathogenic fungi; (ii) function as biofertilizers; (iii) increase the tolerance of plants to biotic and abiotic stresses; and (iv) induce plant defense responses via the production and secretion of elicitor molecules. In this study, we analyzed the gene-regulation effects of Trichoderma harzianum Epl-1 protein during the interactions of mutant Δ epl-1 or wild-type T. harzianum strains with: (a) the phytopathogen Botrytis cinerea and (b) with tomato plants, on short (24 h hydroponic cultures) and long periods (4-weeks old plants) after Trichoderma inoculation. Our results indicate that T. harzianum Epl-1 protein affects the in vitro expression of B. cinerea virulence genes, especially those involved in the botrydial biosynthesis ( BcBOT genes), during the mycoparasitism interaction. The tomato defense-related genes were also affected, indicating that Epl-1 is involved in the elicitation of the salicylic acid pathway. Moreover, Epl-1 also regulates the priming effect in host tomato plants and contributes to enhance the interaction with the host tomato plant during the early stage of root colonization.
Directory of Open Access Journals (Sweden)
Eriston V. Gomes
2017-05-01
Full Text Available Several Trichoderma spp. are well known for their ability to: (i act as important biocontrol agents against phytopathogenic fungi; (ii function as biofertilizers; (iii increase the tolerance of plants to biotic and abiotic stresses; and (iv induce plant defense responses via the production and secretion of elicitor molecules. In this study, we analyzed the gene-regulation effects of Trichoderma harzianum Epl-1 protein during the interactions of mutant Δepl-1 or wild-type T. harzianum strains with: (a the phytopathogen Botrytis cinerea and (b with tomato plants, on short (24 h hydroponic cultures and long periods (4-weeks old plants after Trichoderma inoculation. Our results indicate that T. harzianum Epl-1 protein affects the in vitro expression of B. cinerea virulence genes, especially those involved in the botrydial biosynthesis (BcBOT genes, during the mycoparasitism interaction. The tomato defense-related genes were also affected, indicating that Epl-1 is involved in the elicitation of the salicylic acid pathway. Moreover, Epl-1 also regulates the priming effect in host tomato plants and contributes to enhance the interaction with the host tomato plant during the early stage of root colonization.
Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.
Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji
2018-02-15
Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.
Lysøe, Erik; Harris, Linda J.; Walkowiak, Sean; Subramaniam, Rajagopal; Divon, Hege H.; Riiser, Even S.; Llorens, Carlos; Gabaldón, Toni; Kistler, H. Corby; Jonkers, Wilfried; Kolseth, Anna-Karin; Nielsen, Kristian F.; Thrane, Ulf; Frandsen, Rasmus J. N.
2014-01-01
Fusarium avenaceum is a fungus commonly isolated from soil and associated with a wide range of host plants. We present here three genome sequences of F. avenaceum, one isolated from barley in Finland and two from spring and winter wheat in Canada. The sizes of the three genomes range from 41.6–43.1 MB, with 13217–13445 predicted protein-coding genes. Whole-genome analysis showed that the three genomes are highly syntenic, and share>95% gene orthologs. Comparative analysis to other sequenced Fusaria shows that F. avenaceum has a very large potential for producing secondary metabolites, with between 75 and 80 key enzymes belonging to the polyketide, non-ribosomal peptide, terpene, alkaloid and indole-diterpene synthase classes. In addition to known metabolites from F. avenaceum, fuscofusarin and JM-47 were detected for the first time in this species. Many protein families are expanded in F. avenaceum, such as transcription factors, and proteins involved in redox reactions and signal transduction, suggesting evolutionary adaptation to a diverse and cosmopolitan ecology. We found that 20% of all predicted proteins were considered to be secreted, supporting a life in the extracellular space during interaction with plant hosts. PMID:25409087
Directory of Open Access Journals (Sweden)
Kandasamy Suganthi
2010-06-01
Full Text Available Abstract Background Arsenic contamination is widespread throughout the world and this toxic metalloid is known to cause cancers of organs such as liver, kidney, skin, and lung in human. In spite of a recent surge in arsenic related studies, we are still far from a comprehensive understanding of arsenic uptake, detoxification, and sequestration in plants. Crambe abyssinica, commonly known as 'abyssinian mustard', is a non-food, high biomass oil seed crop that is naturally tolerant to heavy metals. Moreover, it accumulates significantly higher levels of arsenic as compared to other species of the Brassicaceae family. Thus, C. abyssinica has great potential to be utilized as an ideal inedible crop for phytoremediation of heavy metals and metalloids. However, the mechanism of arsenic metabolism in higher plants, including C. abyssinica, remains elusive. Results To identify the differentially expressed transcripts and the pathways involved in arsenic metabolism and detoxification, C. abyssinica plants were subjected to arsenate stress and a PCR-Select Suppression Subtraction Hybridization (SSH approach was employed. A total of 105 differentially expressed subtracted cDNAs were sequenced which were found to represent 38 genes. Those genes encode proteins functioning as antioxidants, metal transporters, reductases, enzymes involved in the protein degradation pathway, and several novel uncharacterized proteins. The transcripts corresponding to the subtracted cDNAs showed strong upregulation by arsenate stress as confirmed by the semi-quantitative RT-PCR. Conclusions Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to arsenate toxicity. The differential expression of transcripts encoding glutathione-S-transferases, antioxidants, sulfur metabolism, heat-shock proteins, metal transporters, and enzymes in the ubiquitination pathway of protein degradation as well as several unknown
2010-01-01
Background Arsenic contamination is widespread throughout the world and this toxic metalloid is known to cause cancers of organs such as liver, kidney, skin, and lung in human. In spite of a recent surge in arsenic related studies, we are still far from a comprehensive understanding of arsenic uptake, detoxification, and sequestration in plants. Crambe abyssinica, commonly known as 'abyssinian mustard', is a non-food, high biomass oil seed crop that is naturally tolerant to heavy metals. Moreover, it accumulates significantly higher levels of arsenic as compared to other species of the Brassicaceae family. Thus, C. abyssinica has great potential to be utilized as an ideal inedible crop for phytoremediation of heavy metals and metalloids. However, the mechanism of arsenic metabolism in higher plants, including C. abyssinica, remains elusive. Results To identify the differentially expressed transcripts and the pathways involved in arsenic metabolism and detoxification, C. abyssinica plants were subjected to arsenate stress and a PCR-Select Suppression Subtraction Hybridization (SSH) approach was employed. A total of 105 differentially expressed subtracted cDNAs were sequenced which were found to represent 38 genes. Those genes encode proteins functioning as antioxidants, metal transporters, reductases, enzymes involved in the protein degradation pathway, and several novel uncharacterized proteins. The transcripts corresponding to the subtracted cDNAs showed strong upregulation by arsenate stress as confirmed by the semi-quantitative RT-PCR. Conclusions Our study revealed novel insights into the plant defense mechanisms and the regulation of genes and gene networks in response to arsenate toxicity. The differential expression of transcripts encoding glutathione-S-transferases, antioxidants, sulfur metabolism, heat-shock proteins, metal transporters, and enzymes in the ubiquitination pathway of protein degradation as well as several unknown novel proteins serve as
Directory of Open Access Journals (Sweden)
Arase Sachiko
2012-03-01
Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.
Cell-specific expression of plant nutrient transporter genes in orchid mycorrhizae.
Fochi, Valeria; Falla, Nicole; Girlanda, Mariangela; Perotto, Silvia; Balestrini, Raffaella
2017-10-01
Orchid mycorrhizal protocorms and roots are heterogeneous structures composed of different plant cell-types, where cells colonized by intracellular fungal coils (the pelotons) are close to non-colonized plant cells. Moreover, the fungal coils undergo rapid turnover inside the colonized cells, so that plant cells containing coils at different developmental stages can be observed in the same tissue section. Here, we have investigated by laser microdissection (LMD) the localization of specific plant gene transcripts in different cell-type populations collected from mycorrhizal protocorms and roots of the Mediterranean orchid Serapias vomeracea colonized by Tulasnella calospora. RNAs extracted from the different cell-type populations have been used to study plant gene expression, focusing on genes potentially involved in N uptake and transport and previously identified as up-regulated in symbiotic protocorms. Results clearly showed that some plant N transporters are differentially expressed in cells containing fungal coils at different developmental stages, as well as in non-colonized cells, and allowed the identification of new functional markers associated to coil-containing cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rosa Lozano-Durán
2013-03-01
Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the
Isolation and characterization of Lotus japonicus genes involved in iron and zinc homeostasis
DEFF Research Database (Denmark)
Cvitanich, Cristina; Jensen, Winnie; Sandal, Niels Nørgaard
. Legumes are frequently grown in soil with limited nutrient availability. Plants use finely tuned mechanisms to keep appropriated levels of iron and zinc in each of their organs. Several genes involved in iron and zinc homeostasis have been described in yeast, and a few orthologs have been studied...... in plants. We have used these sequences to search for L. japonicus ESTs and genomic loci that are likely to be involved in iron and zinc metabolism. We have identified sequences corresponding to ferritins, ferric reductases, metal transport proteins of the ZIP family, and cation transporters of the NRAMP......The goal of this project is to find ways to improve the nutritional value of legumes by identifying genes and proteins important for iron and zinc regulation in the model legume Lotus japonicus. Legumes are important staples in the developing world and are a major source of nutrients in many areas...
Chen, Li; Liu, Yushan; Liu, Hongdi; Kang, Limin; Geng, Jinman; Gai, Yuzhuo; Ding, Yunlong; Sun, Haiyue; Li, Yadong
2015-01-01
Multidrug and toxic compound extrusion (MATE) proteins are the most recently identified family of multidrug transporters. In plants, this family is remarkably large compared to the human and bacteria counterpart, highlighting the importance of MATE proteins in this kingdom. Here 33 Unigenes annotated as MATE transporters were found in the blueberry fruit transcriptome, of which eight full-length cDNA sequences were identified and cloned. These proteins are composed of 477-517 residues, with molecular masses ~54 kDa, and theoretical isoelectric points from 5.35 to 8.41. Bioinformatics analysis predicted 10-12 putative transmembrane segments for VcMATEs, and localization to the plasma membrane without an N-terminal signal peptide. All blueberry MATE proteins shared 32.1-84.4% identity, among which VcMATE2, VcMATE3, VcMATE5, VcMATE7, VcMATE8, and VcMATE9 were more similar to the MATE-type flavonoid transporters. Phylogenetic analysis showed VcMATE2, VcMATE3, VcMATE5, VcMATE7, VcMATE8 and VcMATE9 clustered with MATE-type flavonoid transporters, indicating that they might be involved in flavonoid transport. VcMATE1 and VcMATE4 may be involved in the transport of secondary metabolites, the detoxification of xenobiotics, or the export of toxic cations. Real-time quantitative PCR demonstrated that the expression profile of the eight VcMATE genes varied spatially and temporally. Analysis of expression and anthocyanin accumulation indicated that there were some correlation between the expression profile and the accumulation of anthocyanins. These results showed VcMATEs might be involved in diverse physiological functions, and anthocyanins across the membranes might be mutually maintained by MATE-type flavonoid transporters and other mechanisms. This study will enrich the MATE-based transport mechanisms of secondary metabolite, and provide a new biotechonology strategy to develop better nutritional blueberry cultivars.
Bencke-Malato, Marta; Cabreira, Caroline; Wiebke-Strohm, Beatriz; Bücker-Neto, Lauro; Mancini, Estefania; Osorio, Marina B; Homrich, Milena S; Turchetto-Zolet, Andreia Carina; De Carvalho, Mayra C C G; Stolf, Renata; Weber, Ricardo L M; Westergaard, Gastón; Castagnaro, Atílio P; Abdelnoor, Ricardo V; Marcelino-Guimarães, Francismar C; Margis-Pinheiro, Márcia; Bodanese-Zanettini, Maria Helena
2014-09-10
Many previous studies have shown that soybean WRKY transcription factors are involved in the plant response to biotic and abiotic stresses. Phakopsora pachyrhizi is the causal agent of Asian Soybean Rust, one of the most important soybean diseases. There are evidences that WRKYs are involved in the resistance of some soybean genotypes against that fungus. The number of WRKY genes already annotated in soybean genome was underrepresented. In the present study, a genome-wide annotation of the soybean WRKY family was carried out and members involved in the response to P. pachyrhizi were identified. As a result of a soybean genomic databases search, 182 WRKY-encoding genes were annotated and 33 putative pseudogenes identified. Genes involved in the response to P. pachyrhizi infection were identified using superSAGE, RNA-Seq of microdissected lesions and microarray experiments. Seventy-five genes were differentially expressed during fungal infection. The expression of eight WRKY genes was validated by RT-qPCR. The expression of these genes in a resistant genotype was earlier and/or stronger compared with a susceptible genotype in response to P. pachyrhizi infection. Soybean somatic embryos were transformed in order to overexpress or silence WRKY genes. Embryos overexpressing a WRKY gene were obtained, but they were unable to convert into plants. When infected with P. pachyrhizi, the leaves of the silenced transgenic line showed a higher number of lesions than the wild-type plants. The present study reports a genome-wide annotation of soybean WRKY family. The participation of some members in response to P. pachyrhizi infection was demonstrated. The results contribute to the elucidation of gene function and suggest the manipulation of WRKYs as a strategy to increase fungal resistance in soybean plants.
Davin, Nicolas; Edger, Patrick P; Hefer, Charles A; Mizrachi, Eshchar; Schuetz, Mathias; Smets, Erik; Myburg, Alexander A; Douglas, Carl J; Schranz, Michael E; Lens, Frederic
2016-06-01
Many plant genes are known to be involved in the development of cambium and wood, but how the expression and functional interaction of these genes determine the unique biology of wood remains largely unknown. We used the soc1ful loss of function mutant - the woodiest genotype known in the otherwise herbaceous model plant Arabidopsis - to investigate the expression and interactions of genes involved in secondary growth (wood formation). Detailed anatomical observations of the stem in combination with mRNA sequencing were used to assess transcriptome remodeling during xylogenesis in wild-type and woody soc1ful plants. To interpret the transcriptome changes, we constructed functional gene association networks of differentially expressed genes using the STRING database. This analysis revealed functionally enriched gene association hubs that are differentially expressed in herbaceous and woody tissues. In particular, we observed the differential expression of genes related to mechanical stress and jasmonate biosynthesis/signaling during wood formation in soc1ful plants that may be an effect of greater tension within woody tissues. Our results suggest that habit shifts from herbaceous to woody life forms observed in many angiosperm lineages could have evolved convergently by genetic changes that modulate the gene expression and interaction network, and thereby redeploy the conserved wood developmental program. © 2016 The Authors. The Plant Journal published by Society for Experimental Biology and John Wiley & Sons Ltd.
In Silico Identification, Phylogenetic and Bioinformatic Analysis of Argonaute Genes in Plants
Directory of Open Access Journals (Sweden)
Khaled Mirzaei
2014-01-01
Full Text Available Argonaute protein family is the key players in pathways of gene silencing and small regulatory RNAs in different organisms. Argonaute proteins can bind small noncoding RNAs and control protein synthesis, affect messenger RNA stability, and even participate in the production of new forms of small RNAs. The aim of this study was to characterize and perform bioinformatic analysis of Argonaute proteins in 32 plant species that their genome was sequenced. A total of 437 Argonaute genes were identified and were analyzed based on lengths, gene structure, and protein structure. Results showed that Argonaute proteins were highly conserved across plant kingdom. Phylogenic analysis divided plant Argonautes into three classes. Argonaute proteins have three conserved domains PAZ, MID and PIWI. In addition to three conserved domains namely, PAZ, MID, and PIWI, we identified few more domains in AGO of some plant species. Expression profile analysis of Argonaute proteins showed that expression of these genes varies in most of tissues, which means that these proteins are involved in regulation of most pathways of the plant system. Numbers of alternative transcripts of Argonaute genes were highly variable among the plants. A thorough analysis of large number of putative Argonaute genes revealed several interesting aspects associated with this protein and brought novel information with promising usefulness for both basic and biotechnological applications.
Goel, Parul; Bhuria, Monika; Kaushal, Mamta
2016-01-01
In plants, several cellular and metabolic pathways interact with each other to regulate processes that are vital for their growth and development. Carbon (C) and Nitrogen (N) are two main nutrients for plants and coordination of C and N pathways is an important factor for maintaining plant growth and development. In the present work, influence of nitrogen and sucrose (C source) on growth parameters and expression of genes involved in nitrogen transport and assimilatory pathways was studied in B. juncea seedlings. For this, B. juncea seedlings were treated with four combinations of C and N source viz., N source alone (-Suc+N), C source alone (+Suc-N), with N and C source (+Suc+N) or without N and C source (-Suc-N). Cotyledon size and shoot length were found to be increased in seedlings, when nitrogen alone was present in the medium. Distinct expression pattern of genes in both, root and shoot tissues was observed in response to exogenously supplied N and C. The presence or depletion of nitrogen alone in the medium leads to severe up- or down-regulation of key genes involved in N-uptake and transport (BjNRT1.1, BjNRT1.8) in root tissue and genes involved in nitrate reduction (BjNR1 and BjNR2) in shoot tissue. Moreover, expression of several genes, like BjAMT1.2, BjAMT2 and BjPK in root and two genes BjAMT2 and BjGS1.1 in shoot were found to be regulated only when C source was present in the medium. Majority of genes were found to respond in root and shoot tissues, when both C and N source were present in the medium, thus reflecting their importance as a signal in regulating expression of genes involved in N-uptake and assimilation. The present work provides insight into the regulation of genes of N-uptake and assimilatory pathway in B. juncea by interaction of both carbon and nitrogen. PMID:27637072
Directory of Open Access Journals (Sweden)
Parul Goel
Full Text Available In plants, several cellular and metabolic pathways interact with each other to regulate processes that are vital for their growth and development. Carbon (C and Nitrogen (N are two main nutrients for plants and coordination of C and N pathways is an important factor for maintaining plant growth and development. In the present work, influence of nitrogen and sucrose (C source on growth parameters and expression of genes involved in nitrogen transport and assimilatory pathways was studied in B. juncea seedlings. For this, B. juncea seedlings were treated with four combinations of C and N source viz., N source alone (-Suc+N, C source alone (+Suc-N, with N and C source (+Suc+N or without N and C source (-Suc-N. Cotyledon size and shoot length were found to be increased in seedlings, when nitrogen alone was present in the medium. Distinct expression pattern of genes in both, root and shoot tissues was observed in response to exogenously supplied N and C. The presence or depletion of nitrogen alone in the medium leads to severe up- or down-regulation of key genes involved in N-uptake and transport (BjNRT1.1, BjNRT1.8 in root tissue and genes involved in nitrate reduction (BjNR1 and BjNR2 in shoot tissue. Moreover, expression of several genes, like BjAMT1.2, BjAMT2 and BjPK in root and two genes BjAMT2 and BjGS1.1 in shoot were found to be regulated only when C source was present in the medium. Majority of genes were found to respond in root and shoot tissues, when both C and N source were present in the medium, thus reflecting their importance as a signal in regulating expression of genes involved in N-uptake and assimilation. The present work provides insight into the regulation of genes of N-uptake and assimilatory pathway in B. juncea by interaction of both carbon and nitrogen.
Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.
2011-01-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805
Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A
2011-03-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.
Cadmium resistance in tobacco plants expressing the MuSI gene
Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon
2011-01-01
MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI t...
Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses
Directory of Open Access Journals (Sweden)
Magdalena eMazur
2012-09-01
Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.
The rice YABBY1 gene is involved in the feedback regulation of gibberellin metabolism.
Dai, Mingqiu; Zhao, Yu; Ma, Qian; Hu, Yongfeng; Hedden, Peter; Zhang, Qifa; Zhou, Dao-Xiu
2007-05-01
Gibberellin (GA) biosynthesis is regulated by feedback control providing a mechanism for GA homeostasis in plants. However, regulatory elements involved in the feedback control are not known. In this report, we show that a rice (Oryza sativa) YABBY1 (YAB1) gene had a similar expression pattern as key rice GA biosynthetic genes GA3ox2 and GA20ox2. Overexpression of YAB1 in transgenic rice resulted in a semidwarf phenotype that could be fully rescued by applied GA. Quantification of the endogenous GA content revealed increases of GA(20) and decreases of GA(1) levels in the overexpression plants, in which the transcripts of the biosynthetic gene GA3ox2 were decreased. Cosuppression of YAB1 in transgenic plants induced expression of GA3ox2. The repression of GA3ox2 could be obtained upon treatment by dexamethasone of transgenic plants expressing a YAB1-glucocorticoid receptor fusion. Importantly, we show that YAB1 bound to a GA-responsive element within the GA3ox2 promoter. In addition, the expression of YAB1 was deregulated in GA biosynthesis and signaling mutants and could be either transiently induced by GA or repressed by a GA inhibitor. Finally, either overexpression or cosuppression of YAB1 impaired GA-mediated repression of GA3ox2. These data together suggest that YAB1 is involved in the feedback regulation of GA biosynthesis in rice.
MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense
Directory of Open Access Journals (Sweden)
Sheng-Rui Liu
2017-09-01
Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.
Gomes, Eriston Vieira; Costa, Mariana do Nascimento; de Paula, Renato Graciano; de Azevedo, Rafael Ricci; da Silva, Francilene Lopes; Noronha, Eliane F; Ulhoa, Cirano José; Monteiro, Valdirene Neves; Cardoza, Rosa Elena; Gutiérrez, Santiago; Silva, Roberto Nascimento
2015-12-09
Trichoderma harzianum species are well known as biocontrol agents against important fungal phytopathogens. Mycoparasitism is one of the strategies used by this fungus in the biocontrol process. In this work, we analyzed the effect of Epl-1 protein, previously described as plant resistance elicitor, in expression modulation of T. harzianum genes involved in mycoparasitism process against phytopathogenic fungi; self cell wall protection and recognition; host hyphae coiling and triggering expression of defense-related genes in beans plants. The results indicated that the absence of Epl-1 protein affects the expression of all mycoparasitism genes analyzed in direct confrontation assays against phytopathogen Sclerotinia sclerotiorum as well as T. harzianum itself; the host mycoparasitic coiling process and expression modulation of plant defense genes showing different pattern compared with wild type strain. These data indicated the involvement T. harzianum Epl-1 in self and host interaction and also recognition of T. harzianum as a symbiotic fungus by the bean plants.
Genes under positive selection in a model plant pathogenic fungus, Botrytis.
Aguileta, Gabriela; Lengelle, Juliette; Chiapello, Hélène; Giraud, Tatiana; Viaud, Muriel; Fournier, Elisabeth; Rodolphe, François; Marthey, Sylvain; Ducasse, Aurélie; Gendrault, Annie; Poulain, Julie; Wincker, Patrick; Gout, Lilian
2012-07-01
The rapid evolution of particular genes is essential for the adaptation of pathogens to new hosts and new environments. Powerful methods have been developed for detecting targets of selection in the genome. Here we used divergence data to compare genes among four closely related fungal pathogens adapted to different hosts to elucidate the functions putatively involved in adaptive processes. For this goal, ESTs were sequenced in the specialist fungal pathogens Botrytis tulipae and Botrytis ficariarum, and compared with genome sequences of Botrytis cinerea and Sclerotinia sclerotiorum, responsible for diseases on over 200 plant species. A maximum likelihood-based analysis of 642 predicted orthologs detected 21 genes showing footprints of positive selection. These results were validated by resequencing nine of these genes in additional Botrytis species, showing they have also been rapidly evolving in other related species. Twenty of the 21 genes had not previously been identified as pathogenicity factors in B. cinerea, but some had functions related to plant-fungus interactions. The putative functions were involved in respiratory and energy metabolism, protein and RNA metabolism, signal transduction or virulence, similarly to what was detected in previous studies using the same approach in other pathogens. Mutants of B. cinerea were generated for four of these genes as a first attempt to elucidate their functions. Copyright © 2012 Elsevier B.V. All rights reserved.
A novel gene of Kalanchoe daigremontiana confers plant drought resistance.
Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi
2018-02-07
Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.
The Role of Tomato WRKY Genes in Plant Responses to Combined Abiotic and Biotic Stresses
Directory of Open Access Journals (Sweden)
Yuling Bai
2018-06-01
Full Text Available In the field, plants constantly face a plethora of abiotic and biotic stresses that can impart detrimental effects on plants. In response to multiple stresses, plants can rapidly reprogram their transcriptome through a tightly regulated and highly dynamic regulatory network where WRKY transcription factors can act as activators or repressors. WRKY transcription factors have diverse biological functions in plants, but most notably are key players in plant responses to biotic and abiotic stresses. In tomato there are 83 WRKY genes identified. Here we review recent progress on functions of these tomato WRKY genes and their homologs in other plant species, such as Arabidopsis and rice, with a special focus on their involvement in responses to abiotic and biotic stresses. In particular, we highlight WRKY genes that play a role in plant responses to a combination of abiotic and biotic stresses.
ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance
Directory of Open Access Journals (Sweden)
Yu Agnes
2008-12-01
Full Text Available Abstract Background Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying potential targets for plant breeding. Drought tolerance in the field was successfully conferred to crops by transferring genes from this model species. While involved in a plant genomics programme, which aims to identify new genes responsible for plant response to abiotic stress, we identified ESKIMO1 as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE, which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis of one mutant line and its wild-type background was carried out. Under control watering conditions a number of genes were differentially expressed between the mutant and the wild type whereas under mild drought stress this list of genes was reduced. Among the genes that were differentially expressed between the wild type and mutant, two functional categories related to the response to stress or biotic and abiotic stimulus were over-represented. Under salt stress conditions, all gene functional categories were represented equally in both the mutant and wild type. Based on this transcriptome analysis we hypothesise that in control conditions the esk1 mutant behaves as if it was exposed to drought stress. Conclusion Overall our findings suggest that the
JGI Plant Genomics Gene Annotation Pipeline
Energy Technology Data Exchange (ETDEWEB)
Shu, Shengqiang; Rokhsar, Dan; Goodstein, David; Hayes, David; Mitros, Therese
2014-07-14
Plant genomes vary in size and are highly complex with a high amount of repeats, genome duplication and tandem duplication. Gene encodes a wealth of information useful in studying organism and it is critical to have high quality and stable gene annotation. Thanks to advancement of sequencing technology, many plant species genomes have been sequenced and transcriptomes are also sequenced. To use these vastly large amounts of sequence data to make gene annotation or re-annotation in a timely fashion, an automatic pipeline is needed. JGI plant genomics gene annotation pipeline, called integrated gene call (IGC), is our effort toward this aim with aid of a RNA-seq transcriptome assembly pipeline. It utilizes several gene predictors based on homolog peptides and transcript ORFs. See Methods for detail. Here we present genome annotation of JGI flagship green plants produced by this pipeline plus Arabidopsis and rice except for chlamy which is done by a third party. The genome annotations of these species and others are used in our gene family build pipeline and accessible via JGI Phytozome portal whose URL and front page snapshot are shown below.
A meta-analysis based method for prioritizing candidate genes involved in a pre-specific function
Directory of Open Access Journals (Sweden)
Jingjing Zhai
2016-12-01
Full Text Available The identification of genes associated with a given biological function in plants remains a challenge, although network-based gene prioritization algorithms have been developed for Arabidopsis thaliana and many non-model plant species. Nevertheless, these network-based gene prioritization algorithms have encountered several problems; one in particular is that of unsatisfactory prediction accuracy due to limited network coverage, varying link quality, and/or uncertain network connectivity. Thus a model that integrates complementary biological data may be expected to increase the prediction accuracy of gene prioritization. Towards this goal, we developed a novel gene prioritization method named RafSee, to rank candidate genes using a random forest algorithm that integrates sequence, evolutionary, and epigenetic features of plants. Subsequently, we proposed an integrative approach named RAP (Rank Aggregation-based data fusion for gene Prioritization, in which an order statistics-based meta-analysis was used to aggregate the rank of the network-based gene prioritization method and RafSee, for accurately prioritizing candidate genes involved in a pre-specific biological function. Finally, we showcased the utility of RAP by prioritizing 380 flowering-time genes in Arabidopsis. The ‘leave-one-out’ cross-validation experiment showed that RafSee could work as a complement to a current state-of-art network-based gene prioritization system (AraNet v2. Moreover, RAP ranked 53.68% (204/380 flowering-time genes higher than AraNet v2, resulting in an 39.46% improvement in term of the first quartile rank. Further evaluations also showed that RAP was effective in prioritizing genes-related to different abiotic stresses. To enhance the usability of RAP for Arabidopsis and non-model plant species, an R package implementing the method is freely available at http://bioinfo.nwafu.edu.cn/software.
Directory of Open Access Journals (Sweden)
Qiang Yan
Full Text Available The cytochrome P450 monooxygenases (P450s represent a large and important enzyme superfamily in plants. They catalyze numerous monooxygenation/hydroxylation reactions in biochemical pathways, P450s are involved in a variety of metabolic pathways and participate in the homeostasis of phytohormones. The CYP82 family genes specifically reside in dicots and are usually induced by distinct environmental stresses. However, their functions are largely unknown, especially in soybean (Glycine max L.. Here, we report the function of GmCYP82A3, a gene from soybean CYP82 family. Its expression was induced by Phytophthora sojae infection, salinity and drought stresses, and treatment with methyl jasmonate (MeJA or ethephon (ETH. Its expression levels were consistently high in resistant cultivars. Transgenic Nicotiana benthamiana plants overexpressing GmCYP82A3 exhibited strong resistance to Botrytis cinerea and Phytophthora parasitica, and enhanced tolerance to salinity and drought stresses. Furthermore, transgenic plants were less sensitive to jasmonic acid (JA, and the enhanced resistance was accompanied with increased expression of the JA/ET signaling pathway-related genes.
An in silico analysis of the key genes involved in flavonoid biosynthesis in Citrus sinensis
Directory of Open Access Journals (Sweden)
Adriano R. Lucheta
2007-01-01
Full Text Available Citrus species are known by their high content of phenolic compounds, including a wide range of flavonoids. In plants, these compounds are involved in protection against biotic and abiotic stresses, cell structure, UV protection, attraction of pollinators and seed dispersal. In humans, flavonoid consumption has been related to increasing overall health and fighting some important diseases. The goals of this study were to identify expressed sequence tags (EST in Citrus sinensis (L. Osbeck corresponding to genes involved in general phenylpropanoid biosynthesis and the key genes involved in the main flavonoids pathways (flavanones, flavones, flavonols, leucoanthocyanidins, anthocyanins and isoflavonoids. A thorough analysis of all related putative genes from the Citrus EST (CitEST database revealed several interesting aspects associated to these pathways and brought novel information with promising usefulness for both basic and biotechnological applications.
International Nuclear Information System (INIS)
Deveaux, Yves
1999-01-01
DNA damage, that can be experimentally introduced by ionizing radiation (IR), induces complex signal transduction pathways leading to cell recovery or, alternatively to programmed cell death if damages are too severe. To identify the inducible components of the response to genotoxic stress in plants, we have screened by Differential Display for mRNAs that rapidly and strongly accumulate after IR treatment in A. thaliana cells. We have characterized ATGR1, a new single copy Arabidopsis gene encoding a PEST-box protein of unknown function. In unstressed plant organs the ATGR1 mRNA is hardly detectable, whereas the protein is present in extracts prepared from roots, shoot meristems and inflorescences, that all contain large amounts of actively dividing cells. This pattern is confirmed by immuno localisation on tissue sections that shows constitutive ATGR1 protein expression covering the root elongation zone, the shoot meristem, leaf primordial and the ovules of developing flowers. Histochemical analysis of transgenic plants expressing the GUS reporter gene under the control of the ATGR1 promoter, demonstrate that the developmental and tissue-specific profile of ATGR1 protein expression is conferred by the gene promoter. The massive, transient and dose-dependent accumulation of ATGR1 transcripts after IR treatment observed in all plant organs does not lead to significant changes in ATGR1 protein pattern. Stable ATGR1 protein overexpression, as exemplified by transgenic A. thaliana plants that contain a 35S promoter-ATGR1 gene fusion, does not induce notable changes of the overall ATGR1 protein level, but leads to male and female sterility. The cause of sterility is a lack of correct chromosome assembly and distribution at the stage metaphase II of meiosis. Taken together our results show that i) ATGR1 gene expression is associated to cell division during plant development ii) the ATGR1 protein level is regulated at the transcriptional and post-transcriptional level iii
Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function
Directory of Open Access Journals (Sweden)
Jie Luo
2018-01-01
Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.
Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po
2016-08-01
Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.
Elías, J M; Guerrero-Molina, M F; Martínez-Zamora, M G; Díaz-Ricci, J C; Pedraza, R O
2018-05-01
Induced systemic resistance (ISR) is one of the indirect mechanisms of growth promotion exerted by plant growth-promoting bacteria, and can be mediated by ethylene (ET). We assessed ET production and the expression of related genes in the Azospirillum-strawberry plant interaction. Ethylene production was evaluated by gas chromatography in plants inoculated or not with A. brasilense REC3. Also, plants were treated with AgNO 3 , an inhibitor of ET biosynthesis; with 1-aminocyclopropane-1-carboxylic acid (ACC), a precursor of ET biosynthesis; and with indole acetic acid (IAA). Plant dry biomass and the growth index were determined to assess the growth-promoting effect of A. brasilense REC3 in strawberry plants. Quantitative real time PCR (qRT-PCR) was performed to analyse relative expression of the genes Faetr1, Faers1 and Faein4, which encode ET receptors; Factr1 and Faein2, involved in the ET signalling pathway; Faacs1 encoding ACC synthase; Faaco1 encoding ACC oxidase; and Faaux1 and Faami1 for IAA synthesis enzymes. Results showed that ET acts as a rapid and transient signal in the first 12 h post-treatment. A. brasilense REC3-inoculated plants had a significantly higher growth index compared to control plants. Modulation of the genes Faetr1, Faers1, Faein4, Factr1, Faein2 and Faaco1 indicated activation of ET synthesis and signalling pathways. The up-regulation of Faaux1 and Faami1 involved in IAA synthesis suggested that inoculation with A. brasilense REC3 induces production of this auxin, modulating ET signalling. Ethylene production and up-regulation of genes associated with ET signalling in strawberry plants inoculated with A. brasilense REC3 support the priming activation characteristic of ISR. This type of resistance and the activation of systemic acquired resistance previously observed in this interaction indicate that both are present in strawberry plants, could act synergistically and increase protection against pathogens. © 2018 German Society
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu
2017-10-01
The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.
Hwang, Ok Jin; Back, Kyoungwhan
2018-04-01
Serotonin N-acetyltransferase (SNAT) is the penultimate enzyme in melatonin biosynthesis catalyzing the conversion of serotonin into N-acetylserotonin. In plants, SNAT is encoded by two isogenes of which SNAT1 is constitutively expressed and its overexpression confers increased yield in rice. However, the role of SNAT2 remains to be clarified. In contrast to SNAT1, the diurnal rhythm of SNAT2 mRNA expression peaks at night. In this study, transgenic rice plants in which SNAT2 expression was suppressed by RNAi technology showed a decrease in melatonin and a dwarf phenotype with erect leaves, reminiscent of brassinosteroids (BRs)-deficient mutants. Of note, the dwarf phenotype was dependent on the presence of dark, suggesting that melatonin is involved in dark growth (skotomorphogenesis). In support of this suggestion, SNAT2 RNAi lines exhibited photomorphogenic phenotypes such as inhibition of internodes and increased expression of light-inducible CAB genes in the dark. The causative gene for the melatonin-mediated BRs biosynthetic gene was DWARF4, a rate limiting BRs biosynthetic gene. Exogenous melatonin treatment induced several BRs biosynthetic genes, including DWARF4, D11, and RAVL1. As expected from the erect leaves, the SNAT2 RNAi lines produced less BRs than the wild type. Our results show for the first time that melatonin is a positive regulator of dark growth or shade outgrowth by regulating BR biosynthesis in plants. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Identification and analysis of novel genes involved in gravitropism of Arabidopsis thaliana.
Morita, Miyo T.; Tasaka, Masao; Masatoshi Taniguchi, .
2012-07-01
Gravitropism is a continuous control with regard to the orientation and juxtaposition of the various parts of the plant body in response to gravity. In higher plants, the relative directional change of gravity is mainly suscepted in specialized cells called statocytes, followed by signal conversion from physical information into physiological information within the statocytes. We have studied the early process of shoot gravitropism, gravity sensing and signaling process, mainly by molecular genetic approach. In Arabidopsis shoot, statocytes are the endodermal cells. sgr1/scarcrow (scr) and sgr7/short-root (shr) mutants fail to form the endodermis and to respond to gravity in their inflorescence stems. Since both SGR1/SCR and SGR7/SHR are transcriptional factors, at least a subset of their downstream genes can be expected to be involved in gravitropism. In addition, eal1 (endodermal-amyloplast less 1), which exhibits no gravitropism in inflorescence stem but retains ability to form endodermis, is a hypomorphic allele of sgr7/shr. Take advantage of these mutants, we performed DNA microarray analysis and compared gene expression profiles between wild type and the mutants. We found that approx. 40 genes were commonly down-regulated in these mutants and termed them DGE (DOWN-REGULATED GENE IN EAL1) genes. DGE1 has sequence similarity to Oryza sativa LAZY1 that is involved in shoot gravitropism of rice. DGE2 has a short region homologous to DGE1. DTL (DGE TWO-LIKE}) that has 54% identity to DGE2 is found in Arabidopsis genome. All three genes are conserved in angiosperm but have no known functional domains or motifs. We analyzed T-DNA insertion for these genes in single or multiple combinations. In dge1 dge2 dtl triple mutant, gravitropic response of shoot, hypocotyl and root dramatically reduced. Now we are carrying out further physiological and molecular genetic analysis of the triple mutant.
Modi, Arpan; Kumar, Nitish; Narayanan, Subhash
2016-01-01
Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.
Ethical perception of cross-species gene transfer in plant | Amin ...
African Journals Online (AJOL)
Plants can be genetically modified through a variety of methods in the hope that it will be improved in some way to increase the yield and quality of a crop, or to add nutritional value or shelf life. The development of genetically modified (GM) rice to enrich its nutritional value, such as Vitamin C might involve gene transfer ...
Directory of Open Access Journals (Sweden)
Chunhua eMa
2016-05-01
Full Text Available Background: Platycodon grandiflorum is the only species in the genus Platycodon of the family Campanulaceae, which has been traditionally used as a medicinal plant for its lung-heat-clearing, antitussive, and expectorant properties in China, Japanese and Korean. Oleanane-type triterpenoid saponins were the main chemical components of P. grandiflorum and platycodin D was the abundant and main bioactive component, but little is known about their biosynthesis in plants. Hence, P. grandiflorum is an ideal medicinal plant for studying the biosynthesis of Oleanane-type saponins. In addition, the genomic information of this important herbal plant is unavailable.Principal Findings:A total of 58,580,566 clean reads were obtained, which were assembled into 34,053 unigenes, with an average length of 936 bp and N50 of 1,661 bp by analyzing the transcriptome data of P. grandiflorum. Among these 34,053 unigenes, 22,409 unigenes (65.80% were annotated based on the information available from public databases, including Nr, NCBI, Swiss-Prot, KOG and KEGG. Furthermore, 21 candidate cytochrome P450 genes and 17 candidate UDP-glycosyltransferase genes most likely involved in triterpenoid saponins biosynthesis pathway were discovered from the transcriptome sequencing of P. grandiflorum. In addition, 10,626 SSRs were identified based on the transcriptome data, which would provide abundant candidates of molecular markers for genetic diversity and genetic map for this medicinal plant.Conclusion:The genomic data obtained from P. grandiflorum, especially the identification of putative genes involved in triterpenoid saponins biosynthesis pathway, will facilitate our understanding of the biosynthesis of triterpenoid saponins at molecular level.
Directory of Open Access Journals (Sweden)
Behrooz eDarbani
2016-06-01
Full Text Available RNA circularization made by head-to-tail back-splicing events is involved in the regulation of gene expression from transcriptional to post-translational levels. By exploiting RNA-Seq data and down-stream analysis, we shed light on the importance of circular RNAs in plants. The results introduce circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes including protein coding transcripts, microRNA, rRNA, and long non-coding/microprotein coding RNAs. The results shed light on the mitochondrial exonic circular RNAs and imply the importance of circular RNAs for regulation of mitochondrial genes. Importantly, we introduce circular RNAs in barley and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs' functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear transcripts.Keywords: circular RNAs, coding and non-coding transcripts, leaves, seeds, transfer cells, micronutrients, mitochondria
Directory of Open Access Journals (Sweden)
Marek eMutwil
2014-08-01
Full Text Available The analysis of gene expression data has shown that transcriptionally coordinated (co-expressed genes are often functionally related, enabling scientists to use expression data in gene function prediction. This Focused Review discusses our original paper (Large-scale co-expression approach to dissect secondary cell wall formation across plant species, Frontiers in Plant Science 2:23. In this paper we applied cross-species analysis to co-expression networks of genes involved in cellulose biosynthesis. We show that the co-expression networks from different species are highly similar, indicating that whole biological pathways are conserved across species. This finding has two important implications. First, the analysis can transfer gene function annotation from well-studied plants, such as Arabidopsis, to other, uncharacterized plant species. As the analysis finds genes that have similar sequence and similar expression pattern across different organisms, functionally equivalent genes can be identified. Second, since co-expression analyses are often noisy, a comparative analysis should have higher performance, as parts of co-expression networks that are conserved are more likely to be functionally relevant. In this Focused Review, we outline the comparative analysis done in the original paper and comment on the recent advances and approaches that allow comparative analyses of co-function networks. We hypothesize that, in comparison to simple co-expression analysis, comparative analysis would yield more accurate gene function predictions. Finally, by combining comparative analysis with genomic information of green plants, we propose a possible composition of cellulose biosynthesis machinery during earlier stages of plant evolution.
Hwang, Hwan-Su; Lee, Hyoshin; Choi, Yong Eui
2015-03-14
Eleutherococcus senticosus, Siberian ginseng, is a highly valued woody medicinal plant belonging to the family Araliaceae. E. senticosus produces a rich variety of saponins such as oleanane-type, noroleanane-type, 29-hydroxyoleanan-type, and lupane-type saponins. Genomic or transcriptomic approaches have not been used to investigate the saponin biosynthetic pathway in this plant. In this study, de novo sequencing was performed to select candidate genes involved in the saponin biosynthetic pathway. A half-plate 454 pyrosequencing run produced 627,923 high-quality reads with an average sequence length of 422 bases. De novo assembly generated 72,811 unique sequences, including 15,217 contigs and 57,594 singletons. Approximately 48,300 (66.3%) unique sequences were annotated using BLAST similarity searches. All of the mevalonate pathway genes for saponin biosynthesis starting from acetyl-CoA were isolated. Moreover, 206 reads of cytochrome P450 (CYP) and 145 reads of uridine diphosphate glycosyltransferase (UGT) sequences were isolated. Based on methyl jasmonate (MeJA) treatment and real-time PCR (qPCR) analysis, 3 CYPs and 3 UGTs were finally selected as candidate genes involved in the saponin biosynthetic pathway. The identified sequences associated with saponin biosynthesis will facilitate the study of the functional genomics of saponin biosynthesis and genetic engineering of E. senticosus.
Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R
2014-11-01
Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. © 2014 American Society of Plant Biologists. All Rights Reserved.
Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong
2017-12-01
SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.
Dal Santo, Silvia; Fasoli, Marianna; Cavallini, Erika; Tornielli, Giovanni Battista; Pezzotti, Mario; Zenoni, Sara
2011-12-01
Expansins are wall-loosening proteins that induce wall stress relaxation and irreversible wall extension in a pH-dependent manner. Despite a substantial body of work has been performed on the characterization of many expansins genes in different plant species, the knowledge about their precise biological roles during plant development remains scarce. To yield insights into the expansion process in Petunia hybrida, PhEXPA1, an expansin gene preferentially expressed in petal limb, has been characterized. The constitutive overexpression of PhEXPA1 significantly increased expansin activity, cells size and organ dimensions. Moreover, 35S::PhEXPA1 transgenic plants exhibited an altered cell wall polymer composition and a precocious timing of axillary meristem development compared with wild-type plants. These findings supported a previous hypothesis that expansins are not merely structural proteins involved in plant cell wall metabolism but they also take part in many plant development processes. Here, to support this expansins dual role, we discuss about differential cell wall-related genes expressed in PhEXPA1 expression mutants and gradients of altered petunia branching pattern. © 2011 Landes Bioscience
Environmental control of plant nuclear gene expression by chloroplast redox signals
Directory of Open Access Journals (Sweden)
Jeannette ePfalz
2012-11-01
Full Text Available Plant photosynthesis takes place in specialised cell organelles, the chloroplasts, which perform all essential steps of this process. The proteins involved in photosynthesis are encoded by genes located on the plastid and nuclear genomes. Proper function and regulation of light harvesting and energy fixation thus requires a tight coordination of the gene expression machineries in the two genetic compartments. This is achieved by a bi-directional exchange of information between nucleus and plastids. Signals emerging from plastids report the functional and developmental state of the organelle to the nucleus and initiate distinct nuclear gene expression profiles, which trigger responses that support or improve plastid functions. Recent research indicated that this signalling is absolutely essential for plant growth and development. Reduction/oxidation (redox signals from photosynthesis are key players in this information network since they do report functional disturbances in photosynthesis, the primary energy source of plants. Such disturbances are caused by environmental fluctuations for instance in illumination, temperature or water availability. These environmental changes affect the linear electron flow of photosynthesis and result in changes of the redox state of the components involved (e.g. the plastoquinone pool or coupled to it (e.g. the thioredoxin pool. Thus, the changes in redox state directly reflect the environmental impact and serve as immediate plastidial signals to the nucleus. The triggered responses range from counterbalancing reactions within the physiological range up to severe stress responses including cell death. This review focuses on physiological redox signals from photosynthetic electron transport, their relation to the environment, potential transduction pathways to the nucleus and their impact on nuclear gene expression.
Richards, Thomas A; Soanes, Darren M; Foster, Peter G; Leonard, Guy; Thornton, Christopher R; Talbot, Nicholas J
2009-07-01
Horizontal gene transfer (HGT) describes the transmission of genetic material across species boundaries and is an important evolutionary phenomenon in the ancestry of many microbes. The role of HGT in plant evolutionary history is, however, largely unexplored. Here, we compare the genomes of six plant species with those of 159 prokaryotic and eukaryotic species and identify 1689 genes that show the highest similarity to corresponding genes from fungi. We constructed a phylogeny for all 1689 genes identified and all homolog groups available from the rice (Oryza sativa) genome (3177 gene families) and used these to define 14 candidate plant-fungi HGT events. Comprehensive phylogenetic analyses of these 14 data sets, using methods that account for site rate heterogeneity, demonstrated support for nine HGT events, demonstrating an infrequent pattern of HGT between plants and fungi. Five HGTs were fungi-to-plant transfers and four were plant-to-fungi HGTs. None of the fungal-to-plant HGTs involved angiosperm recipients. These results alter the current view of organismal barriers to HGT, suggesting that phagotrophy, the consumption of a whole cell by another, is not necessarily a prerequisite for HGT between eukaryotes. Putative functional annotation of the HGT candidate genes suggests that two fungi-to-plant transfers have added phenotypes important for life in a soil environment. Our study suggests that genetic exchange between plants and fungi is exceedingly rare, particularly among the angiosperms, but has occurred during their evolutionary history and added important metabolic traits to plant lineages.
Plant gene technology: social considerations
African Journals Online (AJOL)
Administrator
The genetic modification of plants by gene technology is of immense potential benefits, but there may be possible risks. ... As a new endeavour, however, people have a mixed ... reality by gene biotechnology (Watson, 1997). Industrial ...
Apolipoprotein gene involved in lipid metabolism
Rubin, Edward; Pennacchio, Len A.
2007-07-03
Methods and materials for studying the effects of a newly identified human gene, APOAV, and the corresponding mouse gene apoAV. The sequences of the genes are given, and transgenic animals which either contain the gene or have the endogenous gene knocked out are described. In addition, single nucleotide polymorphisms (SNPs) in the gene are described and characterized. It is demonstrated that certain SNPs are associated with diseases involving lipids and triglycerides and other metabolic diseases. These SNPs may be used alone or with SNPs from other genes to study individual risk factors. Methods for intervention in lipid diseases, including the screening of drugs to treat lipid-related or diabetic diseases are also disclosed.
Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción
2015-10-24
NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.
Diversification of Root Hair Development Genes in Vascular Plants.
Huang, Ling; Shi, Xinhui; Wang, Wenjia; Ryu, Kook Hui; Schiefelbein, John
2017-07-01
The molecular genetic program for root hair development has been studied intensively in Arabidopsis ( Arabidopsis thaliana ). To understand the extent to which this program might operate in other plants, we conducted a large-scale comparative analysis of root hair development genes from diverse vascular plants, including eudicots, monocots, and a lycophyte. Combining phylogenetics and transcriptomics, we discovered conservation of a core set of root hair genes across all vascular plants, which may derive from an ancient program for unidirectional cell growth coopted for root hair development during vascular plant evolution. Interestingly, we also discovered preferential diversification in the structure and expression of root hair development genes, relative to other root hair- and root-expressed genes, among these species. These differences enabled the definition of sets of genes and gene functions that were acquired or lost in specific lineages during vascular plant evolution. In particular, we found substantial divergence in the structure and expression of genes used for root hair patterning, suggesting that the Arabidopsis transcriptional regulatory mechanism is not shared by other species. To our knowledge, this study provides the first comprehensive view of gene expression in a single plant cell type across multiple species. © 2017 American Society of Plant Biologists. All Rights Reserved.
DEFF Research Database (Denmark)
Makarova, Olga; MacLean, Allyson M.; Nicolaisen, Mogens
2015-01-01
a role in host adaptation. 74 genes were up-regulated in insects and included genes involved in stress response, phospholipid synthesis, malate and pyruvate metabolism, hemolysin and transporter genes, multiple copies of thymidylate kinase, sigma factor and Zn-proteases genes. In plants, 34 genes...... encoding an immune dominant membrane protein, membrane-associated proteins, and multidrug resistance ABC-type transporters, were up-regulated. Differential regulation of gene expression thus appears to play an important role in host adaptation of phytoplasmas....
Role of microRNAs involved in plant response to nitrogen and phosphorous limiting conditions.
Nguyen, Giao N; Rothstein, Steven J; Spangenberg, German; Kant, Surya
2015-01-01
Plant microRNAs (miRNAs) are a class of small non-coding RNAs which target and regulate the expression of genes involved in several growth, development, and metabolism processes. Recent researches have shown involvement of miRNAs in the regulation of uptake and utilization of nitrogen (N) and phosphorus (P) and more importantly for plant adaptation to N and P limitation conditions by modifications in plant growth, phenology, and architecture and production of secondary metabolites. Developing strategies that allow for the higher efficiency of using both N and P fertilizers in crop production is important for economic and environmental benefits. Improved crop varieties with better adaptation to N and P limiting conditions could be a key approach to achieve this effectively. Furthermore, understanding on the interactions between N and P uptake and use and their regulation is important for the maintenance of nutrient homeostasis in plants. This review describes the possible functions of different miRNAs and their cross-talk relevant to the plant adaptive responses to N and P limiting conditions. In addition, a comprehensive understanding of these processes at molecular level and importance of biological adaptation for improved N and P use efficiency is discussed.
International Nuclear Information System (INIS)
Mufti, F.U.D.; Banaras, S.
2015-01-01
Internal control genes are the constitutive genes which maintain the basic cellular functions and regularly express in both normal and stressed conditions in living organisms. They are used in normalization of gene expression studies in comparative analysis of target genes, as their expression remains comparatively unchanged in all varied conditions. Among internal control genes, actin is considered as a candidate gene for expression studies due to its vital role in shaping cytoskeleton and plant physiology. Unfortunately most of such knowledge is limited to only model plants or crops, not much is known about important medicinal plants. Therefore, we selected seven important medicinal wild plants for molecular identification of actin gene. We used gene specific primers designed from the conserved regions of several known orthologues or homologues of actin genes from other plants. The amplified products of 370-380 bp were sequenced and submitted to GeneBank after their confirmation using different bioinformatics tools. All the novel partial sequences of putative actin genes were submitted to GeneBank (Parthenium hysterophorus (KJ774023), Fagonia indica (KJ774024), Rhazya stricta (KJ774025), Whithania coagulans (KJ774026), Capparis decidua (KJ774027), Verbena officinalis (KJ774028) and Aerva javanica (KJ774029)). The comparisons of these partial sequences by Basic Local Alignment Search Tool (BLAST) and phylogenetic trees demonstrated high similarity with known actin genes of other plants. Our findings illustrated highly conserved nature of actin gene among these selected plants. These novel partial fragments of actin genes from these wild medicinal plants can be used as internal controls for future gene expression studies of these important plants after precise validations of their stable expression in such plants. (author)
Identification of Bradyrhizobium elkanii Genes Involved in Incompatibility with Vigna radiata
Directory of Open Access Journals (Sweden)
Hien P. Nguyen
2017-12-01
Full Text Available The establishment of a root nodule symbiosis between a leguminous plant and a rhizobium requires complex molecular interactions between the two partners. Compatible interactions lead to the formation of nitrogen-fixing nodules, however, some legumes exhibit incompatibility with specific rhizobial strains and restrict nodulation by the strains. Bradyrhizobium elkanii USDA61 is incompatible with mung bean (Vigna radiata cv. KPS1 and soybean cultivars carrying the Rj4 allele. Here, we explored genetic loci in USDA61 that determine incompatibility with V. radiata KPS1. We identified five novel B. elkanii genes that contribute to this incompatibility. Four of these genes also control incompatibility with soybean cultivars carrying the Rj4 allele, suggesting that a common mechanism underlies nodulation restriction in both legumes. The fifth gene encodes a hypothetical protein that contains a tts box in its promoter region. The tts box is conserved in genes encoding the type III secretion system (T3SS, which is known for its delivery of virulence effectors by pathogenic bacteria. These findings revealed both common and unique genes that are involved in the incompatibility of B. elkanii with mung bean and soybean. Of particular interest is the novel T3SS-related gene, which causes incompatibility specifically with mung bean cv. KPS1.
Differentially expressed genes in healthy and plum pox virus-infected Nicotiana benthamiana plants.
Vozárová, Z; Žilová, M; Šubr, Z
2015-12-01
Viruses use both material and energy sources of their hosts and redirect the production of disposable compounds in order to make viral replication more efficient. Metabolism of infected organisms is modified by these enhanced requirements as well by their own defense response. Resulting complex story consists of many regulation events on various gene expression levels. Elucidating these processes may contribute to the knowledge on virus-host interactions and to evolving new antiviral strategies. In our work we applied a subtractive cloning technique to compare the transcriptomes of healthy and plum pox virus (PPV)-infected Nicotiana benthamiana plants. Several genes were found to be induced or repressed by the PPV infection. The induced genes were mainly related to general stress response or photosynthesis, several repressed genes could be connected with growth defects evoked by the infection. Interestingly, some genes usually up-regulated by fungal or bacterial infection were found repressed in PPV-infected plants. Potential involvement of particular differently expressed genes in the process of PPV infection is discussed.
DEFF Research Database (Denmark)
Shirvanehdeh, Behrooz Darbani; Noeparvar, Shahin; Borg, Søren
2016-01-01
circular RNAs as novel interactors in the regulation of gene expression in plants and imply the comprehensiveness of this regulatory pathway by identifying circular RNAs for a diverse set of genes. These genes are involved in several aspects of cellular metabolism as hormonal signaling, intracellular...... protein sorting, carbohydrate metabolism and cell-wall biogenesis, respiration, amino acid biosynthesis, transcription and translation, and protein ubiquitination. Additionally, these parental loci of circular RNAs, from both nuclear and mitochondrial genomes, encode for different transcript classes...... and elucidate their cellular-level alterations across tissues and in response to micronutrients iron and zinc. In further support of circular RNAs’ functional roles in plants, we report several cases where fluctuations of circRNAs do not correlate with the levels of their parental-loci encoded linear...
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Directory of Open Access Journals (Sweden)
Huang Hsien-Da
2008-11-01
Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.
Cadmium resistance in tobacco plants expressing the MuSI gene.
Kim, Young-Nam; Kim, Ji-Seoung; Seo, Sang-Gyu; Lee, Youngwoo; Baek, Seung-Woo; Kim, Il-Sup; Yoon, Ho-Sung; Kim, Kwon-Rae; Kim, Sun-Hyung; Kim, Kye-Hoon
2011-10-01
MuSI, a gene that corresponds to a domain that contains the rubber elongation factor (REF), is highly homologous to many stress-related proteins in plants. Since MuSI is up-regulated in the roots of plants treated with cadmium or copper, the involvement of MuSI in cadmium tolerance was investigated in this study. Escherichia coli cells overexpressing MuSI were more resistant to Cd than wild-type cells transfected with vector alone. MuSI transgenic plants were also more resistant to Cd. MuSI transgenic tobacco plants absorbed less Cd than wild-type plants. Cd translocation from roots to shoots was reduced in the transgenic plants, thereby avoiding Cd toxicity. The number of short trichomes in the leaves of wild-type tobacco plants was increased by Cd treatment, while this was unchanged in MuSI transgenic tobacco. These results suggest that MuSI transgenic tobacco plants have enhanced tolerance to Cd via reduced Cd uptake and/or increased Cd immobilization in the roots, resulting in less Cd translocation to the shoots.
Liu, Jianfeng; Ming, Yuetong; Cheng, Yunqing; Zhang, Yuchu; Xing, Jiyang; Sun, Yuqi
2017-01-01
Raspberries ( Rubus spp.) exhibit a unique rooting process that is initiated from the stem apex of primocane, conferring an unusual asexual mode of reproduction to this plant. However, the full complement of genes involved in this process has not been identified. To this end, the present study analyzed the transcriptomes of the Rubus primocane and floricane stem apex at three developmental stages by Digital Gene Expression profiling to identify genes that regulate rooting. Sequencing and de novo assembly yielded 26.82 Gb of nucleotides and 59,173 unigenes; 498, 7,346, 4,110, 7,900, 9,397, and 4,776 differently expressed genes were identified in paired comparisons of SAF1 (floricane at developmental stage 1) vs. SAP1 (primocane at developmental stage 1), SAF2 vs. SAP2, SAF3 vs. SAP3, SAP1 vs. SAP2, SAP1 vs. SAP3, and SAP2 vs. SAP3, respectively. SAP1 maintains an extension growth pattern; SAP2 then exhibits growth arrest and vertical (downward) gravitropic deflection; and finally, short roots begin to form on the apex of SAP3. The Kyoto Encyclopedia of Genes and Genomes enrichment analysis of SAP1 vs. SAP2 revealed 12 pathways that were activated in response to shoot growth arrest and root differentiation, including circadian rhythm-plant (ko04712) and plant hormone signal transduction (ko04075). Our results indicate that genes related to circadian rhythm, ethylene and auxin signaling, shoot growth, and root development are potentially involved in the regulation of primocane apex rooting in Rubus . These findings provide a basis for elucidating the molecular mechanisms of primocane apex rooting in this economically valuable crop.
Alencar, Valquíria Campos; Jabes, Daniela Leite; Menegidio, Fabiano Bezerra; Sassaki, Guilherme Lanzi; de Souza, Lucas Rodrigo; Puzer, Luciano; Meneghetti, Maria Cecília Zorél; Lima, Marcelo Andrade; Tersariol, Ivarne Luis Dos Santos; de Oliveira, Regina Costa; Nunes, Luiz R
2017-02-07
Xylella fastidiosa is a plant-infecting bacillus, responsible for many important crop diseases, such as Pierce's disease of vineyards, citrus variegated chlorosis, and coffee leaf scorch (CLS), among others. Recent genomic comparisons involving two CLS-related strains, belonging to X. fastidiosa subsp. pauca, revealed that one of them carries a frameshift mutation that inactivates a gene encoding an oxidoreductase of the short-chain dehydrogenase/reductase (SDR) superfamily, which may play important roles in determining structural variations in bacterial glycans and glycoconjugates. However, the exact nature of this SDR has been a matter of controversy, as different annotations of X. fastidiosa genomes have implicated it in distinct reactions. To confirm the nature of this mutated SDR, a comparative analysis was initially performed, suggesting that it belongs to a subgroup of SDR decarboxylases, representing a UDP-xylose synthase (Uxs). Functional assays, using a recombinant derivative of this enzyme, confirmed its nature as XfUxs, and carbohydrate composition analyses, performed with lipopolysaccharide (LPS) molecules obtained from different strains, indicate that inactivation of the X. fastidiosa uxs gene affects the LPS structure among CLS-related X. fastidiosa strains. Finally, a comparative sequence analysis suggests that this mutation is likely to result in a morphological and evolutionary hallmark that differentiates two subgroups of CLS-related strains, which may influence interactions between these bacteria and their plant and/or insect hosts.
Transfer of engineered genes from crop to wild plants
DEFF Research Database (Denmark)
Bagger Jørgensen, Rikke; Hauser, T.P.; Mikkelsen, T.R.
1996-01-01
The escape of engineered genes - genes inserted using recombinant DNA techniques - from cultivated plants to wild or weedy relatives has raised concern about possible risks to the environment or to health. The media have added considerably to public concern by suggesting that such gene escape...... is a new and rather unexpected phenomenon. However, transfer of engineered genes between plants is not at-all surprising, because it is mediated by exactly the same mechanisms as those responsible for transferring endogenous plant genes: it takes place by sexual crosses, with pollen as the carrier...
DUF581 is plant specific FCS-like zinc finger involved in protein-protein interaction.
Directory of Open Access Journals (Sweden)
Muhammed Jamsheer K
Full Text Available Zinc fingers are a ubiquitous class of protein domain with considerable variation in structure and function. Zf-FCS is a highly diverged group of C2-C2 zinc finger which is present in animals, prokaryotes and viruses, but not in plants. In this study we identified that a plant specific domain of unknown function, DUF581 is a zf-FCS type zinc finger. Based on HMM-HMM comparison and signature motif similarity we named this domain as FCS-Like Zinc finger (FLZ domain. A genome wide survey identified that FLZ domain containing genes are bryophytic in origin and this gene family is expanded in spermatophytes. Expression analysis of selected FLZ gene family members of A. thaliana identified an overlapping expression pattern suggesting a possible redundancy in their function. Unlike the zf-FCS domain, the FLZ domain found to be highly conserved in sequence and structure. Using a combination of bioinformatic and protein-protein interaction tools, we identified that FLZ domain is involved in protein-protein interaction.
Plant Core Environmental Stress Response Genes Are Systemically Coordinated during Abiotic Stresses
Directory of Open Access Journals (Sweden)
Kenneth W. Berendzen
2013-04-01
Full Text Available Studying plant stress responses is an important issue in a world threatened by global warming. Unfortunately, comparative analyses are hampered by varying experimental setups. In contrast, the AtGenExpress abiotic stress experiment displays intercomparability. Importantly, six of the nine stresses (wounding, genotoxic, oxidative, UV-B light, osmotic and salt can be examined for their capacity to generate systemic signals between the shoot and root, which might be essential to regain homeostasis in Arabidopsis thaliana. We classified the systemic responses into two groups: genes that are regulated in the non-treated tissue only are defined as type I responsive and, accordingly, genes that react in both tissues are termed type II responsive. Analysis of type I and II systemic responses suggest distinct functionalities, but also significant overlap between different stresses. Comparison with salicylic acid (SA and methyl-jasmonate (MeJA responsive genes implies that MeJA is involved in the systemic stress response. Certain genes are predominantly responding in only one of the categories, e.g., WRKY genes respond mainly non-systemically. Instead, genes of the plant core environmental stress response (PCESR, e.g., ZAT10, ZAT12, ERD9 or MES9, are part of different response types. Moreover, several PCESR genes switch between the categories in a stress-specific manner.
Reverón, Inés; Jiménez, Natalia; Curiel, José Antonio; Peñas, Elena; López de Felipe, Félix; de Las Rivas, Blanca; Muñoz, Rosario
2017-04-01
Lactobacillus plantarum is a lactic acid bacterium that can degrade food tannins by the successive action of tannase and gallate decarboxylase enzymes. In the L. plantarum genome, the gene encoding the catalytic subunit of gallate decarboxylase ( lpdC , or lp_2945 ) is only 6.5 kb distant from the gene encoding inducible tannase ( L. plantarum tanB [ tanB Lp ], or lp_2956 ). This genomic context suggests concomitant activity and regulation of both enzymatic activities. Reverse transcription analysis revealed that subunits B ( lpdB , or lp_0271 ) and D ( lpdD , or lp_0272 ) of the gallate decarboxylase are cotranscribed, whereas subunit C ( lpdC , or lp_2945 ) is cotranscribed with a gene encoding a transport protein ( gacP , or lp_2943 ). In contrast, the tannase gene is transcribed as a monocistronic mRNA. Investigation of knockout mutations of genes located in this chromosomal region indicated that only mutants of the gallate decarboxylase (subunits B and C), tannase, GacP transport protein, and TanR transcriptional regulator ( lp_2942 ) genes exhibited altered tannin metabolism. The expression profile of genes involved in tannin metabolism was also analyzed in these mutants in the presence of methyl gallate and gallic acid. It is noteworthy that inactivation of tanR suppresses the induction of all genes overexpressed in the presence of methyl gallate and gallic acid. This transcriptional regulator was also induced in the presence of other phenolic compounds, such as kaempferol and myricetin. This study complements the catalog of L. plantarum expression profiles responsive to phenolic compounds, which enable this bacterium to adapt to a plant food environment. IMPORTANCE Lactobacillus plantarum is a bacterial species frequently found in the fermentation of vegetables when tannins are present. L. plantarum strains degrade tannins to the less-toxic pyrogallol by the successive action of tannase and gallate decarboxylase enzymes. The genes encoding these enzymes are
A contribution to the study of plant development evolution based on gene co-expression networks
Directory of Open Access Journals (Sweden)
Francisco J. Romero-Campero
2013-08-01
Full Text Available Phototrophic eukaryotes are among the most successful organisms on Earth due to their unparalleled efficiency at capturing light energy and fixing carbon dioxide to produce organic molecules. A conserved and efficient network of light-dependent regulatory modules could be at the bases of this success. This regulatory system conferred early advantages to phototrophic eukaryotes that allowed for specialization, complex developmental processes and modern plant characteristics. We have studied light-dependent gene regulatory modules from algae to plants employing integrative-omics approaches based on gene co-expression networks. Our study reveals some remarkably conserved ways in which eukaryotic phototrophs deal with day length and light signaling. Here we describe how a family of Arabidopsis transcription factors involved in photoperiod response has evolved from a single algal gene according to the innovation, amplification and divergence theory of gene evolution by duplication. These modifications of the gene co-expression networks from the ancient unicellular green algae Chlamydomonas reinhardtii to the modern brassica Arabidopsis thaliana may hint on the evolution and specialization of plants and other organisms.
Expression of streptavidin gene in bacteria and plants
International Nuclear Information System (INIS)
Guan, Xueni; Wurtele, E.S.; Nikolau, B.J.
1990-01-01
Six biotin-containing proteins are present in plants, representing at least four different biotin enzymes. The physiological function of these biotin enzymes is not understood. Streptavidin, a protein from Streptomyces avidinii, binds tightly and specifically to biotin causing inactivation of biotin enzymes. One approach to elucidating the physiological function of biotin enzymes in plant metabolism is to create transgenic plants expressing the streptavidin gene. A plasmid containing a fused streptavidin-beta-galactosidase gene has been expressed in E. coli. We also have constructed various fusion genes that include an altered CaMV 35S promoter, signal peptides to target the streptavidin protein to specific organelles, and the streptavidin coding gene. We are examining the expression of these genes in cells of carrot
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Yang, Xiaozhen; Li, Hao; Yang, Yongchao; Wang, Yongqi; Mo, Yanling; Zhang, Ruimin; Zhang, Yong; Ma, Jianxiang; Wei, Chunhua; Zhang, Xian
2018-01-01
Despite identification of WRKY family genes in numerous plant species, a little is known about WRKY genes in watermelon, one of the most economically important fruit crops around the world. Here, we identified a total of 63 putative WRKY genes in watermelon and classified them into three major groups (I-III) and five subgroups (IIa-IIe) in group II. The structure analysis indicated that ClWRKYs with different WRKY domains or motifs may play different roles by regulating respective target genes. The expressions of ClWRKYs in different tissues indicate that they are involved in various tissue growth and development. Furthermore, the diverse responses of ClWRKYs to drought, salt, or cold stress suggest that they positively or negatively affect plant tolerance to various abiotic stresses. In addition, the altered expression patterns of ClWRKYs in response to phytohormones such as, ABA, SA, MeJA, and ETH, imply the occurrence of complex cross-talks between ClWRKYs and plant hormone signals in regulating plant physiological and biological processes. Taken together, our findings provide valuable clues to further explore the function and regulatory mechanisms of ClWRKY genes in watermelon growth, development, and adaption to environmental stresses.
Directory of Open Access Journals (Sweden)
Xiaozhen Yang
Full Text Available Despite identification of WRKY family genes in numerous plant species, a little is known about WRKY genes in watermelon, one of the most economically important fruit crops around the world. Here, we identified a total of 63 putative WRKY genes in watermelon and classified them into three major groups (I-III and five subgroups (IIa-IIe in group II. The structure analysis indicated that ClWRKYs with different WRKY domains or motifs may play different roles by regulating respective target genes. The expressions of ClWRKYs in different tissues indicate that they are involved in various tissue growth and development. Furthermore, the diverse responses of ClWRKYs to drought, salt, or cold stress suggest that they positively or negatively affect plant tolerance to various abiotic stresses. In addition, the altered expression patterns of ClWRKYs in response to phytohormones such as, ABA, SA, MeJA, and ETH, imply the occurrence of complex cross-talks between ClWRKYs and plant hormone signals in regulating plant physiological and biological processes. Taken together, our findings provide valuable clues to further explore the function and regulatory mechanisms of ClWRKY genes in watermelon growth, development, and adaption to environmental stresses.
Emerging use of gene expression microarrays in plant physiology.
Wullschleger, Stan D; Difazio, Stephen P
2003-01-01
Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.
Gene expression from plants grown on the International Space Station
Stimpson, Alexander; Pereira, Rhea; Kiss, John Z.; Correll, Melanie
Three experiments were performed on the International Space Station (ISS) in 2006 as part of the TROPI experiments. These experiments were performed to study graviTROPIsm and photoTROPIsm responses of Arabidopsis in microgravity (µg). Seedlings were grown with a variety of light and gravitational treatments for approximately five days. The frozen samples were returned to Earth during three space shuttle missions in 2007 and stored at -80° C. Due to the limited amount of plant biomass returned, new protocols were developed to minimize the amount of material needed for RNA extraction as a preparation for microarray analysis. Using these new protocols, RNA was extracted from several sets of seedlings grown in red light followed by blue light with one sample from 1.0g treatment and the other at µg. Using a 2-fold change criterion, microarray (Affymetrix, GeneChip) results showed that 613 genes were upregulated in the µg sample while 757 genes were downregulated. Upregulated genes in response to µg included transcription factors from the WRKY (15 genes), MYB (3) and ZF (8) families as well as those that are involved in auxin responses (10). Downregulated genes also included transcription factors such as MYB (5) and Zinc finger (10) but interestingly only two WRKY family genes were down-regulated during the µg treatment. Studies are underway to compare these results with other samples to identify the genes involved in the gravity and light signal transduction pathways (this project is Supported By: NASA NCC2-1200).
Directory of Open Access Journals (Sweden)
Ana Belén Sánchez-García
Full Text Available Understanding the functional basis of auxin homeostasis requires knowledge about auxin biosynthesis, auxin transport and auxin catabolism genes, which is not always directly available despite the recent whole-genome sequencing of many plant species. Through sequence homology searches and phylogenetic analyses on a selection of 11 plant species with high-quality genome annotation, we identified the putative gene homologs involved in auxin biosynthesis, auxin catabolism and auxin transport pathways in carnation (Dianthus caryophyllus L.. To deepen our knowledge of the regulatory events underlying auxin-mediated adventitious root formation in carnation stem cuttings, we used RNA-sequencing data to confirm the expression profiles of some auxin homeostasis genes during the rooting of two carnation cultivars with different rooting behaviors. We also confirmed the presence of several auxin-related metabolites in the stem cutting tissues. Our findings offer a comprehensive overview of auxin homeostasis genes in carnation and provide a solid foundation for further experiments investigating the role of auxin homeostasis in the regulation of adventitious root formation in carnation.
Christinet, Laurent; Burdet, Frédéric X.; Zaiko, Maïa; Hinz, Ursula; Zrÿd, Jean-Pierre
2004-01-01
Betalains are pigments that replace anthocyanins in the majority of families of the plant order Caryophyllales. Betalamic acid is the common chromophore of betalains. The key enzyme of the betalain biosynthetic pathway is an extradiol dioxygenase that opens the cyclic ring of dihydroxy-phenylalanine (DOPA) between carbons 4 and 5, thus producing an unstable seco-DOPA that rearranges nonenzymatically to betalamic acid. A gene for a 4,5-DOPA-dioxygenase has already been isolated from the fungus Amanita muscaria, but no homolog was ever found in plants. To identify the plant gene, we constructed subtractive libraries between different colored phenotypes of isogenic lines of Portulaca grandiflora (Portulacaceae) and between different stages of flower bud formation. Using in silico analysis of differentially expressed cDNAs, we identified a candidate showing strong homology at the level of translated protein with the LigB domain present in several bacterial extradiol 4,5-dioxygenases. The gene was expressed only in colored flower petals. The function of this gene in the betalain biosynthetic pathway was confirmed by biolistic genetic complementation in white petals of P. grandiflora genotypes lacking the gene for color formation. This gene named DODA is the first characterized member of a novel family of plant dioxygenases phylogenetically distinct from Amanita sp. DOPA-dioxygenase. Homologs of DODA are present not only in betalain-producing plants but also, albeit with some changes near the catalytic site, in other angiosperms and in the bryophyte Physcomitrella patens. These homologs are part of a novel conserved plant gene family probably involved in aromatic compound metabolism. PMID:14730069
Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa
2016-10-01
Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.
Exploring genes and pathways involved in migraine
Eising, E.
2017-01-01
The research in this thesis was aimed at identifying genes and molecular pathways involved in migraine. To this end, two gene expression analyses were performed in brain tissue obtained from transgenic mouse models for familial hemiplegic migraine (FHM), a monogenic subtype of migraine with aura.
Using a periclinal chimera to unravel layer-specific gene expression in plants.
Filippis, Ioannis; Lopez-Cobollo, Rosa; Abbott, James; Butcher, Sarah; Bishop, Gerard J
2013-09-01
Plant organs are made from multiple cell types, and defining the expression level of a gene in any one cell or group of cells from a complex mixture is difficult. Dicotyledonous plants normally have three distinct layers of cells, L1, L2 and L3. Layer L1 is the single layer of cells making up the epidermis, layer L2 the single cell sub-epidermal layer and layer L3 constitutes the rest of the internal cells. Here we show how it is possible to harvest an organ and characterise the level of layer-specific expression by using a periclinal chimera that has its L1 layer from Solanum pennellii and its L2 and L3 layers from Solanum lycopersicum. This is possible by measuring the level of the frequency of species-specific transcripts. RNA-seq analysis enabled the genome-wide assessment of whether a gene is expressed in the L1 or L2/L3 layers. From 13 277 genes that are expressed in both the chimera and the parental lines and with at least one polymorphism between the parental alleles, we identified 382 genes that are preferentially expressed in L1 in contrast to 1159 genes in L2/L3. Gene ontology analysis shows that many genes preferentially expressed in L1 are involved in cutin and wax biosynthesis, whereas numerous genes that are preferentially expressed in L2/L3 tissue are associated with chloroplastic processes. These data indicate the use of such chimeras and provide detailed information on the level of layer-specific expression of genes. © 2013 East Malling Research The Plant Journal © 2013 John Wiley & Sons Ltd.
Yu, Xiao-Zhang; Zhang, Xue-Hong
2016-07-01
Hydroponic experiments were conducted with different species of plants (rice, maize, soybean and willow) exposed to ferri-cyanide to investigate the half-saturation constant (K M ) and the maximal metabolic capacity (v max ) involved in phyto-assimilation. Three varieties for each testing species were collected from different origins. Measured concentrations show that the uptake rates responded biphasically to ferri-cyanide treatments by showing increases linearly at low and almost constant at high concentrations from all treatments, indicating that phyto-assimilation of ferri-cyanide followed the Michaelis-Menten kinetics. Using non-linear regression, the highest v max was by rice, followed by willows. The lowest v max was found for soybean. All plants, except maize (DY26) and rice (XJ12), had a similar K M value, suggesting the same enzyme was active in phyto-assimilation of ferri-cyanide. Transcript level, by real-time quantitative PCR, of enzymes involved in degradation of cyanides showed that the analyzed genes were differently expressed during different cyanides exposure. The expression of CAS and ST genes responded positively to KCN exposure, suggesting that β-CAS and ST pathways were two possible pathways for cyanide detoxification in rice. The transcript level of NIT and ASPNASE genes also showed a remarkable up-regulation to KCN, implying the contribution to the pool of amino acid aspartate, which is an end product of CN metabolism. Up-regulation of GS genes suggests that acquisition of ammonium released from cyanide degradation may be an additional nitrogen source for plant nutrition. Results also revealed that the expressions of these genes, except for GS, were relatively constant during iron cyanide exposure, suggesting that they are likely metabolized by plants through a non-defined pathway rather than the β-CAS pathway.
Emerging Use of Gene Expression Microarrays in Plant Physiology
Directory of Open Access Journals (Sweden)
Stephen P. Difazio
2006-04-01
Full Text Available Microarrays have become an important technology for the global analysis of gene expression in humans, animals, plants, and microbes. Implemented in the context of a well-designed experiment, cDNA and oligonucleotide arrays can provide highthroughput, simultaneous analysis of transcript abundance for hundreds, if not thousands, of genes. However, despite widespread acceptance, the use of microarrays as a tool to better understand processes of interest to the plant physiologist is still being explored. To help illustrate current uses of microarrays in the plant sciences, several case studies that we believe demonstrate the emerging application of gene expression arrays in plant physiology were selected from among the many posters and presentations at the 2003 Plant and Animal Genome XI Conference. Based on this survey, microarrays are being used to assess gene expression in plants exposed to the experimental manipulation of air temperature, soil water content and aluminium concentration in the root zone. Analysis often includes characterizing transcript profiles for multiple post-treatment sampling periods and categorizing genes with common patterns of response using hierarchical clustering techniques. In addition, microarrays are also providing insights into developmental changes in gene expression associated with fibre and root elongation in cotton and maize, respectively. Technical and analytical limitations of microarrays are discussed and projects attempting to advance areas of microarray design and data analysis are highlighted. Finally, although much work remains, we conclude that microarrays are a valuable tool for the plant physiologist interested in the characterization and identification of individual genes and gene families with potential application in the fields of agriculture, horticulture and forestry.
Host genes involved in Agrobacterium-mediated transformation
Soltani, Jalal
2009-01-01
Agrobacterium is the nature’s genetic engineer that can transfer genes across the kingdom barriers to both prokaryotic and eukaryotic host cells. The host genes which are involved in Agrobacterium-mediated transformatiom (AMT) are not well known. Here, I studied in a systematic way to identify the
Divergence and Conservative Evolution of XTNX Genes in Land Plants
Directory of Open Access Journals (Sweden)
Yan-Mei Zhang
2017-10-01
Full Text Available The Toll-interleukin-1 receptor (TIR and Nucleotide-binding site (NBS domains are two major components of the TIR-NBS-leucine-rich repeat family plant disease resistance genes. Extensive functional and evolutionary studies have been performed on these genes; however, the characterization of a small group of genes that are composed of atypical TIR and NBS domains, namely XTNX genes, is limited. The present study investigated this specific gene family by conducting genome-wide analyses of 59 green plant genomes. A total of 143 XTNX genes were identified in 51 of the 52 land plant genomes, whereas no XTNX gene was detected in any green algae genomes, which indicated that XTNX genes originated upon emergence of land plants. Phylogenetic analysis revealed that the ancestral XTNX gene underwent two rounds of ancient duplications in land plants, which resulted in the formation of clades I/II and clades IIa/IIb successively. Although clades I and IIb have evolved conservatively in angiosperms, the motif composition difference and sequence divergence at the amino acid level suggest that functional divergence may have occurred since the separation of the two clades. In contrast, several features of the clade IIa genes, including the absence in the majority of dicots, the long branches in the tree, the frequent loss of ancestral motifs, and the loss of expression in all detected tissues of Zea mays, all suggest that the genes in this lineage might have undergone pseudogenization. This study highlights that XTNX genes are a gene family originated anciently in land plants and underwent specific conservative pattern in evolution.
Trichoderma species produce trichothecenes, most notably trichodermin and harzianum A (HA), by a biosynthetic pathway in which several of the involved proteins have significant differences in functionality, compared to their Fusarium orthologues. In addition, the genes encoding these proteins show a...
Chemical signaling involved in plant-microbe interactions.
Chagas, Fernanda Oliveira; Pessotti, Rita de Cassia; Caraballo-Rodríguez, Andrés Mauricio; Pupo, Mônica Tallarico
2018-03-05
Microorganisms are found everywhere, and they are closely associated with plants. Because the establishment of any plant-microbe association involves chemical communication, understanding crosstalk processes is fundamental to defining the type of relationship. Although several metabolites from plants and microbes have been fully characterized, their roles in the chemical interplay between these partners are not well understood in most cases, and they require further investigation. In this review, we describe different plant-microbe associations from colonization to microbial establishment processes in plants along with future prospects, including agricultural benefits.
Weighted Gene Co-expression Network Analysis of the Dioscin Rich Medicinal Plant Dioscorea nipponica
Directory of Open Access Journals (Sweden)
Wei Sun
2017-06-01
Full Text Available Dioscorea contains critically important species which can be used as staple foods or sources of bioactive substances, including Dioscorea nipponica, which has been used to develop highly successful drugs to treat cardiovascular disease. Its major active ingredients are thought to be sterol compounds such as diosgenin, which has been called “medicinal gold” because of its valuable properties. However, reliance on naturally growing plants as a production system limits the potential use of D. nipponica, raising interest in engineering metabolic pathways to enhance the production of secondary metabolites. However, the biosynthetic pathway of diosgenin is still poorly understood, and D. nipponica is poorly characterized at a molecular level, hindering in-depth investigation. In the present work, the RNAs from five organs and seven methyl jasmonate treated D. nipponica rhizomes were sequenced using the Illumina high-throughput sequencing platform, yielding 52 gigabases of data, which were pooled and assembled into a reference transcriptome. Four hundred and eighty two genes were found to be highly expressed in the rhizomes, and these genes are mainly involved in stress response and transcriptional regulation. Based on their expression patterns, 36 genes were selected for further investigation as candidate genes involved in dioscin biosynthesis. Constructing co-expression networks based on significant changes in gene expression revealed 15 gene modules. Of these, four modules with properties correlating to dioscin regulation and biosynthesis, consisting of 4,665 genes in total, were selected for further functional investigation. These results improve our understanding of dioscin biosynthesis in this important medicinal plant and will help guide more intensive investigations.
Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae
Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.
2013-01-01
Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276
Bioinformatics analysis of the predicted polyprenol reductase genes in higher plants
Basyuni, M.; Wati, R.
2018-03-01
The present study evaluates the bioinformatics methods to analyze twenty-four predicted polyprenol reductase genes from higher plants on GenBank as well as predicted the structure, composition, similarity, subcellular localization, and phylogenetic. The physicochemical properties of plant polyprenol showed diversity among the observed genes. The percentage of the secondary structure of plant polyprenol genes followed the ratio order of α helix > random coil > extended chain structure. The values of chloroplast but not signal peptide were too low, indicated that few chloroplast transit peptide in plant polyprenol reductase genes. The possibility of the potential transit peptide showed variation among the plant polyprenol reductase, suggested the importance of understanding the variety of peptide components of plant polyprenol genes. To clarify this finding, a phylogenetic tree was drawn. The phylogenetic tree shows several branches in the tree, suggested that plant polyprenol reductase genes grouped into divergent clusters in the tree.
Gene stacking of multiple traits for high yield of fermentable sugars in plant biomass
DEFF Research Database (Denmark)
Aznar, Aude; Chalvin, Camille; Shih, Patrick M.
2018-01-01
the ratio of C6 to C5 sugars in the cell wall and decreasing the lignin content are two important targets in engineering of plants that are more suitable for downstream processing for second-generation biofuel production.Results: We have studied the basic mechanisms of cell wall biosynthesis and identified...... genes involved in biosynthesis of pectic galactan, including the GALS1 galactan synthase and the UDP-galactose/UDP-rhamnose transporter URGT1. We have engineered plants with a more suitable biomass composition by applying these findings, in conjunction with synthetic biology and gene stacking tools...... to vessels where this polysaccharide is essential. Finally, the high galactan and low xylan traits were stacked with the low lignin trait obtained by expressing the QsuB gene encoding dehydroshikimate dehydratase in lignifying cells.Conclusion: The results show that approaches to increasing C6 sugar content...
DCD – a novel plant specific domain in proteins involved in development and programmed cell death
Directory of Open Access Journals (Sweden)
Doerks Tobias
2005-07-01
Full Text Available Abstract Background Recognition of microbial pathogens by plants triggers the hypersensitive reaction, a common form of programmed cell death in plants. These dying cells generate signals that activate the plant immune system and alarm the neighboring cells as well as the whole plant to activate defense responses to limit the spread of the pathogen. The molecular mechanisms behind the hypersensitive reaction are largely unknown except for the recognition process of pathogens. We delineate the NRP-gene in soybean, which is specifically induced during this programmed cell death and contains a novel protein domain, which is commonly found in different plant proteins. Results The sequence analysis of the protein, encoded by the NRP-gene from soybean, led to the identification of a novel domain, which we named DCD, because it is found in plant proteins involved in development and cell death. The domain is shared by several proteins in the Arabidopsis and the rice genomes, which otherwise show a different protein architecture. Biological studies indicate a role of these proteins in phytohormone response, embryo development and programmed cell by pathogens or ozone. Conclusion It is tempting to speculate, that the DCD domain mediates signaling in plant development and programmed cell death and could thus be used to identify interacting proteins to gain further molecular insights into these processes.
Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R.
2014-01-01
Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. PMID:24399359
D'Andrea, Rodrigo Matías; Triassi, Agustina; Casas, María Isabel; Andreo, Carlos Santiago; Lara, María Valeria
2015-05-01
Portulaca oleracea is one of the richest plant sources of ω-3 and ω-6 fatty acids and other compounds potentially valuable for nutrition. It is broadly established in arid, semiarid and well-watered fields, thus making it a promising candidate for research on abiotic stress resistance mechanisms. It is capable of withstanding severe drought and then of recovering upon rehydration. Here, the adaptation to drought and the posterior recovery was evaluated at transcriptomic level by differential display validated by qRT-PCR. Of the 2279 transcript-derived fragments amplified, 202 presented differential expression. Ninety of them were successfully isolated and sequenced. Selected genes were tested against different abiotic stresses in P. oleracea and the behavior of their orthologous genes in Arabidopsis thaliana was also explored to seek for conserved response mechanisms. In drought adapted and in recovered plants changes in expression of many protein metabolism-, lipid metabolism- and stress-related genes were observed. Many genes with unknown function were detected, which also respond to other abiotic stresses. Some of them are also involved in the seed desiccation/imbibition process and thus would be of great interest for further research. The potential use of candidate genes to engineer drought tolerance improvement and recovery is discussed. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Felipe eMoraga
2015-10-01
Full Text Available Protein complexes involved in epigenetic regulation of transcription have evolved as molecular strategies to face environmental stress in plants. SAGA (Spt–Ada–Gcn5 Acetyltransferase is a transcriptional co-activator complex that regulates numerous cellular processes through the coordination of multiple post-translational histone modifications, including acetylation, deubiquitination, and chromatin recognition. The diverse functions of the SAGA complex involve distinct modules that are highly conserved between yeast, flies, and mammals. In this review, the composition of the SAGA complex in plants is described and its role in gene expression regulation under stress conditions summarized. Some of these proteins are likely involved in the regulation of the inducible expression of genes under light, cold, drought, salt, and iron stress, although the functions of several of its components remain unknown.
Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.
Directory of Open Access Journals (Sweden)
Kazuhiro Hayashi
Full Text Available Coenzyme Q (CoQ is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9 that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Directory of Open Access Journals (Sweden)
Sian Liu
2017-11-01
Full Text Available The passion fruit (Passiflora edulis Sims, also known as the purple granadilla, is widely cultivated as the new darling of the fruit market throughout southern China. This exotic and perennial climber is adapted to warm and humid climates, and thus is generally intolerant of cold. There is limited information about gene regulation and signaling pathways related to the cold stress response in this species. In this study, two transcriptome libraries (KEDU_AP vs. GX_AP were constructed from the aerial parts of cold-tolerant and cold-susceptible varieties of P. edulis, respectively. Overall, 126,284,018 clean reads were obtained, and 86,880 unigenes with a mean size of 1449 bp were assembled. Of these, there were 64,067 (73.74% unigenes with significant similarity to publicly available plant protein sequences. Expression profiles were generated, and 3045 genes were found to be significantly differentially expressed between the KEDU_AP and GX_AP libraries, including 1075 (35.3% up-regulated and 1970 (64.7% down-regulated. These included 36 genes in enriched pathways of plant hormone signal transduction, and 56 genes encoding putative transcription factors. Six genes involved in the ICE1–CBF–COR pathway were induced in the cold-tolerant variety, and their expression levels were further verified using quantitative real-time PCR. This report is the first to identify genes and signaling pathways involved in cold tolerance using high-throughput transcriptome sequencing in P. edulis. These findings may provide useful insights into the molecular mechanisms regulating cold tolerance and genetic breeding in Passiflora spp.
Kendziorek, Maria; Klimecka, Maria; Barabasz, Anna; Borg, Sören; Rudzka, Justyna; Szczęsny, Paweł; Antosiewicz, Danuta Maria
2016-08-12
To increase the Zn level in shoots, AtHMA4 was ectopically expressed in tomato under the constitutive CaMV 35S promoter. However, the Zn concentration in the shoots of transgenic plants failed to increase at all tested Zn levels in the medium. Modification of Zn root/shoot distribution in tomato expressing 35S::AtHMA4 depended on the concentration of Zn in the medium, thus indicating involvement of unknown endogenous metal-homeostasis mechanisms. To determine these mechanisms, those metal-homeostasis genes that were expressed differently in transgenic and wild-type plants were identified by microarray and RT-qPCR analysis using laser-assisted microdissected RNA isolated from two root sectors: (epidermis + cortex and stele), and leaf sectors (upper epidermis + palisade parenchyma and lower epidermis + spongy parenchyma). Zn-supply-dependent modification of Zn root/shoot distribution in AtHMA4-tomato (increase at 5 μM Zn, no change at 0.5 μM Zn) involved tissue-specific, distinct from that in the wild type, expression of tomato endogenous genes. First, it is suggested that an ethylene-dependent pathway underlies the detected changes in Zn root/shoot partitioning, as it was induced in transgenic plants in a distinct way depending on Zn exposure. Upon exposure to 5 or 0.5 μM Zn, in the epidermis + cortex of the transgenics' roots the expression of the Strategy I Fe-uptake system (ethylene-dependent LeIRT1 and LeFER) was respectively lower or higher than in the wild type and was accompanied by respectively lower or higher expression of the identified ethylene genes (LeNR, LeACO4, LeACO5) and of LeChln. Second, the contribution of LeNRAMP2 expression in the stele is shown to be distinct for wild-type and transgenic plants at both Zn exposures. Ethylene was also suggested as an important factor in a pathway induced in the leaves of transgenic plants by high Zn in the apoplast, which results in the initiation of loading of the excess Zn into the
Li, Peng; Miao, Hongxia; Ma, Yuewen; Wang, Lu; Hu, Guibing; Ye, Zixing; Zhao, Jietang; Qin, Yonghua
2015-09-09
Plant S-phase kinase-associated protein 1 (SKP1) genes play crucial roles in plant development and differentiation. However, the role of SKP1 in citrus is unclear. Herein, we described a novel SKP1-like gene, designated as CrWSKP1, from "Wuzishatangju" (Citrus reticulata Blanco). The cDNA sequence of CrWSKP1 is 779 base pairs (bp) and contains an open reading frame (ORF) of 477 bp. The genomic sequence of the CrWSKP1 gene is 1296 bp with two exons and one intron. CrWSKP1 has high identity with SKP1-like genes from other plant species within two conserved regions. Approximately 85% of pollen tubes of self-pollinated CrWSKP1 transgenic tobaccos became twisted at four days after self-pollination. Pollen tube numbers of self-pollinated CrWSKP1 transformants entering into ovules were significantly fewer than that of the control. Seed number of self-pollinated CrWSKP1 transformants was significantly reduced. These results suggested that the CrWSKP1 is involved in the self-incompatibility (SI) reaction of "Wuzishatangju".
Li, Yuanjun; Gou, Junbo; Chen, Fangfang; Li, Changfu; Zhang, Yansheng
2016-01-01
Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones, which include the xanthanolides. To date, the biogenesis of xanthanolides, especiallytheir downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes...
Directory of Open Access Journals (Sweden)
Kaijie Xu
2016-03-01
Full Text Available Abstract Switchgrass (Panicum virgatum L.; family Poaceae is a warm-season C4 perennial grass. Tillering plays an important role in determining the morphology of aboveground parts and the final biomass yield of switchgrass. Auxin distribution in plants can affect a variety of important growth and developmental processes, including the regulation of shoot and root branching, plant resistance and biological yield. Auxin transport and gradients in plants are mediated by influx and efflux carriers. PvPIN1, a switchgrass PIN1-like gene that is involved in regulating polar transport, is a putative auxin efflux carrier. Neighbor-joining analysis using sequences deposited in NCBI databases showed that the PvPIN1gene belongs to the PIN1 family and is evolutionarily closer to the Oryza sativa japonica group. Tiller emergence and development was significantly promoted in plants subjected toPvPIN1 RNA interference (RNAi, which yielded a phenotype similar to that of wild-type plants treated with the auxin transport inhibitor TIBA (2,3,5-triiodobenzoic acid. A transgenic approach that inducedPvPIN1 gene overexpression or suppression altered tiller number and the shoot/root ratio. These data suggest that PvPIN1plays an important role in auxin-dependent adventitious root emergence and tillering.
Li, Wang; Wang, Bing; Wang, Man; Chen, Min; Yin, Jing-Ming; Kaleri, Ghullam Murtaza; Zhang, Rui-Jie; Zuo, Tie-Niu; You, Xiong; Yang, Qing
2014-04-01
Anthocyanins are a class of products of plant secondary metabolism and are responsible for tubers color in potato. The biosynthesis of anthocyanins is a complex biological process, in which multiple genes are involved including structural genes and regulatory genes. In this study, StAN11, a WD40-repeat gene, was cloned from potato cultivar Chieftain (Solanum tuberosum L.). StAN11 (HQ599506) contained no intron and its open reading frame (ORF) was 1,029 bp long, encoding a putative protein of 342 amino acids. In order to verify its role in anthocyanin biosynthesis, StAN11 was inserted behind the CaMV-35S promoter of pCMBIA1304 and the recombination vector was introduced into the potato cultivar Désirée plants by Agrobacterium-mediated transformation. The color of transgenic tuber skin was significantly deepened, compared to the wild-type control, which was highly consistent with the accumulation of anthocyanin and expression of StAN11 in transgenic lines tuber skin. Further analysis on the expression of Flavonone-3-hydroxylase (F3H), Dihydroflavonol reductase (DFR), Anthocyanidin synthase (ANS), and Flavonoid 3-O-glucosyl transferase (3GT) in transgenic plants revealed that only DFR was upregulated. This result suggested that StAN11 regulated anthocyanin biosynthesis in potato by controlling DFR expression and accumulation of anthocyanin could be increased through overexpression of StAN11 in the tubers with the genetic background of anthocyanin biosynthesis. © 2013 Institute of Botany, Chinese Academy of Sciences.
Plant ion channels: gene families, physiology, and functional genomics analyses.
Ward, John M; Mäser, Pascal; Schroeder, Julian I
2009-01-01
Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.
Ntdin, a tobacco senescence-associated gene, is involved in molybdenum cofactor biosynthesis.
Yang, Seung Hwan; Berberich, Thomas; Miyazaki, Atsushi; Sano, Hiroshi; Kusano, Tomonobu
2003-10-01
To date, dozens of genes have been reported to be up-regulated with senescence in higher plants. Radish din1 and its ortholog sen1 of Arabidopsis are known as such, but their function is not clear yet. Here we have isolated their counterpart cDNA from tobacco and designated it as NTDIN: Its product, Ntdin, a 185 amino acid polypeptide with 56.8% and 54.2% identity to Atsen1 and Rsdin1, respectively, is localized in chloroplasts. Transcripts of Ntdin are induced by sulfate or nitrate but not by phosphate, suggesting its involvement in sulfur and nitrogen metabolism. A database search revealed that Ntdin shows similarity with the C-terminal region of Nicotiana plumbaginifolia Cnx5, which functions in molybdenum cofactor (Moco) biosynthesis. Transgenic tobacco plants with suppressed Ntdin are more tolerant to chlorate, a substrate analog of nitrate reductase, than controls, implying low nitrate reductase activity in the transgenic plants due to a deficiency of Moco. Indeed, enzymatic activities of two molybdoenzymes, nitrate reductase and xanthine dehydrogenase, in transgenic plants are found to be significantly lower than in control plants. Direct measurement of Moco contents reveals that those transgenic plants contain about 5% Moco of those of the control plants. Abscisic acid and indole-3-acidic acid, whose biosynthetic pathways require Moco, up-regulated Ntdin expression. Taken together, it is concluded that Ntdin functions in a certain step in Moco biosynthesis.
Bassett, Shalome A; Johnson, Richard D; Simpson, Wayne R; Laugraud, Aurelie; Jordan, T William; Bryan, Gregory T
2016-10-01
Secreted proteins, those involved in cell wall biogenesis, are likely to play a role in communication in the symbiotic interaction between the fungal endophyte Epichloë festucae with perennial ryegrass (Lolium perenne), particularly given the close association between fungal hyphae and the plant cell wall. Our hypothesis was that secreted proteins are likely to be responsible for establishing and maintaining a normal symbiotic relationship. We analyzed an endophyte EST database for genes with predicted signal peptide sequences. Here, we report the identification and characterization of rhgA; a gene involved in the regulation of hyphal growth in planta In planta analysis of ΔrhgA mutants showed that disruption of rhgA resulted in extensive unregulated hyphal growth. This phenotype was fully complemented by insertion of the rhgA gene and suggests that rhgA is important for maintaining normal hyphal growth during symbiosis. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
McNeal, Joel R; Kuehl, Jennifer V; Boore, Jeffrey L; de Pamphilis, Claude W
2007-10-24
Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.
Directory of Open Access Journals (Sweden)
Kuehl Jennifer V
2007-10-01
Full Text Available Abstract Background Plastid genome content and protein sequence are highly conserved across land plants and their closest algal relatives. Parasitic plants, which obtain some or all of their nutrition through an attachment to a host plant, are often a striking exception. Heterotrophy can lead to relaxed constraint on some plastid genes or even total gene loss. We sequenced plastid genomes of two species in the parasitic genus Cuscuta along with a non-parasitic relative, Ipomoea purpurea, to investigate changes in the plastid genome that may result from transition to the parasitic lifestyle. Results Aside from loss of all ndh genes, Cuscuta exaltata retains photosynthetic and photorespiratory genes that evolve under strong selective constraint. Cuscuta obtusiflora has incurred substantially more change to its plastid genome, including loss of all genes for the plastid-encoded RNA polymerase. Despite extensive change in gene content and greatly increased rate of overall nucleotide substitution, C. obtusiflora also retains all photosynthetic and photorespiratory genes with only one minor exception. Conclusion Although Epifagus virginiana, the only other parasitic plant with its plastid genome sequenced to date, has lost a largely overlapping set of transfer-RNA and ribosomal genes as Cuscuta, it has lost all genes related to photosynthesis and maintains a set of genes which are among the most divergent in Cuscuta. Analyses demonstrate photosynthetic genes are under the highest constraint of any genes within the plastid genomes of Cuscuta, indicating a function involving RuBisCo and electron transport through photosystems is still the primary reason for retention of the plastid genome in these species.
Zúñiga-Sánchez, Esther; Soriano, Diana; Martínez-Barajas, Eleazar; Orozco-Segovia, Alma; Gamboa-deBuen, Alicia
2014-12-02
DUF642 proteins constitute a highly conserved family of proteins that are associated with the cell wall and are specific to spermatophytes. Transcriptome studies have suggested that members of this family are involved in seed development and germination processes. Previous in vitro studies have revealed that At4g32460- and At5g11420-encoded proteins interact with the catalytic domain of pectin methyl esterase 3 (AtPME3, which is encoded by At3g14310). PMEs play an important role in plant development, including seed germination. The aim of this study was to evaluate the function of the DUF642 gene At4g32460 during seed germination and plant development and to determine its relation to PME activity regulation. Our results indicated that the DUF642 proteins encoded by At4g32460 and At5g11420 could be positive regulators of PME activity during several developmental processes. Transgenic lines overexpressing these proteins showed increased PME activity during seed germination, and improved seed germination performance. In plants expressing At4g32460 antisense RNA, PME activity was decreased in the leaves, and the siliques were very short and contained no seeds. This phenotype was also present in the SALK_142260 and SALK_054867 lines for At4g32460. Our results suggested that the DUF642 family contributes to the complexity of the methylesterification process by participating in the fine regulation of pectin status during plant development.
Stably Expressed Genes Involved in Basic Cellular Functions.
Directory of Open Access Journals (Sweden)
Kejian Wang
Full Text Available Stably Expressed Genes (SEGs whose expression varies within a narrow range may be involved in core cellular processes necessary for basic functions. To identify such genes, we re-analyzed existing RNA-Seq gene expression profiles across 11 organs at 4 developmental stages (from immature to old age in both sexes of F344 rats (n = 4/group; 320 samples. Expression changes (calculated as the maximum expression / minimum expression for each gene of >19000 genes across organs, ages, and sexes ranged from 2.35 to >109-fold, with a median of 165-fold. The expression of 278 SEGs was found to vary ≤4-fold and these genes were significantly involved in protein catabolism (proteasome and ubiquitination, RNA transport, protein processing, and the spliceosome. Such stability of expression was further validated in human samples where the expression variability of the homologous human SEGs was significantly lower than that of other genes in the human genome. It was also found that the homologous human SEGs were generally less subject to non-synonymous mutation than other genes, as would be expected of stably expressed genes. We also found that knockout of SEG homologs in mouse models was more likely to cause complete preweaning lethality than non-SEG homologs, corroborating the fundamental roles played by SEGs in biological development. Such stably expressed genes and pathways across life-stages suggest that tight control of these processes is important in basic cellular functions and that perturbation by endogenous (e.g., genetics or exogenous agents (e.g., drugs, environmental factors may cause serious adverse effects.
Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing
2014-01-01
Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE) motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS) reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose RhNAC3 protein
Directory of Open Access Journals (Sweden)
Guimei Jiang
Full Text Available Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida, RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory sequence of RhNAC3 and found many stress-related cis-elements to be present in the promoter, with five ABA-responsive element (ABRE motifs being of particular interest. Characterization of Arabidopsis thaliana plants transformed with the putative RhNAC3 promoter sequence fused to the β-glucuronidase (GUS reporter gene revealed that RhNAC3 is expressed at high basal levels in leaf guard cells and in vascular tissues. Moreover, the ABRE motifs in the RhNAC3 promoter were observed to have a cumulative effect on the transcriptional activity of this gene both in the presence and absence of exogenous ABA. Overexpression of RhNAC3 in A. thaliana resulted in ABA hypersensitivity during seed germination and promoted leaf closure after ABA or drought treatments. Additionally, the expression of 11 ABA-responsive genes was induced to a greater degree by dehydration in the transgenic plants overexpressing RhNAC3 than control lines transformed with the vector alone. Further analysis revealed that all these genes contain NAC binding cis-elements in their promoter regions, and RhNAC3 was found to partially bind to these putative NAC recognition sites. We further found that of 219 A. thaliana genes previously shown by microarray analysis to be regulated by heterologous overexpression RhNAC3, 85 are responsive to ABA. In rose, the expression of genes downstream of the ABA-signaling pathways was also repressed in RhNAC3-silenced petals. Taken together, we propose that the rose Rh
Wang, Zhi; Ke, Qingbo; Kim, Myoung Duck; Kim, Sun Ha; Ji, Chang Yoon; Jeong, Jae Cheol; Lee, Haeng-Soon; Park, Woo Sung; Ahn, Mi-Jeong; Li, Hongbing; Xu, Bingcheng; Deng, Xiping; Lee, Sang-Hoon; Lim, Yong Pyo; Kwak, Sang-Soo
2015-01-01
Alfalfa (Medicago sativa L.), a perennial forage crop with high nutritional content, is widely distributed in various environments worldwide. We recently demonstrated that the sweetpotato Orange gene (IbOr) is involved in increasing carotenoid accumulation and enhancing resistance to multiple abiotic stresses. In this study, in an effort to improve the nutritional quality and environmental stress tolerance of alfalfa, we transferred the IbOr gene into alfalfa (cv. Xinjiang Daye) under the control of an oxidative stress-inducible peroxidase (SWPA2) promoter through Agrobacterium tumefaciens-mediated transformation. Among the 11 transgenic alfalfa lines (referred to as SOR plants), three lines (SOR2, SOR3, and SOR8) selected based on their IbOr transcript levels were examined for their tolerance to methyl viologen (MV)-induced oxidative stress in a leaf disc assay. The SOR plants exhibited less damage in response to MV-mediated oxidative stress and salt stress than non-transgenic plants. The SOR plants also exhibited enhanced tolerance to drought stress, along with higher total carotenoid levels. The results suggest that SOR alfalfa plants would be useful as forage crops with improved nutritional value and increased tolerance to multiple abiotic stresses, which would enhance the development of sustainable agriculture on marginal lands. PMID:25946429
In silico identification and analysis of phytoene synthase genes in plants.
Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J
2015-08-14
In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.
Kumar, Sunil; Kalra, Shikha; Singh, Baljinder; Kumar, Avneesh; Kaur, Jagdeep; Singh, Kashmir
2016-01-01
Chlorophytum borivilianum is an important species of liliaceae family, owing to its vital medicinal properties. Plant roots are used for aphrodisiac, adaptogen, anti-aging, health-restorative and health-promoting purposes. Saponins, are considered to be the principal bioactive components responsible for the wide variety of pharmacological properties of this plant. In the present study, we have performed de novo root transcriptome sequencing of C. borivilianum using Illumina Hiseq 2000 platform, to gain molecular insight into saponins biosynthesis. A total of 33,963,356 high-quality reads were obtained after quality filtration. Sequences were assembled using various programs which generated 97,344 transcripts with a size range of 100-5,216 bp and N50 value of 342. Data was analyzed against non-redundant proteins, gene ontology (GO), and enzyme commission (EC) databases. All the genes involved in saponins biosynthesis along with five full-length genes namely farnesyl pyrophosphate synthase, cycloartenol synthase, β-amyrin synthase, cytochrome p450, and sterol-3-glucosyltransferase were identified. Read per exon kilobase per million (RPKM)-based comparative expression profiling was done to study the differential regulation of the genes. In silico expression analysis of seven selected genes of saponin biosynthetic pathway was validated by qRT-PCR.
Repressor-mediated tissue-specific gene expression in plants
Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA
2009-02-17
Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.
Expression profiles of genes involved in tanshinone biosynthesis of ...
Indian Academy of Sciences (India)
Expression profiles of genes involved in tanshinone biosynthesis of two. Salvia miltiorrhiza genotypes with different tanshinone contents. Zhenqiao Song, Jianhua Wang and Xingfeng Li. J. Genet. 95, 433–439. Table 1. S. miltiorrhiza genes and primer pairs used for qRT-PCR. Gene. GenBank accession. Primer name.
Coverage analysis of lists of genes involved in heterogeneous ...
Indian Academy of Sciences (India)
Genes involved in myopathies: 82 genes, based on the disease groups ... 605517 Muscular dystrophy-dystroglycanopathy (congenital with brain and eye ..... Epilepsy, X-linked, with variable learning disabilities and behavior disorders. 300491.
Plant domestication and gene banks
International Nuclear Information System (INIS)
Perrino, P.
1989-01-01
At the time of the dawn of agriculture, plant domestication was very slow. As agriculture progressed, however, domestication began to evolve faster and reached its highest point with the advent of plant breeders who played a very important role in solving the world food problem. One of the fastest moving strategies was a better exploitation of genetic diversity, both natural and induced. However, intensive plant breeding activity caused a heavy fall in genetic variability. Gene banks then provided a further tool for modern agriculture, specifically to preserve genetic resources and to help breeders to further domesticate important crops and to introduce and domesticate new species. (author). 3 refs
The Wheat E Subunit of V-Type H+-ATPase Is Involved in the Plant Response to Osmotic Stress
Directory of Open Access Journals (Sweden)
Xiao-Hong Zhang
2014-09-01
Full Text Available The vacuolar type H+-ATPase (V-type H+-ATPase plays important roles in establishing an electrochemical H+-gradient across tonoplast, energizing Na+ sequestration into the central vacuole, and enhancing salt stress tolerance in plants. In this paper, a putative E subunit of the V-type H+-ATPase gene, W36 was isolated from stress-induced wheat de novo transcriptome sequencing combining with 5'-RACE and RT-PCR methods. The full-length of W36 gene was 1097 bp, which contained a 681 bp open reading frame (ORF and encoded 227 amino acids. Southern blot analysis indicated that W36 was a single-copy gene. The quantitative real-time PCR (qRT-PCR analysis revealed that the expression level of W36 could be upregulated by drought, cold, salt, and exogenous ABA treatment. A subcellular localization assay showed that the W36 protein accumulated in the cytoplasm. Isolation of the W36 promoter revealed some cis-acting elements responding to abiotic stresses. Transgenic Arabidopsis plants overexpressing W36 were enhanced salt and mannitol tolerance. These results indicate that W36 is involved in the plant response to osmotic stress.
Collonnier, Cécile; Guyon-Debast, Anouchka; Maclot, François; Mara, Kostlend; Charlot, Florence; Nogué, Fabien
2017-05-15
Beyond its predominant role in human and animal therapy, the CRISPR-Cas9 system has also become an essential tool for plant research and plant breeding. Agronomic applications rely on the mastery of gene inactivation and gene modification. However, if the knock-out of genes by non-homologous end-joining (NHEJ)-mediated repair of the targeted double-strand breaks (DSBs) induced by the CRISPR-Cas9 system is rather well mastered, the knock-in of genes by homology-driven repair or end-joining remains difficult to perform efficiently in higher plants. In this review, we describe the different approaches that can be tested to improve the efficiency of CRISPR-induced gene modification in plants, which include the use of optimal transformation and regeneration protocols, the design of appropriate guide RNAs and donor templates and the choice of nucleases and means of delivery. We also present what can be done to orient DNA repair pathways in the target cells, and we show how the moss Physcomitrella patens can be used as a model plant to better understand what DNA repair mechanisms are involved, and how this knowledge could eventually be used to define more performant strategies of CRISPR-induced gene knock-in. Copyright © 2017 Elsevier Inc. All rights reserved.
Pierella Karlusich, Juan J; Ceccoli, Romina D; Graña, Martín; Romero, Héctor; Carrillo, Néstor
2015-02-16
Oxidative stress and iron limitation represent the grim side of life in an oxygen-rich atmosphere. The versatile electron transfer shuttle ferredoxin, an iron-sulfur protein, is particularly sensitive to these hardships, and its downregulation under adverse conditions severely compromises survival of phototrophs. Replacement of ferredoxin by a stress-resistant isofunctional carrier, flavin-containing flavodoxin, is a widespread strategy employed by photosynthetic microorganisms to overcome environmental adversities. The flavodoxin gene was lost in the course of plant evolution, but its reintroduction in transgenic plants confers increased tolerance to environmental stress and iron starvation, raising the question as to why a genetic asset with obvious adaptive value was not kept by natural selection. Phylogenetic analyses reveal that the evolutionary history of flavodoxin is intricate, with several horizontal gene transfer events between distant organisms, including Eukarya, Bacteria, and Archaea. The flavodoxin gene is unevenly distributed in most algal lineages, with flavodoxin-containing species being overrepresented in iron-limited regions and scarce or absent in iron-rich environments. Evaluation of cyanobacterial genomic and metagenomic data yielded essentially the same results, indicating that there was little selection pressure to retain flavodoxin in iron-rich coastal/freshwater phototrophs. Our results show a highly dynamic evolution pattern of flavodoxin tightly connected to the bioavailability of iron. Evidence presented here also indicates that the high concentration of iron in coastal and freshwater habitats may have facilitated the loss of flavodoxin in the freshwater ancestor of modern plants during the transition of photosynthetic organisms from the open oceans to the firm land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Plant isoflavone and isoflavanone O-methyltransferase genes
Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.
2014-08-19
The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.
Yang, Zhifan; Zhang, Futie; Zhu, Lili; He, Guangcun
2006-02-01
The brown planthopper Nilaparvata lugens Stål is one of the major insect pests of rice Oryza sativa L. The host resistance exhibits profound effects on growth, development and propagation of N. lugens. To investigate the molecular response of N. lugens to host resistance, a cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique was employed to identify the differentially expressed genes in the nymphs feeding on three rice varieties. Of the 2,800 cDNA bands analysed, 54 were up-regulated and seven down-regulated qualitatively in N. lugens when the ingestion sources were changed from susceptible rice plants to resistant ones. Sequence analysis of the differential transcript-derived fragments showed that the genes involved in signalling, stress response, gene expression regulation, detoxification and metabolism were regulated by host resistance. Four of the transcript-derived fragments corresponding to genes encoding for a putative B subunit of phosphatase PP2A, a nemo kinase, a cytochrome P450 monooxygenase and a prolyl endopeptidase were further characterized in detail. Northern blot analysis confirmed that the expression of the four genes was enhanced in N. lugens feeding on resistant rice plants. The roles of these genes in the defensive response of N. lugens to host plant resistance were discussed.
Delgado, María J; Tresierra-Ayala, Alvaro; Talbi, Chouhra; Bedmar, Eulogio J
2006-01-01
A modABC gene cluster that encodes an ABC-type, high-affinity molybdate transporter from Bradyrhizobium japonicum has been isolated and characterized. B. japonicum modA and modB mutant strains were unable to grow aerobically or anaerobically with nitrate as nitrogen source or as respiratory substrate, respectively, and lacked nitrate reductase activity. The nitrogen-fixing ability of the mod mutants in symbiotic association with soybean plants grown in a Mo-deficient mineral solution was severely impaired. Addition of molybdate to the bacterial growth medium or to the plant mineral solution fully restored the wild-type phenotype. Because the amount of molybdate required for suppression of the mutant phenotype either under free-living or under symbiotic conditions was dependent on sulphate concentration, it is likely that a sulphate transporter is also involved in Mo uptake in B. japonicum. The promoter region of the modABC genes has been characterized by primer extension. Reverse transcription and expression of a transcriptional fusion, P(modA)-lacZ, was detected only in a B. japonicum modA mutant grown in a medium without molybdate supplementation. These findings indicate that transcription of the B. japonicum modABC genes is repressed by molybdate.
da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando
2016-01-01
The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.
Directory of Open Access Journals (Sweden)
Dong An
2016-12-01
Full Text Available Cassava is a tropical origin plant that is sensitive to chilling stress. In order to understand the CBF cold response pathway, a well-recognized regulatory mechanism in temperate plants, in cassava, overexpression of an Arabidopsis CBF3 gene is studied. This gene renders cassava increasingly tolerant to cold and drought stresses but is associated with retarded plant growth, leaf curling, reduced storage root yield, and reduced anthocyanin accumulation in a transcript abundance-dependent manner. Physiological analysis revealed that the transgenic cassava increased proline accumulation, reduced malondialdehyde production, and electrolyte leakage under cold stress. These transgenic lines also showed high relative water content when faced with drought. The expression of partial CBF-targeted genes in response to cold displayed temporal and spatial variations in the wild-type and transgenic plants: highly inducible in leaves and less altered in apical buds. In addition, anthocyanin accumulation was inhibited by downregulating the expression of genes involved in its biosynthesis and by interplaying between the CBF3 and the endogenous transcription factors. Thus, the heterologous CBF3 modulates the expression of stress-related genes and carries out a series of physiological adjustments under stressful conditions, showing a varied regulation pattern of CBF regulon from that of cassava CBFs.
Directory of Open Access Journals (Sweden)
Wenxiu eWang
2016-03-01
Full Text Available Cryptochromes (CRY are blue-light photoreceptors that mediate various light responses in plants and animals. It has long been demonstrated that Arabidopsis CRY (CRY1 and CRY2 C termini (CCT1 and CCT2 mediate light signaling through direct interaction with COP1. Most recently, CRY1 N terminus (CNT1 has been found to be involved in CRY1 signaling independent of CCT1, and implicated in the inhibition of gibberellin acids (GA/brassinosteroids (BR/auxin-responsive gene expression. Here, we performed RNA-Seq assay using transgenic plants expressing CCT1 fused to β-glucuronidase (GUS-CCT1, abbreviated as CCT1, which exhibit a constitutively photomorphogenic phenotype, and compared the results with those obtained previously from cry1cry2 mutant and the transgenic plants expressing CNT1 fused to nuclear localization signal sequence (NLS-tagged YFP (CNT1-NLS-YFP, abbreviated as CNT1, which display enhanced responsiveness to blue light. We found that 2,903 (67.85% of the CRY-regulated genes are regulated by CCT1 and that 1,095 of these CCT1-regulated genes are also regulated by CNT1. After annotating the gene functions, we found that CCT1 is involved in mediating CRY1 regulation of phytohormone-responsive genes, like CNT1, and that about half of the up-regulated genes by GA/BR/auxin are down-regulated by CCT1 and CNT1, consistent with the antagonistic role for CRY1 and these phytohormones in regulating hypocotyl elongation. Physiological studies showed that both CCT1 and CNT1 are likely involved in mediating CRY1 reduction of seedlings sensitivity to GA under blue light. Furthermore, protein expression studies demonstrate that the inhibition of GA promotion of HY5 degradation by CRY1 is likely mediated by CCT1, but not by CNT1. These results give genome-wide transcriptome information concerning the signaling mechanism of CRY1, unraveling possible involvement of its C and N termini in its regulation of response of GA and likely other phytohormones.
Proudhon, D; Wei, J; Briat, J; Theil, E C
1996-03-01
Ferritin, a protein widespread in nature, concentrates iron approximately 10(11)-10(12)-fold above the solubility within a spherical shell of 24 subunits; it derives in plants and animals from a common ancestor (based on sequence) but displays a cytoplasmic location in animals compared to the plastid in contemporary plants. Ferritin gene regulation in plants and animals is altered by development, hormones, and excess iron; iron signals target DNA in plants but mRNA in animals. Evolution has thus conserved the two end points of ferritin gene expression, the physiological signals and the protein structure, while allowing some divergence of the genetic mechanisms. Comparison of ferritin gene organization in plants and animals, made possible by the cloning of a dicot (soybean) ferritin gene presented here and the recent cloning of two monocot (maize) ferritin genes, shows evolutionary divergence in ferritin gene organization between plants and animals but conservation among plants or among animals; divergence in the genetic mechanism for iron regulation is reflected by the absence in all three plant genes of the IRE, a highly conserved, noncoding sequence in vertebrate animal ferritin mRNA. In plant ferritin genes, the number of introns (n = 7) is higher than in animals (n = 3). Second, no intron positions are conserved when ferritin genes of plants and animals are compared, although all ferritin gene introns are in the coding region; within kingdoms, the intron positions in ferritin genes are conserved. Finally, secondary protein structure has no apparent relationship to intron/exon boundaries in plant ferritin genes, whereas in animal ferritin genes the correspondence is high. The structural differences in introns/exons among phylogenetically related ferritin coding sequences and the high conservation of the gene structure within plant or animal kingdoms of the gene structure within plant or animal kingdoms suggest that kingdom-specific functional constraints may
Wu, Shuanghua; Lei, Jianjun; Chen, Guoju; Chen, Hancai; Cao, Bihao; Chen, Changming
2017-01-01
Chinese kale, a vegetable of the cruciferous family, is a popular crop in southern China and Southeast Asia due to its high glucosinolate content and nutritional qualities. However, there is little research on the molecular genetics and genes involved in glucosinolate metabolism and its regulation in Chinese kale. In this study, we sequenced and characterized the transcriptomes and expression profiles of genes expressed in 11 tissues of Chinese kale. A total of 216 million 150-bp clean reads were generated using RNA-sequencing technology. From the sequences, 98,180 unigenes were assembled for the whole plant, and 49,582~98,423 unigenes were assembled for each tissue. Blast analysis indicated that a total of 80,688 (82.18%) unigenes exhibited similarity to known proteins. The functional annotation and classification tools used in this study suggested that genes principally expressed in Chinese kale, were mostly involved in fundamental processes, such as cellular and molecular functions, the signal transduction, and biosynthesis of secondary metabolites. The expression levels of all unigenes were analyzed in various tissues of Chinese kale. A large number of candidate genes involved in glucosinolate metabolism and its regulation were identified, and the expression patterns of these genes were analyzed. We found that most of the genes involved in glucosinolate biosynthesis were highly expressed in the root, petiole, and in senescent leaves. The expression patterns of ten glucosinolate biosynthetic genes from RNA-seq were validated by quantitative RT-PCR in different tissues. These results provided an initial and global overview of Chinese kale gene functions and expression activities in different tissues. PMID:28228764
Li, Yun-He; Zhang, Hong-Na; Wu, Qing-Song; Muday, Gloria K
2017-06-01
A total of 74,745 unigenes were generated and 1975 DEGs were identified. Candidate genes that may be involved in the adventitious root formation of mango cotyledon segment were revealed. Adventitious root formation is a crucial step in plant vegetative propagation, but the molecular mechanism of adventitious root formation remains unclear. Adventitious roots formed only at the proximal cut surface (PCS) of mango cotyledon segments, whereas no roots were formed on the opposite, distal cut surface (DCS). To identify the transcript abundance changes linked to adventitious root development, RNA was isolated from PCS and DCS at 0, 4 and 7 days after culture, respectively. Illumina sequencing of libraries generated from these samples yielded 62.36 Gb high-quality reads that were assembled into 74,745 unigenes with an average sequence length of 807 base pairs, and 33,252 of the assembled unigenes at least had homologs in one of the public databases. Comparative analysis of these transcriptome databases revealed that between the different time points at PCS there were 1966 differentially expressed genes (DEGs), while there were only 51 DEGs for the PCS vs. DCS when time-matched samples were compared. Of these DEGs, 1636 were assigned to gene ontology (GO) classes, the majority of that was involved in cellular processes, metabolic processes and single-organism processes. Candidate genes that may be involved in the adventitious root formation of mango cotyledon segment are predicted to encode polar auxin transport carriers, auxin-regulated proteins, cell wall remodeling enzymes and ethylene-related proteins. In order to validate RNA-sequencing results, we further analyzed the expression profiles of 20 genes by quantitative real-time PCR. This study expands the transcriptome information for Mangifera indica and identifies candidate genes involved in adventitious root formation in cotyledon segments of mango.
Ruhlman, Tracey A; Chang, Wan-Jung; Chen, Jeremy J W; Huang, Yao-Ting; Chan, Ming-Tsair; Zhang, Jin; Liao, De-Chih; Blazier, John C; Jin, Xiaohua; Shih, Ming-Che; Jansen, Robert K; Lin, Choun-Sea
2015-04-11
Key innovations have facilitated novel niche utilization, such as the movement of the algal predecessors of land plants into terrestrial habitats where drastic fluctuations in light intensity, ultraviolet radiation and water limitation required a number of adaptations. The NDH (NADH dehydrogenase-like) complex of Viridiplantae plastids participates in adapting the photosynthetic response to environmental stress, suggesting its involvement in the transition to terrestrial habitats. Although relatively rare, the loss or pseudogenization of plastid NDH genes is widely distributed across diverse lineages of photoautotrophic seed plants and mutants/transgenics lacking NDH function demonstrate little difference from wild type under non-stressed conditions. This study analyzes large transcriptomic and genomic datasets to evaluate the persistence and loss of NDH expression across plants. Nuclear expression profiles showed accretion of the NDH gene complement at key transitions in land plant evolution, such as the transition to land and at the base of the angiosperm lineage. While detection of transcripts for a selection of non-NDH, photosynthesis related proteins was independent of the state of NDH, coordinate, lineage-specific loss of plastid NDH genes and expression of nuclear-encoded NDH subunits was documented in Pinaceae, gnetophytes, Orchidaceae and Geraniales confirming the independent and complete loss of NDH in these diverse seed plant taxa. The broad phylogenetic distribution of NDH loss and the subtle phenotypes of mutants suggest that the NDH complex is of limited biological significance in contemporary plants. While NDH activity appears dispensable under favorable conditions, there were likely sufficiently frequent episodes of abiotic stress affecting terrestrial habitats to allow the retention of NDH activity. These findings reveal genetic factors influencing plant/environment interactions in a changing climate through 450 million years of land plant
Directory of Open Access Journals (Sweden)
Queiroux Clothilde
2012-05-01
Full Text Available Abstract Background We have used the genomic data in the Integrated Microbial Genomes system of the Department of Energy’s Joint Genome Institute to make predictions about rhizobial open reading frames that play a role in nodulation of host plants. The genomic data was screened by searching for ORFs conserved in α-proteobacterial rhizobia, but not conserved in closely-related non-nitrogen-fixing α-proteobacteria. Results Using this approach, we identified many genes known to be involved in nodulation or nitrogen fixation, as well as several new candidate genes. We knocked out selected new genes and assayed for the presence of nodulation phenotypes and/or nodule-specific expression. One of these genes, SMc00911, is strongly expressed by bacterial cells within host plant nodules, but is expressed minimally by free-living bacterial cells. A strain carrying an insertion mutation in SMc00911 is not defective in the symbiosis with host plants, but in contrast to expectations, this mutant strain is able to out-compete the S. meliloti 1021 wild type strain for nodule occupancy in co-inoculation experiments. The SMc00911 ORF is predicted to encode a “SodM-like” (superoxide dismutase-like protein containing a rhodanese sulfurtransferase domain at the N-terminus and a chromate-resistance superfamily domain at the C-terminus. Several other ORFs (SMb20360, SMc01562, SMc01266, SMc03964, and the SMc01424-22 operon identified in the screen are expressed at a moderate level by bacteria within nodules, but not by free-living bacteria. Conclusions Based on the analysis of ORFs identified in this study, we conclude that this comparative genomics approach can identify rhizobial genes involved in the nitrogen-fixing symbiosis with host plants, although none of the newly identified genes were found to be essential for this process.
Satoh, Kouji; Saji, Shoko; Ito, Shoko; Shimizu, Hideyuki; Saji, Hikaru; Kikuchi, Shoshi
2014-01-01
Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species.
International Nuclear Information System (INIS)
Yousaf, Sohail; Afzal, Muhammad; Reichenauer, Thomas G.; Brady, Carrie L.; Sessitsch, Angela
2011-01-01
The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: → E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. → E. ludwigii strains efficiently expressed alkane degradation genes in plants. → E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. → E. ludwigii interacted more effectively with Italian ryegrass than with other plants. → Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.
Energy Technology Data Exchange (ETDEWEB)
Yousaf, Sohail [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); Afzal, Muhammad [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria); National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad (Pakistan); Reichenauer, Thomas G. [AIT Austrian Institute of Technology GmbH, Environmental Resources and Technologies Unit, A-2444 Seibersdorf (Austria); Brady, Carrie L. [Forestry and Agricultural Biotechnology Institute, Department of Microbiology and Plant Pathology, University of Pretoria, Pretoria (South Africa); Sessitsch, Angela, E-mail: angela.sessitsch@ait.ac.at [AIT Austrian Institute of Technology GmbH, Bioresources Unit, A-2444 Seibersdorf (Austria)
2011-10-15
The genus Enterobacter comprises a range of beneficial plant-associated bacteria showing plant growth promotion. Enterobacter ludwigii belongs to the Enterobacter cloacae complex and has been reported to include human pathogens but also plant-associated strains with plant beneficial capacities. To assess the role of Enterobacter endophytes in hydrocarbon degradation, plant colonization, abundance and expression of CYP153 genes in different plant compartments, three plant species (Italian ryegrass, birdsfoot trefoil and alfalfa) were grown in sterile soil spiked with 1% diesel and inoculated with three endophytic E. ludwigii strains. Results showed that all strains were capable of hydrocarbon degradation and efficiently colonized the rhizosphere and plant interior. Two strains, ISI10-3 and BRI10-9, showed highest degradation rates of diesel fuel up to 68% and performed best in combination with Italian ryegrass and alfalfa. All strains expressed the CYP153 gene in all plant compartments, indicating an active role in degradation of diesel in association with plants. - Highlights: > E. ludwigii strains efficiently colonized plants in a non-sterile soil environment. > E. ludwigii strains efficiently expressed alkane degradation genes in plants. > E. ludwigii efficiently degraded alkane contaminations and promoted plant growth. > E. ludwigii interacted more effectively with Italian ryegrass than with other plants. > Degradation activity varied with plant and microbial genotype as well as with time. - Enterobacter ludwigii strains belonging to the E. cloacae complex are able to efficiently degrade alkanes when associated with plants and to promote plant growth.
Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression.
1996-10-01
AD GRANT NUMBER DAMDI7-94-J-4041 TITLE: Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression PRINCIPAL...October 1996 Annual (1 Sep 95 - 31 Aug 96) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS Cloning and Characterizing Genes Involved in Monoterpene Induced... Monoterpene -induced/repressed genes were identified in regressing rat mammary carcinomas treated with dietary limonene using a newly developed method
International Nuclear Information System (INIS)
Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee
2013-05-01
Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application
Energy Technology Data Exchange (ETDEWEB)
Kim, Dong Sub; Kim, Jinbaek; Ha, Bokeun; Kim, Sang Hoon; Kim, Sunhee
2013-05-15
Physiological analysis of monocot model plant (rice) in response to ionizing radiation (cosmic-ray, gamma-ray, Ion beam). - Identification of antioxidant characters through cytochemical analysis. - Comparison of antioxidant activities in response to ionizing irradiation. - Evaluation of anthocyanin quantity in response to ionizing irradiation. Ionization energy response gene family analysis via bioinformatic validation. - Expression analysis of monocot and dicot gene families. - In silico and bioinformatic approach to elucidate gene function. Characterization and functional analysis of genes specifically expressed in response to ionizing irradiation (cosmic-ray, gamma-ray, Ion beam). - High throughput trancriptomic analysis of plants under ionizing radiation using microarray. - Promotor and cis-element analysis of genes specifically expressed in response to ionizing radiation. - Validation and function analysis of candidate genes. - Elucidation of plant mechanism of sensing and response to ionization energy. Development of bioindicator plants detecting ionization energy. - Cloning and identification of 'Radio marker genes (RMG)'. - Development of Over-expression (O/E) or Knock-out (K/O) plant using RMG. Development of Genechip as an ionization energy detector. - Expression profiling analysis of genes specifically expression in response to ionization energy. - Prepare high-conserved gene specific oligomer. - Development of ionization energy monitoring Genechip and application.
Penninckx, I.A.M.A.; Eggermont, K.; Schenk, P.M.; Ackerveken, van den G.; Cammue, B.P.A.; Thomma, B.P.H.J.
2003-01-01
Jasmonate and ethylene are concomitantly involved in the induction of the Arabidopsis plant defensin gene PDF1.2. To define genes in the signal transduction pathway leading to the induction of PDF1.2, we screened for mutants with induced over-expression of a β-glucuronidase reporter, under the
Receptor-like proteins involved in plant disease resistance
Kruijt, M.; Kock, de M.J.D.; Wit, de P.J.G.M.
2005-01-01
Race-specific resistance in plants against microbial pathogens is governed by several distinct classes of resistance (R) genes. This review focuses on the class that consists of the plasma membrane-bound leucine-rich repeat proteins known as receptor-like proteins (RLPs). The first isolated
Plasencia, Anna; Soler, Marçal; Dupas, Annabelle; Ladouce, Nathalie; Silva-Martins, Guilherme; Martinez, Yves; Lapierre, Catherine; Franche, Claudine; Truchet, Isabelle; Grima-Pettenati, Jacqueline
2016-06-01
Eucalyptus are of tremendous economic importance being the most planted hardwoods worldwide for pulp and paper, timber and bioenergy. The recent release of the Eucalyptus grandis genome sequence pointed out many new candidate genes potentially involved in secondary growth, wood formation or lineage-specific biosynthetic pathways. Their functional characterization is, however, hindered by the tedious, time-consuming and inefficient transformation systems available hitherto for eucalypts. To overcome this limitation, we developed a fast, reliable and efficient protocol to obtain and easily detect co-transformed E. grandis hairy roots using fluorescent markers, with an average efficiency of 62%. We set up conditions both to cultivate excised roots in vitro and to harden composite plants and verified that hairy root morphology and vascular system anatomy were similar to wild-type ones. We further demonstrated that co-transformed hairy roots are suitable for medium-throughput functional studies enabling, for instance, protein subcellular localization, gene expression patterns through RT-qPCR and promoter expression, as well as the modulation of endogenous gene expression. Down-regulation of the Eucalyptus cinnamoyl-CoA reductase1 (EgCCR1) gene, encoding a key enzyme in lignin biosynthesis, led to transgenic roots with reduced lignin levels and thinner cell walls. This gene was used as a proof of concept to demonstrate that the function of genes involved in secondary cell wall biosynthesis and wood formation can be elucidated in transgenic hairy roots using histochemical, transcriptomic and biochemical approaches. The method described here is timely because it will accelerate gene mining of the genome for both basic research and industry purposes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Genes involved in Beauveria bassiana infection to Galleria mellonella.
Chen, Anhui; Wang, Yulong; Shao, Ying; Zhou, Qiumei; Chen, Shanglong; Wu, Yonghua; Chen, Hongwei; Liu, Enqi
2018-05-01
The ascomycete fungus Beauveria bassiana is a natural pathogen of hundreds of insect species and is commercially produced as an environmentally friendly mycoinsecticide. Many genes involved in fungal insecticide infection have been identified but few have been further explored. In this study, we constructed three transcriptomes of B. bassiana at 24, 48 and 72 h post infection of insect pests (BbI) or control (BbC). There were 3148, 3613 and 4922 genes differentially expressed at 24, 48 and 72 h post BbI/BbC infection, respectively. A large number of genes and pathways involved in infection were identified. To further analyze those genes, expression patterns across different infection stages (0, 12, 24, 36, 48, 60, 72 and 84 h) were studied using quantitative RT-PCR. This analysis showed that the infection-related genes could be divided into four patterns: highly expressed throughout the whole infection process (thioredoxin 1); highly expressed during early stages of infection but lowly expressed after the insect death (adhesin protein Mad1); lowly expressed during early infection but highly expressed after insect death (cation transporter, OpS13); or lowly expressed across the entire infection process (catalase protein). The data provide novel insights into the insect-pathogen interaction and help to uncover the molecular mechanisms involved in fungal infection of insect pests.
DEFF Research Database (Denmark)
Christiansen, Michael W; Matthewman, Colette; Podzimska-Sroka, Dagmara
2016-01-01
-expressing plants showed up-regulation of genes involved with secondary metabolism, hormone metabolism, stress, signalling, development, and transport. Up-regulation of senescence markers and hormone metabolism and signalling genes supports a role of HvNAC005 in the cross field of different hormone and signalling......The plant-specific NAC transcription factors have attracted particular attention because of their involvement in stress responses, senescence, and nutrient remobilization. The HvNAC005 gene of barley encodes a protein belonging to subgroup NAC-a6 of the NAC family. This study shows that HvNAC005...... pathways. Binding of HvNAC005 to promoter sequences of putative target genes containing the T[G/A]CGT core motif was shown by direct protein-DNA interactions of HvNAC005 with promoters for two of the up-regulated genes. In conclusion, HvNAC005 was shown to be a strong positive regulator of senescence...
Su, Junji; Li, Libei; Zhang, Chi; Wang, Caixiang; Gu, Lijiao; Wang, Hantao; Wei, Hengling; Liu, Qibao; Huang, Long; Yu, Shuxun
2018-06-01
Thirty significant associations between 22 SNPs and five plant architecture component traits in Chinese upland cotton were identified via GWAS. Four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits. A candidate gene, Gh_D03G0922, might be responsible for plant height in upland cotton. A compact plant architecture is increasingly required for mechanized harvesting processes in China. Therefore, cotton plant architecture is an important trait, and its components, such as plant height, fruit branch length and fruit branch angle, affect the suitability of a cultivar for mechanized harvesting. To determine the genetic basis of cotton plant architecture, a genome-wide association study (GWAS) was performed using a panel composed of 355 accessions and 93,250 single nucleotide polymorphisms (SNPs) identified using the specific-locus amplified fragment sequencing method. Thirty significant associations between 22 SNPs and five plant architecture component traits were identified via GWAS. Most importantly, four peak SNP loci located on chromosome D03 were simultaneously associated with more plant architecture component traits, and these SNPs were harbored in one linkage disequilibrium block. Furthermore, 21 candidate genes for plant architecture were predicted in a 0.95-Mb region including the four peak SNPs. One of these genes (Gh_D03G0922) was near the significant SNP D03_31584163 (8.40 kb), and its Arabidopsis homologs contain MADS-box domains that might be involved in plant growth and development. qRT-PCR showed that the expression of Gh_D03G0922 was upregulated in the apical buds and young leaves of the short and compact cotton varieties, and virus-induced gene silencing (VIGS) proved that the silenced plants exhibited increased PH. These results indicate that Gh_D03G0922 is likely the candidate gene for PH in cotton. The genetic variations and candidate genes identified in this study lay a foundation
Armijos Jaramillo, Vinicio Danilo; Vargas, Walter Alberto; Sukno, Serenella Ana; Thon, Michael R
2013-01-01
The genus Colletotrichum contains a large number of phytopathogenic fungi that produce enormous economic losses around the world. The effect of horizontal gene transfer (HGT) has not been studied yet in these organisms. Inter-Kingdom HGT into fungal genomes has been reported in the past but knowledge about the HGT between plants and fungi is particularly limited. We describe a gene in the genome of several species of the genus Colletotrichum with a strong resemblance to subtilisins typically found in plant genomes. Subtilisins are an important group of serine proteases, widely distributed in all of the kingdoms of life. Our hypothesis is that the gene was acquired by Colletotrichum spp. through (HGT) from plants to a Colletotrichum ancestor. We provide evidence to support this hypothesis in the form of phylogenetic analyses as well as a characterization of the similarity of the subtilisin at the primary, secondary and tertiary structural levels. The remarkable level of structural conservation of Colletotrichum plant-like subtilisin (CPLS) with plant subtilisins and the differences with the rest of Colletotrichum subtilisins suggests the possibility of molecular mimicry. Our phylogenetic analysis indicates that the HGT event would have occurred approximately 150-155 million years ago, after the divergence of the Colletotrichum lineage from other fungi. Gene expression analysis shows that the gene is modulated during the infection of maize by C. graminicola suggesting that it has a role in plant disease. Furthermore, the upregulation of the CPLS coincides with the downregulation of several plant genes encoding subtilisins. Based on the known roles of subtilisins in plant pathogenic fungi and the gene expression pattern that we observed, we postulate that the CPLSs have an important role in plant infection.
Directory of Open Access Journals (Sweden)
Bharani Manoharan
Full Text Available The bacterial plant pathogen Pseudomonas syringae pv. phaseolicola (Pph colonises the surface of common bean plants before moving into the interior of plant tissue, via wounds and stomata. In the intercellular spaces the pathogen proliferates in the apoplastic fluid and forms microcolonies (biofilms around plant cells. If the pathogen can suppress the plant's natural resistance response, it will cause halo blight disease. The process of resistance suppression is fairly well understood, but the mechanisms used by the pathogen in colonisation are less clear. We hypothesised that we could apply in vitro genetic screens to look for changes in motility, colony formation, and adhesion, which are proxies for infection, microcolony formation and cell adhesion. We made transposon (Tn mutant libraries of Pph strains 1448A and 1302A and found 106/1920 mutants exhibited alterations in colony morphology, motility and biofilm formation. Identification of the insertion point of the Tn identified within the genome highlighted, as expected, a number of altered motility mutants bearing mutations in genes encoding various parts of the flagellum. Genes involved in nutrient biosynthesis, membrane associated proteins, and a number of conserved hypothetical protein (CHP genes were also identified. A mutation of one CHP gene caused a positive increase in in planta bacterial growth. This rapid and inexpensive screening method allows the discovery of genes important for in vitro traits that can be correlated to roles in the plant interaction.
Jiang, Guimei; Jiang, Xinqiang; Lü, Peitao; Liu, Jitao; Gao, Junping; Zhang, Changqing
2014-01-01
Plant transcription factors involved in stress responses are generally classified by their involvement in either the abscisic acid (ABA)-dependent or the ABA-independent regulatory pathways. A stress-associated NAC gene from rose (Rosa hybrida), RhNAC3, was previously found to increase dehydration tolerance in both rose and Arabidopsis. However, the regulatory mechanism involved in RhNAC3 action is still not fully understood. In this study, we isolated and analyzed the upstream regulatory seq...
Expression profiling identifies genes involved in emphysema severity
Directory of Open Access Journals (Sweden)
Bowman Rayleen V
2009-09-01
Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients. Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples. Class comparison identified 98 differentially expressed genes (p p Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.
Vandelle, Elodie; Puttilli, Maria Rita; Chini, Andrea; Devescovi, Giulia; Venturi, Vittorio; Polverari, Annalisa
2017-01-01
The life cycle of bacterial phytopathogens consists of a benign epiphytic phase, during which the bacteria grow in the soil or on the plant surface, and a virulent endophytic phase involving the penetration of host defenses and the colonization of plant tissues. Innovative strategies are urgently required to integrate copper treatments that control the epiphytic phase with complementary tools that control the virulent endophytic phase, thus reducing the quantity of chemicals applied to economically and ecologically acceptable levels. Such strategies include targeted treatments that weaken bacterial pathogens, particularly those inhibiting early infection steps rather than tackling established infections. This chapter describes a reporter gene-based chemical genomic high-throughput screen for the induction of bacterial virulence by plant molecules. Specifically, we describe a chemical genomic screening method to identify agonist and antagonist molecules for the induction of targeted bacterial virulence genes by plant extracts, focusing on the experimental controls required to avoid false positives and thus ensuring the results are reliable and reproducible.
Molecular Evolution and Expression Divergence of HMT Gene Family in Plants
Directory of Open Access Journals (Sweden)
Man Zhao
2018-04-01
Full Text Available Homocysteine methyltransferase (HMT converts homocysteine to methionine using S-methylmethionine (SMM or S-adenosylmethionine (SAM as methyl donors in organisms, playing an important role in supplying methionine for the growth and the development of plants. To better understand the functions of the HMT genes in plants, we conducted a wide evolution and expression analysis of these genes. Reconstruction of the phylogenetic relationship showed that the HMT gene family was divided into Class 1 and Class 2. In Class 1, HMTs were only found in seed plants, while Class 2 presented in all land plants, which hinted that the HMT genes might have diverged in seed plants. The analysis of gene structures and selection pressures showed that they were relatively conserved during evolution. However, type I functional divergence had been detected in the HMTs. Furthermore, the expression profiles of HMTs showed their distinct expression patterns in different tissues, in which some HMTs were widely expressed in various organs, whereas the others were highly expressed in some specific organs, such as seeds or leaves. Therefore, according to our results in the evolution, functional divergence, and expression, the HMT genes might have diverged during evolution. Further analysis in the expression patterns of AthHMTs with their methyl donors suggested that the diverged HMTs might be related to supply methionine for the development of plant seeds.
Malmierca, M G; McCormick, S P; Cardoza, R E; Monte, E; Alexander, N J; Gutiérrez, S
2015-11-01
Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both the antagonistic fungus and the plant. The terpene trichodiene (TD) elicits the expression of genes related to tomato defense and to Botrytis virulence. We show here that TD itself is able to induce the expression of Botrytis genes involved in the synthesis of botrydial (BOT) and also induces terpene gene expression in Trichoderma spp. The terpene ergosterol, in addition to its role as a structural component of the fungal cell membranes, acts as an elicitor of defense response in plants. In the present work, using a transformant of T. harzianum, which is silenced in the erg1 gene and accumulates high levels of squalene, we show that this ergosterol precursor also acts as an important elicitor molecule of tomato defense-related genes and induces Botrytis genes involved in BOT biosynthesis, in both cases, in a concentration-dependent manner. Our data emphasize the importance of a balance of squalene and ergosterol in fungal interactions as well as in the biocontrol activity of Trichoderma spp.
Lilley, Catherine J.; Maqbool, Abbas; Wu, Duqing; Yusup, Hazijah B.; Jones, Laura M.; Birch, Paul R. J.; Urwin, Peter E.
2018-01-01
Plant pathogens and parasites are a major threat to global food security. Plant parasitism has arisen four times independently within the phylum Nematoda, resulting in at least one parasite of every major food crop in the world. Some species within the most economically important order (Tylenchida) secrete proteins termed effectors into their host during infection to re-programme host development and immunity. The precise detail of how nematodes evolve new effectors is not clear. Here we reconstruct the evolutionary history of a novel effector gene family. We show that during the evolution of plant parasitism in the Tylenchida, the housekeeping glutathione synthetase (GS) gene was extensively replicated. New GS paralogues acquired multiple dorsal gland promoter elements, altered spatial expression to the secretory dorsal gland, altered temporal expression to primarily parasitic stages, and gained a signal peptide for secretion. The gene products are delivered into the host plant cell during infection, giving rise to “GS-like effectors”. Remarkably, by solving the structure of GS-like effectors we show that during this process they have also diversified in biochemical activity, and likely represent the founding members of a novel class of GS-like enzyme. Our results demonstrate the re-purposing of an endogenous housekeeping gene to form a family of effectors with modified functions. We anticipate that our discovery will be a blueprint to understand the evolution of other plant-parasitic nematode effectors, and the foundation to uncover a novel enzymatic function. PMID:29641602
Babić, Katarina Huić; Schauss, Kristina; Hai, Brigitte; Sikora, Sanja; Redzepović, Sulejman; Radl, Viviane; Schloter, Michael
2008-11-01
Inoculation of leguminous seeds with selected rhizobial strains is practised in agriculture to ameliorate the plant yield by enhanced root nodulation and nitrogen uptake of the plant. However, effective symbiosis between legumes and rhizobia does not only depend on the capacity of nitrogen fixation but also on the entire nitrogen turnover in the rhizosphere. We investigated the influence of seed inoculation with two indigenous Sinorhizobium meliloti strains exhibiting different efficiency concerning plant growth promotion on nitrogen turnover processes in the rhizosphere during the growth of alfalfa. Quantification of six target genes (bacterial amoA, nirK, nirS, nosZ, nifH and archaeal amoA) within the nitrogen cycle was performed in rhizosphere samples before nodule formation, at bud development and at the late flowering stage. The results clearly demonstrated that effectiveness of rhizobial inocula is related to abundance of nifH genes in the late flowering phase of alfalfa. Moreover, other genes involved in nitrogen turnover had been affected by the inocula, e.g. higher numbers of amoA copies were observed during flowering when the more effective strain had been inoculated. However, the respective gene abundances differed overall to a greater extent between the three plant development stages than between the inoculation variants.
Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.
Panwar, Vinay; Bakkeren, Guus
2017-01-01
Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.
Li, Xiao-Jie; Li, Mo; Zhou, Ying; Hu, Shan; Hu, Rong; Chen, Yun; Li, Xue-Bao
2015-01-01
RAV (related to ABI3/VP1) protein containing an AP2 domain in the N-terminal region and a B3 domain in the C-terminal region, which belongs to AP2 transcription factor family, is unique in higher plants. In this study, a gene (GhRAV1) encoding a RAV protein of 357 amino acids was identified in cotton (Gossypium hirsutum). Transient expression analysis of the eGFP:GhRAV1 fusion genes in tobacco (Nicotiana tabacum) epidermal cells revealed that GhRAV1 protein was localized in the cell nucleus. Quantitative RT-PCR analysis indicated that expression of GhRAV1 in cotton is induced by abscisic acid (ABA), NaCl and polyethylene glycol (PEG). Overexpression of GhRAV1 in Arabidopsis resulted in plant sensitive to ABA, NaCl and PEG. With abscisic acid (ABA) treatment, seed germination and green seedling rates of the GhRAV1 transgenic plants were remarkably lower than those of wild type. In the presence of NaCl, the seed germination and seedling growth of the GhRAV1 transgenic lines were inhibited greater than those of wild type. And chlorophyll content and maximum photochemical efficiency of the transgenic plants were significantly lower than those of wild type. Under drought stress, the GhRAV1 transgenic plants displayed more severe wilting than wild type. Furthermore, expressions of the stress-related genes were altered in the GhRAV1 transgenic Arabidopsis plants under high salinity and drought stresses. Collectively, our data suggested that GhRAV1 may be involved in response to high salinity and drought stresses through regulating expressions of the stress-related genes during cotton development.
Pandey, Sonika; Patel, Manish Kumar; Mishra, Avinash; Jha, Bhavanath
2016-01-01
Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII) specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13), overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid), and lower electrolytic leakage, lipid peroxidation (MDA content) and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.
Directory of Open Access Journals (Sweden)
Sonika Pandey
Full Text Available Cumin is an annual, herbaceous, medicinal, aromatic, spice glycophyte that contains diverse applications as a food and flavoring additive, and therapeutic agents. An efficient, less time consuming, Agrobacterium-mediated, a tissue culture-independent in planta genetic transformation method was established for the first time using cumin seeds. The SbNHX1 gene, cloned from an extreme halophyte Salicornia brachiata was transformed in cumin using optimized in planta transformation method. The SbNHX1 gene encodes a vacuolar Na+/H+ antiporter and is involved in the compartmentalization of excess Na+ ions into the vacuole and maintenance of ion homeostasis Transgenic cumin plants were confirmed by PCR using gene (SbNHX1, uidA and hptII specific primers. The single gene integration event and overexpression of the gene were confirmed by Southern hybridization and competitive RT-PCR, respectively. Transgenic lines L3 and L13 showed high expression of the SbNHX1 gene compared to L6 whereas moderate expression was detected in L5 and L10 transgenic lines. Transgenic lines (L3, L5, L10 and L13, overexpressing the SbNHX1 gene, showed higher photosynthetic pigments (chlorophyll a, b and carotenoid, and lower electrolytic leakage, lipid peroxidation (MDA content and proline content as compared to wild type plants under salinity stress. Though transgenic lines were also affected by salinity stress but performed better compared to WT plants. The ectopic expression of the SbNHX1 gene confirmed enhanced salinity stress tolerance in cumin as compared to wild type plants under stress condition. The present study is the first report of engineering salt tolerance in cumin, so far and the plant may be utilized for the cultivation in saline areas.
Macho-Rivero, Miguel Ángel; Camacho-Cristóbal, Juan José; Herrera-Rodríguez, María Begoña; Müller, Maren; Munné-Bosch, Sergi; González-Fontes, Agustín
2017-05-01
Boron (B) is an essential microelement for vascular plant development, but its toxicity is a major problem affecting crop yields in arid and semi-arid areas of the world. In the literature, several genes involved in abscisic acid (ABA) signalling and responses are upregulated in Arabidopsis roots after treatment with excess B. It is known that the AtNCED3 gene, which encodes a crucial enzyme for ABA biosynthesis, plays a key role in the plant response to drought stress. In this study, root AtNCED3 expression and shoot ABA content were rapidly increased in wild-type plants upon B-toxicity treatment. The Arabidopsis ABA-deficient nced3-2 mutant had higher transpiration rate, stomatal conductance and accumulated more B in their shoots than wild-type plants, facts that were associated with the lower levels of ABA in this mutant. However, in wild-type plants, B toxicity caused a significant reduction in stomatal conductance, resulting in a decreased transpiration rate. This response could be a mechanism to limit the transport of excess B from the roots to the leaves under B toxicity. In agreement with the higher transpiration rate of the nced3-2 mutant, this genotype showed an increased leaf B concentration and damage upon exposure to 5 mM B. Under B toxicity, ABA application decreased B accumulation in wild-type and nced3-2 plants. In summary, this work shows that excess B applied to the roots leads to rapid changes in AtNCED3 expression and gas exchange parameters that would contribute to restrain the B entry into the leaves, this effect being mediated by ABA. © 2016 Scandinavian Plant Physiology Society.
Divergence and adaptive evolution of the gibberellin oxidase genes in plants.
Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan
2015-09-29
The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.
Scholthof, Karen-Beth G
2017-02-01
One of the seminal events in plant pathology was the discovery by Francis O. Holmes that necrotic local lesions induced on certain species of Nicotiana following rub-inoculation of Tobacco mosaic virus (TMV) was due to a specific interaction involving a dominant host gene (N). From this, Holmes had an idea that if the N gene from N. glutinosa was introgressed into susceptible tobacco, the greatly reduced titer of TMV would, by extension, prevent subsequent infection of tomato and pepper plants by field workers whose hands were contaminated with TMV from their use of chewing and smoking tobacco. The ultimate outcome has many surprising twists and turns, including Holmes' failure to obtain fertile crosses of N. glutinosa × N. tabacum after 3 years of intensive work. Progress was made with N. digluta, a rare amphidiploid that was readily crossed with N. tabacum. And, importantly, the first demonstration by Holmes of the utility of interspecies hybridization for virus resistance was made with Capsicum (pepper) species with the identification of the L gene in Tabasco pepper, that he introgressed into commercial bell pepper varieties. Holmes' findings are important as they predate Flor's gene-for-gene hypothesis, show the use of interspecies hybridization for control of plant pathogens, and the use of the local lesion as a bioassay to monitor resistance events in crop plants.
Iaria, Domenico; Chiappetta, Adriana; Muzzalupo, Innocenzo
2016-01-01
In olive (Olea europaea L.), the processes controlling self-incompatibility are still unclear and the molecular basis underlying this process are still not fully characterized. In order to determine compatibility relationships, using next-generation sequencing techniques and a de novo transcriptome assembly strategy, we show that pollen tubes from different olive plants, grown in vitro in a medium containing its own pistil and in combination pollen/pistil from self-sterile and self-fertile cultivars, have a distinct gene expression profile and many of the differentially expressed sequences between the samples fall within gene families involved in the development of the pollen tube, such as lipase, carboxylesterase, pectinesterase, pectin methylesterase, and callose synthase. Moreover, different genes involved in signal transduction, transcription, and growth are overrepresented. The analysis also allowed us to identify members in actin and actin depolymerization factor and fibrin gene family and member of the Ca(2+) binding gene family related to the development and polarization of pollen apical tip. The whole transcriptomic analysis, through the identification of the differentially expressed transcripts set and an extended functional annotation analysis, will lead to a better understanding of the mechanisms of pollen germination and pollen tube growth in the olive.
Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz
2012-01-01
The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887
Directory of Open Access Journals (Sweden)
Manuella Nóbrega Dourado
2012-01-01
Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.
Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz
2012-01-01
The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.
Alteration of plant meristem function by manipulation of the Retinoblastoma-like plant RRB gene
Durfee, Tim [Madison, WI; Feiler, Heidi [Albany, CA; Gruissem, Wilhelm [Forch, CH; Jenkins, Susan [Martinez, CA; Roe, Judith [Manhattan, KS; Zambryski, Patricia [Berkeley, CA
2007-01-16
This invention provides methods and compositions for altering the growth, organization, and differentiation of plant tissues. The invention is based on the discovery that, in plants, genetically altering the levels of Retinoblastoma-related gene (RRB) activity produces dramatic effects on the growth, proliferation, organization, and differentiation of plant meristem.
Directory of Open Access Journals (Sweden)
Tushar Kanti Dutta
2015-04-01
Full Text Available Root-knot nematodes (Meloidogyne incognita cause substantial yield losses in vegetables worldwide, and are difficult to manage. Continuous withdrawal of environmentally-harmful nematicides from the global market warrants the need for novel nematode management strategies. Utility of host-delivered RNAi has been demonstrated in several plants (Arabidopsis, tobacco and soybean that exhibited resistance against root-knot and cyst nematodes. Herein, a M. incognita-specific protease gene, cathepsin L cysteine proteinase (Mi-cpl-1, was targeted to generate tomato transgenic lines to evaluate the genetically modified nematode resistance. In vitro knockdown of Mi-cpl-1 gene led to the reduced attraction and penetration of M. incognita in tomato, suggesting the involvement of Mi-cpl-1 in nematode parasitism. Transgenic expression of the RNAi construct of Mi-cpl-1 gene resulted in 60-80% reduction in infection and multiplication of M. incognita in tomato. Evidence for in vitro and in vivo silencing of Mi-cpl-1 was confirmed by expression analysis using quantitative PCR. Our study demonstrates that Mi-cpl-1 plays crucial role during plant-nematode interaction and plant-mediated downregulation of this gene elicits detrimental effect on M. incognita development, reinforcing the potential of RNAi technology for management of phytonematodes in crop plants.
DEFF Research Database (Denmark)
Piercey, Marta J.; Hingston, Patricia A.; Hansen, Lisbeth Truelstrup
2016-01-01
proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan,teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p b 0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more......Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30–37 °C rather than at temperatures found in the food processing plants (i.e., 10–20 °C......). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesisapproach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants wascreated. Mutants with reduced or enhanced biofilm...
Energy Technology Data Exchange (ETDEWEB)
Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)
2016-08-15
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
International Nuclear Information System (INIS)
Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po
2016-01-01
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
Directory of Open Access Journals (Sweden)
Wei Fan
2018-06-01
Full Text Available The zinc-regulated transporters, iron-regulated transporter-like proteins (ZIPs, the natural resistance and macrophage proteins (NRAMP, the heavy metal ATPases (HMAs and the metal tolerance or transporter proteins (MTPs families are involved in cadmium (Cd uptake, translocation and sequestration in plants. Mulberry (Morus L., one of the most ecologically and economically important (as a food plant for silkworm production genera of perennial trees, exhibits excellent potential for remediating Cd-contaminated soils. However, there is no detailed information about the genes involved in Cd2+ transport in mulberry. In this study, we identified 31 genes based on a genome-wide analysis of the Morus notabilis genome database. According to bioinformatics analysis, the four transporter gene families in Morus were distributed in each group of the phylogenetic tree, and the gene exon/intron structure and protein motif structure were similar among members of the same group. Subcellular localization software predicted that these transporters were mainly distributed in the plasma membrane and the vacuolar membrane, with members of the same group exhibiting similar subcellular locations. Most of the gene promoters contained abiotic stress-related cis-elements. The expression patterns of these genes in different organs were determined, and the patterns identified, allowing the categorization of these genes into four groups. Under low or high-Cd2+ concentrations (30 μM or 100 μM, respectively, the transcriptional regulation of the 31 genes in root, stem and leaf tissues of M. alba seedlings differed with regard to tissue and time of peak expression. Heterologous expression of MaNRAMP1, MaHMA3, MaZIP4, and MaIRT1 in Saccharomyces cerevisiae increased the sensitivity of yeast to Cd, suggested that these transporters had Cd transport activity. Subcellular localization experiment showed that the four transporters were localized to the plasma membrane of yeast and
pGenN, a Gene Normalization Tool for Plant Genes and Proteins in Scientific Literature
Ding, Ruoyao; Arighi, Cecilia N.; Lee, Jung-Youn; Wu, Cathy H.; Vijay-Shanker, K.
2015-01-01
Background Automatically detecting gene/protein names in the literature and connecting them to databases records, also known as gene normalization, provides a means to structure the information buried in free-text literature. Gene normalization is critical for improving the coverage of annotation in the databases, and is an essential component of many text mining systems and database curation pipelines. Methods In this manuscript, we describe a gene normalization system specifically tailored for plant species, called pGenN (pivot-based Gene Normalization). The system consists of three steps: dictionary-based gene mention detection, species assignment, and intra species normalization. We have developed new heuristics to improve each of these phases. Results We evaluated the performance of pGenN on an in-house expertly annotated corpus consisting of 104 plant relevant abstracts. Our system achieved an F-value of 88.9% (Precision 90.9% and Recall 87.2%) on this corpus, outperforming state-of-art systems presented in BioCreative III. We have processed over 440,000 plant-related Medline abstracts using pGenN. The gene normalization results are stored in a local database for direct query from the pGenN web interface (proteininformationresource.org/pgenn/). The annotated literature corpus is also publicly available through the PIR text mining portal (proteininformationresource.org/iprolink/). PMID:26258475
Directory of Open Access Journals (Sweden)
Pedro J. Rocha
2002-07-01
Full Text Available Catharanthus roseus (L. G Don is a medicinal plant that produces a variety of terpenoid indole alkaloids (TIAs, some of which display pharmacological activity. C. roseus plants and cell cultures have been used to elucidate the TIAs biosynthetic pathway. A considerable number or enzymes have also been characterised, and their respective genes cloned. TIAs production in C. roseus plant and cell cultures is highly regulated at transcriptional-, develop-mental-, and environmental-level. Studies into TIAs biosynthetic gene regulation have been carried out using cell cultures. However, regulation in plants is almost unknown. Here, biosynthetic genes idc, strl, d4h and dat expres-sion levels are qualitatively examined in a developmental series of C. roseus seedlings. The effect of water- and light-stress and methyl jasmonate (MeJa and acetyl salicylic acid (ASA elicitation is also examined. Comparison between seedlings and cell cultures strongly suggests that TIAs biosynthetic gene transcriptional regulation is different in C.roseus plants and cell cultures.
Yousfi, Fatma-Ezzahra; Makhloufi, Emna; Marande, William; Ghorbel, Abdel W; Bouzayen, Mondher; Bergès, Hélène
2016-01-01
WRKY transcription factors are involved in multiple aspects of plant growth, development and responses to biotic stresses. Although they have been found to play roles in regulating plant responses to environmental stresses, these roles still need to be explored, especially those pertaining to crops. Durum wheat is the second most widely produced cereal in the world. Complex, large and unsequenced genomes, in addition to a lack of genomic resources, hinder the molecular characterization of tolerance mechanisms. This paper describes the isolation and characterization of five TdWRKY genes from durum wheat ( Triticum turgidum L . ssp. durum ). A PCR-based screening of a T. turgidum BAC genomic library using primers within the conserved region of WRKY genes resulted in the isolation of five BAC clones. Following sequencing fully the five BACs, fine annotation through Triannot pipeline revealed 74.6% of the entire sequences as transposable elements and a 3.2% gene content with genes organized as islands within oceans of TEs. Each BAC clone harbored a TdWRKY gene. The study showed a very extensive conservation of genomic structure between TdWRKYs and their orthologs from Brachypodium, barley, and T. aestivum . The structural features of TdWRKY proteins suggested that they are novel members of the WRKY family in durum wheat. TdWRKY1/2/4, TdWRKY3, and TdWRKY5 belong to the group Ia, IIa, and IIc, respectively. Enrichment of cis -regulatory elements related to stress responses in the promoters of some TdWRKY genes indicated their potential roles in mediating plant responses to a wide variety of environmental stresses. TdWRKY genes displayed different expression patterns in response to salt stress that distinguishes two durum wheat genotypes with contrasting salt stress tolerance phenotypes. TdWRKY genes tended to react earlier with a down-regulation in sensitive genotype leaves and with an up-regulation in tolerant genotype leaves. The TdWRKY transcripts levels in roots
Discovery of a novel gene involved in autolysis of Clostridium cells.
Yang, Liejian; Bao, Guanhui; Zhu, Yan; Dong, Hongjun; Zhang, Yanping; Li, Yin
2013-06-01
Cell autolysis plays important physiological roles in the life cycle of clostridial cells. Understanding the genetic basis of the autolysis phenomenon of pathogenic Clostridium or solvent producing Clostridium cells might provide new insights into this important species. Genes that might be involved in autolysis of Clostridium acetobutylicum, a model clostridial species, were investigated in this study. Twelve putative autolysin genes were predicted in C. acetobutylicum DSM 1731 genome through bioinformatics analysis. Of these 12 genes, gene SMB_G3117 was selected for testing the in tracellular autolysin activity, growth profile, viable cell numbers, and cellular morphology. We found that overexpression of SMB_G3117 gene led to earlier ceased growth, significantly increased number of dead cells, and clear electrolucent cavities, while disruption of SMB_G3117 gene exhibited remarkably reduced intracellular autolysin activity. These results indicate that SMB_G3117 is a novel gene involved in cellular autolysis of C. acetobutylicum.
Linking plant nutritional status to plant-microbe interactions.
Carvalhais, Lilia C; Dennis, Paul G; Fan, Ben; Fedoseyenko, Dmitri; Kierul, Kinga; Becker, Anke; von Wiren, Nicolaus; Borriss, Rainer
2013-01-01
Plants have developed a wide-range of adaptations to overcome nutrient limitation, including changes to the quantity and composition of carbon-containing compounds released by roots. Root-associated bacteria are largely influenced by these compounds which can be perceived as signals or substrates. Here, we evaluate the effect of root exudates collected from maize plants grown under nitrogen (N), phosphate (P), iron (Fe) and potassium (K) deficiencies on the transcriptome of the plant growth promoting rhizobacterium (PGPR) Bacillus amyloliquefaciens FZB42. The largest shifts in gene expression patterns were observed in cells exposed to exudates from N-, followed by P-deficient plants. Exudates from N-deprived maize triggered a general stress response in FZB42 in the exponential growth phase, which was evidenced by the suppression of numerous genes involved in protein synthesis. Exudates from P-deficient plants induced bacterial genes involved in chemotaxis and motility whilst exudates released by Fe and K deficient plants did not cause dramatic changes in the bacterial transcriptome during exponential growth phase. Global transcriptional changes in bacteria elicited by nutrient deficient maize exudates were significantly correlated with concentrations of the amino acids aspartate, valine and glutamate in root exudates suggesting that transcriptional profiling of FZB42 associated with metabolomics of N, P, Fe and K-deficient maize root exudates is a powerful approach to better understand plant-microbe interactions under conditions of nutritional stress.
The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion
Directory of Open Access Journals (Sweden)
Tran Lan T
2012-08-01
Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic
Liu, Xiaolin; Liu, Wei; Sun, Yu; Xia, Chunlei; Elmerich, Claudine; Xie, Zhihong
2018-02-01
Chemotaxis can provide bacteria with competitive advantages for survival in complex environments. The CheZ chemotaxis protein is a phosphatase, affecting the flagellar motor in Escherichia coli by dephosphorylating the response regulator phosphorylated CheY protein (CheY∼P) responsible for clockwise rotation. A cheZ gene has been found in Azorhizobium caulinodans ORS571, in contrast to other rhizobial species studied so far. The CheZ protein in strain ORS571 has a conserved motif similar to that corresponding to the phosphatase active site in E. coli The construction of a cheZ deletion mutant strain and of cheZ mutant strains carrying a mutation in residues of the putative phosphatase active site showed that strain ORS571 participates in chemotaxis and motility, causing a hyperreversal behavior. In addition, the properties of the cheZ deletion mutant revealed that ORS571 CheZ is involved in other physiological processes, since it displayed increased flocculation, biofilm formation, exopolysaccharide (EPS) production, and host root colonization. In particular, it was observed that the expression of several exp genes, involved in EPS synthesis, was upregulated in the cheZ mutant compared to that in the wild type, suggesting that CheZ negatively controls exp gene expression through an unknown mechanism. It is proposed that CheZ influences the Azorhizobium -plant association by negatively regulating early colonization via the regulation of EPS production. This report established that CheZ in A. caulinodans plays roles in chemotaxis and the symbiotic association with the host plant. IMPORTANCE Chemotaxis allows bacteria to swim toward plant roots and is beneficial to the establishment of various plant-microbe associations. The level of CheY phosphorylation (CheY∼P) is central to the chemotaxis signal transduction. The mechanism of the signal termination of CheY∼P remains poorly characterized among Alphaproteobacteria , except for Sinorhizobium meliloti , which
Qin, J; Ma, X; Yi, Z; Tang, Z; Meng, Y
2016-03-01
Leaf senescence is an important physiological process during the plant life cycle. However, systemic studies on the impact of microRNAs (miRNAs) on the expression of senescence-associated genes (SAGs) are lacking. Besides, whether other Argonaute 1 (AGO1)-enriched small RNAs (sRNAs) play regulatory roles in leaf senescence remains unclear. In this study, a total of 5,123 and 1,399 AGO1-enriched sRNAs, excluding miRNAs, were identified in Arabidopsis thaliana and rice (Oryza sativa), respectively. After retrieving SAGs from the Leaf Senescence Database, all of the AGO1-enriched sRNAs and the miRBase-registered miRNAs of these two plants were included for target identification. Supported by degradome signatures, 200 regulatory pairs involving 120 AGO1-enriched sRNAs and 40 SAGs, and 266 regulatory pairs involving 64 miRNAs and 42 SAGs were discovered in Arabidopsis. Moreover, 13 genes predicted to interact with some of the above-identified target genes at protein level were validated as regulated by 17 AGO1-enriched sRNAs and ten miRNAs in Arabidopsis. In rice, only one SAG was targeted by three AGO1-enriched sRNAs, and one SAG was targeted by miR395. However, five AGO1-enriched sRNAs were conserved between Arabidopsis and rice. Target genes conserved between the two plants were identified for three of the above five sRNAs, pointing to the conserved roles of these regulatory pairs in leaf senescence or other developmental procedures. Novel targets were discovered for three of the five AGO1-enriched sRNAs in rice, indicating species-specific functions of these sRNA-target pairs. These results could advance our understanding of the sRNA-involved molecular processes modulating leaf senescence. © 2015 German Botanical Society and The Royal Botanical Society of the Netherlands.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
International Nuclear Information System (INIS)
Arif, A.; Mohsin, A.M.; Shafiq, S.; Zafar, Y.; Hameed, S.M.; Arif, M.; Javed, M.; Gaxiola, R.A.
2005-01-01
Drought and salinity are global problems. In Pakistan these problems are increasing to an alarming situation due to low rain-fall and bad agricultural practices. Salt and drought stress shows a high degree of similarity with respect to physiological, biochemical, molecular and genetic effects. This is due to the fact that sub-lethal salt-stress condition is ultimately an osmotic effect which is apparently similar to that brought in by water deficit. Genetic engineering allows the re-introduction of plant genes into their genomes by increasing their expression level. Plant vacuoles play a central role in cellular mechanisms of adaptation to salinity and drought stresses. In principle, increased vacuolar solute accumulation should have a positive impact in the adaptation of plants to salinity and drought. The active transport of the solutes depends on the proton gradients established by proton pumps. We have over expressed Arabidopsis gene AVP1 (Arabidopsis thaliana vacuolar pyro phosphatase H/sup +/ pump) to increase drought/salt tolerance in tobacco. The AVP1 ORF with a tandem repeat of 358 promoter was cloned in pPZP212 vector and Agrobacterium-mediated transformation was performed. Transgenic plants were selected on plant nutrient agar medium supplemented with 50 mg/liter kanamycin. Transgenic plants were confirmed for transfer of genes by AVP1 and nptll gene specific PCR and Southern hybridization. AVP1 transgenic plants were screened for salt tolerance by providing NaCl solution in addition to nutrient solution. AVP1 transgenic plants showed tolerance up to 300 mM NaCl as compared to control which died ten days after 200 mM NaCl. Sodium and potassium were measured in salt treated and control plants. Results showed that sodium ion uptake in the salt treated transgenic plants was four times more as compared to wild type. This remarkable increase in Na/sup +/ ion uptake indicates that AVP1 vacuole proton pumps are actively involved in the transport of Na
CCDB: a curated database of genes involved in cervix cancer.
Agarwal, Subhash M; Raghav, Dhwani; Singh, Harinder; Raghava, G P S
2011-01-01
The Cervical Cancer gene DataBase (CCDB, http://crdd.osdd.net/raghava/ccdb) is a manually curated catalog of experimentally validated genes that are thought, or are known to be involved in the different stages of cervical carcinogenesis. In spite of the large women population that is presently affected from this malignancy still at present, no database exists that catalogs information on genes associated with cervical cancer. Therefore, we have compiled 537 genes in CCDB that are linked with cervical cancer causation processes such as methylation, gene amplification, mutation, polymorphism and change in expression level, as evident from published literature. Each record contains details related to gene like architecture (exon-intron structure), location, function, sequences (mRNA/CDS/protein), ontology, interacting partners, homology to other eukaryotic genomes, structure and links to other public databases, thus augmenting CCDB with external data. Also, manually curated literature references have been provided to support the inclusion of the gene in the database and establish its association with cervix cancer. In addition, CCDB provides information on microRNA altered in cervical cancer as well as search facility for querying, several browse options and an online tool for sequence similarity search, thereby providing researchers with easy access to the latest information on genes involved in cervix cancer.
Domestication of transposable elements into MicroRNA genes in plants.
Directory of Open Access Journals (Sweden)
Yang Li
Full Text Available Transposable elements (TE usually take up a substantial portion of eukaryotic genome. Activities of TEs can cause genome instability or gene mutations that are harmful or even disastrous to the host. TEs also contribute to gene and genome evolution at many aspects. Part of miRNA genes in mammals have been found to derive from transposons while convincing evidences are absent for plants. We found that a considerable number of previously annotated plant miRNAs are identical or homologous to transposons (TE-MIR, which include a small number of bona fide miRNA genes that conform to generally accepted plant miRNA annotation rules, and hairpin derived siRNAs likely to be pre-evolved miRNAs. Analysis of these TE-MIRs indicate that transitions from the medium to high copy TEs into miRNA genes may undergo steps such as inverted repeat formation, sequence speciation and adaptation to miRNA biogenesis. We also identified initial target genes of the TE-MIRs, which contain homologous sequences in their CDS as consequence of cognate TE insertions. About one-third of the initial target mRNAs are supported by publicly available degradome sequencing data for TE-MIR sRNA induced cleavages. Targets of the TE-MIRs are biased to non-TE related genes indicating their penchant to acquire cellular functions during evolution. Interestingly, most of these TE insertions span boundaries between coding and non-coding sequences indicating their incorporation into CDS through alteration of splicing or translation start or stop signals. Taken together, our findings suggest that TEs in gene rich regions can form foldbacks in non-coding part of transcripts that may eventually evolve into miRNA genes or be integrated into protein coding sequences to form potential targets in a "temperate" manner. Thus, transposons may supply as resources for the evolution of miRNA-target interactions in plants.
Kier, Larry D; Petrick, Jay S
2008-08-01
The current globally recognized comparative food and feed safety assessment paradigm for biotechnology-derived crops is a robust and comprehensive approach for evaluating the safety of both the inserted gene product and the resulting crop. Incorporating many basic concepts from food safety, toxicology, nutrition, molecular biology, and plant breeding, this approach has been used effectively by scientists and regulatory agencies for 10-15 years. Current and future challenges in agriculture include the need for improved yields, tolerance to biotic and abiotic stresses, and improved nutrition. The next generation of biotechnology-derived crops may utilize regulatory proteins, such as transcription factors that modulate gene expression and/or endogenous plant pathways. In this review, we discuss the applicability of the current safety assessment paradigm to biotechnology-derived crops developed using modifications involving regulatory proteins. The growing literature describing the molecular biology underlying plant domestication and conventional breeding demonstrates the naturally occurring genetic variation found in plants, including significant variation in the classes, expression, and activity of regulatory proteins. Specific examples of plant modifications involving insertion or altered expression of regulatory proteins are discussed as illustrative case studies supporting the conclusion that the current comparative safety assessment process is appropriate for these types of biotechnology-developed crops.
Plants, plant pathogens, and microgravity--a deadly trio
Leach, J. E.; Ryba-White, M.; Sun, Q.; Wu, C. J.; Hilaire, E.; Gartner, C.; Nedukha, O.; Kordyum, E.; Keck, M.; Leung, H.;
2001-01-01
Plants grown in spaceflight conditions are more susceptible to colonization by plant pathogens. The underlying causes for this enhanced susceptibility are not known. Possibly the formation of structural barriers and the activation of plant defense response components are impaired in spaceflight conditions. Either condition would result from altered gene expression of the plant. Because of the tools available, past studies focused on a few physiological responses or biochemical pathways. With recent advances in genomics research, new tools, including microarray technologies, are available to examine the global impact of growth in the spacecraft on the plant's gene expression profile. In ground-based studies, we have developed cDNA subtraction libraries of rice that are enriched for genes induced during pathogen infection and the defense response. Arrays of these genes are being used to dissect plant defense response pathways in a model system involving wild-type rice plants and lesion mimic mutants. The lesion mimic mutants are ideal experimental tools because they erratically develop defense response-like lesions in the absence of pathogens. The gene expression profiles from these ground-based studies will provide the molecular basis for understanding the biochemical and physiological impacts of spaceflight on plant growth, development and disease defense responses. This, in turn, will allow the development of strategies to manage plant disease for life in the space environment.
Rodríguez-Luna, Stefany Daniela; Cruz Vázquez, Angélica Patricia; Jiménez Suárez, Verónica; Rodríguez-Sanoja, Romina; Alvarez-Buylla, Elena R.; Sánchez, Sergio
2018-01-01
Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions. PMID:29447216
Directory of Open Access Journals (Sweden)
Corina Diana Ceapă
Full Text Available Endophytic bacteria are wide-spread and associated with plant physiological benefits, yet their genomes and secondary metabolites remain largely unidentified. In this study, we explored the genome of the endophyte Streptomyces scabrisporus NF3 for discovery of potential novel molecules as well as genes and metabolites involved in host interactions. The complete genomes of seven Streptomyces and three other more distantly related bacteria were used to define the functional landscape of this unique microbe. The S. scabrisporus NF3 genome is larger than the average Streptomyces genome and not structured for an obligate endosymbiotic lifestyle; this and the fact that can grow in R2YE media implies that it could include a soil-living stage. The genome displays an enrichment of genes associated with amino acid production, protein secretion, secondary metabolite and antioxidants production and xenobiotic degradation, indicating that S. scabrisporus NF3 could contribute to the metabolic enrichment of soil microbial communities and of its hosts. Importantly, besides its metabolic advantages, the genome showed evidence for differential functional specificity and diversification of plant interaction molecules, including genes for the production of plant hormones, stress resistance molecules, chitinases, antibiotics and siderophores. Given the diversity of S. scabrisporus mechanisms for host upkeep, we propose that these strategies were necessary for its adaptation to plant hosts and to face changes in environmental conditions.
High Rate of Chimeric Gene Origination by Retroposition in Plant Genomes
DEFF Research Database (Denmark)
Wang, Wen; Zheng, Hongkung; Fan, Chuanzhu
2006-01-01
Retroposition is widely found to play essential roles in origination of new mammalian and other animal genes. However, the scarcity of retrogenes in plants has led to the assumption that plant genomes rarely evolve new gene duplicates by retroposition, despite abundant retrotransposons in plants......, confirming a previously observed role of retroelements in generating plant retrogenes. Substitution analyses revealed that the vast majority are subject to negative selection, suggesting, along with expression data and evidence of age, that they are likely functional retrogenes. In addition, 42...
Park, Jeong-Mi; Manen, Jean-François; Schneeweiss, Gerald M
2007-06-01
Plastid sequences are among the most widely used in phylogenetic and phylogeographic studies in flowering plants, where they are usually assumed to evolve like non-recombining, uniparentally transmitted, single-copy genes. Among others, this assumption can be violated by intracellular gene transfer (IGT) within cells or by the exchange of genes across mating barriers (horizontal gene transfer, HGT). We report on HGT of a plastid region including rps2, trnL-F, and rbcL in a group of non-photosynthetic flowering plants. Species of the parasitic broomrape genus Phelipanche harbor two copies of rps2, a plastid ribosomal gene, one corresponding to the phylogenetic position of the respective species, the other being horizontally acquired from the related broomrape genus Orobanche. While the vertically transmitted copies probably reside within the plastid genome, the localization of the horizontally acquired copies is not known. With both donor and recipient being parasitic plants, a possible pathway for the exchange of genetic material is via a commonly attacked host.
Directory of Open Access Journals (Sweden)
Lifeng Zhou
2016-09-01
Full Text Available Bursaphelenchus mucronatus (B. mucronatus isolates that originate from different regions may vary in their virulence, but their virulence-associated genes and proteins are poorly understood. Thus, we conducted an integrated study coupling RNA-Seq and isobaric tags for relative and absolute quantitation (iTRAQ to analyse transcriptomic and proteomic data of highly and weakly virulent B. mucronatus isolates during the pathogenic processes. Approximately 40,000 annotated unigenes and 5000 proteins were gained from the isolates. When we matched all of the proteins with their detected transcripts, a low correlation coefficient of r = 0.138 was found, indicating probable post-transcriptional gene regulation involved in the pathogenic processes. A functional analysis showed that five differentially expressed proteins which were all highly expressed in the highly virulent isolate were involved in the pathogenic processes of nematodes. Peroxiredoxin, fatty acid- and retinol-binding protein, and glutathione peroxidase relate to resistance against plant defence responses, while β-1,4-endoglucanase and expansin are associated with the breakdown of plant cell walls. Thus, the pathogenesis of B. mucronatus depends on its successful survival in host plants. Our work adds to the understanding of B. mucronatus’ pathogenesis, and will aid in controlling B. mucronatus and other pinewood nematode species complexes in the future.
Localizing genes using linkage disequilibrium in plants: integrating ...
African Journals Online (AJOL)
GREGO
2007-03-19
Mar 19, 2007 ... Localizing genes using linkage disequilibrium in plants: integrating lessons ... reduce that association as a function of the marker distance from the QTL. ..... the gene locus enhanced the resolution power of asso- ciation tests .... agents, such as insects, birds, water and wind, so mating is determined by a ...
Ancient signals: comparative genomics of plant MAPK and MAPKK gene families
DEFF Research Database (Denmark)
Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee
2006-01-01
MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...
Zhou, Man; Li, Dayong; Li, Zhigang; Hu, Qian; Yang, Chunhua; Zhu, Lihuang; Luo, Hong
2013-01-01
MicroRNA319 (miR319) is one of the first characterized and conserved microRNA families in plants and has been demonstrated to target TCP (for TEOSINTE BRANCHED/CYCLOIDEA/PROLIFERATING CELL FACTORS [PCF]) genes encoding plant-specific transcription factors. MiR319 expression is regulated by environmental stimuli, suggesting its involvement in plant stress response, although experimental evidence is lacking and the underlying mechanism remains elusive. This study investigates the role that miR319 plays in the plant response to abiotic stress using transgenic creeping bentgrass (Agrostis stolonifera) overexpressing a rice (Oryza sativa) miR319 gene, Osa-miR319a. We found that transgenic plants overexpressing Osa-miR319a displayed morphological changes and exhibited enhanced drought and salt tolerance associated with increased leaf wax content and water retention but reduced sodium uptake. Gene expression analysis indicated that at least four putative miR319 target genes, AsPCF5, AsPCF6, AsPCF8, and AsTCP14, and a homolog of the rice NAC domain gene AsNAC60 were down-regulated in transgenic plants. Our results demonstrate that miR319 controls plant responses to drought and salinity stress. The enhanced abiotic stress tolerance in transgenic plants is related to significant down-regulation of miR319 target genes, implying their potential for use in the development of novel molecular strategies to genetically engineer crop species for enhanced resistance to environmental stress. PMID:23292790
Li, Meng-Jun; Qiao, Yu; Li, Ya-Qing; Shi, Zhan-Liang; Zhang, Nan; Bi, Cai-Li; Guo, Jin-Kao
2016-11-01
We isolated the TaMYBsm1 genes, encoding R2R3-type MYB proteins in common wheat, aimed to uncover the possible molecular mechanisms related to drought response. The TaMYBsm1 genes, TaMYBsm1-A, TaMYBsm1-B and TaMYBsm1-D, were isolated and analyzed from the common wheat cultivar Shimai 15. Their expression patterns under PEG 6000 and mannitol were monitored by semi-quantitative RT-PCR and β-glucuronidase (Gus) assay. The function of TaMYBsm1-D under drought stress in transgenic Arabidopsis plants was investigated, and the germination rate, water loss rate, as well as the proline and malondialdehyde (MDA) content were compared with that in wild type (WT) plants. The expression of three downstream genes (DREB2A, P5CS1 and RD29A) in TaMYBsm1-D transgenic plants was analyzed. The R2R3-MYB domains of the MYBsm1 proteins were highly conserved in plants. In addition, the TaMYBsm1 proteins were targeted to the nucleus and contained transcriptional activation domains (TADs). Gus assay and semi-quantitative RT-PCR analysis demonstrated that the TaMYBsm1 genes were up-regulated when the wheat was treated by PEG and mannitol. Compared with WT plants, the germination rates were much higher, but the water loss rates were much lower in TaMYBsm1-D overexpression plants. TaMYBsm1-D transgenic plants showed distinct higher proline contents but a lower MDA content than the WT plants. The three downstream genes were highly expressed in TaMYBsm1-D transgenic plants. We concluded from these results that TaMYBsm1 genes play an important role in plant drought stress tolerance through up-regulation of DREB2A, P5CS1 and RD29A. The increase of proline content and decrease of MDA content may also be involved in the drought response.
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
Guo, Meng; Liu, Jin-Hong; Ma, Xiao; Zhai, Yu-Fei; Gong, Zhen-Hui; Lu, Ming-Hui
2016-11-01
Hsp70s function as molecular chaperones and are encoded by a multi-gene family whose members play a crucial role in plant response to stress conditions, and in plant growth and development. Pepper (Capsicum annuum L.) is an important vegetable crop whose genome has been sequenced. Nonetheless, no overall analysis of the Hsp70 gene family is reported in this crop plant to date. To assess the functionality of Capsicum annuum Hsp70 (CaHsp70) genes, pepper genome database was analyzed in this research. A total of 21 CaHsp70 genes were identified and their characteristics were also described. The promoter and transcript expression analysis revealed that CaHsp70s were involved in pepper growth and development, and heat stress response. Ectopic expression of a cytosolic gene, CaHsp70-2, regulated expression of stress-related genes and conferred increased thermotolerance in transgenic Arabidopsis. Taken together, our results provide the basis for further studied to dissect CaHsp70s' function in response to heat stress as well as other environmental stresses. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Involvement of thiol-based mechanisms in plant development.
Rouhier, Nicolas; Cerveau, Delphine; Couturier, Jérémy; Reichheld, Jean-Philippe; Rey, Pascal
2015-08-01
Increasing knowledge has been recently gained regarding the redox regulation of plant developmental stages. The current state of knowledge concerning the involvement of glutathione, glutaredoxins and thioredoxins in plant development is reviewed. The control of the thiol redox status is mainly ensured by glutathione (GSH), a cysteine-containing tripeptide and by reductases sharing redox-active cysteines, glutaredoxins (GRXs) and thioredoxins (TRXs). Indeed, thiol groups present in many regulatory proteins and metabolic enzymes are prone to oxidation, ultimately leading to post-translational modifications such as disulfide bond formation or glutathionylation. This review focuses on the involvement of GSH, GRXs and TRXs in plant development. Recent studies showed that the proper functioning of root and shoot apical meristems depends on glutathione content and redox status, which regulate, among others, cell cycle and hormone-related processes. A critical role of GRXs in the formation of floral organs has been uncovered, likely through the redox regulation of TGA transcription factor activity. TRXs fulfill many functions in plant development via the regulation of embryo formation, the control of cell-to-cell communication, the mobilization of seed reserves, the biogenesis of chloroplastic structures, the metabolism of carbon and the maintenance of cell redox homeostasis. This review also highlights the tight relationships between thiols, hormones and carbon metabolism, allowing a proper development of plants in relation with the varying environment and the energy availability. GSH, GRXs and TRXs play key roles during the whole plant developmental cycle via their antioxidant functions and the redox-regulation of signaling pathways. This article is part of a Special Issue entitled Redox regulation of differentiation and de-differentiation. Copyright © 2015 Elsevier B.V. All rights reserved.
Li, Yuanjun; Gou, Junbo; Chen, Fangfang; Li, Changfu; Zhang, Yansheng
2016-01-01
Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones (STLs), which include the xanthanolides. To date, the biogenesis of xanthanolides, especially their downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes, which were derived from the young leaves of two different cultivars and the purified glandular trichomes from one of the cultivars, were constructed in this study. In total, 157 million clean reads were generated and assembled into 91,861 unigenes, of which 59,858 unigenes were successfully annotated. All the genes coding for known enzymes in the upstream pathway to the biosynthesis of xanthanolides were present in the X. strumarium transcriptomes. From a comparative analysis of the X. strumarium transcriptomes, this study identified a number of gene candidates that are putatively involved in the downstream pathway to the synthesis of xanthanolides, such as four unigenes encoding CYP71 P450s, 50 unigenes for dehydrogenases, and 27 genes for acetyltransferases. The possible functions of these four CYP71 candidates are extensively discussed. In addition, 116 transcription factors that are highly expressed in X. strumarium glandular trichomes were also identified. Their possible regulatory roles in the biosynthesis of STLs are discussed. The global transcriptomic data for X. strumarium should provide a valuable resource for further research into the biosynthesis of xanthanolides.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Directory of Open Access Journals (Sweden)
Hamna Saleem
2016-01-01
Full Text Available Petroleum hydrocarbons are harmful to living organisms when they are exposed in natural environment. Once they come in contact, it is not an easy to remove them because many of their constituents are persistent in nature. To achieve this target, different approaches have been exploited by using plants, bacteria, and plant-bacteria together. Among them, combined use of plants and bacteria has gained tremendous attention as bacteria possess set of catabolic genes which produce catabolic enzymes to decontaminate hydrocarbons. In return, plant ooze out root exudates containing nutrients and necessary metabolites which facilitate the microbial colonization in plant rhizosphere. This results into high gene abundance and gene expression in the rhizosphere and, thus, leads to enhanced degradation. Moreover, high proportions of beneficial bacteria helps plant to gain more biomass due to their plant growth promoting activities and production of phytohromones. This review focuses functioning and mechanisms of catabolic genes responsible for degradation of straight chain and aromatic hydrocarbons with their potential of degradation in bioremediation. With the understanding of expression mechanisms, rate of degradation can be enhanced by adjusting environmental factors and acclimatizing plant associated bacteria in plant rhizosphere.
García, María J; García-Mateo, María J; Lucena, Carlos; Romera, Francisco J; Rojas, Carmen L; Alcántara, Esteban; Pérez-Vicente, Rafael
2014-01-01
In a previous work, it was shown that bicarbonate (one of the most important factors causing Fe chlorosis in Strategy I plants) can limit the expression of several genes involved in Fe acquisition. Hypoxia is considered another important factor causing Fe chlorosis, mainly on calcareous soils. However, to date it is not known whether hypoxia aggravates Fe chlorosis by affecting bicarbonate concentration or by specific negative effects on Fe acquisition. Results found in this work show that hypoxia, generated by eliminating the aeration of the nutrient solution, can limit the expression of several Fe acquisition genes in Fe-deficient Arabidopsis, cucumber and pea plants, like the genes for ferric reductases AtFRO2, PsFRO1 and CsFRO1; iron transporters AtIRT1, PsRIT1 and CsIRT1; H(+) -ATPase CsHA1; and transcription factors AtFIT, AtbHLH38, and AtbHLH39. Interestingly, the limitation of the expression of Fe-acquisition genes by hypoxia did not occur in the Arabidopsis ethylene constitutive mutant ctr1, which suggests that the negative effect of hypoxia is related to ethylene, an hormone involved in the upregulation of Fe acquisition genes. As for hypoxia, results obtained by applying bicarbonate to the nutrient solution suggests that ethylene is also involved in its negative effect, since ACC (1-aminocyclopropane-1-carboxylic acid; ethylene precursor) partially reversed the negative effect of bicarbonate on the expression of Fe acquisition genes. Taken together, the results obtained show that hypoxia and bicarbonate could induce Fe chlorosis by limiting the expression of Fe acquisition genes, probably because each factor negatively affects different steps of ethylene synthesis and/or signaling. © 2013 Scandinavian Plant Physiology Society.
Directory of Open Access Journals (Sweden)
Zhaofen eHan
2016-03-01
Full Text Available Abstracts: The histone deacetylases play important roles in the regulation of gene expression and the subsequent control of a number of important biological processes, including those involved in the response to environmental stress. A specific group of histone deacetylase genes, HD2, is present in plants. In Arabidopsis, HD2s include HD2A, HD2B, HD2C and HD2D. Previous research showed that HD2A, HD2B and HD2C are more related in terms of expression and function, but not HD2D. In this report, we studied different aspects of AtHD2D in Arabidopsis with respect to plant response to drought and other abiotic stresses. Bioinformatics analysis indicates that HD2D is distantly related to other HD2 genes. Transient expression in Nicotiana benthamiana and stable expression in Arabidopsis of AtHD2D fused with gfp showed that AtHD2D was expressed in the nucleus. Overexpression of AtHD2D resulted in developmental changes including fewer main roots, more lateral roots, and a higher root:shoot ratio. Seed germination and plant flowering time were delayed in transgenic plants expressing AtHD2D, but these plants exhibited higher degrees of tolerance to abiotic stresses, including drought, salt and cold stresses. Physiological studies indicated that the malondialdehyde (MDA content was high in wild-type plants but in plants overexpressing HD2D the MDA level increased slowly in response to stress conditions of drought, cold, and salt stress. Furthermore, electrolyte leakage in leaf cells of wild type plants increased but remained stable in transgenic plants. Our results indicate that AtHD2D is unique among HD2 genes and it plays a role in plant growth and development regulation and these changes can modulate plant stress responses.
Genes Involved in the Evolution of Herbivory by a Leaf-Mining, Drosophilid Fly
DEFF Research Database (Denmark)
Whiteman, Noah K.; Gloss, Andrew D.; Sackton, Timothy B.
2012-01-01
a total of 341 transcripts that were differentially regulated by glucosinolate uptake in larval S. flava. Of these, approximately a third corresponded to homologs of Drosophila melanogaster genes associated with starvation, dietary toxin-, heat-, oxidation-, and aging-related stress. The upregulated...... the widely studied reference plant, Arabidopsis thaliana (Arabidopsis). Scaptomyza flava is phylogenetically nested within the paraphyletic genus Drosophila, and the whole genome sequences available for 12 species of Drosophila facilitated phylogenetic analysis and assembly of a transcriptome for S. flava....... The presence of glucosinolates in wild-type (WT) Arabidopsis plants reduced S. flava larval weight gain and increased egg-adult development time relative to flies reared in glucosinolate knockout (GKO) plants. An analysis of gene expression differences in 5-day-old larvae reared on WT versus GKO plants showed...
Song, Guo-Qing; Gao, Xuan
2017-06-19
Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.
Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R
1995-09-01
The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II
Agrobacterium-mediated gene transfer in plants and biosafety considerations.
Mehrotra, Shweta; Goyal, Vinod
2012-12-01
Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.
Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter
2017-01-01
The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.
VIGS for dissecting mechanisms involved in the symbiotic interaction of microbes with plants
DEFF Research Database (Denmark)
Grønlund, Mette
2015-01-01
Virus-induced gene silencing (VIGS) is an alternative reverse genetics tool for silencing of genes in some plants which are difficult to transform. The pea early browning virus (PEBV) has been developed as a VIGS vector and used in pea for functional analysis of several genes. Here, a PEBV-VIGS p...
Zaag, Rim; Tamby, Jean Philippe; Guichard, Cécile; Tariq, Zakia; Rigaill, Guillem; Delannoy, Etienne; Renou, Jean-Pierre; Balzergue, Sandrine; Mary-Huard, Tristan; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Brunaud, Véronique
2015-01-01
CATdb (http://urgv.evry.inra.fr/CATdb) is a database providing a public access to a large collection of transcriptomic data, mainly for Arabidopsis but also for other plants. This resource has the rare advantage to contain several thousands of microarray experiments obtained with the same technical protocol and analyzed by the same statistical pipelines. In this paper, we present GEM2Net, a new module of CATdb that takes advantage of this homogeneous dataset to mine co-expression units and decipher Arabidopsis gene functions. GEM2Net explores 387 stress conditions organized into 18 biotic and abiotic stress categories. For each one, a model-based clustering is applied on expression differences to identify clusters of co-expressed genes. To characterize functions associated with these clusters, various resources are analyzed and integrated: Gene Ontology, subcellular localization of proteins, Hormone Families, Transcription Factor Families and a refined stress-related gene list associated to publications. Exploiting protein-protein interactions and transcription factors-targets interactions enables to display gene networks. GEM2Net presents the analysis of the 18 stress categories, in which 17,264 genes are involved and organized within 681 co-expression clusters. The meta-data analyses were stored and organized to compose a dynamic Web resource. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Plant genetic and molecular responses to water deficit
Directory of Open Access Journals (Sweden)
Silvio Salvi
2011-02-01
Full Text Available Plant productivity is severely affected by unfavourable environmental conditions (biotic and abiotic stresses. Among others, water deficit is the plant stress condition which mostly limits the quality and the quantity of plant products. Tolerance to water deficit is a polygenic trait strictly dependent on the coordinated expression of a large set of genes coding for proteins directly involved in stress-induced protection/repair mechanisms (dehydrins, chaperonins, enzymes for the synthesis of osmoprotectants and detoxifying compounds, and others as well as genes involved in transducing the stress signal and regulating gene expression (transcription factors, kinases, phosphatases. Recently, research activities in the field evolved from the study of single genes directly involved in cellular stress tolerance (functional genes to the identification and characterization of key regulatory genes involved in stress perception and transduction and able to rapidly and efficiently activate the complex gene network involved in the response to stress. The complexity of the events occurring in response to stress have been recently approached by genomics tools; in fact the analysis of transcriptome, proteome and metabolome of a plant tissue/cell in response to stress already allowed to have a global view of the cellular and molecular events occurring in response to water deficit, by the identification of genes activated and co-regulated by the stress conditions and the characterization of new signalling pathways. Moreover the recent application of forward and reverse genetic approaches, trough mutant collection development, screening and characterization, is giving a tremendous impulse to the identification of gene functions with key role in stress tolerance. The integration of data obtained by high-throughput genomic approaches, by means of powerful informatic tools, is allowing nowadays to rapidly identify of major genes/QTLs involved in stress tolerance
Imran, Muhammad; Asad, Shaheen; Barboza, Andre Luiz; Galeano, Esteban; Carrer, Helaine; Mukhtar, Zahid
2017-04-01
Glyphosate quashes the synthesis of 5-enolpyruvylshikimate-3- phosphate synthase (EPSPS) enzyme which intercedes the functioning of shikimate pathway for the production of aromatic amino acids. Herbicide resistant crops are developed using glyphosate insensitive EPSPS gene isolated from Agrobacterium sp. strain CP4, which give farmers a sustainable weed control option. Intentions behind this study were to design and characterize the synthetic herbicide resistant CP4 - EPSPS gene in a model plant system and check the effectiveness of transformed tobacco against application of glyphosate. Putative transgenic plants were obtained from independent transformation events, and stable plant transformation, transgene expression and integration were demonstrated respectively by PCR, qRT-PCR and Southern hybridization. Gene transcript level and gene copy number (1-4) varied among the tested transgenic tobacco lines. Herbicide assays showed that transgenic plants were resistant to glyphosate after 12 days of spraying with glyphosate, and EPSPS activity remained at sufficient level to withstand the spray at 1000 ppm of the chemical. T 1 plants analyzed through immunoblot strips and PCR showed that the gene was being translated into protein and transmitted to the next generation successfully. This codon optimized synthetic CP4 - EPSPS gene is functionally equivalent to the gene for glyphosate resistance available in the commercial crops and hence we recommend this gene for transformation into commercial crops.
The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)
Energy Technology Data Exchange (ETDEWEB)
Karen S. Browning; Marie Petrocek; Bonnie Bartel
2006-06-01
The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.
Directory of Open Access Journals (Sweden)
Ning Zhao
2017-08-01
Full Text Available Non-target-site resistance (NTSR to herbicides is a worldwide concern for weed control. However, as the dominant NTSR mechanism in weeds, metabolic resistance is not yet well-characterized at the genetic level. For this study, we have identified a shortawn foxtail (Alopecurus aequalis Sobol. population displaying both TSR and NTSR to mesosulfuron-methyl and fenoxaprop-P-ethyl, yet the molecular basis for this NTSR remains unclear. To investigate the mechanisms of metabolic resistance, an RNA-Seq transcriptome analysis was used to find candidate genes that may confer metabolic resistance to the herbicide mesosulfuron-methyl in this plant population. The RNA-Seq libraries generated 831,846,736 clean reads. The de novo transcriptome assembly yielded 95,479 unigenes (averaging 944 bp in length that were assigned putative annotations. Among these, a total of 29,889 unigenes were assigned to 67 GO terms that contained three main categories, and 14,246 unigenes assigned to 32 predicted KEGG metabolic pathways. Global gene expression was measured using the reads generated from the untreated control (CK, water-only control (WCK, and mesosulfuron-methyl treatment (T of R and susceptible (S. Contigs that showed expression differences between mesosulfuron-methyl-treated R and S biotypes, and between mesosulfuron-methyl-treated, water-treated and untreated R plants were selected for further quantitative real-time PCR (qRT-PCR validation analyses. Seventeen contigs were consistently highly expressed in the resistant A. aequalis plants, including four cytochrome P450 monooxygenase (CytP450 genes, two glutathione S-transferase (GST genes, two glucosyltransferase (GT genes, two ATP-binding cassette (ABC transporter genes, and seven additional contigs with functional annotations related to oxidation, hydrolysis, and plant stress physiology. These 17 contigs could serve as major candidate genes for contributing to metabolic mesosulfuron-methyl resistance; hence
Agung, Muhammad Budi; Budiarsa, I. Made; Suwastika, I. Nengah
2017-02-01
Cocoa bean is one of the main commodities from Indonesia for the world, which still have problem regarding yield degradation due to pathogens and disease attack. Developing robust cacao plant that genetically resistant to pathogen and disease attack is an ideal solution in over taking on this problem. The aim of this study was to identify Theobroma cacao genes on database of cacao genome that homolog to response genes of pathogen and disease attack in other plant, through in silico analysis. Basic information survey and gene identification were performed in GenBank and The Arabidopsis Information Resource database. The In silico analysis contains protein BLAST, homology test of each gene's protein candidates, and identification of homologue gene in Cacao Genome Database using data source "Theobroma cacao cv. Matina 1-6 v1.1" genome. Identification found that Thecc1EG011959t1 (EDS1), Thecc1EG006803t1 (EDS5), Thecc1EG013842t1 (ICS1), and Thecc1EG015614t1 (BG_PPAP) gene of Cacao Genome Database were Theobroma cacao genes that homolog to plant's resistance genes which highly possible to have similar functions of each gene's homologue gene.
Cui, Na; Yang, Peng-Cheng; Guo, Kun; Kang, Le; Cui, Feng
2017-06-01
Host alternation, an obligatory seasonal shifting between host plants of distant genetic relationship, has had significant consequences for the diversification and success of the superfamily of aphids. However, the underlying molecular mechanism remains unclear. In this study, the molecular mechanism of host alternation was explored through a large-scale gene expression analysis of the mealy aphid Hyalopterus persikonus on winter and summer host plants. More than four times as many unigenes of the mealy aphid were significantly upregulated on summer host Phragmites australis than on winter host Rosaceae plants. In order to identify gene candidates related to host alternation, the differentially expressed unigenes of H. persikonus were compared to salivary gland expressed genes and secretome of Acyrthosiphon pisum. Genes involved in ribosome and oxidative phosphorylation and with molecular functions of heme-copper terminal oxidase activity, hydrolase activity and ribosome binding were potentially upregulated in salivary glands of H. persikonus on the summer host. Putative secretory proteins, such as detoxification enzymes (carboxylesterases and cytochrome P450s), antioxidant enzymes (peroxidase and superoxide dismutase), glutathione peroxidase, glucose dehydrogenase, angiotensin-converting enzyme, cadherin, and calreticulin, were highly expressed in H. persikonus on the summer host, while a SCP GAPR-1-like family protein and a salivary sheath protein were highly expressed in the aphids on winter hosts. These results shed light on phenotypic plasticity in host utilization and seasonal adaptation of aphids. © 2016 Institute of Zoology, Chinese Academy of Sciences.
El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia
2016-11-01
Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Endophytic Herbaspirillum seropedicae expresses nif genes in gramineous plants.
Roncato-Maccari, Lauren D B; Ramos, Humberto J O; Pedrosa, Fabio O; Alquini, Yedo; Chubatsu, Leda S; Yates, Marshall G; Rigo, Liu U; Steffens, Maria Berenice R; Souza, Emanuel M
2003-07-01
Abstract The interactions between maize, sorghum, wheat and rice plants and Herbaspirillum seropedicae were examined microscopically following inoculation with the H. seropedicae LR15 strain, a Nif(+) (Pnif::gusA) mutant obtained by the insertion of a gusA-kanamycin cassette into the nifH gene of the H. seropedicae wild-type strain. The expression of the Pnif::gusA fusion was followed during the association of the diazotroph with the gramineous species. Histochemical analysis of seedlings of maize, sorghum, wheat and rice grown in vermiculite showed that strain LR15 colonized root surfaces and inner tissues. In early steps of the endophytic association, H. seropedicae colonized root exudation sites, such as axils of secondary roots and intercellular spaces of the root cortex; it then occupied the vascular tissue and there expressed nif genes. The expression of nif genes occurred in roots, stems and leaves as detected by the GUS reporter system. The expression of nif genes was also observed in bacterial colonies located in the external mucilaginous root material, 8 days after inoculation. Moreover, the colonization of plant tissue by H. seropedicae did not depend on the nitrogen-fixing ability, since similar numbers of cells were isolated from roots or shoots of the plants inoculated with Nif(+) or Nif(-) strains.
New insights on the evolution of Leafy cotyledon1 (LEC1) type genes in vascular plants.
Cagliari, Alexandro; Turchetto-Zolet, Andreia Carina; Korbes, Ana Paula; Maraschin, Felipe Dos Santos; Margis, Rogerio; Margis-Pinheiro, Marcia
2014-01-01
NF-Y is a conserved oligomeric transcription factor found in all eukaryotes. In plants, this regulator evolved with a broad diversification of the genes coding for its three subunits (NF-YA, NF-YB and NF-YC). The NF-YB members can be divided into Leafy Cotyledon1 (LEC1) and non-LEC1 types. Here we presented a comparative genomic study using phylogenetic analyses to validate an evolutionary model for the origin of LEC-type genes in plants and their emergence from non-LEC1-type genes. We identified LEC1-type members in all vascular plant genomes, but not in amoebozoa, algae, fungi, metazoa and non-vascular plant representatives, which present exclusively non-LEC1-type genes as constituents of their NF-YB subunits. The non-synonymous to synonymous nucleotide substitution rates (Ka/Ks) between LEC1 and non-LEC1-type genes indicate the presence of positive selection acting on LEC1-type members to the fixation of LEC1-specific amino acid residues. The phylogenetic analyses demonstrated that plant LEC1-type genes are evolutionary divergent from the non-LEC1-type genes of plants, fungi, amoebozoa, algae and animals. Our results point to a scenario in which LEC1-type genes have originated in vascular plants after gene expansion in plants. We suggest that processes of neofunctionalization and/or subfunctionalization were responsible for the emergence of a versatile role for LEC1-type genes in vascular plants, especially in seed plants. LEC1-type genes besides being phylogenetic divergent also present different expression profile when compared with non-LEC1-type genes. Altogether, our data provide new insights about the LEC1 and non-LEC1 evolutionary relationship during the vascular plant evolution. Copyright © 2014 Elsevier Inc. All rights reserved.
Santos, Eliane Macedo Sobrinho; Santos, Hércules Otacílio; Dos Santos Dias, Ivoneth; Santos, Sérgio Henrique; Batista de Paula, Alfredo Maurício; Feltenberger, John David; Sena Guimarães, André Luiz; Farias, Lucyana Conceição
2016-01-01
Pathogenesis of odontogenic tumors is not well known. It is important to identify genetic deregulations and molecular alterations. This study aimed to investigate, through bioinformatic analysis, the possible genes involved in the pathogenesis of ameloblastoma (AM) and keratocystic odontogenic tumor (KCOT). Genes involved in the pathogenesis of AM and KCOT were identified in GeneCards. Gene list was expanded, and the gene interactions network was mapped using the STRING software. "Weighted number of links" (WNL) was calculated to identify "leader genes" (highest WNL). Genes were ranked by K-means method and Kruskal-Wallis test was used (Preview data was used to corroborate the bioinformatics data. CDK1 was identified as leader gene for AM. In KCOT group, results show PCNA and TP53 . Both tumors exhibit a power law behavior. Our topological analysis suggested leader genes possibly important in the pathogenesis of AM and KCOT, by clustering coefficient calculated for both odontogenic tumors (0.028 for AM, zero for KCOT). The results obtained in the scatter diagram suggest an important relationship of these genes with the molecular processes involved in AM and KCOT. Ontological analysis for both AM and KCOT demonstrated different mechanisms. Bioinformatics analyzes were confirmed through literature review. These results may suggest the involvement of promising genes for a better understanding of the pathogenesis of AM and KCOT.
Khan, Abdur Rahim; Park, Gun-Seok; Asaf, Sajjad; Hong, Sung-Jun; Jung, Byung Kwon
2017-01-01
Serratia marcescens RSC-14 is a Gram-negative bacterium that was previously isolated from the surface-sterilized roots of the Cd-hyperaccumulator Solanum nigrum. The strain stimulates plant growth and alleviates Cd stress in host plants. To investigate the genetic basis for these traits, the complete genome of RSC-14 was obtained by single-molecule real-time sequencing. The genome of S. marcescens RSC-14 comprised a 5.12-Mbp-long circular chromosome containing 4,593 predicted protein-coding genes, 22 rRNA genes, 88 tRNA genes, and 41 pseudogenes. It contained genes with potential functions in plant growth promotion, including genes involved in indole-3-acetic acid (IAA) biosynthesis, acetoin synthesis, and phosphate solubilization. Moreover, annotation using NCBI and Rapid Annotation using Subsystem Technology identified several genes that encode antioxidant enzymes as well as genes involved in antioxidant production, supporting the observed resistance towards heavy metals, such as Cd. The presence of IAA pathway-related genes and oxidative stress-responsive enzyme genes may explain the plant growth-promoting potential and Cd tolerance, respectively. This is the first report of a complete genome sequence of Cd-tolerant S. marcescens and its plant growth promotion pathway. The whole-genome analysis of this strain clarified the genetic basis underlying its phenotypic and biochemical characteristics, underpinning the beneficial interactions between RSC-14 and plants. PMID:28187139
Identification of new genes involved in human adipogenesis and fat storage.
Directory of Open Access Journals (Sweden)
Jörn Söhle
Full Text Available Since the worldwide increase in obesity represents a growing challenge for health care systems, new approaches are needed to effectively treat obesity and its associated diseases. One prerequisite for advances in this field is the identification of genes involved in adipogenesis and/or lipid storage. To provide a systematic analysis of genes that regulate adipose tissue biology and to establish a target-oriented compound screening, we performed a high throughput siRNA screen with primary (preadipocytes, using a druggable siRNA library targeting 7,784 human genes. The primary screen showed that 459 genes affected adipogenesis and/or lipid accumulation after knock-down. Out of these hits, 333 could be validated in a secondary screen using independent siRNAs and 110 genes were further regulated on the gene expression level during adipogenesis. Assuming that these genes are involved in neutral lipid storage and/or adipocyte differentiation, we performed InCell-Western analysis for the most striking hits to distinguish between the two phenotypes. Beside well known regulators of adipogenesis and neutral lipid storage (i.e. PPARγ, RXR, Perilipin A the screening revealed a large number of genes which have not been previously described in the context of fatty tissue biology such as axonemal dyneins. Five out of ten axonemal dyneins were identified in our screen and quantitative RT-PCR-analysis revealed that these genes are expressed in preadipocytes and/or maturing adipocytes. Finally, to show that the genes identified in our screen are per se druggable we performed a proof of principle experiment using an antagonist for HTR2B. The results showed a very similar phenotype compared to knock-down experiments proofing the "druggability". Thus, we identified new adipogenesis-associated genes and those involved in neutral lipid storage. Moreover, by using a druggable siRNA library the screen data provides a very attractive starting point to identify anti
Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei
2016-01-01
Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants.
A plant EPF-type zinc-finger protein, CaPIF1, involved in defence against pathogens.
Oh, Sang-Keun; Park, Jeong Mee; Joung, Young Hee; Lee, Sanghyeob; Chung, Eunsook; Kim, Soo-Yong; Yu, Seung Hun; Choi, Doil
2005-05-01
SUMMARY To understand better the defence responses of plants to pathogen attack, we challenged hot pepper plants with bacterial pathogens and identified transcription factor-encoding genes whose expression patterns were altered during the subsequent hypersensitive response. One of these genes, CaPIF1 (Capsicum annuum Pathogen-Induced Factor 1), was characterized further. This gene encodes a plant-specific EPF-type protein that contains two Cys(2)/His(2) zinc fingers. CaPIF1 expression was rapidly and specifically induced when pepper plants were challenged with bacterial pathogens to which they are resistant. In contrast, challenge with a pathogen to which the plants are susceptible only generated weak CaPIF1 expression. CaPIF1 expression was also strongly induced in pepper leaves by the exogenous application of ethephon, an ethylene-releasing compound, and salicylic acid, whereas methyl jasmonate had only moderate effects. CaPIF1 localized to the nuclei of onion epidermis when expressed as a CaPIF1-smGFP fusion protein. Transgenic tobacco plants over-expressing CaPIF1 driven by the CaMV 35S promoter showed increased resistance to challenge with a tobacco-specific pathogen or non-host bacterial pathogens. These plants also showed constitutive up-regulation of multiple defence-related genes. Moreover, virus-induced silencing of the CaPIF1 orthologue in Nicotiana benthamiana enhanced susceptibility to the same host or non-host bacterial pathogens. These observations provide evidence that an EPF-type Cys(2)/His(2) zinc-finger protein plays a crucial role in the activation of the pathogen defence response in plants.
Isolation and identification of differentially expressed genes between ...
African Journals Online (AJOL)
Plants have evolved sophisticated molecular defense mechanisms in order to survive disease conditions. So far, a number of pathogen resistance (R) genes have been reported in plants. These R genes are thought to be involved in activating the signals that lead to disease resistance. The structural specificity of R genes ...
Wu, Weifang; Deng, Qin; Shi, Pibiao; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang
2016-01-01
Watermelon (Citrullus lanatus) is a globally important crop belonging to the family Cucurbitaceae. The grafting technique is commonly used to improve its tolerance to stress, as well as to enhance its nutrient uptake and utilization. It is believed that miRNA is most likely involved in its nutrient-starvation response as a graft-transportable signal. The quantitative real-time reverse transcriptase polymerase chain reaction is the preferred method for miRNA functional analysis, in which reliable reference genes for normalization are crucial to ensure the accuracy. The purpose of this study was to select appropriate reference genes in scion (watermelon) and rootstocks (squash and bottle gourd) of grafted watermelon plants under normal growth conditions and nutrient stresses (nitrogen and phosphorus starvation). Under nutrient starvation, geNorm identified miR167c and miR167f as two most stable genes in both watermelon leaves and squash roots. miR166b was recommended by both geNorm and NormFinder as the best reference in bottle gourd roots under nutrient limitation. Expression of a new Cucurbitaceae miRNA, miR85, was used to validate the reliability of candidate reference genes under nutrient starvation. Moreover, by comparing several target genes expression in qRT-PCR analysis with those in RNA-seq data, miR166b and miR167c were proved to be the most suitable reference genes to normalize miRNA expression under normal growth condition in scion and rootstock tissues, respectively. This study represents the first comprehensive survey of the stability of miRNA reference genes in Cucurbitaceae and provides valuable information for investigating more accurate miRNA expression involving grafted watermelon plants.
Duan, X; Li, X; Xue, Q; Abo-el-Saad, M; Xu, D; Wu, R
1996-04-01
We introduced the potato proteinase inhibitor II (PINII) gene (pin2) into several Japonica rice varieties, and regenerated a large number of transgenic rice plants. Wound-inducible expression of the pin2 gene driven by its own promoter, together with the first intron of the rice actin 1 gene (act1), resulted in high-level accumulation of the PINII protein in the transgenic plants. The introduced pin2 gene was stably inherited in the second, third, and fourth generations, as shown by molecular analyses. Based on data from the molecular analyses, several homozygous transgenic lines were obtained. Bioassay for insect resistance with the fifth-generation transgenic rice plants showed that transgenic rice plants had increased resistance to a major rice insect pest, pink stem borer (Sesamia inferens). Thus, introduction of an insecticidal proteinase inhibitor gene into cereal plants can be used as a general strategy for control of insect pests.
Involvement of lipid-protein complexes in plant-microorganism interactions
Directory of Open Access Journals (Sweden)
Blein Jean-Pierre
2002-01-01
Full Text Available Increasing concerns about the environmental impact of modern agricultural have prompted research for alternate practices to pesticide treatments, notably using plant defense mechanisms. Thus, isolation and characterization of plant defense elicitors have been the main step of studies in many groups. Moreover, in the global concept of interactions between organisms and their environment, a major concern is to discriminate recognition between exogenous and endogenous signals, notably during pathogenic or allergenic interactions involving small proteins, such as elicitins or lipid transfer proteins (LTPs. Elicitins and lipid transfer proteins (LTP are both able to load and transfer lipidic molecules and share some structural and functional properties. While elicitins are known as elicitors of plant defense mechanisms, the biological function of LTPs is still an enigma. They are ubiquitous plant proteins able to load and transfer hydrophobic molecules such as fatty acids or phospholipids. Among them, LTPs1 (type 1 lipid transfer proteins constitute a multigenic family of secreted plant lipid binding proteins that are constitutively expressed in specific tissues and/or induced in response to biotic and abiotic stress (for reviews [1-4]. Their biological function is still unknown, even if some data provide arguments for a role of these proteins in the assembly of extracellular hydrophobic polymers (i.e., cutin and suberin [2, 4] and/or in plant defense against fungal pathogens [1, 3]. Beside their involvement in plant defense, LTPs1 are also known to be pan-allergens of plant-derived foods [5]. Finally, the discovery of the sterol carrier-properties of elicitins has opened new perspectives dealing with the relationship between this function and the elicitor activity of these small cystein-rich proteins. Nevertheless, this elicitor activity is restrained to few plant species, and thus does not appear in accordance with a universal lipid transfer
Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.
2004-01-01
Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These
Directory of Open Access Journals (Sweden)
Yuanjun Li
2016-08-01
Full Text Available Xanthium strumarium L. is a traditional Chinese herb belonging to the Asteraceae family. The major bioactive components of this plant are sesquiterpene lactones, which include the xanthanolides. To date, the biogenesis of xanthanolides, especiallytheir downstream pathway, remains largely unknown. In X. strumarium, xanthanolides primarily accumulate in its glandular trichomes. To identify putative gene candidates involved in the biosynthesis of xanthanolides, three X. strumarium transcriptomes, which were derived from the young leaves of two different cultivars and the purified glandular trichomes from one of the cultivars, were constructed in this study. In total, 157 million clean reads were generated and assembled into 91,861 unigenes, of which 59,858 unigenes were successfully annotated. All the genes coding for known enzymes in the upstream pathway to the biosynthesis of xanthanolides were present in the X. strumarium transcriptomes. From a comparative analysis of the X. strumarium transcriptomes, this study identified a number of gene candidates that are putatively involved in the downstream pathway to the synthesis of xanthanolides, such as four unigenes encoding CYP71 P450s, 50 unigenes for dehydrogenases, and 27 genes for acetyltransferases. The possible functions of these four CYP71 candidates are extensively discussed. In addition, 116 transcription factors that were highly expressed in X. strumarium glandular trichomes were also identified. Their possible regulatory roles in the biosynthesis of sesquiterpene lactones are discussed. The global transcriptomic data for X. strumarium should provide a valuable resource for further research into the biosynthesis of xanthanolides.
Forrest, Kerrie L; Bhave, Mrinal
2007-10-01
The ubiquitous cell membrane proteins called aquaporins are now firmly established as channel proteins that control the specific transport of water molecules across cell membranes in all living organisms. The aquaporins are thus likely to be of fundamental significance to all facets of plant growth and development affected by plant-water relations. A majority of plant aquaporins have been found to share essential structural features with the human aquaporin and exhibit water-transporting ability in various functional assays, and some have been shown experimentally to be of critical importance to plant survival. Furthermore, substantial evidence is now available from a number of plant species that shows differential gene expression of aquaporins in response to abiotic stresses such as salinity, drought, or cold and clearly establishes the aquaporins as major players in the response of plants to conditions that affect water availability. This review summarizes the function and regulation of these genes to develop a greater understanding of the response of plants to water insufficiency, and particularly, to identify tolerant genotypes of major crop species including wheat and rice and plants that are important in agroforestry.
Gene expression in mycorrhizal orchid protocorms suggests a friendly plant-fungus relationship.
Perotto, Silvia; Rodda, Marco; Benetti, Alex; Sillo, Fabiano; Ercole, Enrico; Rodda, Michele; Girlanda, Mariangela; Murat, Claude; Balestrini, Raffaella
2014-06-01
Orchids fully depend on symbiotic interactions with specific soil fungi for seed germination and early development. Germinated seeds give rise to a protocorm, a heterotrophic organ that acquires nutrients, including organic carbon, from the mycorrhizal partner. It has long been debated if this interaction is mutualistic or antagonistic. To investigate the molecular bases of the orchid response to mycorrhizal invasion, we developed a symbiotic in vitro system between Serapias vomeracea, a Mediterranean green meadow orchid, and the rhizoctonia-like fungus Tulasnella calospora. 454 pyrosequencing was used to generate an inventory of plant and fungal genes expressed in mycorrhizal protocorms, and plant genes could be reliably identified with a customized bioinformatic pipeline. A small panel of plant genes was selected and expression was assessed by real-time quantitative PCR in mycorrhizal and non-mycorrhizal protocorm tissues. Among these genes were some markers of mutualistic (e.g. nodulins) as well as antagonistic (e.g. pathogenesis-related and wound/stress-induced) genes. None of the pathogenesis or wound/stress-related genes were significantly up-regulated in mycorrhizal tissues, suggesting that fungal colonization does not trigger strong plant defence responses. In addition, the highest expression fold change in mycorrhizal tissues was found for a nodulin-like gene similar to the plastocyanin domain-containing ENOD55. Another nodulin-like gene significantly more expressed in the symbiotic tissues of mycorrhizal protocorms was similar to a sugar transporter of the SWEET family. Two genes coding for mannose-binding lectins were significantly up-regulated in the presence of the mycorrhizal fungus, but their role in the symbiosis is unclear.
Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M
1998-04-01
Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.
Krinitsyna, A A; Mel'nikova, N V; Belenikin, M S; Poltronieri, P; Santino, A; Kudriavtseva, A V; Savilova, A M; Speranskaia, A S
2013-01-01
Kunitz-type proteinase inhibitor proteins of group A (KPI-A) are involved in the protection of potato plants from pathogens and pests. Although sequences of large number of the KPI-A genes from different species of cultivated potato (Solanum tuberosum subsp. tuberosum) and a few genes from tomato (Solanum lycopersicum) are known to date, information about the allelic diversity of these genes in other species of the genus Solanum is lacking. In our work, the consensus sequences of the KPI-A genes were established in two species of subgenus Potatoe sect. Petota (Solanum tuberosum subsp. andigenum--5 genes and Solanum stoloniferum--2 genes) and in the subgenus Solanum (Solanum nigrum--5 genes) by amplification, cloning, sequencing and subsequent analysis. The determined sequences of KPI-A genes were 97-100% identical to known sequences of the cultivated potato of sect. Petota (cultivated potato Solanum tuberosum subsp. tuberosum) and sect. Etuberosum (S. palustre). The interspecific variability of these genes did not exceed the intraspecific variability for all studied species except Solanum lycopersicum. The distribution of highly variable and conserved sequences in the mature protein-encoding regions was uniform for all investigated KPI-A genes. However, our attempts to amplify the homologous genes using the same primers and the genomes of Solanum dulcamarum, Solanum lycopersicum and Mandragora officinarum resulted in no product formation. Phylogenetic analysis of KPI-A diversity showed that the sequences of the S. lycopersicum form independent cluster, whereas KPI-A of S. nigrum and species of sect. Etuberosum and sect. Petota are closely related and do not form species-specific subclasters. Although Solanum nigrum is resistant to all known races of economically one of the most important diseases of solanaceous plants oomycete Phytophthora infestans aminoacid sequences encoding by KPI-A genes from its genome have nearly or absolutely no differences to the same from
Jin, Yue; Yang, Cheng-Min; Wei, Jian-He
2016-05-01
In order to evaluate seed viability of Platycodon grandiflorum, Schizonepeta tenuifolia, Andrographis paniculat, Codonopsis pilosula, Scutellaria baicalensis, Leonurus japonicus, Rabdosia rubescens, stored in the medium-term gene bank of the National Medicinal Plant Gene Bank for 4 years, we tested seed germination rate of 7 species of medicinal plant and analyzed the change of significance of levels of the germination rate in pre and post store. Seed germination rates of 7 species of medicinal plants were all decreased after 4 years, and the decrease of S. tenuifolia and S. baicalensis germination rates were much smaller than other species. The higher initial germination rate of P. grandiflorum, C. pilosula, R. rubescens seed has the smaller decline of germination rate, but the data of A. paniculata showed the opposite trend. The rate decline of the germination of S. tenuifolia and S. baicalensis was roughly the same in different germination rate interval. The results showed that low temperature storage could effectively prolong the seed longevity, and maintain the seed vigor. Moreover, it is necessary to study on the storage characteristics of the main medicinal plant seeds, and establish the monitoring plan and regeneration standard. Copyright© by the Chinese Pharmaceutical Association.
Wu, Zhi-Jun; Wang, Wen-Li; Zhuang, Jing
2017-09-01
Tea plant (Camellia sinensis (L.) O. Kuntze) is an important leaf-type woody crop used for producing of non-alcoholic beverages worldwide. The GROWTH-REGULATING FACTOR (GRF) transcription factors cooperated with GRF-INTERACTING FACTOR (GIF) transcriptional coactivators positively regulate leaf development. In the present study, six GRF and two GIF genes were identified and characterized in the leaf transcriptome of C. sinensis, respectively. The alignment results showed that the feature structures of the predicted homologous GRF and GIF proteins of C. sinensis hold a high identity with Arabidopsis and rice. The presence of C. sinensis miR396 target sites suggested that these miR396 members are the potential post-transcriptional regulators of CsGRF genes. The expression profiles of CsGRF and CsGIF1 genes were higher in tender leaves and consistently downregulated during tea plant leaf development. Those results suggested that these genes may be actively involved in the early stage leaf tissue formation in tea plant. The divergence of CsGRF and CsGIF genes in response to different hormonal stimuli revealed the possible multiple functions of these genes in hormonal regulation. This study provided the potential molecular basis of the CsGRF and CsGIF family genes for future functional research on leaf development and hormonal stimuli in C. sinensis.
A moso bamboo WRKY gene PeWRKY83 confers salinity tolerance in transgenic Arabidopsis plants.
Wu, Min; Liu, Huanlong; Han, Guomin; Cai, Ronghao; Pan, Feng; Xiang, Yan
2017-09-15
The WRKY family are transcription factors, involved in plant development, and response to biotic and abiotic stresses. Moso bamboo is an important bamboo that has high ecological, economic and cultural value and is widely distributed in the south of China. In this study, we performed a genome-wide identification of WRKY members in moso bamboo and identified 89 members. By comparative analysis in six grass genomes, we found the WRKY gene family may have experienced or be experiencing purifying selection. Based on relative expression levels among WRKY IIc members under three abiotic stresses, PeWRKY83 functioned as a transcription factor and was selected for detailed analysis. The transgenic Arabidopsis of PeWRKY83 showed superior physiological properties compared with the WT under salt stress. Overexpression plants were less sensitive to ABA at both germination and postgermination stages and accumulated more endogenous ABA under salt stress conditions. Further studies demonstrated that overexpression of PeWRKY83 could regulate the expression of some ABA biosynthesis genes (AtAAO3, AtNCED2, AtNCED3), signaling genes (AtABI1, AtPP2CA) and responsive genes (AtRD29A, AtRD29B, AtABF1) under salt stress. Together, these results suggested that PeWRKY83 functions as a novel WRKY-related TF which plays a positive role in salt tolerance by regulating stress-induced ABA synthesis.
Poulicard, Nils; Pacios, Luis Fernández; Gallois, Jean-Luc; Piñero, Daniel; García-Arenal, Fernando
2016-08-01
This work analyses the genetic variation and evolutionary patterns of recessive resistance loci involved in matching-allele (MA) host-pathogen interactions, focusing on the pvr2 resistance gene to potyviruses of the wild pepper Capsicum annuum glabriusculum (chiltepin). Chiltepin grows in a variety of wild habitats in Mexico, and its cultivation in home gardens started about 25 years ago. Potyvirus infection of Capsicum plants requires the physical interaction of the viral VPg with the pvr2 product, the translation initiation factor eIF4E1. Mutations impairing this interaction result in resistance, according to the MA model. The diversity of pvr2/eIF4E1 in wild and cultivated chiltepin populations from six biogeographical provinces in Mexico was analysed in 109 full-length coding sequences from 97 plants. Eleven alleles were found, and their interaction with potyvirus VPg in yeast-two-hybrid assays, plus infection assays of plants, identified six resistance alleles. Mapping resistance mutations on a pvr2/eIF4E1 model structure showed that most were around the cap-binding pocket and strongly altered its surface electrostatic potential, suggesting resistance-associated costs due to functional constraints. The pvr2/eIF4E1 phylogeny established that susceptibility was ancestral and resistance was derived. The spatial structure of pvr2/eIF4E1 diversity differed from that of neutral markers, but no evidence of selection for resistance was found in wild populations. In contrast, the resistance alleles were much more frequent, and positive selection stronger, in cultivated chiltepin populations, where diversification of pvr2/eIF4E1 was higher. This analysis of the genetic variation of a recessive resistance gene involved in MA host-pathogen interactions in populations of a wild plant show that evolutionary patterns differ according to the plant habitat, wild or cultivated. It also demonstrates that human management of the plant population has profound effects on the
Directory of Open Access Journals (Sweden)
Nils Poulicard
2016-08-01
Full Text Available This work analyses the genetic variation and evolutionary patterns of recessive resistance loci involved in matching-allele (MA host-pathogen interactions, focusing on the pvr2 resistance gene to potyviruses of the wild pepper Capsicum annuum glabriusculum (chiltepin. Chiltepin grows in a variety of wild habitats in Mexico, and its cultivation in home gardens started about 25 years ago. Potyvirus infection of Capsicum plants requires the physical interaction of the viral VPg with the pvr2 product, the translation initiation factor eIF4E1. Mutations impairing this interaction result in resistance, according to the MA model. The diversity of pvr2/eIF4E1 in wild and cultivated chiltepin populations from six biogeographical provinces in Mexico was analysed in 109 full-length coding sequences from 97 plants. Eleven alleles were found, and their interaction with potyvirus VPg in yeast-two-hybrid assays, plus infection assays of plants, identified six resistance alleles. Mapping resistance mutations on a pvr2/eIF4E1 model structure showed that most were around the cap-binding pocket and strongly altered its surface electrostatic potential, suggesting resistance-associated costs due to functional constraints. The pvr2/eIF4E1 phylogeny established that susceptibility was ancestral and resistance was derived. The spatial structure of pvr2/eIF4E1 diversity differed from that of neutral markers, but no evidence of selection for resistance was found in wild populations. In contrast, the resistance alleles were much more frequent, and positive selection stronger, in cultivated chiltepin populations, where diversification of pvr2/eIF4E1 was higher. This analysis of the genetic variation of a recessive resistance gene involved in MA host-pathogen interactions in populations of a wild plant show that evolutionary patterns differ according to the plant habitat, wild or cultivated. It also demonstrates that human management of the plant population has profound
Identification of Phytophthora sojae genes involved in asexual ...
Indian Academy of Sciences (India)
ual sporulation or germination. But molecular details about asexual spore development in P. sojae are limited (Tyler et al. 2006). In the present study, to understand the molecular basis of asexual spore development in P. sojae, we investigated gene expression changes involved in asexual sporulation after ul- traviolet (UV) ...
Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar
2018-02-01
Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.
Li, Hui; Yan, Shihan; Zhao, Lin; Tan, Junjun; Zhang, Qi; Gao, Fei; Wang, Pu; Hou, Haoli; Li, Lijia
2014-01-01
Background Salt stress usually causes crop growth inhibition and yield decrease. Epigenetic regulation is involved in plant responses to environmental stimuli. The epigenetic regulation of the cell wall related genes associated with the salt-induced cellular response is still little known. This study aimed to analyze cell morphological alterations in maize roots as a consequence of excess salinity in relation to the transcriptional and epigenetic regulation of the cell wall related protein ge...
Chen, Yun; Cao, Shugeng; Chai, Yunrong; Clardy, Jon; Kolter, Roberto; Guo, Jian-hua; Losick, Richard
2012-01-01
SUMMARY The soil bacterium Bacillus subtilis is widely used in agriculture as a biocontrol agent able to protect plants from a variety of pathogens. Protection is thought to involve the formation of bacterial communities - biofilms - on the roots of the plants. Here we used confocal microscopy to visualize biofilms on the surface of the roots of tomato seedlings and demonstrated that biofilm formation requires genes governing the production of the extracellular matrix that holds cells together. We further show that biofilm formation was dependent on the sensor histidine kinase KinD and in particular on an extracellular CACHE domain implicated in small molecule sensing. Finally, we report that exudates of tomato roots strongly stimulated biofilm formation ex planta and that an abundant small molecule in the exudates, l-malic acid, was able to stimulate biofilm formation at high concentrations in a manner that depended on the KinD CACHE domain. We propose that small signaling molecules released by the roots of tomato plants are directly or indirectly recognized by KinD, triggering biofilm formation. PMID:22716461
Genes and Gut Bacteria Involved in Luminal Butyrate Reduction Caused by Diet and Loperamide.
Hwang, Nakwon; Eom, Taekil; Gupta, Sachin K; Jeong, Seong-Yeop; Jeong, Do-Youn; Kim, Yong Sung; Lee, Ji-Hoon; Sadowsky, Michael J; Unno, Tatsuya
2017-11-28
Unbalanced dietary habits and gut dysmotility are causative factors in metabolic and functional gut disorders, including obesity, diabetes, and constipation. Reduction in luminal butyrate synthesis is known to be associated with gut dysbioses, and studies have suggested that restoring butyrate formation in the colon may improve gut health. In contrast, shifts in different types of gut microbiota may inhibit luminal butyrate synthesis, requiring different treatments to restore colonic bacterial butyrate synthesis. We investigated the influence of high-fat diets (HFD) and low-fiber diets (LFD), and loperamide (LPM) administration, on key bacteria and genes involved in reduction of butyrate synthesis in mice. MiSeq-based microbiota analysis and HiSeq-based differential gene analysis indicated that different types of bacteria and genes were involved in butyrate metabolism in each treatment. Dietary modulation depleted butyrate kinase and phosphate butyryl transferase by decreasing members of the Bacteroidales and Parabacteroides . The HFD also depleted genes involved in succinate synthesis by decreasing Lactobacillus . The LFD and LPM treatments depleted genes involved in crotonoyl-CoA synthesis by decreasing Roseburia and Oscilllibacter . Taken together, our results suggest that different types of bacteria and genes were involved in gut dysbiosis, and that selected treatments may be needed depending on the cause of gut dysfunction.
PRGdb 3.0: a comprehensive platform for prediction and analysis of plant disease resistance genes.
Osuna-Cruz, Cristina M; Paytuvi-Gallart, Andreu; Di Donato, Antimo; Sundesha, Vicky; Andolfo, Giuseppe; Aiese Cigliano, Riccardo; Sanseverino, Walter; Ercolano, Maria R
2018-01-04
The Plant Resistance Genes database (PRGdb; http://prgdb.org) has been redesigned with a new user interface, new sections, new tools and new data for genetic improvement, allowing easy access not only to the plant science research community but also to breeders who want to improve plant disease resistance. The home page offers an overview of easy-to-read search boxes that streamline data queries and directly show plant species for which data from candidate or cloned genes have been collected. Bulk data files and curated resistance gene annotations are made available for each plant species hosted. The new Gene Model view offers detailed information on each cloned resistance gene structure to highlight shared attributes with other genes. PRGdb 3.0 offers 153 reference resistance genes and 177 072 annotated candidate Pathogen Receptor Genes (PRGs). Compared to the previous release, the number of putative genes has been increased from 106 to 177 K from 76 sequenced Viridiplantae and algae genomes. The DRAGO 2 tool, which automatically annotates and predicts (PRGs) from DNA and amino acid with high accuracy and sensitivity, has been added. BLAST search has been implemented to offer users the opportunity to annotate and compare their own sequences. The improved section on plant diseases displays useful information linked to genes and genomes to connect complementary data and better address specific needs. Through, a revised and enlarged collection of data, the development of new tools and a renewed portal, PRGdb 3.0 engages the plant science community in developing a consensus plan to improve knowledge and strategies to fight diseases that afflict main crops and other plants. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.
Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V
2017-09-30
Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.
Coordinations between gene modules control the operation of plant amino acid metabolic networks
Directory of Open Access Journals (Sweden)
Galili Gad
2009-01-01
Full Text Available Abstract Background Being sessile organisms, plants should adjust their metabolism to dynamic changes in their environment. Such adjustments need particular coordination in branched metabolic networks in which a given metabolite can be converted into multiple other metabolites via different enzymatic chains. In the present report, we developed a novel "Gene Coordination" bioinformatics approach and use it to elucidate adjustable transcriptional interactions of two branched amino acid metabolic networks in plants in response to environmental stresses, using publicly available microarray results. Results Using our "Gene Coordination" approach, we have identified in Arabidopsis plants two oppositely regulated groups of "highly coordinated" genes within the branched Asp-family network of Arabidopsis plants, which metabolizes the amino acids Lys, Met, Thr, Ile and Gly, as well as a single group of "highly coordinated" genes within the branched aromatic amino acid metabolic network, which metabolizes the amino acids Trp, Phe and Tyr. These genes possess highly coordinated adjustable negative and positive expression responses to various stress cues, which apparently regulate adjustable metabolic shifts between competing branches of these networks. We also provide evidence implying that these highly coordinated genes are central to impose intra- and inter-network interactions between the Asp-family and aromatic amino acid metabolic networks as well as differential system interactions with other growth promoting and stress-associated genome-wide genes. Conclusion Our novel Gene Coordination elucidates that branched amino acid metabolic networks in plants are regulated by specific groups of highly coordinated genes that possess adjustable intra-network, inter-network and genome-wide transcriptional interactions. We also hypothesize that such transcriptional interactions enable regulatory metabolic adjustments needed for adaptation to the stresses.
Li, Changyan; Luo, Chao; Zhou, Zaihui; Wang, Rui; Ling, Fei; Xiao, Langtao; Lin, Yongjun; Chen, Hao
2017-02-28
The brown planthopper (BPH; Nilaparvata lugens Stål) is a destructive piercing-sucking insect pest of rice. The plant hormones salicylic acid (SA) and jasmonic acid (JA) play important roles in plant-pest interactions. Many isolated rice genes that modulate BPH resistance are involved in the metabolism or signaling pathways of SA, JA and ethylene. 'Rathu Heenati' (RH) is a rice cultivar with a high-level, broad-spectrum resistance to all BPH biotypes. Here, RH was used as the research material, while a BPH-susceptible rice cultivar 'Taichung Native 1' (TN1) was the control. A cDNA microarray analysis illuminated the resistance response at the genome level of RH under BPH infestation. The levels of SA and JA in RH and TN1 seedlings after BPH infestation were also determined. The expression pattern clustering indicated that 1467 differential probe sets may be associated with constitutive resistance and 67 with the BPH infestation-responsive resistance of RH. A Venn diagram analysis revealed 192 RH-specific and BPH-inducible probe sets. Finally, 23 BPH resistance-related gene candidates were selected based on the expression pattern clustering and Venn diagram analysis. In RH, the SA content significantly increased and the JA content significantly decreased after BPH infestation, with the former occurring prior to the latter. In RH, the differential genes in the SA pathway were synthesis-related and were up-regulated after BPH infestation. The differential genes in the JA pathway were also up-regulated. They were jasmonate ZIM-domain transcription factors, which are important negative regulators of the JA pathway. Comparatively, genes involved in the ET pathway were less affected by a BPH infestation in RH. DNA sequence analysis revealed that most BPH infestation-inducible genes may be regulated by the genetic background in a trans-acting manner, instead of by their promoters. We profiled the analysis of the global gene expression in RH and TN1 under BPH infestation
Phylogeographic support for horizontal gene transfer involving sympatric bruchid species
Directory of Open Access Journals (Sweden)
Grill Andrea
2006-07-01
, hybridization, and pseudogenisation. However, none of these seem able to explain the patterns observed. A fourth hypothesis, involving recent horizontal gene transfer (HGT between A. obtectus and A. obvelatus, and from one of these species to Z. subfasciatus in the Mexican Altiplano, seems the only plausible explanation. The HGT between our study species seems to have occurred recently, and only in a zone where the three beetles are sympatric and share common host plants. This suggests that transfer could have been effected by some external vector such as a eukaryotic or viral parasite, which might still host the transferred fragment. Reviewers This article was reviewed by Eric Bapteste, Adam Eyre-Walker and Alexey Kondrashov.
Phylogeographic support for horizontal gene transfer involving sympatric bruchid species.
Alvarez, Nadir; Benrey, Betty; Hossaert-McKey, Martine; Grill, Andrea; McKey, Doyle; Galtier, Nicolas
2006-07-27
seem able to explain the patterns observed. A fourth hypothesis, involving recent horizontal gene transfer (HGT) between A. obtectus and A. obvelatus, and from one of these species to Z. subfasciatus in the Mexican Altiplano, seems the only plausible explanation. The HGT between our study species seems to have occurred recently, and only in a zone where the three beetles are sympatric and share common host plants. This suggests that transfer could have been effected by some external vector such as a eukaryotic or viral parasite, which might still host the transferred fragment. This article was reviewed by Eric Bapteste, Adam Eyre-Walker and Alexey Kondrashov.
Vetchinkina, E M; Komakhina, V V; Vysotskii, D A; Zaitsev, D V; Smirnov, A N; Babakov, A V; Komakhin, R A
2016-09-01
The chickweed (Stellaria media L.) pro-SmAMP2 gene encodes the hevein-like peptides that have in vitro antimicrobial activity against certain harmful microorganisms. These peptides play an important role in protecting the chickweed plants from infection, and the pro-SmAMP2 gene was previously used to protect transgenic tobacco and Arabidopsis plants from phytopathogens. In this study, the pro-SmAMP2 gene under control of viral CaMV35S promoter or under control of its own pro-SmAMP2 promoter was transformed into cultivated potato plants of two cultivars, differing in the resistance to Alternaria: Yubiley Zhukova (resistant) and Skoroplodny (susceptible). With the help of quantitative real-time PCR, it was demonstrated that transgenic potato plants expressed the pro-SmAMP2 gene under control of both promoters at the level comparable to or exceeding the level of the potato actin gene. Assessment of the immune status of the transformants demonstrated that expression of antimicrobial peptide pro-SmAMP2 gene was able to increase the resistance to a complex of Alternaria sp. and Fusarium sp. phytopathogens only in potato plants of the Yubiley Zhukova cultivar. The possible role of the pro-SmAMP2 products in protecting potatoes from Alternaria sp. and Fusarium sp. is discussed.
Park, Sung-Chul; Kim, Sun Ha; Park, Seyeon; Lee, Hyeong-Un; Lee, Joon Seol; Park, Woo Sung; Ahn, Mi-Jeong; Kim, Yun-Hee; Jeong, Jae Cheol; Lee, Haeng-Soon; Kwak, Sang-Soo
2015-01-01
Sweetpotato [Ipomoea batatas (L.) Lam] is an important root crop that produces low molecular weight antioxidants such as carotenoids and anthocyanin. The sweetpotato orange (IbOr) protein is involved in the accumulation of carotenoids. To increase the levels of carotenoids in the storage roots of sweetpotato, we generated transgenic sweetpotato plants overexpressing IbOr-Ins under the control of the cauliflower mosaic virus (CaMV) 35S promoter in an anthocyanin-rich purple-fleshed cultivar (referred to as IbOr plants). IbOr plants exhibited increased carotenoid levels (up to 7-fold) in their storage roots compared to wild type (WT) plants, as revealed by HPLC analysis. The carotenoid contents of IbOr plants were positively correlated with IbOr transcript levels. The levels of zeaxanthin were ∼ 12 times elevated in IbOr plants, whereas β-carotene increased ∼ 1.75 times higher than those of WT. Quantitative RT-PCR analysis revealed that most carotenoid biosynthetic pathway genes were up-regulated in the IbOr plants, including PDS, ZDS, LCY-β, CHY-β, ZEP and Pftf, whereas LCY-ɛ was down-regulated. Interestingly, CCD1, CCD4 and NCED, which are related to the degradation of carotenoids, were also up-regulated in the IbOr plants. Anthocyanin contents and transcription levels of associated biosynthetic genes seemed to be altered in the IbOr plants. The yields of storage roots and aerial parts of IbOr plants and WT plants were not significantly different under field cultivation. Taken together, these results indicate that overexpression of IbOr-Ins can increase the carotenoid contents of sweetpotato storage roots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Gramzow, Lydia; Weilandt, Lisa; Theißen, Günter
2014-11-01
MADS-box genes comprise a gene family coding for transcription factors. This gene family expanded greatly during land plant evolution such that the number of MADS-box genes ranges from one or two in green algae to around 100 in angiosperms. Given the crucial functions of MADS-box genes for nearly all aspects of plant development, the expansion of this gene family probably contributed to the increasing complexity of plants. However, the expansion of MADS-box genes during one important step of land plant evolution, namely the origin of seed plants, remains poorly understood due to the previous lack of whole-genome data for gymnosperms. The newly available genome sequences of Picea abies, Picea glauca and Pinus taeda were used to identify the complete set of MADS-box genes in these conifers. In addition, MADS-box genes were identified in the growing number of transcriptomes available for gymnosperms. With these datasets, phylogenies were constructed to determine the ancestral set of MADS-box genes of seed plants and to infer the ancestral functions of these genes. Type I MADS-box genes are under-represented in gymnosperms and only a minimum of two Type I MADS-box genes have been present in the most recent common ancestor (MRCA) of seed plants. In contrast, a large number of Type II MADS-box genes were found in gymnosperms. The MRCA of extant seed plants probably possessed at least 11-14 Type II MADS-box genes. In gymnosperms two duplications of Type II MADS-box genes were found, such that the MRCA of extant gymnosperms had at least 14-16 Type II MADS-box genes. The implied ancestral set of MADS-box genes for seed plants shows simplicity for Type I MADS-box genes and remarkable complexity for Type II MADS-box genes in terms of phylogeny and putative functions. The analysis of transcriptome data reveals that gymnosperm MADS-box genes are expressed in a great variety of tissues, indicating diverse roles of MADS-box genes for the development of gymnosperms. This study is
Patankar, Himanshu V; Al-Harrasi, Ibtisam; Al-Yahyai, Rashid; Yaish, Mahmoud W
2018-06-01
Although date palm is a relatively salt-tolerant plant, the molecular basis of this tolerance is complex and poorly understood. Therefore, this study aimed to identify the genes involved in salinity tolerance using a basic yeast functional bioassay. To achieve this, a date palm cDNA library was overexpressed in Saccharomyces cerevisiae cells. The expression levels of selected genes that make yeast cells tolerant to salt were subsequently validated in the leaf and root tissues of date palm seedlings using a quantitative PCR method. About 6000 yeast transformant cells were replica printed and screened on a synthetic minimal medium containing 1.0 M of NaCl. The screening results showed the presence of 62 salt-tolerant transformant colonies. Sequence analysis of the recombinant yeast plasmids revealed the presence of a group of genes with potential salt-tolerance functions, such as aquaporins (PIP), serine/threonine protein kinases (STKs), ethylene-responsive transcription factor 1 (ERF1), and peroxidases (PRX). The expression pattern of the selected genes endorsed the hypothesis that these genes may be involved in salinity tolerance, as they showed a significant (p < 0.05) overexpression trend in both the leaf and root tissues in response to salinity. The genes identified in this project are suitable candidates for the further functional characterization of date palms.
UV-Induced Cell Death in Plants
Nawkar, Ganesh M.; Maibam, Punyakishore; Park, Jung Hoon; Sahi, Vaidurya Pratap; Lee, Sang Yeol; Kang, Chang Ho
2013-01-01
Plants are photosynthetic organisms that depend on sunlight for energy. Plants respond to light through different photoreceptors and show photomorphogenic development. Apart from Photosynthetically Active Radiation (PAR; 400–700 nm), plants are exposed to UV light, which is comprised of UV-C (below 280 nm), UV-B (280–320 nm) and UV-A (320–390 nm). The atmospheric ozone layer protects UV-C radiation from reaching earth while the UVR8 protein acts as a receptor for UV-B radiation. Low levels of UV-B exposure initiate signaling through UVR8 and induce secondary metabolite genes involved in protection against UV while higher dosages are very detrimental to plants. It has also been reported that genes involved in MAPK cascade help the plant in providing tolerance against UV radiation. The important targets of UV radiation in plant cells are DNA, lipids and proteins and also vital processes such as photosynthesis. Recent studies showed that, in response to UV radiation, mitochondria and chloroplasts produce a reactive oxygen species (ROS). Arabidopsis metacaspase-8 (AtMC8) is induced in response to oxidative stress caused by ROS, which acts downstream of the radical induced cell death (AtRCD1) gene making plants vulnerable to cell death. The studies on salicylic and jasmonic acid signaling mutants revealed that SA and JA regulate the ROS level and antagonize ROS mediated cell death. Recently, molecular studies have revealed genes involved in response to UV exposure, with respect to programmed cell death (PCD). PMID:23344059
Implication of the changing concept of genes on plant breeder’s work
Directory of Open Access Journals (Sweden)
Marco Aurélio D. Dias
2011-01-01
Full Text Available The recent genome sequencing of some species has accumulated evidence that for a large number of traits, thecontrol and action of genes are far more complex than previously thought. This article discusses possible implications of newinsights into the gene concept on the work of plant breeders. Apparently, the successful application of biotechnological techniques is not as simple as once assumed. The evident changes in the available concept of genes confirmed what the past experience had shown,i.e, selection should focus on the phenotype, under the same conditions as the plant is to be cultivated in. Advanced vocationaltraining of plant breeders must be continuously maintained, focusing on phenotype-based selection in as accurate as possibleexperiments.
Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil
2015-07-01
Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Identification of genes involved in DNA replication of the Autographa californica baculovirus
Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.
1994-01-01
By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,
Arruda, Sandra C C; Barbosa, Herbert S; Azevedo, Ricardo A; Arruda, Marco A Z
2013-11-20
This work evaluates the activity of a few key enzymes involved in combating reactive oxygen species (ROS), such as ascorbate peroxidase (EC 1.11.1.11), catalase (EC 1.11.1.6), glutathione reductase (EC 1.6.4.2), and superoxide dismutase (EC 1.15.1.1), as well as the concentration of malondialdehyde and hydrogen peroxide in transgenic and non-transgenic soybean leaves. Additionally, differential protein species from leaves of both genotypes were evaluated by applying a regulation factor of ≥1.8 to further corroborate the hypothesis that genetic modification itself can be a stress factor for these plants. For this task, transgenic soybean plants were obtained from seeds modified with the cp4EPSPS gene. The results revealed higher activities of all evaluated enzymes in transgenic than in non-transgenic soybean leaves (ranging from 13.8 to 70.1%), as well as higher concentrations of malondialdehyde and hydrogen peroxide in transgenic soybean leaves, clearly indicating a condition of oxidative stress established in the transgenic genotype. Additionally, 47 proteins were differentially abundant when comparing the leaves of both plants, with 26 species accurately identified, including the protein involved in the genetic modification (CP4EPSPS). From these results, it is possible to conclude that the plant is searching for a new equilibrium to maintain its metabolism because the stress condition is being maintained within levels that can be tolerated by the plant. The present paper is the first one in the literature where are shown translational aspects involving plant stress and the genetic modification for soybean involving the cp4 EPSPS gene. The main biological importance of this work is to make possible the demystification of the genetic modification, allowing answers for some questions that still remain unknown, and enlarge our knowledge about genetically modified organisms. This article is part of a Special Issue entitled: Translational Plant Proteomics. Copyright
Han, R; Rai, A; Nakamura, M; Suzuki, H; Takahashi, H; Yamazaki, M; Saito, K
2016-01-01
Study on transcriptome, the entire pool of transcripts in an organism or single cells at certain physiological or pathological stage, is indispensable in unraveling the connection and regulation between DNA and protein. Before the advent of deep sequencing, microarray was the main approach to handle transcripts. Despite obvious shortcomings, including limited dynamic range and difficulties to compare the results from distinct experiments, microarray was widely applied. During the past decade, next-generation sequencing (NGS) has revolutionized our understanding of genomics in a fast, high-throughput, cost-effective, and tractable manner. By adopting NGS, efficiency and fruitful outcomes concerning the efforts to elucidate genes responsible for producing active compounds in medicinal plants were profoundly enhanced. The whole process involves steps, from the plant material sampling, to cDNA library preparation, to deep sequencing, and then bioinformatics takes over to assemble enormous-yet fragmentary-data from which to comb and extract information. The unprecedentedly rapid development of such technologies provides so many choices to facilitate the task, which can cause confusion when choosing the suitable methodology for specific purposes. Here, we review the general approaches for deep transcriptome analysis and then focus on their application in discovering biosynthetic pathways of medicinal plants that produce important secondary metabolites. © 2016 Elsevier Inc. All rights reserved.
An ant-plant mutualism through the lens of cGMP-dependent kinase genes.
Malé, Pierre-Jean G; Turner, Kyle M; Doha, Manjima; Anreiter, Ina; Allen, Aaron M; Sokolowski, Marla B; Frederickson, Megan E
2017-09-13
In plant-animal mutualisms, how an animal forages often determines how much benefit its plant partner receives. In many animals, foraging behaviour changes in response to foraging gene expression or activation of the cGMP-dependent protein kinase (PKG) that foraging encodes. Here, we show that this highly conserved molecular mechanism affects the outcome of a plant-animal mutualism. We studied the two PKG genes of Allomerus octoarticulatus, an Amazonian ant that defends the ant-plant Cordia nodosa against herbivores. Some ant colonies are better 'bodyguards' than others. Working in the field in Peru, we found that colonies fed with a PKG activator recruited more workers to attack herbivores than control colonies. This resulted in less herbivore damage. PKG gene expression in ant workers correlated with whether an ant colony discovered an herbivore and how much damage herbivores inflicted on leaves in a complex way; natural variation in expression levels of the two genes had significant interaction effects on ant behaviour and herbivory. Our results suggest a molecular basis for ant protection of plants in this mutualism. © 2017 The Author(s).
Sharma, Pooja; Chatterjee, Mithu; Burman, Naini; Khurana, Jitendra P
2014-04-01
The blue light photoreceptors cryptochromes are ubiquitous in higher plants and are vital for regulating plant growth and development. In spite of being involved in controlling agronomically important traits like plant height and flowering time, cryptochromes have not been extensively characterized from agriculturally important crops. Here we show that overexpression of CRY1 from Brassica napus (BnCRY1), an oilseed crop, results in short-statured Brassica transgenics, likely to be less prone to wind and water lodging. The overexpression of BnCRY1 accentuates the inhibition of cell elongation in hypocotyls of transgenic seedlings. The analysis of hypocotyl growth inhibition and anthocyanin accumulation responses in BnCRY1 overexpressors substantiates that regulation of seedling photomorphogenesis by cry1 is dependent on light intensity. This study highlights that the photoactivated cry1 acts through coordinated induction and suppression of specific downstream genes involved in phytohormone synthesis or signalling, and those involved in cell wall modification, during de-etiolation of Brassica seedlings. The microarray-based transcriptome profiling also suggests that the overexpression of BnCRY1 alters abiotic/biotic stress signalling pathways; the transgenic seedlings were apparently oversensitive to abscisic acid (ABA) and mannitol. © 2013 John Wiley & Sons Ltd.
Ma, Jun; Kanakala, S.; He, Yehua; Zhang, Junli; Zhong, Xiaolan
2015-01-01
Background Ananas comosus var. bracteatus (Red Pineapple) is an important ornamental plant for its colorful leaves and decorative red fruits. Because of its complex genome, it is difficult to understand the molecular mechanisms involved in the growth and development. Thus high-throughput transcriptome sequencing of Ananas comosus var. bracteatus is necessary to generate large quantities of transcript sequences for the purpose of gene discovery and functional genomic studies. Results The Anana...
QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD
Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...
ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES
Directory of Open Access Journals (Sweden)
Dominika Ďurechová
2013-02-01
Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.
Jiang, Chunmiao; Shen, Qingxi J; Wang, Bo; He, Bin; Xiao, Suqin; Chen, Ling; Yu, Tengqiong; Ke, Xue; Zhong, Qiaofang; Fu, Jian; Chen, Yue; Wang, Lingxian; Yin, Fuyou; Zhang, Dunyu; Ghidan, Walid; Huang, Xingqi; Cheng, Zaiquan
2017-01-01
Oryza officinalis Wall ex Watt, a very important and special wild rice species, shows abundant genetic diversity and disease resistance features, especially high resistance to bacterial blight. The molecular mechanisms of bacterial blight resistance in O. officinalis have not yet been elucidated. The WRKY transcription factor family is one of the largest gene families involved in plant growth, development and stress response. However, little is known about the numbers, structure, molecular phylogenetics, and expression of the WRKY genes under Xanthomonas oryzae pv. oryzae (Xoo) stress in O. officinalis due to lacking of O. officinalis genome. Therefore, based on the RNA-sequencing data of O. officinalis, we performed a comprehensive study of WRKY genes in O. officinalis and identified 89 OoWRKY genes. Then 89 OoWRKY genes were classified into three groups based on the WRKY domains and zinc finger motifs. Phylogenetic analysis strongly supported that the evolution of OoWRKY genes were consistent with previous studies of WRKYs, and subgroup IIc OoWRKY genes were the original ancestors of some group II and group III OoWRKYs. Among the 89 OoWRKY genes, eight OoWRKYs displayed significantly different expression (>2-fold, pWRKY family of transcription factors in O.officinalis. Insight was gained into the classification, evolution, and function of the OoWRKY genes, revealing the putative roles of eight significantly different expression OoWRKYs in Xoo strains PXO99 and C5 stress responses in O.officinalis. This study provided a better understanding of the evolution and functions of O. officinalis WRKY genes, and suggested that manipulating eight significantly different expression OoWRKYs would enhance resistance to bacterial blight.
Evolution of Parallel Spindles Like genes in plants and highlight of unique domain architecture#
Directory of Open Access Journals (Sweden)
Consiglio Federica M
2011-03-01
Full Text Available Abstract Background Polyploidy has long been recognized as playing an important role in plant evolution. In flowering plants, the major route of polyploidization is suggested to be sexual through gametes with somatic chromosome number (2n. Parallel Spindle1 gene in Arabidopsis thaliana (AtPS1 was recently demonstrated to control spindle orientation in the 2nd division of meiosis and, when mutated, to induce 2n pollen. Interestingly, AtPS1 encodes a protein with a FHA domain and PINc domain putatively involved in RNA decay (i.e. Nonsense Mediated mRNA Decay. In potato, 2n pollen depending on parallel spindles was described long time ago but the responsible gene has never been isolated. The knowledge derived from AtPS1 as well as the availability of genome sequences makes it possible to isolate potato PSLike (PSL and to highlight the evolution of PSL family in plants. Results Our work leading to the first characterization of PSLs in potato showed a greater PSL complexity in this species respect to Arabidopsis thaliana. Indeed, a genomic PSL locus and seven cDNAs affected by alternative splicing have been cloned. In addition, the occurrence of at least two other PSL loci in potato was suggested by the sequence comparison of alternatively spliced transcripts. Phylogenetic analysis on 20 Viridaeplantae showed the wide distribution of PSLs throughout the species and the occurrence of multiple copies only in potato and soybean. The analysis of PSLFHA and PSLPINc domains evidenced that, in terms of secondary structure, a major degree of variability occurred in PINc domain respect to FHA. In terms of specific active sites, both domains showed diversification among plant species that could be related to a functional diversification among PSL genes. In addition, some specific active sites were strongly conserved among plants as supported by sequence alignment and by evidence of negative selection evaluated as difference between non-synonymous and
Signal Network Analysis of Plant Genes Responding to Ionizing Radiation
International Nuclear Information System (INIS)
Kim, Dong Sub; Kim, Jinbaek; Kim, Sang Hoon
2012-12-01
In this project, we irradiated Arabidopsis plants with various doses of gamma-rays at the vegetative and reproductive stages to assess their radiation sensitivity. After the gene expression profiles and an analysis of the antioxidant response, we selected several Arabidopsis genes for uses of 'Radio marker genes (RMG)' and conducted over-expression and knock-down experiments to confirm the radio sensitivity. Based on these results, we applied two patents for the detection of two RMG (At3g28210 and At4g37990) and development of transgenic plants. Also, we developed a Genechip for use of high-throughput screening of Arabidopsis genes responding only to ionizing radiation and identified RMG to detect radiation leaks. Based on these results, we applied two patents associated with the use of Genechip for different types of radiation and different growth stages. Also, we conducted co-expression network study of specific expressed probes against gamma-ray stress and identified expressed patterns of duplicated genes formed by whole/500kb segmental genome duplication
Directory of Open Access Journals (Sweden)
Hong Lu
Full Text Available Xanthomonas is a large genus of plant-associated and plant-pathogenic bacteria. Collectively, members cause diseases on over 392 plant species. Individually, they exhibit marked host- and tissue-specificity. The determinants of this specificity are unknown.To assess potential contributions to host- and tissue-specificity, pathogenesis-associated gene clusters were compared across genomes of eight Xanthomonas strains representing vascular or non-vascular pathogens of rice, brassicas, pepper and tomato, and citrus. The gum cluster for extracellular polysaccharide is conserved except for gumN and sequences downstream. The xcs and xps clusters for type II secretion are conserved, except in the rice pathogens, in which xcs is missing. In the otherwise conserved hrp cluster, sequences flanking the core genes for type III secretion vary with respect to insertion sequence element and putative effector gene content. Variation at the rpf (regulation of pathogenicity factors cluster is more pronounced, though genes with established functional relevance are conserved. A cluster for synthesis of lipopolysaccharide varies highly, suggesting multiple horizontal gene transfers and reassortments, but this variation does not correlate with host- or tissue-specificity. Phylogenetic trees based on amino acid alignments of gum, xps, xcs, hrp, and rpf cluster products generally reflect strain phylogeny. However, amino acid residues at four positions correlate with tissue specificity, revealing hpaA and xpsD as candidate determinants. Examination of genome sequences of xanthomonads Xylella fastidiosa and Stenotrophomonas maltophilia revealed that the hrp, gum, and xcs clusters are recent acquisitions in the Xanthomonas lineage.Our results provide insight into the ancestral Xanthomonas genome and indicate that differentiation with respect to host- and tissue-specificity involved not major modifications or wholesale exchange of clusters, but subtle changes in a small
International Nuclear Information System (INIS)
Wang, Zhenyu; Zhao, Xiuyang; Wang, Bing; Liu, Erlong; Chen, Ni; Zhang, Wei; Liu, Heng
2016-01-01
Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.
Energy Technology Data Exchange (ETDEWEB)
Wang, Zhenyu, E-mail: wzy72609@163.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhao, Xiuyang, E-mail: xiuzh@psb.vib-ugent.be [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Wang, Bing, E-mail: wangbing@ibcas.ac.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Liu, Erlong, E-mail: liuel14@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Chen, Ni, E-mail: 63710156@qq.com [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China); Zhang, Wei, E-mail: wzhang1216@yahoo.com [Shanghai Key Laboratory of Bio-Energy Crops, School of Life Sciences, Shanghai University, Shanghai 200444 (China); Liu, Heng, E-mail: hengliu@lzu.edu.cn [Ministry of Education Key Laboratory of Cell Activities and Stress Adaptations, School of Life Sciences, Lanzhou University, Lanzhou 730030 (China)
2016-04-01
Heterogeneous nuclear ribonucleoproteins (hnRNPs) participate in diverse regulations of plant growth and environmental stress responses. In this work, an Arabidopsis hnRNP of unknown function, AtRNP1, was investigated. We found that AtRNP1 gene is highly expressed in rosette and cauline leaves, and slightly induced under drought, salt, osmotic and ABA stresses. AtRNP1 protein is localized to both the nucleus and cytoplasm. We performed homologous overexpression of AtRNP1 and found that the transgenic plants showed shortened root length and plant height, and accelerated flowering. In addition, the transgenic plants also showed reduced tolerance to drought, salt, osmotic and ABA stresses. Further studies revealed that under both normal and stress conditions, the proline contents in the transgenic plants are markedly decreased, associated with reduced expression levels of a proline synthase gene and several stress-responsive genes. These results suggested that the overexpression of AtRNP1 negatively affects plant growth and abiotic stress tolerance. - Highlights: • AtRNP1 is a widely expressed gene and its expression is slightly induced under abiotic stresses. • AtRNP1 protein is localized to both the nucleus and cytoplasm. • Overexpression of AtRNP1 affects plant growth. • Overexpression of AtRNP1 reduces plant tolerance to drought and salt stresses. • AtRNP1 overexpression plants show decreased proline accumulation and stress-responsive gene expressions.
Balestrini, Raffaella; Gómez-Ariza, Jorge; Lanfranco, Luisa; Bonfante, Paola
2007-09-01
The establishment of a symbiotic interaction between plant roots and arbuscular mycorrhizal (AM) fungi requires both partners to undergo significant morphological and physiological modifications which eventually lead to reciprocal beneficial effects. Extensive changes in gene expression profiles recently have been described in transcriptomic studies that have analyzed the whole mycorrhizal root. However, because root colonization by AM fungi involves different cell types, a cell-specific gene expression pattern is likely to occur. We have applied the laser microdissection (LMD) technology to investigate expression profiles of both plant and fungal genes in Lycopersicon esculentum roots colonized by Glomus mosseae. A protocol to harvest arbuscule-containing cells from paraffin sections of mycorrhizal roots has been developed using a Leica AS LMD system. RNA of satisfactory quantity and quality has been extracted for molecular analysis. Transcripts for plant phosphate transporters (LePTs), selected as molecular markers for a functional symbiosis, have been detected by reverse-transcriptase polymerase chain reaction assays and associated to distinct cell types, leading to novel insights into the distribution of LePT mRNAs. In fact, the transcripts of the five phosphate transporters (PTs) have been detected contemporaneously in the same arbusculated cell population, unlike from the neighboring noncolonized cells. In addition, fungal H(+)ATPase (GmHA5) and phosphate transporter (GmosPT) mRNAs were found exclusively in arbusculated cells. The discovery that five plant and one fungal PT genes are consistently expressed inside the arbusculated cells provides a new scenario for plant-fungus nutrient exchanges.
Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants
Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.
2005-04-01
This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.
Expression of TLP-3 gene without signal peptide in tobacco plants ...
African Journals Online (AJOL)
Expression of TLP-3 gene without signal peptide in tobacco plants using Agrobacterium mediated transformation. ... Plants are exploited as a source of food by a wide range of parasites, including viruses, bacteria, fungi, nematodes, insects and even other plants. So paying attention to their protection is very important.
Identification of genetic components involved in Lotus-endophyte interactions
DEFF Research Database (Denmark)
Zgadzaj, Rafal Lukasz
of growth hormones or nitrogen fixation. However, the genes involved in plant-endophyte interactions and bacterial accomodation within plant tissues are not known. In order to shed some light on such processes, an approach “one host-one endophyte” was chosen. The focus on a single plant species and a single......Endophytes are microorganisms capable of colonising plant tissues without inducing host defense responses. They have a large impact on plants, since they can modulate plant responses to pathogens, herbivores and environmental stress. They can also induce plant growth promotion through synthesis...... bacterial strain aimed at obtaining a reliable and easy to handle system for plant-microsymbiont interaction research. Two different methods were tested for their usefulness in identification of genetic components involved in plant-endophyte interactions. The first method was based on measuring growth...
Preservation of genes involved in sterol metabolism in cholesterol auxotrophs: facts and hypotheses.
Directory of Open Access Journals (Sweden)
Giovanna Vinci
Full Text Available BACKGROUND: It is known that primary sequences of enzymes involved in sterol biosynthesis are well conserved in organisms that produce sterols de novo. However, we provide evidence for a preservation of the corresponding genes in two animals unable to synthesize cholesterol (auxotrophs: Drosophila melanogaster and Caenorhabditis elegans. PRINCIPAL FINDINGS: We have been able to detect bona fide orthologs of several ERG genes in both organisms using a series of complementary approaches. We have detected strong sequence divergence between the orthologs of the nematode and of the fruitfly; they are also very divergent with respect to the orthologs in organisms able to synthesize sterols de novo (prototrophs. Interestingly, the orthologs in both the nematode and the fruitfly are still under selective pressure. It is possible that these genes, which are not involved in cholesterol synthesis anymore, have been recruited to perform different new functions. We propose a more parsimonious way to explain their accelerated evolution and subsequent stabilization. The products of ERG genes in prototrophs might be involved in several biological roles, in addition to sterol synthesis. In the case of the nematode and the fruitfly, the relevant genes would have lost their ancestral function in cholesterogenesis but would have retained the other function(s, which keep them under pressure. CONCLUSIONS: By exploiting microarray data we have noticed a strong expressional correlation between the orthologs of ERG24 and ERG25 in D. melanogaster and genes encoding factors involved in intracellular protein trafficking and folding and with Start1 involved in ecdysteroid synthesis. These potential functional connections are worth being explored not only in Drosophila, but also in Caenorhabditis as well as in sterol prototrophs.
Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer
DEFF Research Database (Denmark)
Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck
2009-01-01
Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...
Legal considerations involving chemical control of iron and other deficiencies in plants
Energy Technology Data Exchange (ETDEWEB)
Wallace, A; Samman, Y. S.
1981-01-01
Four cases of lawsuits involving use of chelating agents in plant nutrition are discussed. Three of them involved use of iron. One concerned addition of FeDTPA to nursery trees in containers. One case involved foliar application of FeHEDTA to potatoes in July by airplane. Another case not involving iron chelate was with ZnEDTA and MnEDTA with Fe as FeSO/sub 4/ later as a foliar spray. The Zn and MnEDTA were applied as a band 8 inches (20 cm) on both sides of nursery tree rows just as the buds that had been placed in the fall began growing in the spring. In the fourth case, many tomato transplants died when the transplanting was done with about 120 ml per plant of transplant solution containing besides N, P and K, about 19 mg Zn as ZnEDTA, 14 mg Mn as MnEDTA and 7 mg Fe as FeHEDTA. Cases such as these will probably discourage use of chelating agents in plant nutrition even if the chelating agents were not the damaging agent. Not enough developmental work was done on the potential toxicities from metal chelates. This trend to lawsuits makes it even more important to solve iron chlorosis problems via plant breeding.
Oh, Myung-Min; Trick, Harold N; Rajashekar, C B
2009-01-30
Lettuce (Lactuca sativa) plants grown in a protective environment, similar to in vitro conditions, were acclimated in a growth chamber and subjected to water stress to examine the activation of genes involved in secondary metabolism and biosynthesis of antioxidants. The expression of phenylalanine ammonia-lyase (PAL), gamma-tocopherol methyl transferase (gamma-TMT) and l-galactose dehydrogenase (l-GalDH) genes involved in the biosynthesis of phenolic compounds, alpha-tocopherol and ascorbic acid, respectively, were determined during plant adaptation. These genes were activated in tender plants, grown under protective conditions, when exposed to normal growing conditions in a growth chamber. A large increase in transcript level for PAL, a key gene in the phenylpropanoid pathway leading to the biosynthesis of a wide array of phenolics and flavonoids, was observed within 1h of exposure of tender plants to normal growing conditions. Plant growth, especially the roots, was retarded in tender plants when exposed to normal growing conditions. Furthermore, exposure of both protected and unprotected plants to water stress resulted in the activation of PAL. PAL inhibition by 2-aminoindan-2-phosphonic acid (AIP) rendered these plants more sensitive to chilling and heat shock treatments. These results suggest that activation of secondary metabolism as well as the antioxidative metabolism is an integral part of plant adaptation to normal growing conditions in lettuce plants.
Search for Partner Proteins of A. thaliana Immunophilins Involved in the Control of Plant Immunity
Directory of Open Access Journals (Sweden)
Inna A. Abdeeva
2018-04-01
Full Text Available The involvement of plant immunophilins in multiple essential processes such as development, various ways of adapting to biotic and abiotic stresses, and photosynthesis has already been established. Previously, research has demonstrated the involvement of three immunophilin genes (AtCYP19-1/ROC3, AtFKBP65/ROF2, and AtCYP57 in the control of plant response to invasion by various pathogens. Current research attempts to identify host target proteins for each of the selected immunophilins. As a result, candidate interactors have been determined and confirmed using a yeast 2-hybrid (Y2H system for protein–protein interaction assays. The generation of mutant isoforms of ROC3 and AtCYP57 harboring substituted amino acids in the in silico-predicted active sites became essential to achieving significant binding to its target partners. This data shows that ROF2 targets calcium-dependent lipid-binding domain-containing protein (At1g70790; AT1 and putative protein phosphatase (At2g30020; АТ2, whereas ROC3 interacts with GTP-binding protein (At1g30580; ENGD-1 and RmlC-like cupin (At5g39120. The immunophilin AtCYP57 binds to putative pyruvate decarboxylase-1 (Pdc1 and clathrin adaptor complex-related protein (At5g05010. Identified interactors confirm our previous findings that immunophilins ROC3, ROF2, and AtCYP57 are directly involved with stress response control. Further, these findings extend our understanding of the molecular functional pathways of these immunophilins.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Directory of Open Access Journals (Sweden)
A.N. Deryabin
2016-05-01
Full Text Available The expression of heterologous genes in plants is an effective method to improve our understanding of plant resistance mechanisms. The purpose of this work was to investigate the involvement of cell-wall invertase and apoplastic sugars into constitutive cold resistance of potato (Solanum tuberosum L., cv. Dйsirйe plants, which expressed the yeast SUC2 gene encoding apoplastic invertase. WT-plants of a potato served as the control. The increase in the essential cell-wall invertase activity in the leaves of transformed plants indicates significant changes in the cellular carbohydrate metabolism and regulatory function of this enzyme. The activity of yeast invertase changed the composition of intracellular sugars in the leaves of the transformed potato plant. The total content of sugars (sucrose, glucose, fructose in the leaves and apoplast was higher in the transformants, in comparison by WT-plants. Our data indicate higher constitutive resistance of transformants to severe hypothermia conditions compared to WT-plants. This fact allows us to consider cell-wall invertase as a enzyme of carbohydrate metabolism playing an important regulatory role in the metabolic signaling upon forming increased plant resistance to low temperature. Thus, the potato line with the integrated SUC2 gene is a convenient tool to study the role of the apoplastic invertase and the products of its activity during growth, development and formation constitutive resistance to hypothermia.
BIOSYNTHESIS AND ACTION OF JASMONATES IN PLANTS.
Creelman, Robert A.; Mullet, John E.
1997-06-01
Jasmonic acid and its derivatives can modulate aspects of fruit ripening, production of viable pollen, root growth, tendril coiling, and plant resistance to insects and pathogens. Jasmonate activates genes involved in pathogen and insect resistance, and genes encoding vegetative storage proteins, but represses genes encoding proteins involved in photosynthesis. Jasmonic acid is derived from linolenic acid, and most of the enzymes in the biosynthetic pathway have been extensively characterized. Modulation of lipoxygenase and allene oxide synthase gene expression in transgenic plants raises new questions about the compartmentation of the biosynthetic pathway and its regulation. The activation of jasmonic acid biosynthesis by cell wall elicitors, the peptide systemin, and other compounds will be related to the function of jasmonates in plants. Jasmonate modulates gene expression at the level of translation, RNA processing, and transcription. Promoter elements that mediate responses to jasmonate have been isolated. This review covers recent advances in our understanding of how jasmonate biosynthesis is regulated and relates this information to knowledge of jasmonate modulated gene expression.
Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family
Directory of Open Access Journals (Sweden)
Jill Christine Preston
2013-04-01
Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.
Moon, Jiyun M; Aronoff, David M; Capra, John A; Abbot, Patrick; Rokas, Antonis
2018-03-28
Sialic acids are nine carbon sugars ubiquitously found on the surfaces of vertebrate cells and are involved in various immune response-related processes. In humans, at least 58 genes spanning diverse functions, from biosynthesis and activation to recycling and degradation, are involved in sialic acid biology. Because of their role in immunity, sialic acid biology genes have been hypothesized to exhibit elevated rates of evolutionary change. Consistent with this hypothesis, several genes involved in sialic acid biology have experienced higher rates of non-synonymous substitutions in the human lineage than their counterparts in other great apes, perhaps in response to ancient pathogens that infected hominins millions of years ago (paleopathogens). To test whether sialic acid biology genes have also experienced more recent positive selection during the evolution of the modern human lineage, reflecting adaptation to contemporary cosmopolitan or geographically-restricted pathogens, we examined whether their protein-coding regions showed evidence of recent hard and soft selective sweeps. This examination involved the calculation of four measures that quantify changes in allele frequency spectra, extent of population differentiation, and haplotype homozygosity caused by recent hard and soft selective sweeps for 55 sialic acid biology genes using publicly available whole genome sequencing data from 1,668 humans from three ethnic groups. To disentangle evidence for selection from confounding demographic effects, we compared the observed patterns in sialic acid biology genes to simulated sequences of the same length under a model of neutral evolution that takes into account human demographic history. We found that the patterns of genetic variation of most sialic acid biology genes did not significantly deviate from neutral expectations and were not significantly different among genes belonging to different functional categories. Those few sialic acid biology genes that
A Comprehensive Classification and Evolutionary Analysis of Plant Homeobox Genes
Mukherjee, Krishanu; Brocchieri, Luciano; B?rglin, Thomas R.
2009-01-01
The full complement of homeobox transcription factor sequences, including genes and pseudogenes, was determined from the analysis of 10 complete genomes from flowering plants, moss, Selaginella, unicellular green algae, and red algae. Our exhaustive genome-wide searches resulted in the discovery in each class of a greater number of homeobox genes than previously reported. All homeobox genes can be unambiguously classified by sequence evolutionary analysis into 14 distinct classes also charact...
Directory of Open Access Journals (Sweden)
Merino Fuencisla
2010-10-01
Full Text Available Abstract Background Verticillium dahliae is a fungal pathogen that infects a wide range of hosts. The only known genes for resistance to Verticillium in the Solanaceae are found in the tomato (Solanum lycopersicum Ve locus, formed by two linked genes, Ve1 and Ve2. To characterize the resistance response mediated by the tomato Ve gene, we inoculated two nearly isogenic tomato lines, LA3030 (ve/ve and LA3038 (Ve/Ve, with V. dahliae. Results We found induction of H2O2 production in roots of inoculated plants, followed by an increase in peroxidase activity only in roots of inoculated resistant plants. Phenylalanine-ammonia lyase (PAL activity was also increased in resistant roots 2 hours after inoculation, while induction of PAL activity in susceptible roots was not seen until 48 hours after inoculation. Phenylpropanoid metabolism was also affected, with increases in ferulic acid, p-coumaric acid, vanillin and p-hydroxybenzaldehyde contents in resistant roots after inoculation. Six tomato PAL cDNA sequences (PAL1 - PAL6 were found in the SolGenes tomato EST database. RT-PCR analysis showed that these genes were expressed in all organs of the plant, albeit at different levels. Real-time RT-PCR indicated distinct patterns of expression of the different PAL genes in V. dahliae-inoculated roots. Phylogenetic analysis of 48 partial PAL cDNAs corresponding to 19 plant species grouped angiosperm PAL sequences into four clusters, suggesting functional differences among the six tomato genes, with PAL2 and PAL6 presumably involved in lignification, and the remaining PAL genes implicated in other biological processes. An increase in the synthesis of lignins was found 16 and 28 days after inoculation in both lines; this increase was greater and faster to develop in the resistant line. In both resistant and susceptible inoculated plants, an increase in the ratio of guaiacyl/syringyl units was detected 16 days after inoculation, resulting from the lowered amount
DEFF Research Database (Denmark)
Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn
2011-01-01
have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... in response to thioridazine in combination with oxacillin. We observed that the oxacillin-induced expression of genes belonging to the VraSR regulon is reduced by the addition of thioridazine. The exclusion of such key factors involved in cell wall biosynthesis will most likely lead to a weakened cell wall...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....
Lee, Karen J I; Calder, Grant M; Hindle, Christopher R; Newman, Jacob L; Robinson, Simon N; Avondo, Jerome J H Y; Coen, Enrico S
2017-01-01
Optical projection tomography (OPT) is a well-established method for visualising gene activity in plants and animals. However, a limitation of conventional OPT is that the specimen upper size limit precludes its application to larger structures. To address this problem we constructed a macro version called Macro OPT (M-OPT). We apply M-OPT to 3D live imaging of gene activity in growing whole plants and to visualise structural morphology in large optically cleared plant and insect specimens up to 60 mm tall and 45 mm deep. We also show how M-OPT can be used to image gene expression domains in 3D within fixed tissue and to visualise gene activity in 3D in clones of growing young whole Arabidopsis plants. A further application of M-OPT is to visualise plant-insect interactions. Thus M-OPT provides an effective 3D imaging platform that allows the study of gene activity, internal plant structures and plant-insect interactions at a macroscopic scale. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Li, Jiang; Li, Caili; Lu, Shanfa
2018-05-08
DEMETER-like DNA glycosylases (DMLs) initiate the base excision repair-dependent DNA demethylation to regulate a wide range of biological processes in plants. Six putative SmDML genes, termed SmDML1-SmDML6, were identified from the genome of S. miltiorrhiza, an emerging model plant for Traditional Chinese Medicine (TCM) studies. Integrated analysis of gene structures, sequence features, conserved domains and motifs, phylogenetic analysis and differential expression showed the conservation and divergence of SmDMLs. SmDML1, SmDML2 and SmDML4 were significantly down-regulated by the treatment of 5Aza-dC, a general DNA methylation inhibitor, suggesting involvement of SmDMLs in genome DNA methylation change. SmDML1 was predicted and experimentally validated to be target of Smi-miR7972. Computational analysis of forty whole genome sequences and almost all of RNA-seq data from Lamiids revealed that MIR7972s were only distributed in some plants of the three orders, including Lamiales, Solanales and Boraginales, and the number of MIR7972 genes varied among species. It suggests that MIR7972 genes underwent expansion and loss during the evolution of some Lamiids species. Phylogenetic analysis of MIR7972s showed closer evolutionary relationships between MIR7972s in Boraginales and Solanales in comparison with Lamiales. These results provide a valuable resource for elucidating DNA demethylation mechanism in S. miltiorrhiza.
Directory of Open Access Journals (Sweden)
O.I. Grabelnych
2017-02-01
Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.
Directory of Open Access Journals (Sweden)
Yan Wei
2015-01-01
Full Text Available Tea (Camellia sinensis is a popular beverage all over the world and a number of studies have focused on the genetic uniqueness of tea and its cultivars. However, molecular mechanisms underlying these phenomena are largely undefined. In this report, based on expression data available from public databases, we performed a series of analyses to identify genes probably relevant to the uniqueness of C. sinensis and two of its cultivars (LJ43 and ZH2. Evolutionary analyses showed that the evolutionary rates of genes involved in the pathways were not significantly different among C. sinensis, C. oleifera, and C. azalea. Interestingly, a number of gene families, including genes involved in the pathways synthesizing iconic secondary metabolites of tea plant, were significantly upregulated, expressed in C. sinensis (LJ43 when compared to C. azalea, and this may partially explain its higher content of flavonoid, theanine, and caffeine. Further investigation showed that nonsynonymous mutations may partially contribute to the differences between the two cultivars of C. sinensis, such as the chlorina and higher contents of amino acids in ZH2. Genes identified as candidates are probably relevant to the uniqueness of C. sinensis and its cultivars should be good candidates for subsequent functional analyses and marker-assisted breeding.
Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit
2009-08-01
Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.
Directory of Open Access Journals (Sweden)
Masayoshi Hashimoto
2016-10-01
Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.
Xiao, Chaowen; Somerville, Chris; Anderson, Charles T
2014-03-01
Pectins are acidic carbohydrates that comprise a significant fraction of the primary walls of eudicotyledonous plant cells. They influence wall porosity and extensibility, thus controlling cell and organ growth during plant development. The regulated degradation of pectins is required for many cell separation events in plants, but the role of pectin degradation in cell expansion is poorly defined. Using an activation tag screen designed to isolate genes involved in wall expansion, we identified a gene encoding a putative polygalacturonase that, when overexpressed, resulted in enhanced hypocotyl elongation in etiolated Arabidopsis thaliana seedlings. We named this gene POLYGALACTURONASE INVOLVED IN EXPANSION1 (PGX1). Plants lacking PGX1 display reduced hypocotyl elongation that is complemented by transgenic PGX1 expression. PGX1 is expressed in expanding tissues throughout development, including seedlings, roots, leaves, and flowers. PGX1-GFP (green fluorescent protein) localizes to the apoplast, and heterologously expressed PGX1 displays in vitro polygalacturonase activity, supporting a function for this protein in apoplastic pectin degradation. Plants either overexpressing or lacking PGX1 display alterations in total polygalacturonase activity, pectin molecular mass, and wall composition and also display higher proportions of flowers with extra petals, suggesting PGX1's involvement in floral organ patterning. These results reveal new roles for polygalacturonases in plant development.
Co-ordinate regulation of genes involved in storage lipid mobilization in Arabidopsis thaliana.
Rylott, E L; Hooks, M A; Graham, I A
2001-05-01
Molecular genetic approaches in the model plant Arabidopsis thaliana (Col0) are shedding new light on the role and control of the pathways associated with the mobilization of lipid reserves during oilseed germination and post-germinative growth. Numerous independent studies have reported on the expression of individual genes encoding enzymes from the three major pathways: beta-oxidation, the glyoxylate cycle and gluconeogenesis. However, a single comprehensive study of representative genes and enzymes from the different pathways in a single plant species has not been done. Here we present results from Arabidopsis that demonstrate the co-ordinate regulation of gene expression and enzyme activities for the acyl-CoA oxidase- and 3-ketoacyl-CoA thiolase-mediated steps of beta-oxidation, the isocitrate lyase and malate synthase steps of the glyoxylate cycle and the phosphoenolpyruvate carboxykinase step of gluconeogenesis. The mRNA abundance and enzyme activities increase to a peak at stage 2, 48 h after the onset of seed germination, and decline thereafter either to undetectable levels (for malate synthase and isocitrate lyase) or low basal levels (for the genes of beta-oxidation and gluconeogenesis). The co-ordinate induction of all these genes at the onset of germination raises the possibility that a global regulatory mechanism operates to induce the expression of genes associated with the mobilization of storage reserves during the heterotrophic growth period.
Vieira, Dayse Drielly Sousa Santana; Emiliani, Giovanni; Bartolini, Paola; Podda, Alessandra; Centritto, Mauro; Luro, François; Carratore, Renata Del; Morillon, Raphaël; Gesteira, Abelmon; Maserti, Biancaelena
2017-11-01
Combination of biotic and abiotic stress is a major challenge for crop and fruit production. Thus, identification of genes involved in cross-response to abiotic and biotic stress is of great importance for breeding superior genotypes. Lectins are glycan-binding proteins with a functions in the developmental processes as well as in the response to biotic and abiotic stress. In this work, a lectin like gene, namely ClLectin1, was characterized in Volkamer lemon and its expression was studied in plants exposed to either water stress, hormonal elicitors (JA, SA, ABA) or wounding to understand whether this gene may have a function in the response to multiple stress combination. Results showed that ClLectin1 has 100% homology with a L-type lectin gene from C. sinensis and the in silico study of the 5'UTR region showed the presence of cis-responsive elements to SA, DRE2 and ABA. ClLectin1 was rapidly induced by hormonal treatments and wounding, at local and systemic levels, suggesting an involvement in defence signalling pathways and a possible role as fast detection biomarker of biotic stress. On the other hand, the induction of ClLectin1 by water stress pointed out a role of the gene in the response to drought. The simultaneous response of ClLectin1 expression to water stress and SA treatment could be further investigated to assess whether a moderate drought stress may be useful to improve citrus performance by stimulating the SA-dependent response to biotic stress. Copyright © 2017 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Ming Zhu
2017-10-01
Full Text Available Long non-coding RNAs (lncRNAs have been reported to be involved in the development of maize plant. However, few focused on seed development of maize. Here, we identified 753 lncRNA candidates in maize genome from six seed samples. Similar to the mRNAs, lncRNAs showed tissue developmental stage specific and differential expression, indicating their putative role in seed development. Increasing evidence shows that crosstalk among RNAs mediated by shared microRNAs (miRNAs represents a novel layer of gene regulation, which plays important roles in plant development. Functional roles and regulatory mechanisms of lncRNAs as competing endogenous RNAs (ceRNA in plants, particularly in maize seed development, are unclear. We combined analyses of consistently altered 17 lncRNAs, 840 mRNAs and known miRNA to genome-wide investigate potential lncRNA-mediated ceRNA based on “ceRNA hypothesis”. The results uncovered seven novel lncRNAs as potential functional ceRNAs. Functional analyses based on their competitive coding-gene partners by Gene Ontology (GO and KEGG biological pathway demonstrated that combined effects of multiple ceRNAs can have major impacts on general developmental and metabolic processes in maize seed. These findings provided a useful platform for uncovering novel mechanisms of maize seed development and may provide opportunities for the functional characterization of individual lncRNA in future studies.
ESKIMO1 is a key gene involved in water economy as well as cold acclimation and salt tolerance
DEFF Research Database (Denmark)
Bouchabke-Coussa, O.; Quashie, M.L.; Seoane, Jose Miguel
2008-01-01
's improved tolerance to reduced water supply may be explained by its lower transpiration rate and better water use efficiency (WUE), which was assessed by carbon isotope discrimination and gas exchange measurements. esk1 alleles were also shown to be more tolerant to salt stress. Transcriptomic analysis......Background: Drought is a major social and economic problem resulting in huge yield reduction in the field. Today's challenge is to develop plants with reduced water requirements and stable yields in fluctuating environmental conditions. Arabidopsis thaliana is an excellent model for identifying...... as a key gene involved in plant water economy as well as cold acclimation and salt tolerance. Results: All esk1 mutants were more tolerant to freezing, after acclimation, than their wild type counterpart. esk1 mutants also showed increased tolerance to mild water deficit for all traits measured. The mutant...
Chen, Zhen; Liu, Peize; Li, Zhipeng; Yu, Wencheng; Wang, Zhi; Yao, Haosheng; Wang, Yuanpeng; Li, Qingbiao; Deng, Xu; He, Ning
2017-03-01
The present study reports the sequenced genome of Bacillus licheniformis CGMCC 2876, which is composed of a 4,284,461 bp chromosome that contains 4,188 protein-coding genes, 72 tRNA genes, and 21 rRNA genes. Additional analysis revealed an eps gene cluster with 16 open reading frames. Conserved Domains Database analysis combined with qPCR experiments indicated that all genes in this cluster were involved in polysaccharide bioflocculant synthesis. Phosphoglucomutase and UDP-glucose pyrophosphorylase were supposed to be key enzymes in polysaccharide secretion in B. licheniformis. A biosynthesis pathway for the production of polysaccharide bioflocculant involving the integration of individual genes was proposed based on functional analysis. Overexpression of epsDEF from the eps gene cluster in B. licheniformis CGMCC 2876 increased the flocculating activity of the recombinant strain by 90% compared to the original strain. Similarly, the crude yield of polysaccharide bioflocculant was enhanced by 27.8%. Overexpression of the UDP-glucose pyrophosphorylase gene not only increased the flocculating activity by 71% but also increased bioflocculant yield by 13.3%. Independent of UDP-N-acetyl-D-mannosamine dehydrogenase gene, flocculating activity, and polysaccharide yield were negatively impacted by overexpression of the UDP-N-acetylglucosamine 2-epimerase gene. Overall, epsDEF and gtaB2 were identified as key genes for polysaccharide bioflocculant synthesis in B. licheniformis. These results will be useful for further engineering of B. licheniformis for industrial bioflocculant production. Biotechnol. Bioeng. 2017;114: 645-655. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Viral vectors for gene modification of plants as chem/bio sensors.
Energy Technology Data Exchange (ETDEWEB)
Manginell, Monica; Harper, Jason C.; Arango, Dulce C.; Brozik, Susan Marie; Dolan, Patricia L.
2006-11-01
Chemical or biological sensors that are specific, sensitive, and robust allowing intelligence gathering for verification of nuclear non-proliferation treaty compliance and detouring production of weapons of mass destruction are sorely needed. Although much progress has been made in the area of biosensors, improvements in sensor lifetime, robustness, and device packaging are required before these devices become widely used. Current chemical and biological detection and identification techniques require less-than-covert sample collection followed by transport to a laboratory for analysis. In addition to being expensive and time consuming, results can often be inconclusive due to compromised sample integrity during collection and transport. We report here a demonstration of a plant based sensor technology which utilizes mature and seedling plants as chemical sensors. One can envision genetically modifying native plants at a site of interest that can report the presence of specific toxins or chemicals. In this one year project we used a developed inducible expression system to show the feasibility of plant sensors. The vector was designed as a safe, non-infectious vector which could be used to invade, replicate, and introduce foreign genes into mature host plants that then allow the plant to sense chem/bio agents. The genes introduced through the vector included a reporter gene that encodes for green fluorescent protein (GFP) and a gene that encodes for a mammalian receptor that recognizes a chemical agent. Specifically, GFP was induced by the presence of 17-{beta}-Estradiol (estrogen). Detection of fluorescence indicated the presence of the target chemical agent. Since the sensor is a plant, costly device packaging development or manufacturing of the sensor were not required. Additionally, the biological recognition and reporting elements are maintained in a living, natural environment and therefore do not suffer from lifetime disadvantages typical of most biosensing
Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi
2013-01-01
The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833
Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila
2014-05-01
Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Fang Liu
Full Text Available Plant non-specific lipid transfer proteins (nsLTPs constitute large multigene families that possess complex physiological functions, many of which remain unclear. This study isolated and characterized the function of a lipid transfer protein gene, BraLTP1 from Brassica rapa, in the important oilseed crops Brassica napus. BraLTP1 encodes a predicted secretory protein, in the little known VI Class of nsLTP families. Overexpression of BnaLTP1 in B. napus caused abnormal green coloration and reduced wax deposition on leaves and detailed wax analysis revealed 17-80% reduction in various major wax components, which resulted in significant water-loss relative to wild type. BnaLTP1 overexpressing leaves exhibited morphological disfiguration and abaxially curled leaf edges, and leaf cross-sections revealed cell overproliferation that was correlated to increased cytokinin levels (tZ, tZR, iP, and iPR in leaves and high expression of the cytokinin biosynthsis gene IPT3. BnaLTP1-overexpressing plants also displayed morphological disfiguration of flowers, with early-onset and elongated carpel development and outwardly curled stamen. This was consistent with altered expression of a a number of ABC model genes related to flower development. Together, these results suggest that BraLTP1 is a new nsLTP gene involved in wax production or deposition, with additional direct or indirect effects on cell division and flower development.
Screening key candidate genes and pathways involved in insulinoma by microarray analysis.
Zhou, Wuhua; Gong, Li; Li, Xuefeng; Wan, Yunyan; Wang, Xiangfei; Li, Huili; Jiang, Bin
2018-06-01
Insulinoma is a rare type tumor and its genetic features remain largely unknown. This study aimed to search for potential key genes and relevant enriched pathways of insulinoma.The gene expression data from GSE73338 were downloaded from Gene Expression Omnibus database. Differentially expressed genes (DEGs) were identified between insulinoma tissues and normal pancreas tissues, followed by pathway enrichment analysis, protein-protein interaction (PPI) network construction, and module analysis. The expressions of candidate key genes were validated by quantitative real-time polymerase chain reaction (RT-PCR) in insulinoma tissues.A total of 1632 DEGs were obtained, including 1117 upregulated genes and 514 downregulated genes. Pathway enrichment results showed that upregulated DEGs were significantly implicated in insulin secretion, and downregulated DEGs were mainly enriched in pancreatic secretion. PPI network analysis revealed 7 hub genes with degrees more than 10, including GCG (glucagon), GCGR (glucagon receptor), PLCB1 (phospholipase C, beta 1), CASR (calcium sensing receptor), F2R (coagulation factor II thrombin receptor), GRM1 (glutamate metabotropic receptor 1), and GRM5 (glutamate metabotropic receptor 5). DEGs involved in the significant modules were enriched in calcium signaling pathway, protein ubiquitination, and platelet degranulation. Quantitative RT-PCR data confirmed that the expression trends of these hub genes were similar to the results of bioinformatic analysis.The present study demonstrated that candidate DEGs and enriched pathways were the potential critical molecule events involved in the development of insulinoma, and these findings were useful for better understanding of insulinoma genesis.
Huang, Jianzi; Lu, Xiang; Yan, Hao; Chen, Shouyi; Zhang, Wanke; Huang, Rongfeng; Zheng, Yizhi
2012-04-01
Semi-mangroves form a group of transitional species between glycophytes and halophytes, and hold unique potential for learning molecular mechanisms underlying plant salt tolerance. Millettia pinnata is a semi-mangrove plant that can survive a wide range of saline conditions in the absence of specialized morphological and physiological traits. By employing the Illumina sequencing platform, we generated ~192 million short reads from four cDNA libraries of M. pinnata and processed them into 108,598 unisequences with a high depth of coverage. The mean length and total length of these unisequences were 606 bp and 65.8 Mb, respectively. A total of 54,596 (50.3%) unisequences were assigned Nr annotations. Functional classification revealed the involvement of unisequences in various biological processes related to metabolism and environmental adaptation. We identified 23,815 candidate salt-responsive genes with significantly differential expression under seawater and freshwater treatments. Based on the reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR analyses, we verified the changes in expression levels for a number of candidate genes. The functional enrichment analyses for the candidate genes showed tissue-specific patterns of transcriptome remodelling upon salt stress in the roots and the leaves. The transcriptome of M. pinnata will provide valuable gene resources for future application in crop improvement. In addition, this study sets a good example for large-scale identification of salt-responsive genes in non-model organisms using the sequencing-based approach.
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.
Walworth, Aaron E; Chai, Benli; Song, Guo-Qing
2016-01-01
In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.
Directory of Open Access Journals (Sweden)
Aaron E Walworth
Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants
Walworth, Aaron E.; Chai, Benli; Song, Guo-qing
2016-01-01
In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all
Genes involved in cell division in mycoplasmas
Directory of Open Access Journals (Sweden)
Frank Alarcón
2007-01-01
Full Text Available Bacterial cell division has been studied mainly in model systems such as Escherichia coli and Bacillus subtilis, where it is described as a complex process with the participation of a group of proteins which assemble into a multiprotein complex called the septal ring. Mycoplasmas are cell wall-less bacteria presenting a reduced genome. Thus, it was important to compare their genomes to analyze putative genes involved in cell division processes. The division and cell wall (dcw cluster, which in E. coli and B. subtilis is composed of 16 and 17 genes, respectively, is represented by only three to four genes in mycoplasmas. Even the most conserved protein, FtsZ, is not present in all mycoplasma genomes analyzed so far. A model for the FtsZ protein from Mycoplasma hyopneumoniae and Mycoplasma synoviae has been constructed. The conserved residues, essential for GTP/GDP binding, are present in FtsZ from both species. A strong conservation of hydrophobic amino acid patterns is observed, and is probably necessary for the structural stability of the protein when active. M. synoviae FtsZ presents an extended amino acid sequence at the C-terminal portion of the protein, which may participate in interactions with other still unknown proteins crucial for the cell division process.
Vascular Gene Expression: A Hypothesis
Directory of Open Access Journals (Sweden)
Angélica Concepción eMartínez-Navarro
2013-07-01
Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.
Use of NAP gene to manipulate leaf senescence in plants
Gan, Susheng; Guo, Yongfeng
2013-04-16
The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.
Directory of Open Access Journals (Sweden)
Dorota Magdalena Krzyżanowska
2016-05-01
Full Text Available Dickeya solani and Pectobacterium carotovorum subsp. brasili¬ense are recently established species of bacterial plant pathogens causing black leg and soft rot of many vegetables and ornamental plants. Pseudomonas sp. strain P482 inhibits the growth of these pathogens, a desired trait considering the limited measures to combat these diseases. In this study, we determined the genetic background of the antibacterial activity of P482, and established the phylogenetic position of this strain.Pseudomonas sp. P482 was classified as Pseudomonas donghuensis. Genome mining revealed that the P482 genome does not contain genes determining the synthesis of known antimicrobials. However, the ClusterFinder algorithm, designed to detect atypical or novel classes of secondary metabolite gene clusters, predicted 18 such clusters in the genome. Screening of a Tn5 mutant library yielded an antimicrobial negative transposon mutant. The transposon insertion was located in a gene encoding an HpcH/HpaI aldolase/citrate lyase family protein. This gene is located in a hypothetical cluster predicted by the ClusterFinder, together with the downstream homologues of four nfs genes, that confer production of a nonfluorescent siderophore by P. donghuensis HYST. Site-directed inactivation of the HpcH/HpaI aldolase gene, the adjacent short chain dehydrogenase gene, as well as a homologue of an essential nfs cluster gene, all abolished the antimicrobial activity of the P482, suggesting their involvement in a common biosynthesis pathway. However, none of the mutants showed a decreased siderophore yield, neither was the antimicrobial activity of the wild type P482 compromised by high iron bioavailability.A genomic region comprising the nfs cluster and three upstream genes is involved in the antibacterial activity of P. donghuensis P482 against D. solani and P. carotovorum subsp. brasiliense. The genes studied are unique to the two known P. donghuensis strains. This study
Characterization of MORE AXILLARY GROWTH genes in Populus.
Directory of Open Access Journals (Sweden)
Olaf Czarnecki
Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.
A nucleotide metabolite controls stress-responsive gene expression and plant development.
Directory of Open Access Journals (Sweden)
Hao Chen
Full Text Available Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1 protein is a negative regulator of stress and abscisic acid (ABA signaling and exhibits both an inositol polyphosphatase and a 3',5'-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3'-phosphoadenosine-5'-phosphate (PAP, yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3'-phosphoadenosine-5'-phosphosulfate (PAPS, we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt
A nucleotide metabolite controls stress-responsive gene expression and plant development
Chen, Hao
2011-10-19
Abiotic stress, such as drought and high salinity, activates a network of signaling cascades that lead to the expression of many stress-responsive genes in plants. The Arabidopsis FIERY1 (FRY1) protein is a negative regulator of stress and abscisic acid (ABA) signaling and exhibits both an inositol polyphosphatase and a 3?,5?-bisphosphate nucleotidase activity in vitro. The FRY1 nucleotidase degrades the sulfation byproduct 3?-phosphoadenosine-5?-phosphate (PAP), yet its in vivo functions and particularly its roles in stress gene regulation remain unclear. Here we developed a LC-MS/MS method to quantitatively measure PAP levels in plants and investigated the roles of this nucleotidase activity in stress response and plant development. It was found that PAP level was tightly controlled in plants and did not accumulate to any significant level either under normal conditions or under NaCl, LiCl, cold, or ABA treatments. In contrast, high levels of PAP were detected in multiple mutant alleles of FRY1 but not in mutants of other FRY1 family members, indicating that FRY1 is the major enzyme that hydrolyzes PAP in vivo. By genetically reducing PAP levels in fry1 mutants either through overexpression of a yeast PAP nucleotidase or by generating a triple mutant of fry1 apk1 apk2 that is defective in the biosynthesis of the PAP precursor 3?-phosphoadenosine-5?-phosphosulfate (PAPS), we demonstrated that the developmental defects and superinduction of stress-responsive genes in fry1 mutants correlate with PAP accumulation in planta. We also found that the hypersensitive stress gene regulation in fry1 requires ABH1 but not ABI1, two other negative regulators in ABA signaling pathways. Unlike in yeast, however, FRY1 overexpression in Arabidopsis could not enhance salt tolerance. Taken together, our results demonstrate that PAP is critical for stress gene regulation and plant development, yet the FRY1 nucleotidase that catabolizes PAP may not be an in vivo salt toxicity target
International Nuclear Information System (INIS)
Mylen, Joshua
2014-01-01
An ingenious experiment has allowed scientists to observe how plant genes move around the nucleus to locations that either stop or stimulate flowering depending on temperature. Every cell of the humble model plant Arabidopsis contains five chromosomes, each of which carries about 5000 genes. Each cell stashes some of its genes away and keeps some in ready reserve, while the others remain active and busily make proteins. After decades of effort, scientists feel like they have a good understanding of how genes are regulated between these active and inactive states, but it's beginning to dawn on them just how much genes move around while this happens, and that this might be a part of the regulatory process. I have been part of a team of plant biologists that has developed a way to watch one particular gene move about the nucleus of a cell of a living plant. As the gene responded to cold, we saw how its copies came together in one place and were inactivated, showing that physical movement is involved in its control.
Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael
2017-07-01
The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
LMI1-like genes involved in leaf margin development of Brassica napus.
Ni, Xiyuan; Liu, Han; Huang, Jixiang; Zhao, Jianyi
2017-06-01
In rapeseed (Brassica napus L.), leaf margins are variable and can be entire, serrate, or lobed. In our previous study, the lobed-leaf gene (LOBED-LEAF 1, BnLL1) was mapped to a 32.1 kb section of B. napus A10. Two LMI1-like genes, BnaA10g26320D and BnaA10g26330D, were considered the potential genes that controlled the lobed-leaf trait in rapeseed. In the present study, these two genes and another homologous gene (BnaC04g00850D) were transformed into Arabidopsis thaliana (L.) Heynh. plants to identify their functions. All three LMI1-like genes of B. napus produced serrate leaf margins. The expression analysis indicated that the expression level of BnaA10g26320D determined the difference between lobed- and entire-leaved lines in rapeseed. Therefore, it is likely that BnaA10g26320D corresponds to BnLL1.
A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis
Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor
2014-01-01
BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552
Sánchez-Navarro, J A; Reusken, C B; Bol, J F; Pallás, V
1997-12-01
Alfalfa mosaic virus (AMV) and Prunus necrotic ringspot virus (PNRSV) are tripartite positive-strand RNA plant viruses that encode functionally similar translation products. Although the two viruses are phylogenetically closely related, they infect a very different range of natural hosts. The coat protein (CP) gene, the movement protein (MP) gene or both genes in AMV RNA 3 were replaced by the corresponding genes of PNRSV. The chimeric viruses were tested for heterologous encapsidation, replication in protoplasts from plants transformed with AMV replicase genes P1 and P2 (P12 plants) and for cell-to-cell transport in P12 plants. The chimeric viruses exhibited basic competence for encapsidation and replication in P12 protoplasts and for a low level of cell-to-cell movement in P12 plants. The potential involvement of the MP gene in determining host specificity in ilarviruses is discussed.
Directory of Open Access Journals (Sweden)
Yonglong Yu
2016-04-01
Full Text Available Wheat seed development is an important physiological process of seed maturation and directly affects wheat yield and quality. In this study, we performed dynamic transcriptome microarray analysis of an elite Chinese bread wheat cultivar (Jimai 20 during grain development using the GeneChip Wheat Genome Array. Grain morphology and scanning electron microscope observations showed that the period of 11–15 days post-anthesis (DPA was a key stage for the synthesis and accumulation of seed starch. Genome-wide transcriptional profiling and significance analysis of microarrays revealed that the period from 11 to 15 DPA was more important than the 15–20 DPA stage for the synthesis and accumulation of nutritive reserves. Series test of cluster analysis of differential genes revealed five statistically significant gene expression profiles. Gene ontology annotation and enrichment analysis gave further information about differentially expressed genes, and MapMan analysis revealed expression changes within functional groups during seed development. Metabolic pathway network analysis showed that major and minor metabolic pathways regulate one another to ensure regular seed development and nutritive reserve accumulation. We performed gene co-expression network analysis to identify genes that play vital roles in seed development and identified several key genes involved in important metabolic pathways. The transcriptional expression of eight key genes involved in starch and protein synthesis and stress defense was further validated by qRT-PCR. Our results provide new insight into the molecular mechanisms of wheat seed development and the determinants of yield and quality.
The sieve element occlusion gene family in dicotyledonous plants.
Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A
2011-01-01
Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.
Directory of Open Access Journals (Sweden)
Srećko Jelenić
2003-01-01
Full Text Available Plant genetic engineering is a powerful tool for producing crops resistant to pests, diseases and abiotic stress or crops with improved nutritional value or better quality products. Currently over 70 genetically modified (GM crops have been approved for use in different countries. These cover a wide range of plant species with significant number of different modified traits. However, beside the technology used for their improvement, the common component of most GM crops is the neomycin phosphotransferase II gene (nptII, which confers resistance to the antibiotics kanamycin and neomycin. The nptII gene is present in GM crops as a marker gene to select transformed plant cells during the first steps of the transformation process. The use of antibiotic-resistance genes is subject to controversy and intense debate, because of the likelihood that clinical therapy could be compromised due to inactivation of the oral dose of the antibiotic from consumption of food derived from the transgenic plant, and because of the risk of gene transfer from plants to gut and soil microorganisms or to consumer’s cells. The present article discusses these possibilities in the light of current scientific knowledge.
A DNA barcode for land plants.
2009-08-04
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.
Silencing of meiosis-critical genes for engineering male sterility in plants
Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...
Liu, Ping-Li; Du, Liang; Huang, Yuan; Gao, Shu-Min; Yu, Meng
2017-01-01
Background Leucine-rich repeat receptor-like protein kinases (LRR-RLKs) are the largest group of receptor-like kinases in plants and play crucial roles in development and stress responses. The evolutionary relationships among LRR-RLK genes have been investigated in flowering plants; however, no comprehensive studies have been performed for these genes in more ancestral groups. The subfamily classification of LRR-RLK genes in plants, the evolutionary history and driving force for the evolution...
Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E
2015-01-01
Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.
Exploring two plant hosts for expression of diterpenoid pathway genes
DEFF Research Database (Denmark)
Bach, Søren Spanner
Plants produce more than 10.000 diterpenoid compounds of which the large majority is involved in specialized metabolism, while a few are involved in general metabolism. Specialized metabolism diterpenoids have functions in interactions of plants with other organisms and selected ones are utilized....... Since only small changes in the amino acid sequence can influence the roduct outcome of a diterpene synthase (diTPS), prediction of the catalytic activity diTPS of a is not possible purely based on phylogenetic relationship. Thus, functional characterization is required in to determine the catalytic...... and aracterization of diTPSs deriving from the plant kingdom, a plant expression host offers several advantages such as the presence of all relevant compartments (plastids and endoplasmic reticulum) and the universal C5 building blocks for isoprenoid biosynthesis. In addition, a plant based xpression host...
Construction and comparison of gene co-expression networks shows complex plant immune responses
Directory of Open Access Journals (Sweden)
Luis Guillermo Leal
2014-10-01
Full Text Available Gene co-expression networks (GCNs are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA. Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses.
Bai, Suhua; Dong, Chaohua; Li, Baohua; Dai, Hongyi
2013-01-01
Pathogenesis-related protein-4 (PR-4) family is a group of proteins with a Barwin domain in C-terminus and generally thought to be involved in plant defense responses. However, their detailed roles are poorly understood in defense of apple plant against pathogenic infection. In the present study, a new PR-4 gene (designated as MdPR-4) was identified from Malus domestica, and its roles in defense responses of apple were investigated. The open reading frame of MdPR-4 gene is of 447 bp encoding a protein of 148 amino acids with a Barwin domain in C-terminus and a signal peptide of 26 amino acids in N-terminus. Sequence and structural analysis indicated that MdPR-4 protein belongs to class II of PR-4 family. The high-level expression of MdPR-4 was observed in flowers and leaves as revealed by quantitative real time PCR. The temporal expression analysis demonstrated that MdPR-4 expression could be up-regulated by Botryosphaeria dothidea infection and salicylic acid (SA) or methyl jasmonate (MeJA) treatment, but suppressed by diethyldithiocarbamic acid (DIECA). In vitro assays, recombinant MdPR-4 protein exhibited ribonuclease activity specific for single strand RNA and significant inhibition to hyphal growth of three apple pathogenic fungi B. dothidea, Valsa ceratosperma and Glomerella cingulata. Moreover, the inhibition was reduced by the presence of 5'-ADP. Taken all together, the results indicate that MdPR-4 protein is involved in the defense responses of apple against pathogenic attack by directly inhibiting hyphal growth, and the inhibition is correlated with its ribonuclease activity, where as MdPR-4 expression is regulated by both SA and JA signaling pathway. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Benoît eDrogue
2014-11-01
Full Text Available Cooperation involving Plant Growth-Promoting Rhizobacteria results in improvements of plant growth and health. While pathogenic and symbiotic interactions are known to induce transcriptional changes for genes related to plant defence and development, little is known about the impact of phytostimulating rhizobacteria on plant gene expression. This study aims at identifying genes significantly regulated in rice roots upon Azospirillum inoculation, considering possible favored interaction between a strain and its original host cultivar. Genome-wide analyses of Oryza sativa japonica cultivars Cigalon and Nipponbare were performed, by using microarrays, seven days post inoculation with A. lipoferum 4B (isolated from Cigalon or Azospirillum sp. B510 (isolated from Nipponbare and compared to the respective non-inoculated condition. A total of 7,384 genes were significantly regulated, which represent about 16 % of total rice genes. A set of 34 genes is regulated by both Azospirillum strains in both cultivars, including a gene orthologous to PR10 of Brachypodium, and these could represent plant markers of Azospirillum-rice interactions. The results highlight a strain-dependent response of rice, with 83 % of the differentially expressed genes being classified as combination-specific. Whatever the combination, most of the differentially expressed genes are involved in primary metabolism, transport, regulation of transcription and protein fate. When considering genes involved in response to stress and plant defence, it appears that strain B510, a strain displaying endophytic properties, leads to the repression of a wider set of genes than strain 4B. Individual genotypic variations could be the most important driving force of rice roots gene expression upon Azospirillum inoculation. Strain-dependent transcriptional changes observed for genes related to auxin and ethylene signalling highlight the complexity of hormone signalling networks in the Azospirillum
Directory of Open Access Journals (Sweden)
Yuerong Gao
2016-09-01
Full Text Available Roses are one of the most important cut flowers among ornamental plants. Rose flower longevity is largely dependent on the timing of petal shedding occurrence. To understand the molecular mechanism underlying petal abscission in rose, we performed transcriptome profiling of the petal abscission zone during petal shedding using Illumina technology. We identified a total of 2592 differentially transcribed genes (DTGs during rose petal shedding. Gene ontology term enrichment and pathway analysis revealed that major biochemical pathways the DTGs were involved in included ethylene biosynthesis, starch degradation, superpathway of cytosolic glycolysis, pyruvate dehydrogenase and TCA cycle, photorespiration and the lactose degradation III pathway. This suggests that alterations in carbon metabolism are an important part of rose petal abscission. Among these DTGs, approximately 150 genes putatively encoding transcription factors were identified in rose abscission zone. These included zinc finger, WRKY, ERF, and Aux/IAA gene families, suggesting that petal abscission involves complex transcriptional reprogramming. Approximately 108 DTGs were related to hormone pathways, of which auxin and ethylene related DTGs were the largest groups including 52 and 41 genes, respectively. These also included 12 DTGs related to gibberellin and 6 DTGs in jasmonic acid pathway. Surprisingly, no DTGs involved in the biosynthesis/signaling of abscisic acid, cytokinin, brassinosteroid, and salicylic acid pathways were detected. Moreover, among DTGs related to auxin, we identified an Aux/IAA gene RhIAA16 that was up-regulated in response to petal shedding. Down-regulation of RhIAA16 by virus-induced gene silencing in rose promoted petal abscission, suggesting that RhIAA16 plays an important role in rose petal abscission.
The Lotus japonicus ndx gene family is involved in nodule function and maintenance
DEFF Research Database (Denmark)
Grønlund, Mette; Gustafsen, Camilla; Jensen, Dorthe Bødker
2003-01-01
To elucidate the function of the ndx homeobox genes during the Rhizobium-legume symbiosis, two Lotus japonicus ndr genes were expressed in the antisense orientation under the control of the nodule-expressed promoter Psenod12 in transgenic Lotus japonicus plants. Many of the transformants obtained...
Marinković, Natalija; Pašalić, Daria; Potočki, Slavica
2013-01-01
Polycyclic aromatic hydrocarbons (PAHs) are among the most prevalent environmental pollutants and result from the incomplete combustion of hydrocarbons (coal and gasoline, fossil fuel combustion, byproducts of industrial processing, natural emission, cigarette smoking, etc.). The first phase of xenobiotic biotransformation in the PAH metabolism includes activities of cytochrome P450 from the CYP1 family and microsomal epoxide hydrolase. The products of this biotransformation are reactive oxygen species that are transformed in the second phase through the formation of conjugates with glutathione, glucuronate or sulphates. PAH exposure may lead to PAH-DNA adduct formation or induce an inflammatory atherosclerotic plaque phenotype. Several genetic polymorphisms of genes encoded for enzymes involved in PAH biotransformation have been proven to lead to the development of diseases. Enzyme CYP P450 1A1, which is encoded by the CYP1A1 gene, is vital in the monooxygenation of lipofilic substrates, while GSTM1 and GSTT1 are the most abundant isophorms that conjugate and neutralize oxygen products. Some single nucleotide polymorphisms of the CYP1A1 gene as well as the deletion polymorphisms of GSTT1 and GSTM1 may alter the final specific cellular inflammatory respond. Occupational exposure or conditions from the living environment can contribute to the production of PAH metabolites with adverse effects on human health. The aim of this study was to obtain data on biotransformation and atherosclerosis, as well as data on the gene polymorphisms involved in biotransformation, in order to better study gene expression and further elucidate the interaction between genes and the environment. PMID:24266295
van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther
2011-01-01
Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).
Verma, Jitendra Kumar; Wardhan, Vijay; Singh, Deepali; Chakraborty, Subhra; Chakraborty, Niranjan
2018-03-28
Architectural proteins play key roles in genome construction and regulate the expression of many genes, albeit the modulation of genome plasticity by these proteins is largely unknown. A critical screening of the architectural proteins in five crop species, viz., Oryza sativa , Zea mays , Sorghum bicolor , Cicer arietinum , and Vitis vinifera , and in the model plant Arabidopsis thaliana along with evolutionary relevant species such as Chlamydomonas reinhardtii , Physcomitrella patens , and Amborella trichopoda , revealed 9, 20, 10, 7, 7, 6, 1, 4, and 4 Alba (acetylation lowers binding affinity) genes, respectively. A phylogenetic analysis of the genes and of their counterparts in other plant species indicated evolutionary conservation and diversification. In each group, the structural components of the genes and motifs showed significant conservation. The chromosomal location of the Alba genes of rice ( OsAlba ), showed an unequal distribution on 8 of its 12 chromosomes. The expression profiles of the OsAlba genes indicated a distinct tissue-specific expression in the seedling, vegetative, and reproductive stages. The quantitative real-time PCR (qRT-PCR) analysis of the OsAlba genes confirmed their stress-inducible expression under multivariate environmental conditions and phytohormone treatments. The evaluation of the regulatory elements in 68 Alba genes from the 9 species studied led to the identification of conserved motifs and overlapping microRNA (miRNA) target sites, suggesting the conservation of their function in related proteins and a divergence in their biological roles across species. The 3D structure and the prediction of putative ligands and their binding sites for OsAlba proteins offered a key insight into the structure-function relationship. These results provide a comprehensive overview of the subtle genetic diversification of the OsAlba genes, which will help in elucidating their functional role in plants.
Behnam, Babak; Iuchi, Satoshi; Fujita, Miki; Fujita, Yasunari; Takasaki, Hironori; Osakabe, Yuriko; Yamaguchi-Shinozaki, Kazuko; Kobayashi, Masatomo; Shinozaki, Kazuo
2013-01-01
Plants respond to dehydration stress and tolerate water-deficit status through complex physiological and cellular processes. Many genes are induced by water deficit. Abscisic acid (ABA) plays important roles in tolerance to dehydration stress by inducing many stress genes. ABA is synthesized de novo in response to dehydration. Most of the genes involved in ABA biosynthesis have been identified, and they are expressed mainly in leaf vascular tissues. Of the products of such genes, 9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in ABA biosynthesis. One of the five NCED genes in Arabidopsis, AtNCED3, is significantly induced by dehydration. To understand the regulatory mechanism of the early stages of the dehydration stress response, it is important to analyse the transcriptional regulatory systems of AtNCED3. In the present study, we found that an overlapping G-box recognition sequence (5′-CACGTG-3′) at −2248 bp from the transcriptional start site of AtNCED3 is an important cis-acting element in the induction of the dehydration response. We discuss the possible transcriptional regulatory system of dehydration-responsive AtNCED3 expression, and how this may control the level of ABA under water-deficit conditions. PMID:23604098
[Update of a database on plants involved in the composition of 825 drugs: Pharmaplantes-Kénitra 98].
Choulli, M K; Quyou, A; Ait Aguil, F; Rmouch, H
1999-01-01
The main objective of this work lies in the setting up of a database on plants used in medicines which is aimed at pharmacological development of plant resources in Morocco. We have, as a first step, made an inventory of different plant species involved in medicine making in Morocco. This survey dealt with 825 miscellaneous pharmaceutical products and reveals the use of 445 different plant species in medicine making. For each plant species, we have also noted the parts of the plant which are used in the pharmaceutical industry. Furthermore, we have taken an interest in plant extracts involved in this medicine making. The results show that in all these medicines contain 46 extracts of a vegetal nature. At the top of the list, menthol is used in the manufacture of 110 pharmaceutical products. Finally, an analysis per pharmaco-therapeutic family reveals the impact of the involvement of these plants on each of these families. In fact, it turns out that 204 plant species play a part in medicines classified in the family of gastro-entero-hepatology whereas only one plant is involved in anti-inflammatory medicines.
Zhao, Yanhong; Liao, Xiaofang; Huang, Zhipeng; Chen, Peng; Zhou, Bujin; Liu, Dongmei; Kong, Xiangjun; Zhou, Ruiyang
2015-08-01
Chimeric genes resulting from the rearrangement of a mitochondrial genome were generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS). In the study, earlier we reported that identifying a 47 bp deletion at 3'- flanking of atp9 that was linked to male sterile cytoplasm in kenaf. The truncated fragment was fused with atp9, a mitochondrial transit signal (MTS) and/or GFP, comprised two chimeric genes MTS-HM184-GFP and MTS-HM184. The plant expression vector pBI121 containing chimeric genes were then introduced to tobacco plants by Agrobacterium-mediated T-DNA transformation. The result showed that certain transgenic plants were male sterility or semi-sterility, while some were not. The expression analysis further demonstrated that higher level of expression were showed in the sterility plants, while no expression or less expression in fertility plants, the levels of expression of semi-sterility were in between. And the sterile plant (containing MTS-HM184-GFP) had abnormal anther produced malformed/shriveled pollen grains stained negative that failed to germinate (0%), the corresponding fruits was shrunken, the semi-sterile plants having normal anther shape produced about 10-50% normal pollen grains, the corresponding fruits were not full, and the germination rate was 58%. Meanwhile these transgenic plants which altered on fertility were further analyzed in phenotype. As a result, the metamorphosis leaves were observed in the seedling stage, the plant height of transgenic plants was shorter than wild type. The growth duration of transgenic tobacco was delayed 30-45 days compared to the wild type. The copy numbers of target genes of transgenic tobacco were analyzed using the real-time quantitative method. The results showed that these transgenic plants targeting-expression in mitochondrial containing MTS-HM184-GFP had 1 copy and 2 copies, the other two plants containing MTS-HM184 both had 3 copies, but 0 copy in wild type. In
Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas
2013-12-05
The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously
Genes involved in translation of Mycoplasma hyopneumoniae and Mycoplasma synoviae
Directory of Open Access Journals (Sweden)
Mônica de Oliveira Santos
2007-01-01
Full Text Available This is a report on the analysis of genes involved in translation of the complete genomes of Mycoplasma hyopneumoniae strain J and 7448 and Mycoplasma synoviae. In both genomes 31 ORFs encoding large ribosomal subunit proteins and 19 ORFs encoding small ribosomal subunit proteins were found. Ten ribosomal protein gene clusters encoding 42 ribosomal proteins were found in M. synoviae, while 8 clusters encoding 39 ribosomal proteins were found in both M. hyopneumoniae strains. The L33 gene of the M. hyopneumoniae strain 7448 presented two copies in different locations. The genes encoding initiation factors (IF-1, IF-2 and IF-3, elongation factors (EF-G, EF-Tu, EF-Ts and EF-P, and the genes encoding the ribosome recycling factor (frr and one polypeptide release factor (prfA were present in the genomes of M. hyopneumoniae and M. synoviae. Nineteen aminoacyl-tRNA synthases had been previously identified in both mycoplasmas. In the two strains of M. hyopneumoniae, J and 7448, only one set of 5S, 16S and 23S rRNAs had been identified. Two sets of 16S and 23S rRNA genes and three sets of 5S rRNA genes had been identified in the M. synoviae genome.
Association analysis of schizophrenia on 18 genes involved in neuronal migration
DEFF Research Database (Denmark)
Kähler, Anna K; Djurovic, Srdjan; Kulle, Bettina
2008-01-01
neuronal function, morphology, and formation of synaptic connections. We have investigated the putative association between SZ and gene variants engaged in the neuronal migration process, by performing an association study on 839 cases and 1,473 controls of Scandinavian origin. Using a gene-wide approach......Several lines of evidence support the theory of schizophrenia (SZ) being a neurodevelopmental disorder. The structural, cytoarchitectural and functional brain abnormalities reported in patients with SZ, might be due to aberrant neuronal migration, since the final position of neurons affects......, tagSNPs in 18 candidate genes have been genotyped, with gene products involved in the neuron-to-glial cell adhesion, interactions with the DISC1 protein and/or rearrangements of the cytoskeleton. Of the 289 markers tested, 19 markers located in genes MDGA1, RELN, ITGA3, DLX1, SPARCL1, and ASTN1...
Ruedell, Carolina Michels; de Almeida, Márcia Rodrigues; Fett-Neto, Arthur Germano
2015-12-01
Economically important plant species, such as Eucalyptus globulus, are often rooting recalcitrant. We have previously shown that far-red light enrichment applied to E. globulus donor-plants improved microcutting rooting competence and increased rooting zone/shoot carbohydrate ratio. To better understand this developmental response, the relative expression profiles of genes involved in auxin signaling (ARF6, ARF8, AGO1), biosynthesis (YUC3) and transport (AUX1, PIN1, PIN2); sucrose cleavage (SUS1, CWINV1), transport (SUC5), hexose phosphorylation (HXK1, FLN1) and starch biosynthesis (SS3) were quantified during adventitious rooting of E. globulus microcuttings derived from donor plants exposed to far-red or white light. Expression of auxin transport-related genes increased in the first days of root induction. Far-red enrichment of donor plants induced ARF6, ARF8 and AGO1 in microcuttings. The first two gene products could activate GH3 and other rooting related genes, whereas AGO1 deregulation of the repressor ARF17 may relief rooting inhibition. Increased sink strength at the basal stem with sucrose unloading in root tissue mediated by SUC and subsequent hydrolysis by SUS1 were also supported by gene expression profile. Fructose phosphorylation and starch biosynthesis could also contribute to proper carbon allocation at the site of rooting, as evidenced by increased expression of related genes. These data are in good agreement with increased contents of hexoses and starch at the cutting base severed from far-red exposed donor plants. To sum up, pathways integrating auxin and carbohydrate metabolism were activated in microcuttings derived from donor plants exposed to far red light enrichment, thereby improving rooting response in E. globulus. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
Advances in plant gene-targeted and functional markers: a review
Directory of Open Access Journals (Sweden)
Poczai Péter
2013-02-01
Full Text Available Abstract Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information
Advances in plant gene-targeted and functional markers: a review
2013-01-01
Public genomic databases have provided new directions for molecular marker development and initiated a shift in the types of PCR-based techniques commonly used in plant science. Alongside commonly used arbitrarily amplified DNA markers, other methods have been developed. Targeted fingerprinting marker techniques are based on the well-established practices of arbitrarily amplified DNA methods, but employ novel methodological innovations such as the incorporation of gene or promoter elements in the primers. These markers provide good reproducibility and increased resolution by the concurrent incidence of dominant and co-dominant bands. Despite their promising features, these semi-random markers suffer from possible problems of collision and non-homology analogous to those found with randomly generated fingerprints. Transposable elements, present in abundance in plant genomes, may also be used to generate fingerprints. These markers provide increased genomic coverage by utilizing specific targeted sites and produce bands that mostly seem to be homologous. The biggest drawback with most of these techniques is that prior genomic information about retrotransposons is needed for primer design, prohibiting universal applications. Another class of recently developed methods exploits length polymorphism present in arrays of multi-copy gene families such as cytochrome P450 and β-tubulin genes to provide cross-species amplification and transferability. A specific class of marker makes use of common features of plant resistance genes to generate bands linked to a given phenotype, or to reveal genetic diversity. Conserved DNA-based strategies have limited genome coverage and may fail to reveal genetic diversity, while resistance genes may be under specific evolutionary selection. Markers may also be generated from functional and/or transcribed regions of the genome using different gene-targeting approaches coupled with the use of RNA information. Such techniques have the
The hnRNP 2H9 gene, which is involved in the splicing reaction, is a multiply spliced gene
DEFF Research Database (Denmark)
Honoré, B
2000-01-01
The hnRNP 2H9 gene products are involved in the splicing process and participate in early heat shock-induced splicing arrest. By combining low/high stringency hybridisation, database search, Northern and Western blotting it is shown that the gene is alternatively spliced into at least six...
DEFF Research Database (Denmark)
Kautsar, Satria A.; Suarez Duran, Hernando G.; Blin, Kai
2017-01-01
exploration of the nature and dynamics of gene clustering in plant metabolism. Moreover, spurred by the continuing decrease in costs of plant genome sequencing, they will allow genome mining technologies to be applied to plant natural product discovery. The plantiSMASH web server, precalculated results...
Successful modification of plant cell wall composition without compromising plant integrity is dependent on being able to modify the expression of specific genes, but can be very challenging when the target genes are members of multigene families. 4-Coumarate:CoA ligase (4CL) catalyzes the formatio...
Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K
2014-01-01
Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.
Directory of Open Access Journals (Sweden)
Nidhi Thakur
Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.
Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.
2009-01-01
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622
Huang, Meng Tian; Lu, Yi Chen; Zhang, Shuang; Luo, Fang; Yang, Hong
2016-08-24
Atrazine (ATR) and isoproturon (IPU) as herbicides have become serious environmental contaminants due to their overuse in crop production. Although ATR and IPU in soils are easily absorbed by many crops, the mechanisms for their degradation or detoxification in plants are poorly understood. This study identified a group of novel genes encoding laccases (EC 1.10.3.2) that are possibly involved in catabolism or detoxification of ATR and IPU residues in rice. Transcriptome profiling shows at least 22 differentially expressed laccase genes in ATR/IPU-exposed rice. Some of the laccase genes were validated by RT-PCR analysis. The biochemical properties of the laccases were analyzed, and their activities in rice were induced under ATR/IPU exposure. To investigate the roles of laccases in degrading or detoxifying ATR/IPU in rice, transgenic yeast cells (Pichia pastoris X-33) expressing two rice laccase genes (LOC_Os01g63180 and LOC_Os12g15680) were generated. Both transformants were found to accumulate less ATR/IPU compared to the control. The ATR/IPU-degraded products in the transformed yeast cells using UPLC-TOF-MS/MS were further characterized. Two metabolites, hydroxy-dehydrogenated atrazine (HDHA) and 2-OH-isopropyl-IPU, catalyzed by laccases were detected in the eukaryotic cells. These results indicate that the laccase-coding genes identified here could confer degradation or detoxification of the herbicides and suggest that the laccases could be one of the important enzymatic pathways responsible for ATR/IPU degradation/detoxification in rice.
Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong
2011-09-01
Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.
Ma, Qi-Jun; Sun, Mei-Hong; Lu, Jing; Liu, Ya-Jing; Hu, Da-Gang; Hao, Yu-Jin
2017-08-01
Sugars play important roles in plant growth and development, crop yield and quality, as well as responses to abiotic stresses. Abscisic acid (ABA) is a multifunctional hormone. However, the exact mechanism by which ABA regulates sugar accumulation is largely unknown in plants. Here, we tested the expression profile of several sugar transporter and amylase genes in response to ABA treatment. MdSUT2 and MdAREB2 were isolated and genetically transformed into apple ( Malus domestica ) to investigate their roles in ABA-induced sugar accumulation. The MdAREB2 transcription factor was found to bind to the promoters of the sugar transporter and amylase genes and activate their expression. Both MdAREB2 and MdSUT2 transgenic plants produced more soluble sugars than controls. Furthermore, MdAREB2 promoted the accumulation of sucrose and soluble sugars in an MdSUT2 -dependent manner. Our results demonstrate that the ABA-responsive transcription factor MdAREB2 directly activates the expression of amylase and sugar transporter genes to promote soluble sugar accumulation, suggesting a mechanism by which ABA regulates sugar accumulation in plants. © 2017 American Society of Plant Biologists. All Rights Reserved.
Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin
2015-09-01
In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.
Structural evolution of the 4/1 genes and proteins in non-vascular and lower vascular plants.
Morozov, Sergey Y; Milyutina, Irina A; Bobrova, Vera K; Ryazantsev, Dmitry Y; Erokhina, Tatiana N; Zavriev, Sergey K; Agranovsky, Alexey A; Solovyev, Andrey G; Troitsky, Alexey V
2015-12-01
The 4/1 protein of unknown function is encoded by a single-copy gene in most higher plants. The 4/1 protein of Nicotiana tabacum (Nt-4/1 protein) has been shown to be alpha-helical and predominantly expressed in conductive tissues. Here, we report the analysis of 4/1 genes and the encoded proteins of lower land plants. Sequences of a number of 4/1 genes from liverworts, lycophytes, ferns and gymnosperms were determined and analyzed together with sequences available in databases. Most of the vascular plants were found to encode Magnoliophyta-like 4/1 proteins exhibiting previously described gene structure and protein properties. Identification of the 4/1-like proteins in hornworts, liverworts and charophyte algae (sister lineage to all land plants) but not in mosses suggests that 4/1 proteins are likely important for plant development but not required for a primary metabolic function of plant cell. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Alonso-Blanco, C.; Mendez-Vigo, B.; Koornneef, M.
2005-01-01
An enormous amount of naturally occurring genetic variation affecting development is found within wild and domesticated plant species. This diversity is presumably involved in plant adaptation to different natural environments or in human preferences. In addition, such intraspecific variation
Less is more: strategies to remove marker genes from transgenic plants
2013-01-01
Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583
Less is more: strategies to remove marker genes from transgenic plants.
Yau, Yuan-Yeu; Stewart, C Neal
2013-04-23
Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.
Directory of Open Access Journals (Sweden)
Oshrat Levy-Ontman
2014-02-01
Full Text Available N-glycosylation is one of the most important post-translational modifications that influence protein polymorphism, including protein structures and their functions. Although this important biological process has been extensively studied in mammals, only limited knowledge exists regarding glycosylation in algae. The current research is focused on the red microalga Porphyridium sp., which is a potentially valuable source for various applications, such as skin therapy, food, and pharmaceuticals. The enzymes involved in the biosynthesis and processing of N-glycans remain undefined in this species, and the mechanism(s of their genetic regulation is completely unknown. In this study, we describe our pioneering attempt to understand the endoplasmic reticulum N-Glycosylation pathway in Porphyridium sp., using a bioinformatic approach. Homology searches, based on sequence similarities with genes encoding proteins involved in the ER N-glycosylation pathway (including their conserved parts were conducted using the TBLASTN function on the algae DNA scaffold contigs database. This approach led to the identification of 24 encoded-genes implicated with the ER N-glycosylation pathway in Porphyridium sp. Homologs were found for almost all known N-glycosylation protein sequences in the ER pathway of Porphyridium sp.; thus, suggesting that the ER-pathway is conserved; as it is in other organisms (animals, plants, yeasts, etc..
Genes Involved in Initial Follicle Recruitment May Be Associated with Age at Menopause
Voorhuis, Marlies; Broekmans, Frank J.; Fauser, Bart C. J. M.; Onland-Moret, N. Charlotte; van der Schouw, Yvonne T.
Context: Timing of menopause is largely influenced by genetic factors. Because menopause occurs when the follicle pool in the ovaries has become exhausted, genes involved in primordial follicle recruitment can be considered as candidate genes for timing of menopause. Objective: The aim was to study
MYB transcription factor gene involved in sex determination in Asparagus officinalis.
Murase, Kohji; Shigenobu, Shuji; Fujii, Sota; Ueda, Kazuki; Murata, Takanori; Sakamoto, Ai; Wada, Yuko; Yamaguchi, Katsushi; Osakabe, Yuriko; Osakabe, Keishi; Kanno, Akira; Ozaki, Yukio; Takayama, Seiji
2017-01-01
Dioecy is a plant mating system in which individuals of a species are either male or female. Although many flowering plants evolved independently from hermaphroditism to dioecy, the molecular mechanism underlying this transition remains largely unknown. Sex determination in the dioecious plant Asparagus officinalis is controlled by X and Y chromosomes; the male and female karyotypes are XY and XX, respectively. Transcriptome analysis of A. officinalis buds showed that a MYB-like gene, Male Specific Expression 1 (MSE1), is specifically expressed in males. MSE1 exhibits tight linkage with the Y chromosome, specific expression in early anther development and loss of function on the X chromosome. Knockout of the MSE1 orthologue in Arabidopsis induces male sterility. Thus, MSE1 acts in sex determination in A. officinalis. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
sugE: A gene involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27.
Cruz, Andreia; Micaelo, Nuno; Félix, Vitor; Song, Jun-Young; Kitamura, Shin-Ichi; Suzuki, Satoru; Mendo, Sónia
2013-01-01
The mechanism of bacterial resistance to tributyltin (TBT) is still unclear. The results herein presented contribute to clarify that mechanism in the TBT-resistant bacterium Aeromonas molluscorum Av27. We have identified and cloned a new gene that is involved in TBT resistance in this strain. The gene is highly homologous (84%) to the Aeromonas hydrophila-sugE gene belonging to the small multidrug resistance gene family (SMR), which includes genes involved in the transport of lipophilic drugs. In Av27, expression of the Av27-sugE was observed at the early logarithmic growth phase in the presence of a high TBT concentration (500 μM), thus suggesting the contribution of this gene for TBT resistance. E. coli cells transformed with Av27-sugE become resistant to ethidium bromide (EtBr), chloramphenicol (CP) and tetracycline (TE), besides TBT. According to the Moriguchi logP (miLogP) values, EtBr, CP and TE have similar properties and are substrates for the sugE-efflux system. Despite the different miLogP of TBT, E. coli cells transformed with Av27-sugE become resistant to this compound. So it seems that TBT is also a substrate for the SugE protein. The modelling studies performed also support this hypothesis. The data herein presented clearly indicate that sugE is involved in TBT resistance of this bacterium.
Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth
2016-04-16
Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (pbiofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434
The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool
Directory of Open Access Journals (Sweden)
Nan Zhao
2018-02-01
Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.
Evolutionary Trails of Plant Group II Pyridoxal Phosphate-Dependent Decarboxylase Genes.
Kumar, Rahul
2016-01-01
Type II pyridoxal phosphate-dependent decarboxylase (PLP_deC) enzymes play important metabolic roles during nitrogen metabolism. Recent evolutionary profiling of these genes revealed a sharp expansion of histidine decarboxylase genes in the members of Solanaceae family. In spite of the high sequence homology shared by PLP_deC orthologs, these enzymes display remarkable differences in their substrate specificities. Currently, limited information is available on the gene repertoires and substrate specificities of PLP_deCs which renders their precise annotation challenging and offers technical challenges in the immediate identification and biochemical characterization of their full gene complements in plants. Herein, we explored their evolutionary trails in a comprehensive manner by taking advantage of high-throughput data accessibility and computational approaches. We discussed the premise that has enabled an improved reconstruction of their evolutionary lineage and evaluated the factors offering constraints in their rapid functional characterization, till date. We envisage that the synthesized information herein would act as a catalyst for the rapid exploration of their biochemical specificity and physiological roles in more plant species.
Directory of Open Access Journals (Sweden)
Gutiérrez Rodrigo A
2008-09-01
Full Text Available Abstract Background Microarray technology is a widely used approach for monitoring genome-wide gene expression. For Arabidopsis, there are over 1,800 microarray hybridizations representing many different experimental conditions on Affymetrix™ ATH1 gene chips alone. This huge amount of data offers a unique opportunity to infer the principles that govern the regulation of gene expression in plants. Results We used bioinformatics methods to analyze publicly available data obtained using the ATH1 chip from Affymetrix. A total of 1887 ATH1 hybridizations were normalized and filtered to eliminate low-quality hybridizations. We classified and compared control and treatment hybridizations and determined differential gene expression. The largest differences in gene expression were observed when comparing samples obtained from different organs. On average, ten-fold more genes were differentially expressed between organs as compared to any other experimental variable. We defined "gene responsiveness" as the number of comparisons in which a gene changed its expression significantly. We defined genes with the highest and lowest responsiveness levels as hypervariable and housekeeping genes, respectively. Remarkably, housekeeping genes were best distinguished from hypervariable genes by differences in methylation status in their transcribed regions. Moreover, methylation in the transcribed region was inversely correlated (R2 = 0.8 with gene responsiveness on a genome-wide scale. We provide an example of this negative relationship using genes encoding TCA cycle enzymes, by contrasting their regulatory responsiveness to nitrate and methylation status in their transcribed regions. Conclusion Our results indicate that the Arabidopsis transcriptome is largely established during development and is comparatively stable when faced with external perturbations. We suggest a novel functional role for DNA methylation in the transcribed region as a key determinant
Gene-environment interaction involving recently identified colorectal cancer susceptibility loci
Kantor, Elizabeth D.; Hutter, Carolyn M.; Minnier, Jessica; Berndt, Sonja I.; Brenner, Hermann; Caan, Bette J.; Campbell, Peter T.; Carlson, Christopher S.; Casey, Graham; Chan, Andrew T.; Chang-Claude, Jenny; Chanock, Stephen J.; Cotterchio, Michelle; Du, Mengmeng; Duggan, David; Fuchs, Charles S.; Giovannucci, Edward L.; Gong, Jian; Harrison, Tabitha A.; Hayes, Richard B.; Henderson, Brian E.; Hoffmeister, Michael; Hopper, John L.; Jenkins, Mark A.; Jiao, Shuo; Kolonel, Laurence N.; Le Marchand, Loic; Lemire, Mathieu; Ma, Jing; Newcomb, Polly A.; Ochs-Balcom, Heather M.; Pflugeisen, Bethann M.; Potter, John D.; Rudolph, Anja; Schoen, Robert E.; Seminara, Daniela; Slattery, Martha L.; Stelling, Deanna L.; Thomas, Fridtjof; Thornquist, Mark; Ulrich, Cornelia M.; Warnick, Greg S.; Zanke, Brent W.; Peters, Ulrike; Hsu, Li; White, Emily
2014-01-01
BACKGROUND Genome-wide association studies have identified several single nucleotide polymorphisms (SNPs) that are associated with risk of colorectal cancer (CRC). Prior research has evaluated the presence of gene-environment interaction involving the first 10 identified susceptibility loci, but little work has been conducted on interaction involving SNPs at recently identified susceptibility loci, including: rs10911251, rs6691170, rs6687758, rs11903757, rs10936599, rs647161, rs1321311, rs719725, rs1665650, rs3824999, rs7136702, rs11169552, rs59336, rs3217810, rs4925386, and rs2423279. METHODS Data on 9160 cases and 9280 controls from the Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) and Colon Cancer Family Registry (CCFR) were used to evaluate the presence of interaction involving the above-listed SNPs and sex, body mass index (BMI), alcohol consumption, smoking, aspirin use, post-menopausal hormone (PMH) use, as well as intake of dietary calcium, dietary fiber, dietary folate, red meat, processed meat, fruit, and vegetables. Interaction was evaluated using a fixed-effects meta-analysis of an efficient Empirical Bayes estimator, and permutation was used to account for multiple comparisons. RESULTS None of the permutation-adjusted p-values reached statistical significance. CONCLUSIONS The associations between recently identified genetic susceptibility loci and CRC are not strongly modified by sex, BMI, alcohol, smoking, aspirin, PMH use, and various dietary factors. IMPACT Results suggest no evidence of strong gene-environment interactions involving the recently identified 16 susceptibility loci for CRC taken one at a time. PMID:24994789
Directory of Open Access Journals (Sweden)
Wu Bin
2012-01-01
Full Text Available Abstract Background Digitalis purpurea is an important ornamental and medicinal plant. There is considerable interest in exploring its transcriptome. Results Through high-throughput 454 sequencing and subsequent assembly, we obtained 23532 genes, of which 15626 encode conserved proteins. We determined 140 unigenes to be candidates involved in cardiac glycoside biosynthesis. It could be grouped into 30 families, of which 29 were identified for the first time in D. purpurea. We identified 2660 mRNA-like npcRNA (mlncRNA candidates, an emerging class of regulators, using a computational mlncRNA identification pipeline and 13 microRNA-producing unigenes based on sequence conservation and hairpin structure-forming capability. Twenty five protein-coding unigenes were predicted to be targets of these microRNAs. Among the mlncRNA candidates, only 320 could be grouped into 140 families with at least two members in a family. The majority of D. purpurea mlncRNAs were species-specific and many of them showed tissue-specific expression and responded to cold and dehydration stresses. We identified 417 protein-coding genes with regions significantly homologous or complementary to 375 mlncRNAs. It includes five genes involved in secondary metabolism. A positive correlation was found in gene expression between protein-coding genes and the homologous mlncRNAs in response to cold and dehydration stresses, while the correlation was negative when protein-coding genes and mlncRNAs were complementary to each other. Conclusions Through comprehensive transcriptome analysis, we not only identified 29 novel gene families potentially involved in the biosynthesis of cardiac glycosides but also characterized a large number of mlncRNAs. Our results suggest the importance of mlncRNAs in secondary metabolism and stress response in D. purpurea.
Danchin, Etienne G.J.; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Sokolova (Guzeeva), Elena; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T.
2017-01-01
Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum. PMID:29065523
Danchin, Etienne G J; Perfus-Barbeoch, Laetitia; Rancurel, Corinne; Thorpe, Peter; Da Rocha, Martine; Bajew, Simon; Neilson, Roy; Guzeeva, Elena Sokolova; Da Silva, Corinne; Guy, Julie; Labadie, Karine; Esmenjaud, Daniel; Helder, Johannes; Jones, John T; den Akker, Sebastian Eves-van
2017-10-23
Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq) to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus , representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus , respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.
Directory of Open Access Journals (Sweden)
Etienne G.J. Danchin
2017-10-01
Full Text Available Nematodes have evolved the ability to parasitize plants on at least four independent occasions, with plant parasites present in Clades 1, 2, 10 and 12 of the phylum. In the case of Clades 10 and 12, horizontal gene transfer of plant cell wall degrading enzymes from bacteria and fungi has been implicated in the evolution of plant parasitism. We have used ribonucleic acid sequencing (RNAseq to generate reference transcriptomes for two economically important nematode species, Xiphinema index and Longidorus elongatus, representative of two genera within the early-branching Clade 2 of the phylum Nematoda. We used a transcriptome-wide analysis to identify putative horizontal gene transfer events. This represents the first in-depth transcriptome analysis from any plant-parasitic nematode of this clade. For each species, we assembled ~30 million Illumina reads into a reference transcriptome. We identified 62 and 104 transcripts, from X. index and L. elongatus, respectively, that were putatively acquired via horizontal gene transfer. By cross-referencing horizontal gene transfer prediction with a phylum-wide analysis of Pfam domains, we identified Clade 2-specific events. Of these, a GH12 cellulase from X. index was analysed phylogenetically and biochemically, revealing a likely bacterial origin and canonical enzymatic function. Horizontal gene transfer was previously shown to be a phenomenon that has contributed to the evolution of plant parasitism among nematodes. Our findings underline the importance and the extensiveness of this phenomenon in the evolution of plant-parasitic life styles in this speciose and widespread animal phylum.
Directory of Open Access Journals (Sweden)
Saminathan Subburaj
Full Text Available The rice gene seed dormancy 4 (OsSdr4 functions in seed dormancy and is a major factor associated with pre-harvest sprouting (PHS. Although previous studies of this protein family were reported for rice and other species, knowledge of the evolution of genes homologous to OsSdr4 in plants remains inadequate. Fifty four Sdr4-like (hereafter designated Sdr4L genes were identified in nine plant lineages including 36 species. Phylogenetic analysis placed these genes in eight subfamilies (I-VIII. Genes from the same lineage clustered together, supported by analysis of conserved motifs and exon-intron patterns. Segmental duplications were present in both dicot and monocot clusters, while tandemly duplicated genes occurred only in monocot clusters indicating that both tandem and segmental duplications contributed to expansion of the grass I and II subfamilies. Estimation of the approximate ages of the duplication events indicated that ancestral Sdr4 genes evolved from a common angiosperm ancestor, about 160 million years ago (MYA. Moreover, diversification of Sdr4L genes in mono and dicot plants was mainly associated with genome-wide duplication and speciation events. Functional divergence was observed in all subfamily pairs, except IV/VIIIa. Further analysis indicated that functional constraints between subfamily pairs I/II, I/VIIIb, II/VI, II/VIIIb, II/IV, and VI/VIIIb were statistically significant. Site and branch-site model analyses of positive selection suggested that these genes were under strong adaptive selection pressure. Critical amino acids detected for both functional divergence and positive selection were mostly located in the loops, pointing to functional importance of these regions in this protein family. In addition, differential expression studies by transcriptome atlas of 11 Sdr4L genes showed that the duplicated genes may have undergone divergence in expression between plant species. Our findings showed that Sdr4L genes are
Plants, genes and justice : an inquiry into fair and equitable benefit-sharing
Jonge, de B.
2009-01-01
Since the advent of biotechnology, plant genetic resources have become more valuable as possible sources for new products and inventions. With knowledge about the genetic make-up and functioning of a plant, biotechnologists can identify and isolate genes with interesting traits which, after long
Laia, Marcelo L; Moreira, Leandro M; Dezajacomo, Juliana; Brigati, Joice B; Ferreira, Cristiano B; Ferro, Maria I T; Silva, Ana C R; Ferro, Jesus A; Oliveira, Julio C F
2009-01-16
Citrus canker is a disease caused by the phytopathogens Xanthomonas citri subsp. citri, Xanthomonas fuscans subsp. aurantifolli and Xanthomonas alfalfae subsp. citrumelonis. The first of the three species, which causes citrus bacterial canker type A, is the most widely spread and severe, attacking all citrus species. In Brazil, this species is the most important, being found in practically all areas where citrus canker has been detected. Like most phytobacterioses, there is no efficient way to control citrus canker. Considering the importance of the disease worldwide, investigation is needed to accurately detect which genes are related to the pathogen-host adaptation process and which are associated with pathogenesis. Through transposon insertion mutagenesis, 10,000 mutants of Xanthomonas citri subsp. citri strain 306 (Xcc) were obtained, and 3,300 were inoculated in Rangpur lime (Citrus limonia) leaves. Their ability to cause citrus canker was analyzed every 3 days until 21 days after inoculation; a set of 44 mutants showed altered virulence, with 8 presenting a complete loss of causing citrus canker symptoms. Sequencing of the insertion site in all 44 mutants revealed that 35 different ORFs were hit, since some ORFs were hit in more than one mutant, with mutants for the same ORF presenting the same phenotype. An analysis of these ORFs showed that some encoded genes were previously known as related to pathogenicity in phytobacteria and, more interestingly, revealed new genes never implicated with Xanthomonas pathogenicity before, including hypothetical ORFs. Among the 8 mutants with no canker symptoms are the hrpB4 and hrpX genes, two genes that belong to type III secretion system (TTSS), two hypothetical ORFS and, surprisingly, the htrA gene, a gene reported as involved with the virulence process in animal-pathogenic bacteria but not described as involved in phytobacteria virulence. Nucleic acid hybridization using labeled cDNA probes showed that some of the
Maize defensin ZmDEF1 is involved in plant response to fungal ...
African Journals Online (AJOL)
The recombinant ZmDEF1 displays an inhibitive activity against the fungal pathogen, Phytophthora parasitica var. nicotianae. Ectopic expression of the ZmDEF1 gene under the control of the cauliflower mosaic virus (CaMV) 35S promoter conferred enhanced tolerance against P. parasitica in transgenic tobacco plants.
Using The Corngrass1 Gene To Enhance The Biofuel Properties Of Crop Plants
Energy Technology Data Exchange (ETDEWEB)
Hake, Sarah [USDA Agricultural Research Service, Washington DC (United States); Chuck, George [USDA Agricultural Research Service, Washington DC (United States)
2015-10-29
The development of novel plant germplasm is vital to addressing our increasing bioenergy demands. The major hurdle to digesting plant biomass is the complex structure of the cell walls, the substrate of fermentation. Plant cell walls are inaccessible matrices of macromolecules that are polymerized with lignin, making fermentation difficult. Overcoming this hurdle is a major goal toward developing usable bioenergy crop plants. Our project seeks to enhance the biofuel properties of perennial grass species using the Corngrass1 (Cg1) gene and its targets. Dominant maize Cg1 mutants produce increased biomass by continuously initiating extra axillary meristems and leaves. We cloned Cg1 and showed that its phenotype is caused by over expression of a unique miR156 microRNA gene that negatively regulates SPL transcription factors. We transferred the Cg1 phenotype to other plants by expressing the gene behind constitutive promoters in four different species, including the monocots, Brachypodium and switchgrass, and dicots, Arabidopsis and poplar. All transformants displayed a similar range of phenotypes, including increased biomass from extended leaf production, and increased vegetative branching. Field grown switchgrass transformants showed that overall lignin content was reduced, the ratio of glucans to xylans was increased, and surprisingly, that starch levels were greatly increased. The goals of this project are to control the tissue and temporal expression of Cg1 by using different promoters to drive its expression, elucidate the function of the SPL targets of Cg1 by generating gain and loss of function alleles, and isolate downstream targets of select SPL genes using deep sequencing and chromatin immunoprecipitation. We believe it is possible to control biomass accumulation, cell wall properties, and sugar levels through manipulation of either the Cg1 gene and/or its SPL targets.
Growth rate regulated genes and their wide involvement in the Lactococcus lactis stress responses
Directory of Open Access Journals (Sweden)
Redon Emma
2008-07-01
Full Text Available Abstract Background The development of transcriptomic tools has allowed exhaustive description of stress responses. These responses always superimpose a general response associated to growth rate decrease and a specific one corresponding to the stress. The exclusive growth rate response can be achieved through chemostat cultivation, enabling all parameters to remain constant except the growth rate. Results We analysed metabolic and transcriptomic responses of Lactococcus lactis in continuous cultures at different growth rates ranging from 0.09 to 0.47 h-1. Growth rate was conditioned by isoleucine supply. Although carbon metabolism was constant and homolactic, a widespread transcriptomic response involving 30% of the genome was observed. The expression of genes encoding physiological functions associated with biogenesis increased with growth rate (transcription, translation, fatty acid and phospholipids metabolism. Many phages, prophages and transposon related genes were down regulated as growth rate increased. The growth rate response was compared to carbon and amino-acid starvation transcriptomic responses, revealing constant and significant involvement of growth rate regulations in these two stressful conditions (overlap 27%. Two regulators potentially involved in the growth rate regulations, llrE and yabB, have been identified. Moreover it was established that genes positively regulated by growth rate are preferentially located in the vicinity of replication origin while those negatively regulated are mainly encountered at the opposite, thus indicating the relationship between genes expression and their location on chromosome. Although stringent response mechanism is considered as the one governing growth deceleration in bacteria, the rigorous comparison of the two transcriptomic responses clearly indicated the mechanisms are distinct. Conclusion This work of integrative biology was performed at the global level using transcriptomic analysis
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Wang, Yaqiong; Ma, Hong
2015-09-01
Proteins often function as complexes, yet little is known about the evolution of dissimilar subunits of complexes. DNA-directed RNA polymerases (RNAPs) are multisubunit complexes, with distinct eukaryotic types for different classes of transcripts. In addition to Pol I-III, common in eukaryotes, plants have Pol IV and V for epigenetic regulation. Some RNAP subunits are specific to one type, whereas other subunits are shared by multiple types. We have conducted extensive phylogenetic and sequence analyses, and have placed RNAP gene duplication events in land plant history, thereby reconstructing the subunit compositions of the novel RNAPs during land plant evolution. We found that Pol IV/V have experienced step-wise duplication and diversification of various subunits, with increasingly distinctive subunit compositions. Also, lineage-specific duplications have further increased RNAP complexity with distinct copies in different plant families and varying divergence for subunits of different RNAPs. Further, the largest subunits of Pol IV/V probably originated from a gene fusion in the ancestral land plants. We propose a framework of plant RNAP evolution, providing an excellent model for protein complex evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Seeing the forest for the trees: annotating small RNA producing genes in plants.
Coruh, Ceyda; Shahid, Saima; Axtell, Michael J
2014-04-01
A key goal in genomics is the complete annotation of the expressed regions of the genome. In plants, substantial portions of the genome make regulatory small RNAs produced by Dicer-Like (DCL) proteins and utilized by Argonaute (AGO) proteins. These include miRNAs and various types of endogenous siRNAs. Small RNA-seq, enabled by cheap and fast DNA sequencing, has produced an enormous volume of data on plant miRNA and siRNA expression in recent years. In this review, we discuss recent progress in using small RNA-seq data to produce stable and reliable annotations of miRNA and siRNA genes in plants. In addition, we highlight key goals for the future of small RNA gene annotation in plants. Copyright © 2014 Elsevier Ltd. All rights reserved.
The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys
Directory of Open Access Journals (Sweden)
Anna V. Shchennikova
2018-01-01
Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas
2014-01-01
Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.
Major gene mutations and domestication of plants
International Nuclear Information System (INIS)
Ashri, A.
1989-01-01
From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs
Gao, Wu-Jun; Li, Shu-Fen; Zhang, Guo-Jun; Wang, Ning-Na; Deng, Chuan-Liang; Lu, Long-Dou
2013-01-01
To identify rapidly a number of genes probably involved in sex determination and differentiation of the dioecious plant Asparagus officinalis, gene expression profiles in early flower development for male and female plants were investigated by microarray assay with 8,665 probes. In total, 638 male-biased and 543 female-biased genes were identified. These genes with biased-expression for male and female were involved in a variety of processes associated with molecular functions, cellular components, and biological processes, suggesting that a complex mechanism underlies the sex development of asparagus. Among the differentially expressed genes involved in the reproductive process, a number of genes associated with floral development were identified. Reverse transcription-PCR was performed for validation, and the results were largely consistent with those obtained by microarray analysis. The findings of this study might contribute to understanding of the molecular mechanisms of sex determination and differentiation in dioecious asparagus and provide a foundation for further studies of this plant.
Directory of Open Access Journals (Sweden)
Wagner L. Araújo
2012-09-01
Full Text Available The application of post-genomic techniques in plant respiration studies has greatly improved our ability to assign functions to gene products. In addition it has also revealed previously unappreciated interactions between distal elements of metabolism. Such results have reinforced the need to consider plant respiratory metabolism as part of a complex network and making sense of such interactions will ultimately require the construction of predictive and mechanistic models. Transcriptomics, proteomics, metabolomics and the quantification of metabolic flux will be of great value in creating such models both by facilitating the annotation of complex gene function, determining their structure and by furnishing the quantitative data required to test them. In this review we highlight how these experimental approaches have contributed to our current understanding of plant respiratory metabolism and its interplay with associated process (e.g. photosynthesis, photorespiration and nitrogen metabolism. We also discuss how data from these techniques may be integrated, with the ultimate aim of identifying mechanisms that control and regulate plant respiration and discovering novel gene functions with potential biotechnological implications.
Arabidopsis ECERIFERUM9 involvement in cuticle formation and maintenance of plant water status
Lu, Shiyou
2012-05-25
Mutation of the ECERIFERUM9 (CER9) gene in Arabidopsis (Arabidopsis thaliana) causes elevated amounts of 18-carbon-length cutin monomers and a dramatic shift in the cuticular wax profile (especially on leaves) toward the very-long-chain free fatty acids tetracosanoic acid (C24) and hexacosanoic acid (C26). Relative to the wild type, cer9 mutants exhibit elevated cuticle membrane thickness over epidermal cells and cuticular ledges with increased occlusion of the stomatal pore. The cuticular phenotypes of cer9 are associated with delayed onset of wilting in plants experiencing water deficit, lower transpiration rates, and improved water use efficiency measured as carbon isotope discrimination. The CER9 protein thus encodes a novel determinant of plant drought tolerance-associated traits, one whose deficiency elevates cutin synthesis, redistributes wax composition, and suppresses transpiration. Map-based cloning identified CER9, and sequence analysis predicted that it encodes an E3 ubiquitin ligase homologous to yeast Doa10 (previously shown to target endoplasmic reticulum proteins for proteasomal degradation). To further elucidate CER9 function, the impact of CER9 deficiency on interactions with other genes was examined using double mutant and transcriptome analyses. For both wax and cutin, cer9 showed mostly additive effects with cer6, long-chain acyl-CoA synthetase1 (lacs1), and lacs2 and revealed its role in early steps of both wax and cutin synthetic pathways. Transcriptome analysis revealed that the cer9 mutation affected diverse cellular processes, with primary impact on genes associated with diverse stress responses. The discovery of CER9 lays new groundwork for developing novel cuticle-based strategies for improving the drought tolerance and water use efficiency of crop plants. © 2012 American Society of Plant Biologists. All Rights Reserved.
Sreedharan, Shareena; Shekhawat, Upendra K Singh; Ganapathi, Thumballi R
2015-05-01
High soil salinity constitutes a major abiotic stress and an important limiting factor in cultivation of crop plants worldwide. Here, we report the identification and characterization of a aquaporin gene, MusaPIP2;6 which is involved in salt stress signaling in banana. MusaPIP2;6 was firstly identified based on comparative analysis of stressed and non-stressed banana tissue derived EST data sets and later overexpression in transgenic banana plants was performed to study its tangible functions in banana plants. The overexpression of MusaPIP2;6 in transgenic banana plants using constitutive or inducible promoter led to higher salt tolerance as compared to equivalent untransformed control plants. Cellular localization assay performed using transiently transformed onion peel cells indicated that MusaPIP2;6 protein tagged with green fluorescent protein was translocated to the plasma membrane. MusaPIP2;6-overexpressing banana plants displayed better photosynthetic efficiency and lower membrane damage under salt stress conditions. Our results suggest that MusaPIP2;6 is involved in salt stress signaling and tolerance in banana.
Directory of Open Access Journals (Sweden)
Young Mike
2009-07-01
Full Text Available Abstract Background Senescence is integral to the flowering plant life-cycle. Senescence-like processes occur also in non-angiosperm land plants, algae and photosynthetic prokaryotes. Increasing numbers of genes have been assigned functions in the regulation and execution of angiosperm senescence. At the same time there has been a large expansion in the number and taxonomic spread of plant sequences in the genome databases. The present paper uses these resources to make a study of the evolutionary origins of angiosperm senescence based on a survey of the distribution, across plant and microbial taxa, and expression of senescence-related genes. Results Phylogeny analyses were carried out on protein sequences corresponding to genes with demonstrated functions in angiosperm senescence. They include proteins involved in chlorophyll catabolism and its control, homeoprotein transcription factors, metabolite transporters, enzymes and regulators of carotenoid metabolism and of anthocyanin biosynthesis. Evolutionary timelines for the origins and functions of particular genes were inferred from the taxonomic distribution of sequences homologous to those of angiosperm senescence-related proteins. Turnover of the light energy transduction apparatus is the most ancient element in the senescence syndrome. By contrast, the association of phenylpropanoid metabolism with senescence, and integration of senescence with development and adaptation mediated by transcription factors, are relatively recent innovations of land plants. An extended range of senescence-related genes of Arabidopsis was profiled for coexpression patterns and developmental relationships and revealed a clear carotenoid metabolism grouping, coordinated expression of genes for anthocyanin and flavonoid enzymes and regulators and a cluster pattern of genes for chlorophyll catabolism consistent with functional and evolutionary features of the pathway. Conclusion The expression and phylogenetic
Ramirez-Córdova, Jesús; Drnevich, Jenny; Madrigal-Pulido, Jaime Alberto; Arrizon, Javier; Allen, Kirk; Martínez-Velázquez, Moisés; Alvarez-Maya, Ikuri
2012-08-01
During ethanol fermentation, yeast cells are exposed to stress due to the accumulation of ethanol, cell growth is altered and the output of the target product is reduced. For Agave beverages, like tequila, no reports have been published on the global gene expression under ethanol stress. In this work, we used microarray analysis to identify Saccharomyces cerevisiae genes involved in the ethanol response. Gene expression of a tequila yeast strain of S. cerevisiae (AR5) was explored by comparing global gene expression with that of laboratory strain S288C, both after ethanol exposure. Additionally, we used two different culture conditions, cells grown in Agave tequilana juice as a natural fermentation media or grown in yeast-extract peptone dextrose as artificial media. Of the 6368 S. cerevisiae genes in the microarray, 657 genes were identified that had different expression responses to ethanol stress due to strain and/or media. A cluster of 28 genes was found over-expressed specifically in the AR5 tequila strain that could be involved in the adaptation to tequila yeast fermentation, 14 of which are unknown such as yor343c, ylr162w, ygr182c, ymr265c, yer053c-a or ydr415c. These could be the most suitable genes for transforming tequila yeast to increase ethanol tolerance in the tequila fermentation process. Other genes involved in response to stress (RFC4, TSA1, MLH1, PAU3, RAD53) or transport (CYB2, TIP20, QCR9) were expressed in the same cluster. Unknown genes could be good candidates for the development of recombinant yeasts with ethanol tolerance for use in industrial tequila fermentation.
Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M
1993-01-01
The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.
Reyes-Rivera, Jorge; Rodríguez-Alonso, Gustavo; Petrone, Emilio; Vasco, Alejandra; Vergara-Silva, Francisco; Shishkova, Svetlana; Terrazas, Teresa
2017-01-01
The vascular cambium is a lateral meristem that produces secondary xylem (i.e., wood) and phloem. Different Cactaceae species develop different types of secondary xylem; however, little is known about the mechanisms underlying wood formation in the Cactaceae. The KNOTTED HOMEOBOX (KNOX) gene family encodes transcription factors that regulate plant development. The role of class I KNOX genes in the regulation of the shoot apical meristem, inflorescence architecture, and secondary growth is established in a few model species, while the functions of class II KNOX genes are less well understood, although the Arabidopsis thaliana class II KNOX protein KNAT7 is known to regulate secondary cell wall biosynthesis. To explore the involvement of the KNOX genes in the enormous variability of wood in Cactaceae, we identified orthologous genes expressed in species with fibrous ( Pereskia lychnidiflora and Pilosocereus alensis ), non-fibrous ( Ariocarpus retusus ), and dimorphic ( Ferocactus pilosus ) wood. Both class I and class II KNOX genes were expressed in the cactus cambial zone, including one or two class I paralogs of KNAT1 , as well as one or two class II paralogs of KNAT3 - KNAT4 - KNAT5 . While the KNOX gene SHOOTMERISTEMLESS ( STM) and its ortholog ARK1 are expressed during secondary growth in the Arabidopsis and Populus stem, respectively, we did not find STM orthologs in the Cactaceae cambial zone, which suggests possible differences in the vascular cambium genetic regulatory network in these species. Importantly, while two class II KNOX paralogs from the KNAT7 clade were expressed in the cambial zone of A. retusus and F. pilosus , we did not detect KNAT7 ortholog expression in the cambial zone of P. lychnidiflora . Differences in the transcriptional repressor activity of secondary cell wall biosynthesis by the KNAT7 orthologs could therefore explain the differences in wood development in the cactus species.
An Evolutionary Genomic Approach to Identify Genes Involved in Human Birth Timing
Orabona, Guilherme; Morgan, Thomas; Haataja, Ritva; Hallman, Mikko; Puttonen, Hilkka; Menon, Ramkumar; Kuczynski, Edward; Norwitz, Errol; Snegovskikh, Victoria; Palotie, Aarno; Fellman, Vineta; DeFranco, Emily A.; Chaudhari, Bimal P.; McGregor, Tracy L.; McElroy, Jude J.; Oetjens, Matthew T.; Teramo, Kari; Borecki, Ingrid; Fay, Justin; Muglia, Louis
2011-01-01
Coordination of fetal maturation with birth timing is essential for mammalian reproduction. In humans, preterm birth is a disorder of profound global health significance. The signals initiating parturition in humans have remained elusive, due to divergence in physiological mechanisms between humans and model organisms typically studied. Because of relatively large human head size and narrow birth canal cross-sectional area compared to other primates, we hypothesized that genes involved in parturition would display accelerated evolution along the human and/or higher primate phylogenetic lineages to decrease the length of gestation and promote delivery of a smaller fetus that transits the birth canal more readily. Further, we tested whether current variation in such accelerated genes contributes to preterm birth risk. Evidence from allometric scaling of gestational age suggests human gestation has been shortened relative to other primates. Consistent with our hypothesis, many genes involved in reproduction show human acceleration in their coding or adjacent noncoding regions. We screened >8,400 SNPs in 150 human accelerated genes in 165 Finnish preterm and 163 control mothers for association with preterm birth. In this cohort, the most significant association was in FSHR, and 8 of the 10 most significant SNPs were in this gene. Further evidence for association of a linkage disequilibrium block of SNPs in FSHR, rs11686474, rs11680730, rs12473870, and rs1247381 was found in African Americans. By considering human acceleration, we identified a novel gene that may be associated with preterm birth, FSHR. We anticipate other human accelerated genes will similarly be associated with preterm birth risk and elucidate essential pathways for human parturition. PMID:21533219
Directory of Open Access Journals (Sweden)
Hao Li
Full Text Available To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR value was 2. Subsequently, Gene Ontology (GO categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease.
Shrestha, Barsha; Guragain, Bhuwan; Sridhar, Vaniyambadi V
2014-02-24
During abiotic stress many genes that are important for growth and adaptation to stress are expressed at elevated levels. However, the mechanisms that keep the stress responsive genes from expressing under non stress conditions remain elusive. Recent genetic characterization of the co-repressor LEUNIG_HOMOLOG (LUH) and transcriptional adaptor proteins SEUSS-LIKE1 (SLK1) and SLK2 have been proposed to function redundantly in diverse developmental processes; however their function in the abiotic stress response is unknown. Moreover, the molecular functions of LUH, SLK1 and SLK2 remain obscure. Here, we show the molecular function of LUH, SLK1 and SLK2 and the role of this complex in the abiotic stress response. The luh, slk1 and slk2 mutant plants shows enhanced tolerance to salt and osmotic stress conditions. SLK1 and SLK2 interact physically with the LUFS domain in LUH forming SLK1-LUH and SLK2-LUH co-repressor complexes to inhibit the transcription. LUH has repressor activity, whereas SLK1 and SLK2 function as adaptors to recruit LUH, which in turn recruits histone deacetylase to the target sequences to repress transcription. The stress response genes RD20, MYB2 and NAC019 are expressed at elevated levels in the luh, slk1 and slk2 mutant plants. Furthermore, these stress response genes are associated with decreased nucleosome density and increased acetylation levels at H3K9 and H3K14 in the luh, slk1 and slk2 mutant plants. Our results indicate that SLK1, SLK2 and LUH form a co-repressor complex. LUH represses by means of an epigenetic process involving histone modification to facilitate the condensation of chromatin thus preventing transcription at the target genes.
Zhu, Yan; Chen, Longxian; Zhang, Chengjun; Hao, Pei; Jing, Xinyun; Li, Xuan
2017-01-25
Selaginella moellendorffii, a lycophyte, is a model plant to study the early evolution and development of vascular plants. As the first and only sequenced lycophyte to date, the genome of S. moellendorffii revealed many conserved genes and pathways, as well as specialized genes different from flowering plants. Despite the progress made, little is known about long noncoding RNAs (lncRNA) and the alternative splicing (AS) of coding genes in S. moellendorffii. Its coding gene models have not been fully validated with transcriptome data. Furthermore, it remains important to understand whether the regulatory mechanisms similar to flowering plants are used, and how they operate in a non-seed primitive vascular plant. RNA-sequencing (RNA-seq) was performed for three S. moellendorffii tissues, root, stem, and leaf, by constructing strand-specific RNA-seq libraries from RNA purified using RiboMinus isolation protocol. A total of 176 million reads (44 Gbp) were obtained from three tissue types, and were mapped to S. moellendorffii genome. By comparing with 22,285 existing gene models of S. moellendorffii, we identified 7930 high-confidence novel coding genes (a 35.6% increase), and for the first time reported 4422 lncRNAs in a lycophyte. Further, we refined 2461 (11.0%) of existing gene models, and identified 11,030 AS events (for 5957 coding genes) revealed for the first time for lycophytes. Tissue-specific gene expression with functional implication was analyzed, and 1031, 554, and 269 coding genes, and 174, 39, and 17 lncRNAs were identified in root, stem, and leaf tissues, respectively. The expression of critical genes for vascular development stages, i.e. formation of provascular cells, xylem specification and differentiation, and phloem specification and differentiation, was compared in S. moellendorffii tissues, indicating a less complex regulatory mechanism in lycophytes than in flowering plants. The results were further strengthened by the evolutionary trend of
Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.
2002-01-01
Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.
Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants
Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong
2010-01-01
Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...
Energy Technology Data Exchange (ETDEWEB)
Marton, L.
1996-02-01
Genetic manipulation of plants often involves the introduction of homologous or partly homologous genes. Ectropic introduction of homologous sequences into plant genomes may trigger epigenetic changes, making expression of the genes unpredictable. The main project objective was to examine the feasibility of using Agrobacterium-mediated gene transfer for homologous gene targeting in plants.
Cázares-Flores, Paulo; Levac, Dylan; De Luca, Vincenzo
2016-08-01
Ajmaline biosynthesis in Rauvolfia serpentina has been one of the most studied monoterpenoid indole alkaloid (MIA) pathways within the plant family Apocynaceae. Detailed molecular and biochemical information on most of the steps involved in the pathway has been generated over the last 30 years. Here we report the identification, molecular cloning and functional expression in Escherichia coli of two R. serpentinacDNAs that are part of a recently discovered γ-tocopherol-like N-methyltransferase (γ-TLMT) family and are involved in indole and side-chain N-methylation of ajmaline. Recombinant proteins showed remarkable substrate specificity for molecules with an ajmalan-type backbone and strict regiospecific N-methylation. Furthermore, N-methyltransferase gene transcripts and enzyme activity were enriched in R. serpentina roots which correlated with accumulation of ajmaline alkaloid. This study elucidates the final step in the ajmaline biosynthetic pathway and describes the enzyme responsible for the formation of Nβ -methylajmaline, an unusual charged MIA found in R. serpentina. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
The effects of calcium on the expression of genes involved in ...
African Journals Online (AJOL)
Calcium regulation of the genes involved in ethylene biosynthesis and ethylene receptors in flower abscission zones (AZ) of wild-type tomato (Lycopersicon esculentum Mill.) was investigated in this study. Calcium treatment delayed abscission of pedicel explants. However, verapamil (VP, calcium inhibitor) treatments ...
Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong
2017-09-11
Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.
Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël
2014-01-01
Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Confirmation of RAX gene involvement in human anophthalmia.
Lequeux, L; Rio, M; Vigouroux, A; Titeux, M; Etchevers, H; Malecaze, F; Chassaing, N; Calvas, P
2008-10-01
Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. Mutations in several genes have been involved in syndromic and non-syndromic anophthalmia. Previously, RAX recessive mutations were implicated in a single patient with right anophthalmia, left microphthalmia and sclerocornea. In this study, we report the findings of novel compound heterozygous RAX mutations in a child with bilateral anophthalmia. Both mutations are located in exon 3. c.664delT is a frameshifting deletion predicted to introduce a premature stop codon (p.Ser222ArgfsX62), and c.909C>G is a nonsense mutation with similar consequences (p.Tyr303X). This is the second report of a patient with anophthalmia caused by RAX mutations. These findings confirm that RAX plays a major role in the early stages of eye development and is involved in human anophthalmia.
Chenthamara, Komal; Zhang, Jian; Atanasova, Lea; Yang, Dongqing; Miao, Youzhi; Grujic, Marica; Pourmehdi, Shadi; Pretzer, Carina; Kopchinskiy, Alexey G.; Hundley, Hope; Wang, Mei; Aerts, Andrea; Salamov, Asaf; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V.; Shen, Qirong; Kubicek, Christian P.
2018-01-01
Unlike most other fungi, molds of the genus Trichoderma (Hypocreales, Ascomycota) are aggressive parasites of other fungi and efficient decomposers of plant biomass. Although nutritional shifts are common among hypocrealean fungi, there are no examples of such broad substrate versatility as that observed in Trichoderma. A phylogenomic analysis of 23 hypocrealean fungi (including nine Trichoderma spp. and the related Escovopsis weberi) revealed that the genus Trichoderma has evolved from an ancestor with limited cellulolytic capability that fed on either fungi or arthropods. The evolutionary analysis of Trichoderma genes encoding plant cell wall-degrading carbohydrate-active enzymes and auxiliary proteins (pcwdCAZome, 122 gene families) based on a gene tree / species tree reconciliation demonstrated that the formation of the genus was accompanied by an unprecedented extent of lateral gene transfer (LGT). Nearly one-half of the genes in Trichoderma pcwdCAZome (41%) were obtained via LGT from plant-associated filamentous fungi belonging to different classes of Ascomycota, while no LGT was observed from other potential donors. In addition to the ability to feed on unrelated fungi (such as Basidiomycota), we also showed that Trichoderma is capable of endoparasitism on a broad range of Ascomycota, including extant LGT donors. This phenomenon was not observed in E. weberi and rarely in other mycoparasitic hypocrealean fungi. Thus, our study suggests that LGT is linked to the ability of Trichoderma to parasitize taxonomically related fungi (up to adelphoparasitism in strict sense). This may have allowed primarily mycotrophic Trichoderma fungi to evolve into decomposers of plant biomass. PMID:29630596
Dong, Yang; Li, Ming; Liu, Puzhao; Song, Haiyan; Zhao, Yuping; Shi, Jianrong
2014-06-01
Genes involved in immunity and apoptosis were associated with human presbycusis. CCR3 and GILZ played an important role in the pathogenesis of presbycusis, probably through regulating chemokine receptor, T-cell apoptosis, or T-cell activation pathways. To identify genes associated with human presbycusis and explore the molecular mechanism of presbycusis. Hearing function was tested by pure-tone audiometry. Microarray analysis was performed to identify presbycusis-correlated genes by Illumina Human-6 BeadChip using the peripheral blood samples of subjects. To identify biological process categories and pathways associated with presbycusis-correlated genes, bioinformatics analysis was carried out by Gene Ontology Tree Machine (GOTM) and database for annotation, visualization, and integrated discovery (DAVID). Quantitative RT-PCR (qRT-PCR) was used to validate the microarray data. Microarray analysis identified 469 up-regulated genes and 323 down-regulated genes. Both the dominant biological processes by Gene Ontology (GO) analysis and the enriched pathways by Kyoto encyclopedia of genes and genomes (KEGG) and BIOCARTA showed that genes involved in immunity and apoptosis were associated with presbycusis. In addition, CCR3, GILZ, CXCL10, and CX3CR1 genes showed consistent difference between groups for both the gene chip and qRT-PCR data. The differences of CCR3 and GILZ between presbycusis patients and controls were statistically significant (p < 0.05).
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Le Strat, Yann; Ramoz, Nicolas; Gorwood, Philip
2009-05-01
Schizophrenia is a multifactorial disease characterized by a high heritability. Several candidate genes have been suggested, with the strongest evidences for genes encoding dystrobrevin binding protein 1 (DTNBP1), neuregulin 1 (NRG1), neuregulin 1 receptor (ERBB4) and disrupted in schizophrenia 1 (DISC1), as well as several neurotrophic factors. These genes are involved in neuronal plasticity and play also a role in adult neurogenesis. Therefore, the genetic basis of schizophrenia could involve different factors more or less specifically required for neuroplasticity, including the synapse maturation, potentiation and plasticity as well as neurogenesis. Following the model of Knudson in tumors, we propose a two-hit hypothesis of schizophrenia. In this model of gene-environment interaction, a variant in a gene related to neurogenesis is transmitted to the descent (first hit), and, secondarily, an environmental factor occurs during the development of the central nervous system (second hit). Both of these vulnerability and trigger factors are probably necessary to generate a deficit in neurogenesis and therefore to cause schizophrenia. The literature supporting this gene x environment hypothesis is reviewed, with emphasis on some molecular pathways, raising the possibility to propose more specific molecular medicine.
Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun
2016-11-29
Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.
Communicative interactions involving plants: information, evolution, and ecology.
Mescher, Mark C; Pearse, Ian S
2016-08-01
The role of information obtained via sensory cues and signals in mediating the interactions of organisms with their biotic and abiotic environments has been a major focus of work on sensory and behavioral ecology. Information-mediated interactions also have important implications for broader ecological patterns emerging at the community and ecosystem levels that are only now beginning to be explored. Given the extent to which plants dominate the sensory landscapes of terrestrial ecosystems, information-mediated interactions involving plants should be a major focus of efforts to elucidate these broader patterns. Here we explore how such efforts might be enhanced by a clear understanding of information itself-a central and potentially unifying concept in biology that has nevertheless been the subject of considerable confusion-and of its relationship to adaptive evolution and ecology. We suggest that information-mediated interactions should be a key focus of efforts to more fully integrate evolutionary biology and ecology. Copyright © 2016 Elsevier Ltd. All rights reserved.
Endogenous small RNAs and antibacterial immunity in plants.
Jin, Hailing
2008-08-06
Small RNAs are non-coding regulatory RNA molecules that control gene expression by mediating mRNA degradation, translational inhibition, or chromatin modification. Virus-derived small RNAs induce silencing of viral RNAs and are essential for antiviral defense in both animal and plant systems. The role of host endogenous small RNAs on antibacterial immunity has only recently been recognized. Host disease resistance and defense responses are achieved by activation and repression of a large array of genes. Certain endogenous small RNAs in plants, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are induced or repressed in response to pathogen attack and subsequently regulate the expression of genes involved in disease resistance and defense responses by mediating transcriptional or post-transcriptional gene silencing. Thus, these small RNAs play an important role in gene expression reprogramming in plant disease resistance and defense responses. This review focuses on the recent findings of plant endogenous small RNAs in antibacterial immunity.
Fox (forkhead) genes are involved in the dorso-ventral patterning of the Xenopus mesoderm.
El-Hodiri, H; Bhatia-Dey, N; Kenyon, K; Ault, K; Dirksen, M; Jamrich, M
2001-01-01
Fox (forkhead/winged helix) genes encode a family of transcription factors that are involved in embryonic pattern formation, regulation of tissue specific gene expression and tumorigenesis. Several of them are transcribed during Xenopus embryogenesis and are important for the patterning of ectoderm, mesoderm and endoderm. We have isolated three forkhead genes that are activated during gastrulation and play an important role in the dorso-ventral patterning of the mesoderm. XFKH1 (FoxA4b), the first vertebrate forkhead gene to be implicated in embryonic pattern formation, is expressed in the Spemann-Mangold organizer region and later in the embryonic notochord. XFKH7, the Xenopus orthologue of the murine Mfh1(Foxc2), is expressed in the presomitic mesoderm, but not in the notochord or lateral plate mesoderm. Finally, XFD-13'(FoxF1b)1 is expressed in the lateral plate mesoderm, but not in the notochord or presomitic mesoderm. Expression pattern and functional experiments indicate that these three forkhead genes are involved in the dorso-ventral patterning of the mesoderm.
WRKY transcription factors involved in PR-1 gene expression in Arabidopsis
Hussain, Rana Muhammad Fraz
2012-01-01
Salicylic acid (SA) is involved in mediating defense against biotrophic pathogens. The current knowledge of the SA-mediated signaling pathway and its effect on the transcriptional regulation of defense responses are reviewed in this thesis. PR-1 is a marker gene for systemic acquired resistance
Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter
2013-01-01
As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.
Abdollahi Mandoulakani, Babak; Eyvazpour, Elham; Ghadimzadeh, Morteza
2017-07-01
Basil (Ocimum basilicum L.), a medicinal plant of the Lamiaceae family, is used in traditional medicine; its essential oil is a rich source of phenylpropanoids. Methylchavicol and methyleugenol are the most important constituents of basil essential oil. Drought stress is proposed to enhance the essential oil composition and expression levels of the genes involved in its biosynthesis. In the current investigation, an experiment based on a completely randomized design (CRD) with three replications was conducted in the greenhouse to study the effect of drought stress on the expression level of four genes involved in the phenylpropanoid biosynthesis pathway in O. basilicum c.v. Keshkeni luvelou. The genes studied were chavicol O-methyl transferase (CVOMT), eugenol O-methyl transferase (EOMT), cinnamate 4-hydroxylase (C4H), 4-coumarate coA ligase (4CL), and cinnamyl alcohol dehydrogenase (CAD). The effect of drought stress on the essential oil compounds and their relationship with the expression levels of the studied genes were also investigated. Plants were subjected to levels of 100%, 75%, and 50% of field capacity (FC) at the 6-8 leaf stage. Essential oil compounds were identified by gas chromatography/mass spectrometry (GC-MS) at flowering stage and the levels of gene expression were determind by real time PCR in plant leaves at the same stage. Results showed that drought stress increased the amount of methylchavicol, methyleugenol, β-Myrcene and α-bergamotene. The maximum amount of these compounds was observed at 50% FC. Real-time PCR analysis revealed that severe drought stress (50% FC) increased the expression level of CVOMT and EOMT by about 6.46 and 46.33 times, respectively, whereas those of CAD relatively remained unchanged. The expression level of 4CL and C4H reduced under drought stress conditions. Our results also demonstrated that changes in the expression levels of CVOMT and EOMT are significantly correlated with methylchavicol (r = 0.94, P ≤ 0
The landscape of human genes involved in the immune response to parasitic worms
Directory of Open Access Journals (Sweden)
Fumagalli Matteo
2010-08-01
Full Text Available Abstract Background More than 2 billion individuals worldwide suffer from helminth infections. The highest parasite burdens occur in children and helminth infection during pregnancy is a risk factor for preterm delivery and reduced birth weight. Therefore, helminth infections can be regarded as a strong selective pressure. Results Here we propose that candidate susceptibility genes for parasitic worm infections can be identified by searching for SNPs that display a strong correlation with the diversity of helminth species/genera transmitted in different geographic areas. By a genome-wide search we identified 3478 variants that correlate with helminth diversity. These SNPs map to 810 distinct human genes including loci involved in regulatory T cell function and in macrophage activation, as well as leukocyte integrins and co-inhibitory molecules. Analysis of functional relationships among these genes identified complex interaction networks centred around Th2 cytokines. Finally, several genes carrying candidate targets for helminth-driven selective pressure also harbour susceptibility alleles for asthma/allergy or are involved in airway hyper-responsiveness, therefore expanding the known parallelism between these conditions and parasitic infections. Conclusions Our data provide a landscape of human genes that modulate susceptibility to helminths and indicate parasitic worms as one of the major selective forces in humans.
MSU-DOE Plant Research Laboratory
Energy Technology Data Exchange (ETDEWEB)
1991-01-01
This document is the compiled progress reports of research funded through the Michigan State University/Department of Energy Plant Research Laboratory. Fourteen reports are included, covering the molecular basis of plant/microbe symbiosis, cell wall biosynthesis and proteins, gene expression, stress responses, plant hormone biosynthesis, interactions between the nuclear and organelle genomes, sensory transduction and tropisms, intracellular sorting and trafficking, regulation of lipid metabolism, molecular basis of disease resistance and plant pathogenesis, developmental biology of Cyanobacteria, and hormonal involvement in environmental control of plant growth. 320 refs., 26 figs., 3 tabs. (MHB)
Directory of Open Access Journals (Sweden)
Guillem Segarra
Full Text Available Composts are the products obtained after the aerobic degradation of different types of organic matter waste and can be used as substrates or substrate/soil amendments for plant cultivation. There is a small but increasing number of reports that suggest that foliar diseases may be reduced when using compost, rather than standard substrates, as growing medium. The purpose of this study was to examine the gene expression alteration produced by the compost to gain knowledge of the mechanisms involved in compost-induced systemic resistance. A compost from olive marc and olive tree leaves was able to induce resistance against Botrytis cinerea in Arabidopsis, unlike the standard substrate, perlite. Microarray analyses revealed that 178 genes were differently expressed, with a fold change cut-off of 1, of which 155 were up-regulated and 23 were down-regulated in compost-grown, as against perlite-grown plants. A functional enrichment study of up-regulated genes revealed that 38 Gene Ontology terms were significantly enriched. Response to stress, biotic stimulus, other organism, bacterium, fungus, chemical and abiotic stimulus, SA and ABA stimulus, oxidative stress, water, temperature and cold were significantly enriched, as were immune and defense responses, systemic acquired resistance, secondary metabolic process and oxireductase activity. Interestingly, PR1 expression, which was equally enhanced by growing the plants in compost and by B. cinerea inoculation, was further boosted in compost-grown pathogen-inoculated plants. Compost triggered a plant response that shares similarities with both systemic acquired resistance and ABA-dependent/independent abiotic stress responses.
A genome-wide search for genes involved in the radiation-induced gastroschisis
International Nuclear Information System (INIS)
Hillebrandt, S.; Streffer, C.
1997-01-01
Whole genome linkage analysis of gastroschisis (abdominal wall defect) using geno-typing with micro-satellites of affected BC1 mice [(HLGxC57BL/6J)xHLG] was performed. The HLG inbred strain shows an increased risk in gastroschisis after irradiation of embryos in the 1-cell stage. Previous studies demonstrated, that gastroschisis is a poly-genic trait with a recessive mode of inheritance. Since a recessive inheritance of gastroschisis is assumed, the involved genes must be linked to markers showing a high level of homozygosity in the affected animals. For marker loci on the chromosome 13 and 19 a significantly increased number of homozygotes has been found in mice with gastroschisis comparing to mice without this malformation. The linkage analysis performed by us allowed determining intervals likely to contain genes related to gastroschisis on these two chromosomes. The highest lod score value has been found for the marker locus D19MIT27 very close to Pax2 (lod score=1.23; p=0.017). For the marker D13MIT99 a lod score of 0.85 (p=0.047) was calculated. However, markers more close to the homeo-box gene Msx-2 on the chromosome 13 show lower lod score values than D13MIT99, suggesting that this homeo-box gene is probably not involved in gastroschisis. According to the classification of results of the linkage analysis of complex traits described by Lander and Kruglyak (1995), our data provide a suggestive evidence for the involvement of the analyzed intervals on the chromosomes 19 and 13 to gastroschisis. Further studies are necessary to prove this linkage. (authors)
The ERECTA gene regulates plant transpiration efficiency in Arabidopsis.
Masle, Josette; Gilmore, Scott R; Farquhar, Graham D
2005-08-11
Assimilation of carbon by plants incurs water costs. In the many parts of the world where water is in short supply, plant transpiration efficiency, the ratio of carbon fixation to water loss, is critical to plant survival, crop yield and vegetation dynamics. When challenged by variations in their environment, plants often seem to coordinate photosynthesis and transpiration, but significant genetic variation in transpiration efficiency has been identified both between and within species. This has allowed plant breeders to develop effective selection programmes for the improved transpiration efficiency of crops, after it was demonstrated that carbon isotopic discrimination, Delta, of plant matter was a reliable and sensitive marker negatively related to variation in transpiration efficiency. However, little is known of the genetic controls of transpiration efficiency. Here we report the isolation of a gene that regulates transpiration efficiency, ERECTA. We show that ERECTA, a putative leucine-rich repeat receptor-like kinase (LRR-RLK) known for its effects on inflorescence development, is a major contributor to a locus for Delta on Arabidopsis chromosome 2. Mechanisms include, but are not limited to, effects on stomatal density, epidermal cell expansion, mesophyll cell proliferation and cell-cell contact.
Wang, Feng; Liang, Yuting; Jiang, Yuji; Yang, Yunfeng; Xue, Kai; Xiong, Jinbo; Zhou, Jizhong; Sun, Bo
2015-09-23
Plants have an important impact on soil microbial communities and their functions. However, how plants determine the microbial composition and network interactions is still poorly understood. During a four-year field experiment, we investigated the functional gene composition of three types of soils (Phaeozem, Cambisols and Acrisol) under maize planting and bare fallow regimes located in cold temperate, warm temperate and subtropical regions, respectively. The core genes were identified using high-throughput functional gene microarray (GeoChip 3.0), and functional molecular ecological networks (fMENs) were subsequently developed with the random matrix theory (RMT)-based conceptual framework. Our results demonstrated that planting significantly (P soils and 83.5% of microbial alpha-diversity can be explained by the plant factor. Moreover, planting had significant impacts on the microbial community structure and the network interactions of the microbial communities. The calculated network complexity was higher under maize planting than under bare fallow regimes. The increase of the functional genes led to an increase in both soil respiration and nitrification potential with maize planting, indicating that changes in the soil microbial communities and network interactions influenced ecological functioning.
Porcel, Rosa; Aroca, Ricardo; Azcon, Rosario; Ruiz-Lozano, Juan Manuel
2016-10-01
Rice is a salt-sensitive crop whose productivity is strongly reduced by salinity around the world. Plants growing in saline soils are subjected to the toxicity of specific ions such as sodium, which damage cell organelles and disrupt metabolism. Plants have evolved biochemical and molecular mechanisms to cope with the negative effects of salinity. These include the regulation of genes with a role in the uptake, transport or compartmentation of Na(+) and/or K(+). Studies have shown that the arbuscular mycorrhizal (AM) symbiosis alleviates salt stress in several host plant species. However, despite the abundant literature showing mitigation of ionic imbalance by the AM symbiosis, the molecular mechanisms involved are barely explored. The objective of this study was to elucidate the effects of the AM symbiosis on the expression of several well-known rice transporters involved in Na(+)/K(+) homeostasis and measure Na(+) and K(+) contents and their ratios in different plant tissues. Results showed that OsNHX3, OsSOS1, OsHKT2;1 and OsHKT1;5 genes were considerably upregulated in AM plants under saline conditions as compared to non-AM plants. Results suggest that the AM symbiosis favours Na(+) extrusion from the cytoplasm, its sequestration into the vacuole, the unloading of Na(+) from the xylem and its recirculation from photosynthetic organs to roots. As a result, there is a decrease of Na(+) root-to-shoot distribution and an increase of Na(+) accumulation in rice roots which seems to enhance the plant tolerance to salinity and allows AM rice plants to maintain their growing processes under salt conditions.
Energy Technology Data Exchange (ETDEWEB)
Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))
1991-10-01
Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Plant gene bank and vegetable varieties biodiversity in Smederevska Palanka
Directory of Open Access Journals (Sweden)
Pavlović Nenad
2011-01-01
Full Text Available Biodiversity protection and preservation of genetic variability is based on the fact that plant varieties are irreplaceable in production process and that they are more and more jeopardized by urban and industrial development. The most common way of preserving and at the same time the safest way is a storage in a gene bank. Prior to storage comes collecting, studying and replanting for Institute Gene Bank, Central State Gene Bank and for Regional Gene Banks. Institute for Vegetable Crops in Smederevska Palanka preserves a wide variety of vegetable germplasm. This is, so called, work collection, used as a gene resource for breeding purposes. Seed samples are stored at 4±2°C and 50% relative humidity. At the moment, the collection has 2265 samples. Almost all samples have the passport data, but only 10% of samples have been further characterized and evaluated.
Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory
2013-01-01
Objective The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Methods Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Results Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. Conclusion The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure. PMID:24086524
Energy Technology Data Exchange (ETDEWEB)
Harrison, Maria J [Boyce Thompson Institute, Ithaca, NY (United States); Hudson, Matthew E [Univ. of Illinois, Champaign, IL (United States)
2015-11-24
Most vascular flowering plants have the ability to form symbiotic associations with arbuscular mycorrhizal (AM) fungi. The symbiosis develops in the roots and can have a profound effect on plant productivity, largely through improvements in plant mineral nutrition. Within the root cortical cells, the plant and fungus create novel interfaces specialized for nutrient transfer, while the fungus also develops a network of hyphae in the rhizosphere. Through this hyphal network, the fungus acquires and delivers phosphate and nitrogen to the root. In return, the plant provides the fungus with carbon. In addition, to enhancing plant mineral nutrition, the AM symbiosis has an important role in the carbon cycle, and positive effects on soil health. Here we identified and characterized plant genes involved in the regulation and functioning of the AM symbiosis in Medicago truncatula and Brachypodium distachyon. This included the identification and and characterization of a M. truncatula transcription factors that are required for symbiosis. Additionally, we investigated the molecular basis of functional diversity among AM symbioses in B. distachyon and analysed the transcriptome of Brachypodium distachyon during symbiosis.
Gene Discovery and Functional Analyses in the Model Plant Arabidopsis
DEFF Research Database (Denmark)
Feng, Cai-ping; Mundy, J.
2006-01-01
The present mini-review describes newer methods and strategies, including transposon and T-DNA insertions, TILLING, Deleteagene, and RNA interference, to functionally analyze genes of interest in the model plant Arabidopsis. The relative advantages and disadvantages of the systems are also discus...
Directory of Open Access Journals (Sweden)
Francisco Torres-Avilés
2014-03-01
Conclusion: Application of different statistical analyses to detect potential resistance genes reliably has shown to conduct interesting results that improve knowledge on molecular mechanisms of plant resistance to pathogens.
Gene Delivery into Plant Cells for Recombinant Protein Production
Directory of Open Access Journals (Sweden)
Qiang Chen
2015-01-01
Full Text Available Recombinant proteins are primarily produced from cultures of mammalian, insect, and bacteria cells. In recent years, the development of deconstructed virus-based vectors has allowed plants to become a viable platform for recombinant protein production, with advantages in versatility, speed, cost, scalability, and safety over the current production paradigms. In this paper, we review the recent progress in the methodology of agroinfiltration, a solution to overcome the challenge of transgene delivery into plant cells for large-scale manufacturing of recombinant proteins. General gene delivery methodologies in plants are first summarized, followed by extensive discussion on the application and scalability of each agroinfiltration method. New development of a spray-based agroinfiltration and its application on field-grown plants is highlighted. The discussion of agroinfiltration vectors focuses on their applications for producing complex and heteromultimeric proteins and is updated with the development of bridge vectors. Progress on agroinfiltration in Nicotiana and non-Nicotiana plant hosts is subsequently showcased in context of their applications for producing high-value human biologics and low-cost and high-volume industrial enzymes. These new advancements in agroinfiltration greatly enhance the robustness and scalability of transgene delivery in plants, facilitating the adoption of plant transient expression systems for manufacturing recombinant proteins with a broad range of applications.
Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, one of the most important diseases of wheat worldwide. To identify Pst genes involved in infection and sporulation, a custom oligonucleotide Genechip was made using sequences of 442 genes selected from Pst cDNA libraries. Microarray analy...
Peng, Lu; Wang, Lei; Yang, Yi-Fan; Zou, Ming-Min; He, Wei-Yi; Wang, Yue; Wang, Qing; Vasseur, Liette; You, Min-Sheng
2017-12-30
As a specialized organ, the insect ovary performs valuable functions by ensuring fecundity and population survival. Oogenesis is the complex physiological process resulting in the production of mature eggs, which are involved in epigenetic programming, germ cell behavior, cell cycle regulation, etc. Identification of the genes involved in ovary development and oogenesis is critical to better understand the reproductive biology and screening for the potential molecular targets in Plutella xylostella, a worldwide destructive pest of economically major crops. Based on transcriptome sequencing, a total of 7.88Gb clean nucleotides was obtained, with 19,934 genes and 1861 new transcripts being identified. Expression profiling indicated that 61.7% of the genes were expressed (FPKM≥1) in the P. xylostella ovary. GO annotation showed that the pathways of multicellular organism reproduction and multicellular organism reproduction process, as well as gamete generation and chorion were significantly enriched. Processes that were most likely relevant to reproduction included the spliceosome, ubiquitin mediated proteolysis, endocytosis, PI3K-Akt signaling pathway, insulin signaling pathway, cAMP signaling pathway, and focal adhesion were identified in the top 20 'highly represented' KEGG pathways. Functional genes involved in oogenesis were further analyzed and validated by qRT-PCR to show their potential predominant roles in P. xylostella reproduction. Our newly developed P. xylostella ovary transcriptome provides an overview of the gene expression profiling in this specialized tissue and the functional gene network closely related to the ovary development and oogenesis. This is the first genome-wide transcriptome dataset of P. xylostella ovary that includes a subset of functionally activated genes. This global approach will be the basis for further studies on molecular mechanisms of P. xylostella reproduction aimed at screening potential molecular targets for integrated pest
Lei, Mingguang
2010-11-30
With the exception of root hair development, the role of the phytohormone ethylene is not clear in other aspects of plant responses to inorganic phosphate (Pi) starvation. The induction of AtPT2 was used as a marker to find novel signalling components involved in plant responses to Pi starvation. Using genetic and chemical approaches, we examined the role of ethylene in the regulation of plant responses to Pi starvation. hps2, an Arabidopsis mutant with enhanced sensitivity to Pi starvation, was identified and found to be a new allele of CTR1 that is a key negative regulator of ethylene responses. 1-aminocyclopropane-1-carboxylic acid (ACC), the precursor of ethylene, increases plant sensitivity to Pi starvation, whereas the ethylene perception inhibitor Ag+ suppresses this response. The Pi starvation-induced gene expression and acid phosphatase activity are also enhanced in the hps2 mutant, but suppressed in the ethylene-insensitive mutant ein2-5. By contrast, we found that ethylene signalling plays a negative role in Pi starvation-induced anthocyanin production. These findings extend the roles of ethylene in the regulation of plant responses to Pi starvation and will help us to gain a better understanding of the molecular mechanism underlying these responses. © 2010 The Authors. New Phytologist © 2010 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Qi Bao
2012-01-01
Full Text Available Abstract Background Alteration in gene expression resulting from allopolyploidization is a prominent feature in plants, but its spectrum and extent are not fully known. Common wheat (Triticum aestivum was formed via allohexaploidization about 10,000 years ago, and became the most important crop plant. To gain further insights into the genome-wide transcriptional dynamics associated with the onset of common wheat formation, we conducted microarray-based genome-wide gene expression analysis on two newly synthesized allohexaploid wheat lines with chromosomal stability and a genome constitution analogous to that of the present-day common wheat. Results Multi-color GISH (genomic in situ hybridization was used to identify individual plants from two nascent allohexaploid wheat lines between Triticum turgidum (2n = 4x = 28; genome BBAA and Aegilops tauschii (2n = 2x = 14; genome DD, which had a stable chromosomal constitution analogous to that of common wheat (2n = 6x = 42; genome BBAADD. Genome-wide analysis of gene expression was performed for these allohexaploid lines along with their parental plants from T. turgidum and Ae. tauschii, using the Affymetrix Gene Chip Wheat Genome-Array. Comparison with the parental plants coupled with inclusion of empirical mid-parent values (MPVs revealed that whereas the great majority of genes showed the expected parental additivity, two major patterns of alteration in gene expression in the allohexaploid lines were identified: parental dominance expression and non-additive expression. Genes involved in each of the two altered expression patterns could be classified into three distinct groups, stochastic, heritable and persistent, based on their transgenerational heritability and inter-line conservation. Strikingly, whereas both altered patterns of gene expression showed a propensity of inheritance, identity of the involved genes was highly stochastic, consistent with the involvement of diverse Gene Ontology (GO
Heendeniya, Ravindra G; Yu, Peiqiang
2017-03-20
Alfalfa ( Medicago sativa L.) genotypes transformed with Lc-bHLH and Lc transcription genes were developed with the intention of stimulating proanthocyanidin synthesis in the aerial parts of the plant. To our knowledge, there are no studies on the effect of single-gene and two-gene transformation on chemical functional groups and molecular structure changes in these plants. The objective of this study was to use advanced molecular spectroscopy with multivariate chemometrics to determine chemical functional group intensity and molecular structure changes in alfalfa plants when co-expressing Lc-bHLH and C1-MYB transcriptive flavanoid regulatory genes in comparison with non-transgenic (NT) and AC Grazeland (ACGL) genotypes. The results showed that compared to NT genotype, the presence of double genes ( Lc and C1 ) increased ratios of both the area and peak height of protein structural Amide I/II and the height ratio of α-helix to β-sheet. In carbohydrate-related spectral analysis, the double gene-transformed alfalfa genotypes exhibited lower peak heights at 1370, 1240, 1153, and 1020 cm -1 compared to the NT genotype. Furthermore, the effect of double gene transformation on carbohydrate molecular structure was clearly revealed in the principal component analysis of the spectra. In conclusion, single or double transformation of Lc and C1 genes resulted in changing functional groups and molecular structure related to proteins and carbohydrates compared to the NT alfalfa genotype. The current study provided molecular structural information on the transgenic alfalfa plants and provided an insight into the impact of transgenes on protein and carbohydrate properties and their molecular structure's changes.
Samolski, Ilanit; de Luis, Alberto; Vizcaíno, Juan Antonio; Monte, Enrique; Suárez, M Belén
2009-10-13
for expression studies in other Trichoderma spp. represented on it. Using this microarray, we have been able to define a number of genes probably involved in the transcriptional response of T. harzianum within the first hours of contact with tomato plant roots, which may provide new insights into the mechanisms and roles of this fungus in the Trichoderma-plant interaction.
Investigating the toxicity, uptake, nanoparticle formation and genetic response of plants to gold.
Directory of Open Access Journals (Sweden)
Andrew F Taylor
Full Text Available We have studied the physiological and genetic responses of Arabidopsis thaliana L. (Arabidopsis to gold. The root lengths of Arabidopsis seedlings grown on nutrient agar plates containing 100 mg/L gold were reduced by 75%. Oxidized gold was subsequently found in roots and shoots of these plants, but gold nanoparticles (reduced gold were only observed in the root tissues. We used a microarray-based study to monitor the expression of candidate genes involved in metal uptake and transport in Arabidopsis upon gold exposure. There was up-regulation of genes involved in plant stress response such as glutathione transferases, cytochromes P450, glucosyl transferases and peroxidases. In parallel, our data show the significant down-regulation of a discreet number of genes encoding proteins involved in the transport of copper, cadmium, iron and nickel ions, along with aquaporins, which bind to gold. We used Medicago sativa L. (alfalfa to study nanoparticle uptake from hydroponic culture using ionic gold as a non-nanoparticle control and concluded that nanoparticles between 5 and 100 nm in diameter are not directly accumulated by plants. Gold nanoparticles were only observed in plants exposed to ionic gold in solution. Together, we believe our results imply that gold is taken up by the plant predominantly as an ionic form, and that plants respond to gold exposure by up-regulating genes for plant stress and down-regulating specific metal transporters to reduce gold uptake.
Investigating the Toxicity, Uptake, Nanoparticle Formation and Genetic Response of Plants to Gold
Taylor, Andrew F.; Rylott, Elizabeth L.; Anderson, Christopher W. N.; Bruce, Neil C.
2014-01-01
We have studied the physiological and genetic responses of Arabidopsis thaliana L. (Arabidopsis) to gold. The root lengths of Arabidopsis seedlings grown on nutrient agar plates containing 100 mg/L gold were reduced by 75%. Oxidized gold was subsequently found in roots and shoots of these plants, but gold nanoparticles (reduced gold) were only observed in the root tissues. We used a microarray-based study to monitor the expression of candidate genes involved in metal uptake and transport in Arabidopsis upon gold exposure. There was up-regulation of genes involved in plant stress response such as glutathione transferases, cytochromes P450, glucosyl transferases and peroxidases. In parallel, our data show the significant down-regulation of a discreet number of genes encoding proteins involved in the transport of copper, cadmium, iron and nickel ions, along with aquaporins, which bind to gold. We used Medicago sativa L. (alfalfa) to study nanoparticle uptake from hydroponic culture using ionic gold as a non-nanoparticle control and concluded that nanoparticles between 5 and 100 nm in diameter are not directly accumulated by plants. Gold nanoparticles were only observed in plants exposed to ionic gold in solution. Together, we believe our results imply that gold is taken up by the plant predominantly as an ionic form, and that plants respond to gold exposure by up-regulating genes for plant stress and down-regulating specific metal transporters to reduce gold uptake. PMID:24736522
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Simeonova, Diliana Dancheva; Wilson, Marlena Marie; Metcalf, William W.; Schink, Bernhard
2010-01-01
Desulfotignum phosphitoxidans is a strictly anaerobic, Gram-negative bacterium that utilizes phosphite as the sole electron source for homoacetogenic CO2 reduction or sulfate reduction. A genomic library of D. phosphitoxidans, constructed using the fosmid vector pJK050, was screened for clones harboring the genes involved in phosphite oxidation via PCR using primers developed based on the amino acid sequences of phosphite-induced proteins. Sequence analysis of two positive clones revealed a putative operon of seven genes predicted to be involved in phosphite oxidation. Four of these genes (ptxD-ptdFCG) were cloned and heterologously expressed in Desulfotignum balticum, a related strain that cannot use phosphite as either an electron donor or as a phosphorus source. The ptxD-ptdFCG gene cluster was sufficient to confer phosphite uptake and oxidation ability to the D. balticum host strain but did not allow use of phosphite as an electron donor for chemolithotrophic growth. Phosphite oxidation activity was measured in cell extracts of D. balticum transconjugants, suggesting that all genes required for phosphite oxidation were cloned. Genes of the phosphite gene cluster were assigned putative functions on the basis of sequence analysis and enzyme assays. PMID:20622064
Simeonova, Diliana Dancheva; Wilson, Marlena Marie; Metcalf, William W; Schink, Bernhard
2010-10-01
Desulfotignum phosphitoxidans is a strictly anaerobic, Gram-negative bacterium that utilizes phosphite as the sole electron source for homoacetogenic CO2 reduction or sulfate reduction. A genomic library of D. phosphitoxidans, constructed using the fosmid vector pJK050, was screened for clones harboring the genes involved in phosphite oxidation via PCR using primers developed based on the amino acid sequences of phosphite-induced proteins. Sequence analysis of two positive clones revealed a putative operon of seven genes predicted to be involved in phosphite oxidation. Four of these genes (ptxD-ptdFCG) were cloned and heterologously expressed in Desulfotignum balticum, a related strain that cannot use phosphite as either an electron donor or as a phosphorus source. The ptxD-ptdFCG gene cluster was sufficient to confer phosphite uptake and oxidation ability to the D. balticum host strain but did not allow use of phosphite as an electron donor for chemolithotrophic growth. Phosphite oxidation activity was measured in cell extracts of D. balticum transconjugants, suggesting that all genes required for phosphite oxidation were cloned. Genes of the phosphite gene cluster were assigned putative functions on the basis of sequence analysis and enzyme assays.
Directory of Open Access Journals (Sweden)
Xiangying Wei
2016-10-01
Full Text Available Ericoid mycorrhizal (ERM fungi are specifically symbiotic with plants in the family Ericaceae. Little is known thus far about their symbiotic establishment and subsequent nitrogen (N uptake at the molecular level. The present study devised a system for establishing a symbiotic relationship between Rhododendron fortunei Lindl. and an ERM fungus (Oidiodendron maius var. maius strain Om19, quantified seedling growth and N uptake, and compared transcriptome profiling between colonized and uncolonized roots using RNA-Seq. The Om19 colonization induced 16,892 genes that were differentially expressed in plant roots, of which 14,364 were upregulated and 2,528 were downregulated. These genes included those homologous to ATP-binding cassette transporters, calcium/calmodulin-dependent kinases, and symbiosis receptor-like kinases. N metabolism was particularly active in Om19-colonized roots, and 51 genes were upregulated, such as nitrate transporters, nitrate reductase, nitrite reductase, ammonium transporters, glutamine synthetase, and glutamate synthase. Transcriptome analysis also identified a series of genes involving endocytosis, Fc-gamma R-mediated phagocytosis, glycerophospholipid metabolism, and GnRH signal pathway that have not been reported previously. Their roles in the symbiosis require further investigation. The Om19 colonization significantly increased N uptake and seedling growth. Total N content and dry weight of colonized seedlings were 36.6% and 46.6% greater than control seedlings. This is the first transcriptome analysis of a species from the family Ericaceae colonized by an ERM fungus. The findings from this study will shed light on the mechanisms underlying symbiotic relationships of ericaceous species with ERM fungi and the symbiosis-resultant N uptake and plant growth.
Directory of Open Access Journals (Sweden)
Joachim W Bargsten
Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Dual localized mitochondrial and nuclear proteins as gene expression regulators in plants?
Directory of Open Access Journals (Sweden)
Philippe eGiegé
2012-09-01
Full Text Available Mitochondria heavily depend on the coordinated expression of both mitochondrial and nuclear genomes because some of their most significant activities are held by multi-subunit complexes composed of both mitochondrial and nuclear encoded proteins. Thus, precise communication and signaling pathways are believed to exist between the two compartments. Proteins dual localized to both mitochondria and the nucleus make excellent candidates for a potential involvement in the envisaged communication. Here, we review the identified instances of dual localized nucleo-mitochondrial proteins with an emphasis on plant proteins and discuss their functions, which are seemingly mostly related to gene expression regulation. We discuss whether dual localization could be achieved by dual targeting and / or by re-localization and try to apprehend the signals required for the respective processes. Finally, we propose that in some instances, dual localized mitochondrial and nuclear proteins might act as retrograde signaling molecules for mitochondrial biogenesis.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Keates, Sarah E.; Kostman, Todd A.; Anderson, James D.; Bailey, Bryan A.
2003-01-01
Nep1 is an extracellular fungal protein that causes necrosis when applied to many dicotyledonous plants, including invasive weed species. Using transmission electron microscopy, it was determined that application of Nep1 (1.0 μg mL–1, 0.1% [v/v] Silwet-L77) to Arabidopsis and two invasive weed species, spotted knapweed (Centaurea maculosa) and dandelion (Taraxacum officinale), caused a reduction in the thickness of the cuticle and a breakdown of chloroplasts 1 to 4 h after treatment. Membrane breakdown was most severe in cells closest to the surface of application. Differential display was used to isolate cDNA clones from the three species showing differential expression in response to Nep1 treatment. Differential gene expression was observed for a putative serpin (CmSER-1) and a calmodulin-like (CmCAL-1) protein from spotted knapweed, and a putative protein phosphatase 2C (ToPP2C-1) and cytochrome P-450 (ToCYP-1) protein from dandelion. In addition, differential expression was observed for genes coding for a putative protein kinase (AtPK-1), a homolog (AtWI-12) of wound-induced WI12, a homolog (AtLEA-1) of late embryogenesis abundant LEA-5, a WRKY-18 DNA-binding protein (AtWRKY-18), and a phospholipase D (AtPLD-1) from Arabidopsis. Genes showing elevated mRNA levels in Nep1-treated (5 μg mL–1, 0.1% [v/v] Silwet-L77) leaves 15 min after Nep1 treatment included CmSER-1 and CmCAL-1 for spotted knapweed, ToCYP-1 and CmCAL-1 for dandelion, and AtPK-1, AtWRKY-18, AtWI-12, and AtLEA-1 for Arabidopsis. Levels of mRNA for AtPLD-1 (Arabidopsis) and ToPP2C-1 (dandelion) decreased rapidly in Silwet-l77-treated plants between 15 min and 4 h of treatment, but were maintained or decreased more slowly over time in Nep1-treated (5 μg mL–1, 0.1% [v/v] Silwet-L77) leaves. In general, increases in mRNA band intensities were in the range of two to five times, with only ToCYP-1 in dandelion exceeding an increase of 10 times. The identified genes have been shown to be involved
Directory of Open Access Journals (Sweden)
Wentao Wu
2017-10-01
Full Text Available The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three (Physcomitrella patens to 63 (Glycine max. The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Wu, Wentao; Liu, Yaxue; Wang, Yuqian; Li, Huimin; Liu, Jiaxi; Tan, Jiaxin; He, Jiadai; Bai, Jingwen; Ma, Haoli
2017-10-08
The plant hormone auxin plays pivotal roles in many aspects of plant growth and development. The auxin/indole-3-acetic acid (Aux/IAA) gene family encodes short-lived nuclear proteins acting on auxin perception and signaling, but the evolutionary history of this gene family remains to be elucidated. In this study, the Aux/IAA gene family in 17 plant species covering all major lineages of plants is identified and analyzed by using multiple bioinformatics methods. A total of 434 Aux/IAA genes was found among these plant species, and the gene copy number ranges from three ( Physcomitrella patens ) to 63 ( Glycine max ). The phylogenetic analysis shows that the canonical Aux/IAA proteins can be generally divided into five major clades, and the origin of Aux/IAA proteins could be traced back to the common ancestor of land plants and green algae. Many truncated Aux/IAA proteins were found, and some of these truncated Aux/IAA proteins may be generated from the C-terminal truncation of auxin response factor (ARF) proteins. Our results indicate that tandem and segmental duplications play dominant roles for the expansion of the Aux/IAA gene family mainly under purifying selection. The putative nuclear localization signals (NLSs) in Aux/IAA proteins are conservative, and two kinds of new primordial bipartite NLSs in P. patens and Selaginella moellendorffii were discovered. Our findings not only give insights into the origin and expansion of the Aux/IAA gene family, but also provide a basis for understanding their functions during the course of evolution.
Zhao, Jianfei; Favero, David S; Qiu, Jiwen; Roalson, Eric H; Neff, Michael M
2014-10-14
Members of the ancient land-plant-specific transcription factor AT-Hook Motif Nuclear Localized (AHL) gene family regulate various biological processes. However, the relationships among the AHL genes, as well as their evolutionary history, still remain unexplored. We analyzed over 500 AHL genes from 19 land plant species, ranging from the early diverging Physcomitrella patens and Selaginella to a variety of monocot and dicot flowering plants. We classified the AHL proteins into three types (Type-I/-II/-III) based on the number and composition of their functional domains, the AT-hook motif(s) and PPC domain. We further inferred their phylogenies via Bayesian inference analysis and predicted gene gain/loss events throughout their diversification. Our analyses suggested that the AHL gene family emerged in embryophytes and further evolved into two distinct clades, with Type-I AHLs forming one clade (Clade-A), and the other two types together diversifying in another (Clade-B). The two AHL clades likely diverged before the separation of Physcomitrella patens from the vascular plant lineage. In angiosperms, Clade-A AHLs expanded into 5 subfamilies; while, the ones in Clade-B expanded into 4 subfamilies. Examination of their expression patterns suggests that the AHLs within each clade share similar expression patterns with each other; however, AHLs in one monophyletic clade exhibit distinct expression patterns from the ones in the other clade. Over-expression of a Glycine max AHL PPC domain in Arabidopsis thaliana recapitulates the phenotype observed when over-expressing its Arabidopsis thaliana counterpart. This result suggests that the AHL genes from different land plant species may share conserved functions in regulating plant growth and development. Our study further suggests that such functional conservation may be due to conserved physical interactions among the PPC domains of AHL proteins. Our analyses reveal a possible evolutionary scenario for the AHL gene family
Bioinformatics approach of salt tolerance gene in mangrove plant Rhizophora stylosa
Basyuni, M.; Sumardi
2017-01-01
This study descibes bioinformatics approach on the analyze of the salt tolerance genes in mangrove plant, Rhizophora stylosa on DDBJ/EMBL/GenBank as well as similarity, phylogenetic, potential peptide, and subcellular localization. The DNA sequence between salt tolerance gene from R. stylosa exhibited 42-11% between themselves The target peptide value of mitochondria varied from 0.163 to 0.430, indicated it was possible to exist. These results suggested the importance of understanding the diversity and functional of properties of the different amino acids in mangrove OSC genes. To clarify the relationship among the salt-tolerant genes in R. stylosa, a phylogenetic tree was constructed. The phylogenetic tree shows that there are three clusters, first branch of Cu/Zn SOD and reverse transcriptase genes, the second branch consists of the majority genes and the last group was MAP3K alpha protein kinase only. The present study, therefore, suggested that salt tolerance genes form distinct clusters in the tree.
Cytokinins, A classical multifaceted hormone in plant system
Directory of Open Access Journals (Sweden)
Mohd Mazid
2011-12-01
Full Text Available Today, owing to the versatile functionality and physiological importance of the phytohormone cytokinin (Ck is a major focus of attention in contemporary wide areas of plant science. Cytokinins (Cks have implicated in diverse essential processes of plant growth and development as well as in regulation of key genes responsible for the metabolism and activities of plants. Cytokinin interact in a complex manner to control a myriad of aspects related to growth, development and differentiation and its deficiency also causes pleiotropic developmental changes such as reduced shoot and increased root growth. Cytokinin signaling involves His Kinase receptors that perceive cytokinin and transmit the signal via a multi-step phosphorelay similar to bacterial two-component signaling system. Also, this review present a scheme for homeostatic regulation of endogenous cytokinins level in terms of the described mechanism of cytokinin action including its receptors and steps involved in regulation of gene expression at the post-transcriptional level and its role in whole plant as well as cell division. In addition, we also demonstrate a wide variety of biological effects including those on gene expression, inhibition of auxin action, stimulation of cell cycle etc.
Directory of Open Access Journals (Sweden)
Lenka Záveská Drábková
Full Text Available Callose is a plant-specific polysaccharide (β-1,3-glucan playing an important role in angiosperms in many developmental processes and responses to biotic and abiotic stresses. Callose is synthesised at the plasma membrane of plant cells by callose synthase (CalS and, among others, represents the main polysaccharide in the callose wall surrounding the tetrads of developing microspores and in the growing pollen tube wall. CalS proteins involvement in spore development is a plesiomorphic feature of terrestrial plants, but very little is known about their evolutionary origin and relationships amongst the members of this protein family. We performed thorough comparative analyses of callose synthase family proteins from major plant lineages to determine their evolutionary history across the plant kingdom. A total of 1211 candidate CalS sequences were identified and compared amongst diverse taxonomic groups of plants, from bryophytes to angiosperms. Phylogenetic analyses identified six main clades of CalS proteins and suggested duplications during the evolution of specialised functions. Twelve family members had previously been identified in Arabidopsis thaliana. We focused on five CalS subfamilies directly linked to pollen function and found that proteins expressed in pollen evolved twice. CalS9/10 and CalS11/12 formed well-defined clades, whereas pollen-specific CalS5 was found within subfamilies that mostly did not express in mature pollen vegetative cell, although were found in sperm cells. Expression of five out of seven mature pollen-expressed CalS genes was affected by mutations in bzip transcription factors. Only three subfamilies, CalS5, CalS10, and CalS11, however, formed monophyletic, mostly conserved clades. The pairs CalS9/CalS10, CalS11/CalS12 and CalS3 may have diverged after angiosperms diversified from lycophytes and bryophytes. Our analysis of fully sequenced plant proteins identified new evolutionary lineages of callose synthase
Lebedev, V G; Faskhiev, V N; Kovalenko, N P; Shestibratov, K A; Miroshnikov, A I
2016-01-01
Obtaining herbicide resistant plants is an important task in the genetic engineering of forest trees. Transgenic European aspen plants (Populus tremula L.) expressing the bar gene for phosphinothricin resistance have been produced using Agrobacterium tumefaciens-mediated transformation. Successful genetic transformation was confirmed by PCR analysis for thirteen lines derived from two elite genotypes. In 2014-2015, six lines were evaluated for resistance to herbicide treatment under semi-natural conditions. All selected transgenic lines were resistant to the herbicide Basta at doses equivalent to 10 l/ha (twofold normal field dosage) whereas the control plants died at 2.5 l/ha. Foliar NH4-N concentrations in transgenic plants did not change after treatment. Extremely low temperatures in the third ten-day period of October 2014 revealed differences in freeze tolerance between the lines obtained from Pt of f2 aspen genotypes. Stable expression of the bar gene after overwintering outdoors was confirmed by RT-PCR. On the basis of the tests, four transgenic aspen lines were selected. The bar gene could be used for retransformation of transgenic forest trees expressing valuable traits, such as increased productivity.
Expression of TLP-3 gene without signal peptide in tobacco plants ...
African Journals Online (AJOL)
Administrator
2011-06-06
Jun 6, 2011 ... African Journal of Biotechnology Vol. ... group of plant proteins which accumulate as a result of different types ... across the plasma membranes, the rapid production of ..... transformation and RT-PCR analysis confirm the gene.
Cotton plants export microRNAs to inhibit virulence gene expression in a fungal pathogen.
Zhang, Tao; Zhao, Yun-Long; Zhao, Jian-Hua; Wang, Sheng; Jin, Yun; Chen, Zhong-Qi; Fang, Yuan-Yuan; Hua, Chen-Lei; Ding, Shou-Wei; Guo, Hui-Shan
2016-09-26
Plant pathogenic fungi represent the largest group of disease-causing agents on crop plants, and are a constant and major threat to agriculture worldwide. Recent studies have shown that engineered production of RNA interference (RNAi)-inducing dsRNA in host plants can trigger specific fungal gene silencing and confer resistance to fungal pathogens 1-7 . Although these findings illustrate efficient uptake of host RNAi triggers by pathogenic fungi, it is unknown whether or not such an uptake mechanism has been evolved for a natural biological function in fungus-host interactions. Here, we show that in response to infection with Verticillium dahliae (a vascular fungal pathogen responsible for devastating wilt diseases in many crops) cotton plants increase production of microRNA 166 (miR166) and miR159 and export both to the fungal hyphae for specific silencing. We found that two V. dahliae genes encoding a Ca 2+ -dependent cysteine protease (Clp-1) and an isotrichodermin C-15 hydroxylase (HiC-15), and targeted by miR166 and miR159, respectively, are both essential for fungal virulence. Notably, V. dahliae strains expressing either Clp-1 or HiC-15 rendered resistant to the respective miRNA exhibited drastically enhanced virulence in cotton plants. Together, our findings identify a novel defence strategy of host plants by exporting specific miRNAs to induce cross-kingdom gene silencing in pathogenic fungi and confer disease resistance.
van der Linde, Karina; Doehlemann, Gunther
2013-01-01
While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.
Shukla, Devesh; Krishnamurthy, Sneha; Sahi, Shivendra V
2015-03-01
Very little is known about the genes responsible for Au uptake, reduction and detoxification in plants, which indeed essential to understand the complex trait of AuNP biosynthesis. We designed a targeted experiment to elucidate the response of plant at transcriptional level under Au exposure, and a microarray was performed on root tissue treated with AuCl4 (-) in the absence of nutrient media to record specific gene expression signature. Here, we describe the experimental procedures and data analysis in detail to reproduce the results (available at GEO database under GSE55436) published by Shukla et al. (2014) [1] in the Frontiers in Plant Sciences. The data produced from this study provide significant information of genes which may be used to enhance the AuNP biosynthesis.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Fungi that have the enzymes cyanase and carbonic anhydrase show a limited capacity to detoxify cyanate, a fungicide employed by both plants and humans. Here, we describe a novel two-gene cluster that comprises duplicated cyanase and carbonic anhydrase copies, which we name the CCA gene cluster, trac...
The plant P4-ATPase ALA2 is involved in flipping of phosphatidylserine analogues
DEFF Research Database (Denmark)
Lopez Marques, Rosa Laura
The plant P4-ATPase ALA2 is involved in flipping of phosphatidylserine analogues Rosa Laura López-Marqués1, Lisbeth Rosager Poulsen1, Katharina Meffert2, Thomas Pomorski2, Michael Gjedde Palmgren1 1Centre for Membrane Pumps in Cells and Disease - PUMPKIN, Danish National Research Foundation...... physiological function. 1 Poulsen, L.R; López-Marqués, R.L et al. (2008) The Arabidopsis P4-ATPase ALA3 localizes to the Golgi and requires a ß-subunit to function in lipid translocation and secretory vesicle formation. The Plant Cell, vol. 20, 658-676. 2 Gomès, E. et al. (2000) Chilling tolerance...... in Arabidopsis involves ALA1, a member of a new family of putative aminophospholipid translocases. The Plant Cell, vol. 12, 2441-2453....
The plant P4-ATPase ALA2 is involved in flipping of phosphatidylserine analogues
DEFF Research Database (Denmark)
Poulsen, Lisbeth Rosager
The plant P4-ATPase ALA2 is involved in flipping of phosphatidylserine analogues Rosa Laura López-Marqués1, Lisbeth Rosager Poulsen1, Katharina Meffert2, Thomas Pomorski2, Michael Gjedde Palmgren1 1Centre for Membrane Pumps in Cells and Disease - PUMPKIN, Danish National Research Foundation...... physiological function. 1 Poulsen, L.R; López-Marqués, R.L et al. (2008) The Arabidopsis P4-ATPase ALA3 localizes to the Golgi and requires a ß-subunit to function in lipid translocation and secretory vesicle formation. The Plant Cell, vol. 20, 658-676. 2 Gomès, E. et al. (2000) Chilling tolerance...... in Arabidopsis involves ALA1, a member of a new family of putative aminophospholipid translocases. The Plant Cell, vol. 12, 2441-2453....
Directory of Open Access Journals (Sweden)
Sumit Ghosh
Full Text Available Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS, ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process.
Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis
2013-01-01
Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759
Vimolmangkang, Sornkanok; Han, Yuepeng; Wei, Guochao; Korban, Schuyler S
2013-11-07
Red coloration of fruit is an important trait in apple, and it is mainly attributed to the accumulation of anthocyanins, a class of plant flavonoid metabolites. Anthocyanin biosynthesis is genetically determined by structural and regulatory genes. Plant tissue pigmentation patterns are mainly controlled by expression profiles of regulatory genes. Among these regulatory genes are MYB transcription factors (TFs), wherein the class of two-repeats (R2R3) is deemed the largest, and these are associated with the anthocyanin biosynthesis pathway. Although three MdMYB genes, almost identical in nucleotide sequences, have been identified in apple, it is likely that there are other R2R3 MYB TFs that are present in the apple genome that are also involved in the regulation of coloration of red color pigmentation of the skin of apple fruits. In this study, a novel R2R3 MYB gene has been isolated and characterized in apple. This MYB gene is closely related to the Arabidopsis thaliana AtMYB3, and has been designated as MdMYB3. This TF belongs to the subgroup 4 R2R3 family of plant MYB transcription factors. This apple MdMYB3 gene is mapped onto linkage group 15 of the integrated apple genetic map. Transcripts of MdMYB3 are detected in all analyzed tissues including leaves, flowers, and fruits. However, transcripts of MdMYB3 are higher in excocarp of red-skinned apple cultivars than that in yellowish-green skinned apple cultivars. When this gene is ectopically expressed in Nicotiana tabacum cv. Petite Havana SR1, flowers of transgenic tobacco lines carrying MdMYB3 have exhibited increased pigmentation and accumulate higher levels of anthocyanins and flavonols than wild-type flowers. Overexpression of MdMYB3 has resulted in transcriptional activation of several flavonoid pathway genes, including CHS, CHI, UFGT, and FLS. Moreover, peduncles of flowers and styles of pistils of transgenic plants overexpressing MdMYB3 are longer than those of wild-type plants, thus suggesting that this