Differential recruitment of DNA Ligase I and III to DNA repair sites
Mortusewicz, Oliver; Rothbauer, Ulrich; Cardoso, M. Cristina; Leonhardt, Heinrich
2006-01-01
DNA ligation is an essential step in DNA replication, repair and recombination. Mammalian cells contain three DNA Ligases that are not interchangeable although they use the same catalytic reaction mechanism. To compare the recruitment of the three eukaryotic DNA Ligases to repair sites in vivo we introduced DNA lesions in human cells by laser microirradiation. Time lapse microscopy of fluorescently tagged proteins showed that DNA Ligase III accumulated at microirradiated sites before DNA Ligase I, whereas we could detect only a faint accumulation of DNA Ligase IV. Recruitment of DNA Ligase I and III to repair sites was cell cycle independent. Mutational analysis and binding studies revealed that DNA Ligase I was recruited to DNA repair sites by interaction with PCNA while DNA Ligase III was recruited via its BRCT domain mediated interaction with XRCC1. Selective recruitment of specialized DNA Ligases may have evolved to accommodate the particular requirements of different repair pathways and may thus enhance efficiency of DNA repair. PMID:16855289
Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase
Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.
2014-01-01
Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707
Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.
Odell, M; Shuman, S
1999-05-14
The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.
Comparative analysis of the end-joining activity of several DNA ligases.
Directory of Open Access Journals (Sweden)
Robert J Bauer
Full Text Available DNA ligases catalyze the repair of phosphate backbone breaks in DNA, acting with highest activity on breaks in one strand of duplex DNA. Some DNA ligases have also been observed to ligate two DNA fragments with short complementary overhangs or blunt-ended termini. In this study, several wild-type DNA ligases (phage T3, T4, and T7 DNA ligases, Paramecium bursaria chlorella virus 1 (PBCV1 DNA ligase, human DNA ligase 3, and Escherichia coli DNA ligase were tested for their ability to ligate DNA fragments with several difficult to ligate end structures (blunt-ended termini, 3'- and 5'- single base overhangs, and 5'-two base overhangs. This analysis revealed that T4 DNA ligase, the most common enzyme utilized for in vitro ligation, had its greatest activity on blunt- and 2-base overhangs, and poorest on 5'-single base overhangs. Other ligases had different substrate specificity: T3 DNA ligase ligated only blunt ends well; PBCV1 DNA ligase joined 3'-single base overhangs and 2-base overhangs effectively with little blunt or 5'- single base overhang activity; and human ligase 3 had highest activity on blunt ends and 5'-single base overhangs. There is no correlation of activity among ligases on blunt DNA ends with their activity on single base overhangs. In addition, DNA binding domains (Sso7d, hLig3 zinc finger, and T4 DNA ligase N-terminal domain were fused to PBCV1 DNA ligase to explore whether modified binding to DNA would lead to greater activity on these difficult to ligate substrates. These engineered ligases showed both an increased binding affinity for DNA and increased activity, but did not alter the relative substrate preferences of PBCV1 DNA ligase, indicating active site structure plays a role in determining substrate preference.
Activity-based in vitro selection of T4 DNA ligase
International Nuclear Information System (INIS)
Takahashi, Fumio; Funabashi, Hisakage; Mie, Masayasu; Endo, Yaeta; Sawasaki, Tatsuya; Aizawa, Masuo; Kobatake, Eiry
2005-01-01
Recent in vitro methodologies for selection and directed evolution of proteins have concentrated not only on proteins with affinity such as single-chain antibody but also on enzymes. We developed a display technology for selection of T4 DNA ligase on ribosome because an in vitro selection method for DNA ligase had never been developed. The 3' end of mRNA encoding the gene of active or inactive T4 DNA ligase-spacer peptide fusion protein was hybridized to dsDNA fragments with cohesive ends, the substrate of T4 DNA ligase. After in vitro translation of the mRNA-dsDNA complex in a rabbit reticulocyte system, a mRNA-dsDNA-ribosome-ligase complex was produced. T4 DNA ligase enzyme displayed on a ribosome, through addition of a spacer peptide, is able to react with dsDNA in the complex. The complex expressing active ligase was biotinylated by ligation with another biotinylated dsDNA probe and selected with streptavidin-coated magnetic beads. We effectively selected active T4 DNA ligase from a small amount of protein. The gene of the active T4 DNA ligase was enriched 40 times from a mixture of active and inactive genes using this selection strategy. This ribosomal display strategy may have high potential to be useful for selection of other enzymes associated with DNA
DNA ligase III is involved in a DNA-PK independent pathway of NHEJ in human cells
International Nuclear Information System (INIS)
Wang, H.; Perrault, A.R.; Qin, W.; Wang, H.; Iliakis, G.
2003-01-01
Full text: Double strand breaks (DSB) induced by ionizing radiation (IR) and other cytotoxic agents in the genome of higher eukaryotes are thought to be repaired either by homologous recombination repair (HRR), or non-homologous endjoining (NHEJ). We previously reported the operation of two components of NHEJ in vivo: a DNA-PK dependent component that operates with fast kinetics (D-NHEJ), and a DNA-PK independent component that acts as a backup (basic or B-NHEJ) and operates with kinetics an order of magnitude slower. To gain further insight into the mechanisms of B-NHEJ, we investigated DNA endjoining in extracts 180BR, a human cell line deficient in DNA ligase IV, using an in vitro plasmid-based DNA endjoining assay. An anti DNA ligase III antibody inhibited almost completely DNA endjoining activity in these extracts. On the other hand, an anti DNA ligase I antibody had no measurable effect in DNA endjoining activity. Immunodepletion of DNA ligase III from 180BR cell extracts abolished the DNA endjoining activity, which could be restored by addition of purified human DNA ligase IIIb. Full-length DNA ligase III bound to double stranded DNA and stimulated DNA endjoining in both intermolecular and intramolecular ligation. Furthermore, fractionation of HeLa cell extracts demonstrated the presence of an activity stimulating the function of DNA ligase III. Based on these observations we propose that DNA ligase III is the ligase operating in B-NHEJ
C-terminal region of DNA ligase IV drives XRCC4/DNA ligase IV complex to chromatin
International Nuclear Information System (INIS)
Liu, Sicheng; Liu, Xunyue; Kamdar, Radhika Pankaj; Wanotayan, Rujira; Sharma, Mukesh Kumar; Adachi, Noritaka; Matsumoto, Yoshihisa
2013-01-01
Highlights: •Chromatin binding of XRCC4 is dependent on the presence of DNA ligase IV. •C-terminal region of DNA ligase IV alone can recruit itself and XRCC4 to chromatin. •Two BRCT domains of DNA ligase IV are essential for the chromatin binding of XRCC4. -- Abstract: DNA ligase IV (LIG4) and XRCC4 form a complex to ligate two DNA ends at the final step of DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ). It is not fully understood how these proteins are recruited to DSBs. We recently demonstrated radiation-induced chromatin binding of XRCC4 by biochemical fractionation using detergent Nonidet P-40. In the present study, we examined the role of LIG4 in the recruitment of XRCC4/LIG4 complex to chromatin. The chromatin binding of XRCC4 was dependent on the presence of LIG4. The mutations in two BRCT domains (W725R and W893R, respectively) of LIG4 reduced the chromatin binding of LIG4 and XRCC4. The C-terminal fragment of LIG4 (LIG4-CT) without N-terminal catalytic domains could bind to chromatin with XRCC4. LIG4-CT with W725R or W893R mutation could bind to chromatin but could not support the chromatin binding of XRCC4. The ability of C-terminal region of LIG4 to interact with chromatin might provide us with an insight into the mechanisms of DSB repair through NHEJ
Domain structure of a NHEJ DNA repair ligase from Mycobacterium tuberculosis.
Pitcher, Robert S; Tonkin, Louise M; Green, Andrew J; Doherty, Aidan J
2005-08-19
A prokaryotic non-homologous end-joining (NHEJ) system for the repair of DNA double-strand breaks (DSBs), composed of a Ku homodimer (Mt-Ku) and a multidomain multifunctional ATP-dependent DNA ligase (Mt-Lig), has been described recently in Mycobacterium tuberculosis. Mt-Lig exhibits polymerase and nuclease activity in addition to DNA ligation activity. These functions were ascribed to putative polymerase, nuclease and ligase domains that together constitute a monomeric protein. Here, the separate polymerase, nuclease and ligase domains of Mt-Lig were cloned individually, over-expressed and the soluble proteins purified to homogeneity. The polymerase domain demonstrated DNA-dependent RNA primase activity, catalysing the synthesis of unprimed oligoribonucleotides on single-stranded DNA templates. The polymerase domain can also extend DNA in a template-dependent manner. This activity was eliminated when the catalytic aspartate residues were replaced with alanine. The ligase domain catalysed the sealing of nicked double-stranded DNA designed to mimic a DSB, consistent with the role of Mt-Lig in NHEJ. Deletion of the active-site lysine residue prevented the formation of an adenylated ligase complex and consequently thwarted ligation. The nuclease domain did not function independently as a 3'-5' exonuclease. DNA-binding assays revealed that both the polymerase and ligase domains bind DNA in vitro, the latter with considerably higher affinity. Mt-Ku directly stimulated the polymerase and nuclease activities of Mt-Lig. The polymerase domain bound Mt-Ku in vitro, suggesting it may recruit Mt-Lig to Ku-bound DNA in vivo. Consistent with these data, Mt-Ku stimulated the primer extension activity of the polymerase domain, suggestive of a functional interaction relevant to NHEJ-mediated DSB repair processes.
Samai, Poulami; Shuman, Stewart
2011-01-01
Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3′-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3′-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3′-OH nucleoside in the catalysis of DNA 5′-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig. PMID:21335605
Samai, Poulami; Shuman, Stewart
2011-04-15
Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3'-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3'-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3'-OH nucleoside in the catalysis of DNA 5'-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig.
Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining
Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom
2015-01-01
Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724
Schär, Primo; Herrmann, Gernot; Daly, Graham; Lindahl, Tomas
1997-01-01
Eukaryotic DNA ligases are ATP-dependent DNA strand-joining enzymes that participate in DNA replication, repair, and recombination. Whereas mammalian cells contain several different DNA ligases, encoded by at least three distinct genes, only one DNA ligase has been detected previously in either budding yeast or fission yeast. Here, we describe a newly identified nonessential Saccharomyces cerevisiae gene that encodes a DNA ligase distinct from the CDC9 gene product. This DNA ligase shares significant amino acid sequence homology with human DNA ligase IV; accordingly, we designate the yeast gene LIG4. Recombinant LIG4 protein forms a covalent enzyme-AMP complex and can join a DNA single-strand break in a DNA/RNA hybrid duplex, the preferred substrate in vitro. Disruption of the LIG4 gene causes only marginally increased cellular sensitivity to several DNA damaging agents, and does not further sensitize cdc9 or rad52 mutant cells. In contrast, lig4 mutant cells have a 1000-fold reduced capacity for correct recircularization of linearized plasmids by illegitimate end-joining after transformation. Moreover, homozygous lig4 mutant diploids sporulate less efficiently than isogenic wild-type cells, and show retarded progression through meiotic prophase I. Spore viability is normal, but lig4 mutants appear to produce a higher proportion of tetrads with only three viable spores. The mutant phenotypes are consistent with functions of LIG4 in an illegitimate DNA end-joining pathway and ensuring efficient meiosis. PMID:9271115
Yang, S W; Becker, F F; Chan, J Y
1990-10-25
DNA ligases play obligatory roles during replication, repair, and recombination. Multiple forms of DNA ligase have been reported in mammalian cells including DNA ligase I, the high molecular mass species which functions during replication, and DNA ligase II, the low molecular mass species which is associated with repair. In addition, alterations in DNA ligase activities have been reported in acute lymphocytic leukemia cells, Bloom's syndrome cells, and cells undergoing differentiation and development. To better distinguish the biochemical and molecular properties of the various DNA ligases from human cells, we have developed a method of purifying multiple species of DNA ligase from HeLa cells by chromatography through DEAE-Bio-Gel, CM-Bio-Gel, hydroxylapatite, Sephacryl S-300, Mono P, and DNA-cellulose. DNA-cellulose chromatography of the partially purified enzymes resolved multiple species of DNA ligase after labeling the enzyme with [alpha-32P]ATP to form the ligase-[32P]AMP adduct. The early eluting enzyme activity (0.25 M NaCl) contained a major 67-kDa-labeled protein, while the late eluting activity (0.48 M NaCl) contained two major labeled proteins of 90 and 78 kDa. Neutralization experiments with antiligase I antibodies indicated that the early and late eluting activity peaks were DNA ligase II and I, respectively. The three major ligase-[32P]AMP polypeptides (90, 78, and 67 kDa) were subsequently purified to near homogeneity by elution from preparative sodium dodecyl sulfate-polyacrylamide gels. All three polypeptides retained DNA ligase activities after gel elution and renaturation. To further reveal the relationship between these enzymes, partial digestion by V8-protease was performed. All three purified polypeptides gave rise to a common 22-kDa-labeled fragment for their AMP-binding domains, indicating that the catalytic sites of ligase I and II are quite similar, if not identical. Similar findings were obtained from the two-dimensional gel
DEFF Research Database (Denmark)
Zhao, A.; Gray, F. C; MacNeill, S. A.
2006-01-01
DNA ligases join the ends of DNA molecules during replication, repair and recombination. ATP-dependent ligases are found predominantly in the eukarya and archaea whereas NAD+-dependent DNA ligases are found only in the eubacteria and in entomopoxviruses. Using the genetically tractable halophile....... volcanii also encodes an NAD+-dependent DNA ligase family member, LigN, the first such enzyme to be identified in the archaea, and present phylogenetic analysis indicating that the gene encoding this protein has been acquired by lateral gene transfer (LGT) from eubacteria. As with LigA, we show that Lig...
Qing, Taiping; He, Xiaoxiao; He, Dinggeng; Ye, Xiaosheng; Shangguan, Jingfang; Liu, Jinquan; Yuan, Baoyin; Wang, Kemin
2017-08-15
DNA repair processes are responsible for maintaining genome stability. Ligase and polynucleotide kinase (PNK) have important roles in ligase-mediated DNA repair. The development of analytical methods to monitor these enzymes involved in DNA repair pathways is of great interest in biochemistry and biotechnology. In this work, we reported a new strategy for label-free monitoring PNK and ligase activity by using dumbbell-shaped DNA templated copper nanoparticles (CuNPs). In the presence of PNK and ligase, the dumbbell-shaped DNA probe (DP) was locked and could resist the digestion of exonucleases and then served as an efficient template for synthesizing fluorescent CuNPs. However, in the absence of ligase or PNK, the nicked DP could be digested by exonucleases and failed to template fluorescent CuNPs. Therefore, the fluorescence changes of CuNPs could be used to evaluate these enzymes activity. Under the optimal conditions, highly sensitive detection of ligase activity of about 1U/mL and PNK activity down to 0.05U/mL is achieved. To challenge the practical application capability of this strategy, the detection of analyte in dilute cells extracts was also investigated and showed similar linear relationships. In addition to ligase and PNK, this sensing strategy was also extended to the detection of phosphatase, which illustrates the versatility of this strategy. Copyright © 2017 Elsevier B.V. All rights reserved.
Repair of potentially lethal damage by introduction of T4 DNA ligase in eucaryotic cells
International Nuclear Information System (INIS)
Durante, M.; Grossi, G.F.; Napolitano, M.; Gialanella, G.
1991-01-01
The bacterial enzyme PvuII, which generates blunt-ended DNA double-strand breaks, and T4 DNA ligase, which seals adjacent DNA fragments in coupling to ATP cleavage, were introduced in mouse C3H10T1/2 fibroblasts using osmolytic shock of pinocytic vesicles. Cells were then assayed for their clonogenic ability. In agreement with previous studies by others, the authors found that PvuII restriction endonuclease simulates ionizing radiation effects by causing a dose-dependent loss of reproductive capacity. They show that concomitant treatment with DNA ligase considerably increases cell survival. Survival curves were shown to be dependent on ligase enzyme dose and on ATP concentration in the hypertonic medium. They conclude that T4 DNA ligase is able to repair some potentially lethal damage produced by restriction endonucleases in eucaryotic cells. (author)
Ubiquitin ligase activity of TFIIH and the transcriptional response to DNA damage.
Takagi, Yuichiro; Masuda, Claudio A; Chang, Wei-Hau; Komori, Hirofumi; Wang, Dong; Hunter, Tony; Joazeiro, Claudio A P; Kornberg, Roger D
2005-04-15
Core transcription factor (TF) IIH purified from yeast possesses an E3 ubiquitin (Ub) ligase activity, which resides, at least in part, in a RING finger (RNF) domain of the Ssl1 subunit. Yeast strains mutated in the Ssl1 RNF domain are sensitive to ultraviolet (UV) light and to methyl methanesulfonate (MMS). This increased sensitivity to DNA-damaging agents does not reflect a deficiency in nucleotide excision repair. Rather, it correlates with reduced transcriptional induction of genes involved in DNA repair, suggesting that the E3 Ub ligase activity of TFIIH mediates the transcriptional response to DNA damage.
Bhattarai, Hitesh; Gupta, Richa; Glickman, Michael S
2014-10-01
Nonhomologous end joining (NHEJ) is a recently described bacterial DNA double-strand break (DSB) repair pathway that has been best characterized for mycobacteria. NHEJ can religate transformed linear plasmids, repair ionizing radiation (IR)-induced DSBs in nonreplicating cells, and seal I-SceI-induced chromosomal DSBs. The core components of the mycobacterial NHEJ machinery are the DNA end binding protein Ku and the polyfunctional DNA ligase LigD. LigD has three autonomous enzymatic modules: ATP-dependent DNA ligase (LIG), DNA/RNA polymerase (POL), and 3' phosphoesterase (PE). Although genetic ablation of ku or ligD abolishes NHEJ and sensitizes nonreplicating cells to ionizing radiation, selective ablation of the ligase activity of LigD in vivo only mildly impairs NHEJ of linearized plasmids, indicating that an additional DNA ligase can support NHEJ. Additionally, the in vivo role of the POL and PE domains in NHEJ is unclear. Here we define a LigD ligase-independent NHEJ pathway in Mycobacterium smegmatis that requires the ATP-dependent DNA ligase LigC1 and the POL domain of LigD. Mycobacterium tuberculosis LigC can also support this backup NHEJ pathway. We also demonstrate that, although dispensable for efficient plasmid NHEJ, the activities of the POL and PE domains are required for repair of IR-induced DSBs in nonreplicating cells. These findings define the genetic requirements for a LigD-independent NHEJ pathway in mycobacteria and demonstrate that all enzymatic functions of the LigD protein participate in NHEJ in vivo. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.
Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C
2016-01-29
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Luteijn, Rutger David; Drexler, Ingo; Smith, Geoffrey L; Lebbink, Robert Jan; Wiertz, Emmanuel J H J
2018-04-20
Poxviruses comprise a group of large dsDNA viruses that include members relevant to human and animal health, such as variola virus, monkeypox virus, cowpox virus and vaccinia virus (VACV). Poxviruses are remarkable for their unique replication cycle, which is restricted to the cytoplasm of infected cells. The independence from the host nucleus requires poxviruses to encode most of the enzymes involved in DNA replication, transcription and processing. Here, we use the CRISPR/Cas9 genome engineering system to induce DNA damage to VACV (strain Western Reserve) genomes. We show that targeting CRISPR/Cas9 to essential viral genes limits virus replication efficiently. Although VACV is a strictly cytoplasmic pathogen, we observed extensive viral genome editing at the target site; this is reminiscent of a non-homologous end-joining DNA repair mechanism. This pathway was not dependent on the viral DNA ligase, but critically involved the cellular DNA ligase IV. Our data show that DNA ligase IV can act outside of the nucleus to allow repair of dsDNA breaks in poxvirus genomes. This pathway might contribute to the introduction of mutations within the genome of poxviruses and may thereby promote the evolution of these viruses.
Energy Technology Data Exchange (ETDEWEB)
Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.
2009-05-11
The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.
Last stop on the road to repair: structure of E. coli DNA ligase bound to nicked DNA-adenylate.
Nandakumar, Jayakrishnan; Nair, Pravin A; Shuman, Stewart
2007-04-27
NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria and essential for growth. Their distinctive substrate specificity and domain organization vis-a-vis human ATP-dependent ligases make them outstanding targets for anti-infective drug discovery. We report here the 2.3 A crystal structure of Escherichia coli LigA bound to an adenylylated nick, which captures LigA in a state poised for strand closure and reveals the basis for nick recognition. LigA envelopes the DNA within a protein clamp. Large protein domain movements and remodeling of the active site orchestrate progression through the three chemical steps of the ligation reaction. The structure inspires a strategy for inhibitor design.
DEFF Research Database (Denmark)
Poidevin, L.; MacNeill, S. A.
2006-01-01
Background DNA ligases are required for DNA strand joining in all forms of cellular life. NAD+-dependent DNA ligases are found primarily in eubacteria but also in some eukaryotic viruses, bacteriophage and archaea. Among the archaeal NAD+-dependent DNA ligases is the LigN enzyme of the halophilic...
Novel inhibitor of DNA ligase IV with a promising cancer therapeutic ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences; Volume 39; Issue 3. Novel inhibitor of DNA ligase IV with a promising cancer therapeutic potential. Ashwin Kotnis Rita Mulherkar. Clipboards Volume 39 Issue 3 June 2014 pp 339-340. Fulltext. Click here to view fulltext PDF. Permanent link:
International Nuclear Information System (INIS)
Strike, P.
1977-01-01
Toluene treated cells have been used to study the processes of DNA synthesis and DNA degradation in ultra-violet irradiated Escherichia coli K12. Synthesis and degradation are both shown to occur extensively if polynucleotide ligase is inhibited, and to occur to a much lesser extent if ligase activity is optimal. Extensive UV-induced DNA synthesis in toluene-treated cells requires ATP for the initial incision step, and DNA polymerase I. Extensive degradation also depends on the early ATP-dependent incision step, and the subsequent degradation shows a partial requirement for ATP. Curtailment of degradation by ligase requires DNA polymerase activity, but is not dependent upon DNA polymerase I. Apparently this process can be carried out with equal facility by either DNA polymerase II or polymerase III. These observations suggest that extensive DNA polymerase I-dependent repair synthesis and extensive DNA degradation are facets of two divergent pathways of excision repair, both of which depend upon the early uvrABC determined ATP-dependent incision step. (orig.) [de
Dantuma, Nico P; Pfeiffer, Annika
2016-01-01
Ubiquitin and the ubiquitin-like modifier SUMO are intimately connected with the cellular response to various types of DNA damage. A striking feature is the local accumulation of these proteinaceous post-translational modifications in the direct vicinity to DNA double-strand breaks, which plays a critical role in the formation of ionizing radiation-induced foci. The functional significance of these modifications is the coordinated recruitment and removal of proteins involved in DNA damage signaling and repair in a timely manner. The central orchestrators of these processes are the ubiquitin and SUMO ligases that are responsible for accurately tagging a broad array of chromatin and chromatin-associated proteins thereby changing their behavior or destination. Despite many differences in the mode of action of these enzymes, they share some striking features that are of direct relevance for their function in the DNA damage response. In this review, we outline the molecular mechanisms that are responsible for the recruitment of ubiquitin and SUMO ligases and discuss the importance of chromatin proximity in this process.
Structure-function analysis of the OB and latch domains of chlorella virus DNA ligase.
Samai, Poulami; Shuman, Stewart
2011-06-24
Chlorella virus DNA ligase (ChVLig) is a minimized eukaryal ATP-dependent DNA sealing enzyme with an intrinsic nick-sensing function. ChVLig consists of three structural domains, nucleotidyltransferase (NTase), OB-fold, and latch, that envelop the nicked DNA as a C-shaped protein clamp. The OB domain engages the DNA minor groove on the face of the duplex behind the nick, and it makes contacts to amino acids in the NTase domain surrounding the ligase active site. The latch module occupies the DNA major groove flanking the nick. Residues at the tip of the latch contact the NTase domain to close the ligase clamp. Here we performed a structure-guided mutational analysis of the OB and latch domains. Alanine scanning defined seven individual amino acids as essential in vivo (Lys-274, Arg-285, Phe-286, and Val-288 in the OB domain; Asn-214, Phe-215, and Tyr-217 in the latch), after which structure-activity relations were clarified by conservative substitutions. Biochemical tests of the composite nick sealing reaction and of each of the three chemical steps of the ligation pathway highlighted the importance of Arg-285 and Phe-286 in the catalysis of the DNA adenylylation and phosphodiester synthesis reactions. Phe-286 interacts with the nick 5'-phosphate nucleotide and the 3'-OH base pair and distorts the DNA helical conformation at the nick. Arg-285 is a key component of the OB-NTase interface, where it forms a salt bridge to the essential Asp-29 side chain, which is imputed to coordinate divalent metal catalysts during the nick sealing steps.
Structure-Function Analysis of the OB and Latch Domains of Chlorella Virus DNA Ligase*
Samai, Poulami; Shuman, Stewart
2011-01-01
Chlorella virus DNA ligase (ChVLig) is a minimized eukaryal ATP-dependent DNA sealing enzyme with an intrinsic nick-sensing function. ChVLig consists of three structural domains, nucleotidyltransferase (NTase), OB-fold, and latch, that envelop the nicked DNA as a C-shaped protein clamp. The OB domain engages the DNA minor groove on the face of the duplex behind the nick, and it makes contacts to amino acids in the NTase domain surrounding the ligase active site. The latch module occupies the DNA major groove flanking the nick. Residues at the tip of the latch contact the NTase domain to close the ligase clamp. Here we performed a structure-guided mutational analysis of the OB and latch domains. Alanine scanning defined seven individual amino acids as essential in vivo (Lys-274, Arg-285, Phe-286, and Val-288 in the OB domain; Asn-214, Phe-215, and Tyr-217 in the latch), after which structure-activity relations were clarified by conservative substitutions. Biochemical tests of the composite nick sealing reaction and of each of the three chemical steps of the ligation pathway highlighted the importance of Arg-285 and Phe-286 in the catalysis of the DNA adenylylation and phosphodiester synthesis reactions. Phe-286 interacts with the nick 5′-phosphate nucleotide and the 3′-OH base pair and distorts the DNA helical conformation at the nick. Arg-285 is a key component of the OB-NTase interface, where it forms a salt bridge to the essential Asp-29 side chain, which is imputed to coordinate divalent metal catalysts during the nick sealing steps. PMID:21527793
The DNA repair capability of cdc9, the saccharomyces cerevisiae mutant defective in DNA ligase
International Nuclear Information System (INIS)
Johnston, L.H.
1979-01-01
The cell cycle mutant, cdc9, in the yeast Saccharomyces cerevisiae is defective in DNA ligase with the consequence to be deficient in the repair of DNA damaged by methyl methane sulphonate. On the other hand survival of cdc9 after irradiation by γ-rays is little different from that of the wild-type, even after a period of stress at the restrictive temperature. The mutant cdc9 is not allelic with any known rad or mms mutants. (orig./AJ) [de
SUMO E3 ligase Mms21 prevents spontaneous DNA damage induced genome rearrangements.
Directory of Open Access Journals (Sweden)
Jason Liang
2018-03-01
Full Text Available Mms21, a subunit of the Smc5/6 complex, possesses an E3 ligase activity for the Small Ubiquitin-like MOdifier (SUMO. Here we show that the mms21-CH mutation, which inactivates Mms21 ligase activity, causes increased accumulation of gross chromosomal rearrangements (GCRs selected in the dGCR assay. These dGCRs are formed by non-allelic homologous recombination between divergent DNA sequences mediated by Rad52-, Rrm3- and Pol32-dependent break-induced replication. Combining mms21-CH with sgs1Δ caused a synergistic increase in GCRs rates, indicating the distinct roles of Mms21 and Sgs1 in suppressing GCRs. The mms21-CH mutation also caused increased rates of accumulating uGCRs mediated by breakpoints in unique sequences as revealed by whole genome sequencing. Consistent with the accumulation of endogenous DNA lesions, mms21-CH mutants accumulate increased levels of spontaneous Rad52 and Ddc2 foci and had a hyper-activated DNA damage checkpoint. Together, these findings support that Mms21 prevents the accumulation of spontaneous DNA lesions that cause diverse GCRs.
Gul, Sheraz; Brown, Richard; May, Earl; Mazzulla, Marie; Smyth, Martin G; Berry, Colin; Morby, Andrew; Powell, David J
2004-11-01
DNA ligases are key enzymes involved in the repair and replication of DNA. Prokaryotic DNA ligases uniquely use NAD+ as the adenylate donor during catalysis, whereas eukaryotic enzymes use ATP. This difference in substrate specificity makes the bacterial enzymes potential targets for therapeutic intervention. We have developed a homogeneous chemiluminescence-based hybridization protection assay for Staphylococcus aureus DNA ligase that uses novel acridinium ester technology and demonstrate that it is an alternative to the commonly used radiometric assays for ligases. The assay has been used to determine a number of kinetic constants for S. aureus DNA ligase catalysis. These included the K(m) values for NAD+ (2.75+/-0.1 microM) and the acridinium-ester-labelled DNA substrate (2.5+/-0.2 nM). A study of the pH-dependencies of kcat, K(m) and kcat/K(m) has revealed values of kinetically influential ionizations within the enzyme-substrate complexes (kcat) and free enzyme (kcat/K(m)). In each case, the curves were shown to be composed of one kinetically influential ionization, for k(cat), pK(a)=6.6+/-0.1 and kcat/K(m), pK(a)=7.1+/-0.1. Inhibition characteristics of the enzyme against two Escherichia coli DNA ligase inhibitors have also been determined with IC50 values for these being 3.30+/-0.86 microM for doxorubicin and 1.40+/-0.07 microM for chloroquine diphosphate. The assay has also been successfully miniaturized to a sufficiently low volume to allow it to be utilized in a high-throughput screen (384-well format; 20 microl reaction volume), enabling the assay to be used in screening campaigns against libraries of compounds to discover leads for further drug development.
Directory of Open Access Journals (Sweden)
Scott Cukras
Full Text Available Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.
Cukras, Scott; Morffy, Nicholas; Ohn, Takbum; Kee, Younghoon
2014-01-01
Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.
Singh, Vijai; Somvanshi, Pallavi
2010-02-01
DNA ligase is an important enzyme and it plays vital role in the replication and repair; also catalyzes nick joining between adjacent bases of DNA. The NAD(+) dependent DNA ligase is selectively present in eubacteria and few viruses; but missing in humans. Homology modeling was used to generate 3-D structure of NAD(+) dependent DNA ligase (LigA) of Mycobacterium tuberculosis using the known template (PDB: 2OWO). Furthermore, the stereochemical quality and torsion angle of 3-D structure was validated. Numerous effective drugs were selected and the active amino acid residue in LigA was targeted and virtual screening through molecular docking was done. In this analysis, four drugs Chloroquine, Hydroxychloroquine, Putrienscine and Adriamycin were found more potent in inhibition of M. tuberculosis through the robust binding affinity between protein-drug interactions in comparison with the other studied drugs. A phylogenetic tree was constructed and it was observed that homology of LigA in M. tuberculosis resembled with other Mycobacterium species. The conserved active amino acids of LigA may be useful to target these drugs. These findings could be used as the starting point of a rational design of novel antibacterial drugs and its analogs.
DEFF Research Database (Denmark)
Akbari, Mansour; Keijzers, Guido; Maynard, Scott
2014-01-01
slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I...
Escape from Telomere-Driven Crisis Is DNA Ligase III Dependent
Directory of Open Access Journals (Sweden)
Rhiannon E. Jones
2014-08-01
Full Text Available Short dysfunctional telomeres are capable of fusion, generating dicentric chromosomes and initiating breakage-fusion-bridge cycles. Cells that escape the ensuing cellular crisis exhibit large-scale genomic rearrangements that drive clonal evolution and malignant progression. We demonstrate that there is an absolute requirement for fully functional DNA ligase III (LIG3, but not ligase IV (LIG4, to facilitate the escape from a telomere-driven crisis. LIG3- and LIG4-dependent alternative (A and classical (C nonhomologous end-joining (NHEJ pathways were capable of mediating the fusion of short dysfunctional telomeres, both displaying characteristic patterns of microhomology and deletion. Cells that failed to escape crisis exhibited increased proportions of C-NHEJ-mediated interchromosomal fusions, whereas those that escaped displayed increased proportions of intrachromosomal fusions. We propose that the balance between inter- and intrachromosomal telomere fusions dictates the ability of human cells to escape crisis and is influenced by the relative activities of A- and C-NHEJ at short dysfunctional telomeres.
Wang, Li Kai; Zhu, Hui; Shuman, Stewart
2009-03-27
NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria, where they are essential for growth and present attractive targets for antimicrobial drug discovery. LigA has a distinctive modular structure in which a nucleotidyltransferase catalytic domain is flanked by an upstream NMN-binding module and by downstream OB-fold, zinc finger, helix-hairpin-helix, and BRCT domains. Here we conducted a structure-function analysis of the nucleotidyltransferase domain of Escherichia coli LigA, guided by the crystal structure of the LigA-DNA-adenylate intermediate. We tested the effects of 29 alanine and conservative mutations at 15 amino acids on ligase activity in vitro and in vivo. We thereby identified essential functional groups that coordinate the reactive phosphates (Arg(136)), contact the AMP adenine (Lys(290)), engage the phosphodiester backbone flanking the nick (Arg(218), Arg(308), Arg(97) plus Arg(101)), or stabilize the active domain fold (Arg(171)). Finer analysis of the mutational effects revealed step-specific functions for Arg(136), which is essential for the reaction of LigA with NAD(+) to form the covalent ligase-AMP intermediate (step 1) and for the transfer of AMP to the nick 5'-PO(4) to form the DNA-adenylate intermediate (step 2) but is dispensable for phosphodiester formation at a preadenylylated nick (step 3).
The BRCA1 Ubiquitin ligase function sets a new trend for remodelling in DNA repair.
Densham, Ruth M; Morris, Joanna R
2017-03-04
The protein product of the breast and ovarian cancer gene, BRCA1, is part of an obligate heterodimer with BARD1. Together these RING bearing proteins act as an E3 ubiquitin ligase. Several functions have been attributed to BRCA1 that contribute to genome integrity but which of these, if any, require this enzymatic function was unclear. Here we review recent studies clarifying the role of BRCA1 E3 ubiquitin ligase in DNA repair. Perhaps the most surprising finding is the narrow range of BRCA1 functions this activity relates to. Remarkably ligase activity promotes chromatin remodelling and 53BP1 positioning through the remodeller SMARCAD1, but the activity is dispensable for the cellular survival in response to cisplatin or replication stressing agents. Implications for therapy response and tumor susceptibility are discussed.
Taylor, Mark R; Conrad, John A; Wahl, Daniel; O'Brien, Patrick J
2011-07-01
DNA ligase I (LIG1) catalyzes the ligation of single-strand breaks to complete DNA replication and repair. The energy of ATP is used to form a new phosphodiester bond in DNA via a reaction mechanism that involves three distinct chemical steps: enzyme adenylylation, adenylyl transfer to DNA, and nick sealing. We used steady state and pre-steady state kinetics to characterize the minimal mechanism for DNA ligation catalyzed by human LIG1. The ATP dependence of the reaction indicates that LIG1 requires multiple Mg(2+) ions for catalysis and that an essential Mg(2+) ion binds more tightly to ATP than to the enzyme. Further dissection of the magnesium ion dependence of individual reaction steps revealed that the affinity for Mg(2+) changes along the reaction coordinate. At saturating concentrations of ATP and Mg(2+) ions, the three chemical steps occur at similar rates, and the efficiency of ligation is high. However, under conditions of limiting Mg(2+), the nick-sealing step becomes rate-limiting, and the adenylylated DNA intermediate is prematurely released into solution. Subsequent adenylylation of enzyme prevents rebinding to the adenylylated DNA intermediate comprising an Achilles' heel of LIG1. These ligase-generated 5'-adenylylated nicks constitute persistent breaks that are a threat to genomic stability if they are not repaired. The kinetic and thermodynamic framework that we have determined for LIG1 provides a starting point for understanding the mechanism and specificity of mammalian DNA ligases.
Directory of Open Access Journals (Sweden)
David G Nickens
Full Text Available BACKGROUND: In vitro selection of kinase ribozymes for small molecule metabolites, such as free nucleosides, will require partition systems that discriminate active from inactive RNA species. While nucleic acid catalysis of phosphoryl transfer is well established for phosphorylation of 5' or 2' OH of oligonucleotide substrates, phosphorylation of diffusible small molecules has not been demonstrated. METHODOLOGY/PRINCIPAL FINDINGS: This study demonstrates the ability of T4 DNA ligase to capture RNA strands in which a tethered monodeoxynucleoside has acquired a 5' phosphate. The ligation reaction therefore mimics the partition step of a selection for nucleoside kinase (deoxyribozymes. Ligation with tethered substrates was considerably slower than with nicked, fully duplex DNA, even though the deoxynucleotides at the ligation junction were Watson-Crick base paired in the tethered substrate. Ligation increased markedly when the bridging template strand contained unpaired spacer nucleotides across from the flexible tether, according to the trends: A(2>A(1>A(3>A(4>A(0>A(6>A(8>A(10 and T(2>T(3>T(4>T(6 approximately T(1>T(8>T(10. Bridging T's generally gave higher yield of ligated product than bridging A's. ATP concentrations above 33 microM accumulated adenylated intermediate and decreased yields of the gap-sealed product, likely due to re-adenylation of dissociated enzyme. Under optimized conditions, T4 DNA ligase efficiently (>90% joined a correctly paired, or TratioG wobble-paired, substrate on the 3' side of the ligation junction while discriminating approximately 100-fold against most mispaired substrates. Tethered dC and dG gave the highest ligation rates and yields, followed by tethered deoxyinosine (dI and dT, with the slowest reactions for tethered dA. The same kinetic trends were observed in ligase-mediated capture in complex reaction mixtures with multiple substrates. The "universal" analog 5-nitroindole (dNI did not support ligation when
Ferry, Laure; Fournier, Alexandra; Tsusaka, Takeshi; Adelmant, Guillaume; Shimazu, Tadahiro; Matano, Shohei; Kirsh, Olivier; Amouroux, Rachel; Dohmae, Naoshi; Suzuki, Takehiro; Filion, Guillaume J; Deng, Wen; de Dieuleveult, Maud; Fritsch, Lauriane; Kudithipudi, Srikanth; Jeltsch, Albert; Leonhardt, Heinrich; Hajkova, Petra; Marto, Jarrod A; Arita, Kyohei; Shinkai, Yoichi; Defossez, Pierre-Antoine
2017-08-17
DNA methylation is an essential epigenetic mark in mammals that has to be re-established after each round of DNA replication. The protein UHRF1 is essential for this process; it has been proposed that the protein targets newly replicated DNA by cooperatively binding hemi-methylated DNA and H3K9me2/3, but this model leaves a number of questions unanswered. Here, we present evidence for a direct recruitment of UHRF1 by the replication machinery via DNA ligase 1 (LIG1). A histone H3K9-like mimic within LIG1 is methylated by G9a and GLP and, compared with H3K9me2/3, more avidly binds UHRF1. Interaction with methylated LIG1 promotes the recruitment of UHRF1 to DNA replication sites and is required for DNA methylation maintenance. These results further elucidate the function of UHRF1, identify a non-histone target of G9a and GLP, and provide an example of a histone mimic that coordinates DNA replication and DNA methylation maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.
RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.
Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook
2017-08-01
Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].
Energy Technology Data Exchange (ETDEWEB)
Li, Weiwei; Gu, Xueyan; Zhang, Xiaoning; Kong, Jinxin [Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000 (China); Ding, Nan [Gansu Key laboratory of Space Radiobiology, Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Qi, Yongmei; Zhang, Yingmei [Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000 (China); Wang, Jufang [Gansu Key laboratory of Space Radiobiology, Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Huang, Dejun, E-mail: huangdj@lzu.edu.cn [Gansu Key Laboratory of Biomonitoring and Bioremediation for Environmental Pollution, School of Life Sciences, Lanzhou University, Lanzhou 730000 (China)
2015-09-15
Highlights: • Cadmium (Cd) exposure delayed the repair of DNA damage induced by X-ray. • Cd exposure altered the phosphorylation of DNA-PKcs on Thr-2609 and Ser-2056 sites. • Cd impaired the formation of XRCC4 and Ligase IV foci, and down-regulated their protein expression. • Zinc mitigated the effects of Cd on DDR by regulating pDNA-PKcs (Thr-2609), XRCC4 and Ligase IV. - Abstract: Although studies have shown that cadmium (Cd) interfered with DNA damage repair (DDR), whether Cd could affect non-homologous end joining (NHEJ) repair remains elusive. To further understand the effect of Cd on DDR, we used X-ray irradiation of Hela cells as an in vitro model system, along with γH2AX and 53BP1 as markers for DNA damage. Results showed that X-ray significantly increased γH2AX and 53BP1 foci in Hela cells (p < 0.01), all of which are characteristic of accrued DNA damage. The number of foci declined rapidly over time (1–8 h postirradiation), indicating an initiation of NHEJ process. However, the disappearance of γH2AX and 53BP1 foci was remarkably slowed by Cd pretreatment (p < 0.01), suggesting that Cd reduced the efficiency of NHEJ. To further elucidate the mechanisms of Cd toxicity, several markers of NHEJ pathway including Ku70, DNA-PKcs, XRCC4 and Ligase IV were examined. Our data showed that Cd altered the phosphorylation of DNA-PKcs, and reduced the expression of both XRCC4 and Ligase IV in irradiated cells. These observations are indicative of the impairment of NHEJ-dependent DNA repair pathways. In addition, zinc (Zn) mitigated the effects of Cd on NHEJ, suggesting that the Cd-induced NHEJ alteration may partly result from the displacement of Zn or from an interference with the normal function of Zn-containing proteins by Cd. Our findings provide a new insight into the toxicity of Cd on NHEJ repair and its underlying mechanisms in human cells.
Masani, Shahnaz; Han, Li; Meek, Katheryn; Yu, Kefei
2016-02-02
Nonhomologous end-joining (NHEJ) is the major DNA double-strand break (DSB) repair pathway in mammals and resolves the DSBs generated during both V(D)J recombination in developing lymphocytes and class switch recombination (CSR) in antigen-stimulated B cells. In contrast to the absolute requirement for NHEJ to resolve DSBs associated with V(D)J recombination, DSBs associated with CSR can be resolved in NHEJ-deficient cells (albeit at a reduced level) by a poorly defined alternative end-joining (A-EJ) pathway. Deletion of DNA ligase IV (Lig4), a core component of the NHEJ pathway, reduces CSR efficiency in a mouse B-cell line capable of robust cytokine-stimulated CSR in cell culture. Here, we report that CSR levels are not further reduced by deletion of either of the two remaining DNA ligases (Lig1 and nuclear Lig3) in Lig4(-/-) cells. We conclude that in the absence of Lig4, Lig1, and Lig3 function in a redundant manner in resolving switch region DSBs during CSR.
A bacterial E3 ubiquitin ligase targets a host protein kinase to disrupt plant immunity.
Rosebrock, Tracy R; Zeng, Lirong; Brady, Jennifer J; Abramovitch, Robert B; Xiao, Fangming; Martin, Gregory B
2007-07-19
Many bacterial pathogens of plants and animals use a type III secretion system to deliver diverse virulence-associated 'effector' proteins into the host cell. The mechanisms by which these effectors act are mostly unknown; however, they often promote disease by suppressing host immunity. One type III effector, AvrPtoB, expressed by the plant pathogen Pseudomonas syringae pv. tomato, has a carboxy-terminal domain that is an E3 ubiquitin ligase. Deletion of this domain allows an amino-terminal region of AvrPtoB (AvrPtoB(1-387)) to be detected by certain tomato varieties leading to immunity-associated programmed cell death. Here we show that a host kinase, Fen, physically interacts with AvrPtoB(1-387 )and is responsible for activating the plant immune response. The AvrPtoB E3 ligase specifically ubiquitinates Fen and promotes its degradation in a proteasome-dependent manner. This degradation leads to disease susceptibility in Fen-expressing tomato lines. Various wild species of tomato were found to exhibit immunity in response to AvrPtoB(1-387 )and not to full-length AvrPtoB. Thus, by acquiring an E3 ligase domain, AvrPtoB has thwarted a highly conserved host resistance mechanism.
International Nuclear Information System (INIS)
Supangat, Supangat; An, Young Jun; Sun, Younguk; Kwon, Suk-Tae; Cha, Sun-Shin
2010-01-01
A recombinant multiple cofactor-dependent DNA ligase from S. zilligii has been purified and crystallized. X-ray diffraction data were collected to 2.9 Å resolution and the crystals belonged to space group P1. A recombinant DNA ligase from Sulfophobococcus zilligii that shows multiple cofactor specificity (ATP, ADP and GTP) was expressed in Escherichia coli and purified under reducing conditions. Crystals were obtained by the microbatch crystallization method at 295 K in a drop containing 1 µl protein solution (10 mg ml −1 ) and an equal volume of mother liquor [0.1 M HEPES pH 7.5, 10%(w/v) polyethylene glycol 10 000]. A data set was collected to 2.9 Å resolution using synchrotron radiation. The crystals belonged to space group P1, with unit-cell parameters a = 63.7, b = 77.1, c = 77.8 Å, α = 83.4, β = 82.4, γ = 74.6°. Assuming the presence of two molecules in the unit cell, the solvent content was estimated to be about 53.4%
Malyarchuk, Svitlana; Wright, Douglas; Castore, Reneau; Klepper, Emily; Weiss, Bernard; Doherty, Aidan J; Harrison, Lynn
2007-10-01
Unlike Escherichia coli, Mycobacterium tuberculosis (Mt) expresses a Ku-like protein and an ATP-dependent DNA ligase that can perform non-homologous end-joining (NHEJ). We have expressed the Mt-Ku and Mt-Ligase D in E. coli using an arabinose-inducible promoter and expression vectors that integrate into specific sites in the E. coli chromosome. E. coli strains have been generated that express the Mt-Ku and Mt-Ligase D on a genetic background that is wild-type for repair, or deficient in either the RecA or RecB protein. Transformation of these strains with linearized plasmid DNA containing a 2bp overhang has demonstrated that expression of both the Mt-Ku and Mt-Ligase D is required for DNA end-joining and that loss of RecA does not prevent this double-strand break repair. Analysis of the re-joined plasmid has shown that repair is predominantly inaccurate and results in the deletion of sequences. Loss of RecB did not prevent the formation of large deletions, but did increase the amount of end-joining. Sequencing the junctions has revealed that the majority of the ligations occurred at regions of microhomology (1-4bps), eliminating one copy of the homologous sequence at the junction. The Mt-Ku and Mt-Ligase D can therefore function in E. coli to re-circularize linear plasmid.
Energy Technology Data Exchange (ETDEWEB)
Zhu,H.; Nandakumar, J.; Aniukwu, J.; Wang, L.; Glickman, M.; Lima, C.; Shuman, S.
2006-01-01
DNA ligase D (LigD) is a large polyfunctional protein that participates in a recently discovered pathway of nonhomologous end-joining in bacteria. LigD consists of an ATP-dependent ligase domain fused to a polymerase domain (Pol) and a phosphoesterase module. The Pol activity is remarkable for its dependence on manganese, its ability to perform templated and nontemplated primer extension reactions, and its preference for adding ribonucleotides to blunt DNA ends. Here we report the 1.5- Angstroms crystal structure of the Pol domain of Pseudomonas LigD and its complexes with manganese and ATP-dATP substrates, which reveal a minimized polymerase with a two-metal mechanism and a fold similar to that of archaeal DNA primase. Mutational analysis highlights the functionally relevant atomic contacts in the active site. Although distinct nucleoside conformations and contacts for ATP versus dATP are observed in the cocrystals, the functional analysis suggests that the ATP-binding mode is the productive conformation for dNMP and rNMP incorporation. We find that a mutation of Mycobacterium LigD that uniquely ablates the polymerase activity results in increased fidelity of blunt-end double-strand break repair in vivo by virtue of eliminating nucleotide insertions at the recombination junctions. Thus, LigD Pol is a direct catalyst of mutagenic nonhomologous end-joining in vivo. Our studies underscore a previously uncharacterized role for the primase-like polymerase family in DNA repair.
Zhu, Hui; Shuman, Stewart
2005-04-01
NAD+-dependent DNA ligase (LigA) is essential for bacterial growth and a potential target for antimicrobial drug discovery. Here we queried the role of 14 conserved amino acids of Escherichia coli LigA by alanine scanning and thereby identified five new residues within the nucleotidyltransferase domain as being essential for LigA function in vitro and in vivo. Structure activity relationships were determined by conservative mutagenesis for the Glu-173, Arg-200, Arg-208, and Arg-277 side chains, as well as four other essential side chains that had been identified previously (Lys-115, Asp-117, Asp-285, and Lys-314). In addition, we identified Lys-290 as important for LigA activity. Reference to the structure of Enterococcus faecalis LigA allowed us to discriminate three classes of essential/important side chains that: (i) contact NAD+ directly (Lys-115, Glu-173, Lys-290, and Lys-314); (ii) comprise the interface between the NMN-binding domain (domain Ia) and the nucleotidyltransferase domain or comprise part of a nick-binding site on the surface of the nucleotidyltransferase domain (Arg-200 and Arg-208); or (iii) stabilize the active site fold of the nucleotidyltransferase domain (Arg-277). Analysis of mutational effects on the isolated ligase adenylylation and phosphodiester formation reactions revealed different functions for essential side chains at different steps of the DNA ligase pathway, consistent with the proposal that the active site is serially remodeled as the reaction proceeds.
Zhu, Hui; Bhattarai, Hitesh; Yan, Han-Guang; Shuman, Stewart; Glickman, Michael S
2012-12-21
Mycobacteria exploit nonhomologous end-joining (NHEJ) to repair DNA double-strand breaks. The core NHEJ machinery comprises the homodimeric DNA end-binding protein Ku and DNA ligase D (LigD), a modular enzyme composed of a C-terminal ATP-dependent ligase domain (LIG), a central 3'-phosphoesterase domain (PE), and an N-terminal polymerase domain (POL). LigD POL is proficient at adding templated and nontemplated deoxynucleotides and ribonucleotides to DNA ends in vitro and is the catalyst in vivo of unfaithful NHEJ events involving nontemplated single-nucleotide additions to blunt DSB ends. Here, we identify two mycobacterial proteins, PolD1 and PolD2, as stand-alone homologues of the LigD POL domain. Biochemical characterization of PolD1 and PolD2 shows that they resemble LigD POL in their monomeric quaternary structures, their ability to add templated and nontemplated nucleotides to primer-templates and blunt ends, and their preference for rNTPs versus dNTPs. Deletion of polD1, polD2, or both from a Mycobacterium smegmatis strain carrying an inactivating mutation in LigD POL failed to reveal a role for PolD1 or PolD2 in templated nucleotide additions during NHEJ of 5'-overhang DSBs or in clastogen resistance. Whereas our results document the existence and characteristics of new stand-alone members of the LigD POL family of RNA/DNA polymerases, they imply that other polymerases can perform fill-in synthesis during mycobacterial NHEJ.
DEFF Research Database (Denmark)
Lukas, C; Kramer, E R; Peters, J M
2000-01-01
Ubiquitin-proteasome-mediated destruction of rate-limiting proteins is required for timely progression through the main cell cycle transitions. The anaphase-promoting complex (APC), periodically activated by the Cdh1 subunit, represents one of the major cellular ubiquitin ligases which, in Saccha......Ubiquitin-proteasome-mediated destruction of rate-limiting proteins is required for timely progression through the main cell cycle transitions. The anaphase-promoting complex (APC), periodically activated by the Cdh1 subunit, represents one of the major cellular ubiquitin ligases which......, in Saccharomyces cerevisiae and Drosophila spp., triggers exit from mitosis and during G(1) prevents unscheduled DNA replication. In this study we investigated the importance of periodic oscillation of the APC-Cdh1 activity for the cell cycle progression in human cells. We show that conditional interference...... transition and lowered the rate of DNA synthesis during S phase, some of the activities essential for DNA replication became markedly amplified, mainly due to a progressive increase of E2F-dependent cyclin E transcription and a rapid turnover of the p27(Kip1) cyclin-dependent kinase inhibitor. Consequently...
Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre
2017-12-01
5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Billen, D.; Hellermann, G.R.
1976-01-01
Toluene-treated Escherichia coli mutants have been used to study the roles of deoxyribonucleic acid (DNA) polymerases I, II, and III, and of DNA ligase in repair synthesis and strand rejoining following X-irradiation. In cells possessing all three DNA polymerases, both a greater amount of repair synthesis (''exaggerated'' repair synthesis) and failure of ligation are observed when DNA ligase activity is inhibited. In a mutant lacking the polymerizing activity of DNA polymerase I, exaggerated repair synthesis is not observed, and strand rejoining does not occur even if DNA ligase is fully activated. In a mutant possessing the polymerizing activity of DNA polymerase I but lacking its 5' → 3' exonuclease activity, exaggerated repair synthesis is minimal. After irradiation, DNA polymerases II and III are capable of carrying out an adenosine 5'-triphosphate-dependent repair synthesis, but rejoining of strand breaks does not occur and exaggerated synthesis is not seen whether DNA ligase is active or not. These results suggest that DNA polymerase I and DNA ligase act together to limit repair synthesis after X irradiation and that both are necessary in toluene-treated cells for strand rejoining. DNA polymerases II and III apparently cannot complete chain elongation and gap filling, and therefore repair carried out by these enzymes does not respond to ligase action
Stealing the spotlight: CUL4-DDB1 ubiquitin ligase docks WD40-repeat proteins to destroy
Directory of Open Access Journals (Sweden)
Zhang Hui
2007-02-01
Full Text Available Abstract Recent investigation of Cullin 4 (CUL4 has ushered this class of multiprotein ubiquitin E3 ligases to center stage as critical regulators of diverse processes including cell cycle regulation, developmental patterning, DNA replication, DNA damage and repair, and epigenetic control of gene expression. CUL4 associates with DNA Damage Binding protein 1 (DDB1 to assemble an ubiquitin E3 ligase that targets protein substrates for ubiquitin-dependent proteolysis. CUL4 ligase activity is also regulated by the covalent attachment of the ubiquitin-like protein NEDD8 to CUL4, or neddylation, and the COP9 signalosome complex (CSN that removes this important modification. Recently, multiple WD40-repeat proteins (WDR were found to interact with DDB1 and serve as the substrate-recognition subunits of the CUL4-DDB1 ubiquitin ligase. As more than 150–300 WDR proteins exist in the human genome, these findings impact a wide array of biological processes through CUL4 ligase-mediated proteolysis. Here, we review the recent progress in understanding the mechanism of CUL4 ubiquitin E3 ligase and discuss the architecture of CUL4-assembled E3 ubiquitin ligase complexes by comparison to CUL1-based E3s (SCF. Then, we will review several examples to highlight the critical roles of CUL4 ubiquitin ligase in genome stability, cell cycle regulation, and histone lysine methylation. Together, these studies provide insights into the mechanism of this novel ubiquitin ligase in the regulation of important biological processes.
Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay
Zhou, Huijuan; Wu, Baoyan
2008-12-01
The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.
BRCA1 Is a Histone-H2A-Specific Ubiquitin Ligase
Directory of Open Access Journals (Sweden)
Reinhard Kalb
2014-08-01
Full Text Available The RING domain proteins BRCA1 and BARD1 comprise a heterodimeric ubiquitin (E3 ligase that is required for the accumulation of ubiquitin conjugates at sites of DNA damage and for silencing at DNA satellite repeat regions. Despite its links to chromatin, the substrate and underlying function of the BRCA1/BARD1 ubiquitin ligase remain unclear. Here, we show that BRCA1/BARD1 specifically ubiquitylates histone H2A in its C-terminal tail on lysines 127 and 129 in vitro and in vivo. The specificity for K127-129 is acquired only when H2A is within a nucleosomal context. Moreover, site-specific targeting of the BRCA1/BARD1 RING domains to chromatin is sufficient for H2Aub foci formation in vivo. Our data establish BRCA1/BARD1 as a histone-H2A-specific E3 ligase, helping to explain its localization and activities on chromatin in cells.
A novel approach to the generation of seamless constructs for plant transformation
DEFF Research Database (Denmark)
Kronbak, Remy; Ingvardsen, Christina R.; Madsen, Claus K.
2014-01-01
Background: When creating plant transformation vectors, full control of nucleotides flanking the insert in the final construct may be desirable. Modern ligase-independent methods for DNA-recombination are based on linearization by classical type II restriction endonucleases (REs) alone or in comb......Background: When creating plant transformation vectors, full control of nucleotides flanking the insert in the final construct may be desirable. Modern ligase-independent methods for DNA-recombination are based on linearization by classical type II restriction endonucleases (REs) alone...... on wheat and barley endosperm cells for transient gfp expression.Conclusions: All nucleotides flanking an insert in a biolistic plant transformation vector can be customized by means of SRL in combination with SLIC. Especially type IIS REs promote an efficient cloning result. Based on our findings, we...
Ligase-deficient yeast cells exhibit defective DNA rejoining and enhanced gamma ray sensitivity
International Nuclear Information System (INIS)
Moore, C.W.
1982-01-01
Yeast cells deficient in DNA ligase were also deficient in their capacity to rejoin single-strand scissions in prelabeled nuclear DNA. After high-dose-rate gamma irradiation (10 and 25 krads), cdc9-9 mutant cells failed to rejoin single-strand scissions at the restrictive temperature of 37 0 C. In contrast, parental (CDC9) cells (incubated with mutant cells both during and after irradiation) exhibited rapid medium-independent DNA rejoining after 10 min of post-irradiation incubation and slower rates of rejoining after longer incubation. Parental cells were also more resistant than mutant cells to killing by gamma irradiation. Approximately 2.5 +- 0.07 and 5.7 +- 0.6 single-strand breaks per 10 8 daltons were detected in DNAs from either CDC9 or cdc9-9 cells converted to spheroplasts immediately after 10 and 25 krads of irradiation, respectively. At the permissive temperature of 23 0 C, the cdc9-9 cells contained 2 to 3 times the number of DNA single-strand breaks as parental cells after 10 min to 4 h of incubation after 10 krads of irradiation, and two- to eightfold more breaks after 10 min to 2.5 h of incubation after 25 krads of irradiation. Rejoining of single-strand scissions was faster in medium. After only 10 min in buffered growth medium after 10 krads of irradiation, the number of DNA single-strand breaks was reduced to 0.32 +- 0.3 (at 23 0 C) or 0.21 +- 0.05 (at 37 0 C) per 10 8 daltons in parental cells, but remained at 2.1 +- 0.06 (at 23 0 C) or 2.3 +- 0.07 (at 37 0 C) per 10 8 daltons in mutant cells. After 10 or 25 krads of irradiation plus 1 h of incubation in medium at 37 0 C, only DNA from CDC9 cells was rejoined to the size of DNA from unirradiated cells, whereas at 23 0 C, DNAs in both strains were completely rejoined
Plasmid containing a DNA ligase gene from Haemophilus influenzae
International Nuclear Information System (INIS)
McCarthy, D.; Griffin, K.; Setlow, J.K.
1984-01-01
A ligase gene from Haemophilus influenzae was cloned into the shuttle vector pDM2. Although the plasmid did not affect X-ray sensitivity, it caused an increase in UV sensitivity of the wild-type but not excision-defective H. influenzae and a decrease in UV sensitivity of the rec-1 mutant. 14 references, 2 figures
Structure-Based Virtual Ligand Screening on the XRCC4/DNA Ligase IV Interface
Menchon, Grégory; Bombarde, Oriane; Trivedi, Mansi; Négrel, Aurélie; Inard, Cyril; Giudetti, Brigitte; Baltas, Michel; Milon, Alain; Modesti, Mauro; Czaplicki, Georges; Calsou, Patrick
2016-03-01
The association of DNA Ligase IV (Lig4) with XRCC4 is essential for repair of DNA double-strand breaks (DSBs) by Non-homologous end-joining (NHEJ) in humans. DSBs cytotoxicity is largely exploited in anticancer therapy. Thus, NHEJ is an attractive target for strategies aimed at increasing the sensitivity of tumors to clastogenic anticancer treatments. However the high affinity of the XRCC4/Lig4 interaction and the extended protein-protein interface make drug screening on this target particularly challenging. Here, we conducted a pioneering study aimed at interfering with XRCC4/Lig4 assembly. By Molecular Dynamics simulation using the crystal structure of the complex, we first delineated the Lig4 clamp domain as a limited suitable target. Then, we performed in silico screening of ~95,000 filtered molecules on this Lig4 subdomain. Hits were evaluated by Differential Scanning Fluorimetry, Saturation Transfer Difference - NMR spectroscopy and interaction assays with purified recombinant proteins. In this way we identified the first molecule able to prevent Lig4 binding to XRCC4 in vitro. This compound has a unique tripartite interaction with the Lig4 clamp domain that suggests a starting chemotype for rational design of analogous molecules with improved affinity.
Hijacking of the host SCF ubiquitin ligase machinery by plant pathogens
Directory of Open Access Journals (Sweden)
Shimpei eMagori
2011-11-01
Full Text Available The SCF (SKP1-CUL1-F-box protein ubiquitin ligase complex mediates polyubiquitination of proteins targeted for degradation, thereby controlling a plethora of biological processes in eukaryotic cells. Although this ubiquitination machinery is found and functional only in eukaryotes, many non-eukaryotic pathogens also encode F-box proteins, the critical subunits of the SCF complex. Increasing evidence indicates that such non-eukaryotic F-box proteins play an essential role in subverting or exploiting the host ubiquitin/proteasome system for efficient pathogen infection. A recent bioinformatic analysis has identified more than 70 F-box proteins in 22 different bacterial species, suggesting that use of pathogen-encoded F-box effectors in the host cell may be a widespread infection strategy. In this review, we focus on plant pathogen-encoded F-box effectors, such as VirF of Agrobacterium tumefaciens, GALAs of Ralstonia solanacearum, and P0 of Poleroviruses, and discuss the molecular mechanism by which plant pathogens use these factors to manipulate the host cell for their own benefit.
Studying DNA Looping by Single-Molecule FRET
Le, Tung T.; Kim, Harold D.
2014-01-01
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...
Enzymes involved in organellar DNA replication in photosynthetic eukaryotes.
Moriyama, Takashi; Sato, Naoki
2014-01-01
Plastids and mitochondria possess their own genomes. Although the replication mechanisms of these organellar genomes remain unclear in photosynthetic eukaryotes, several organelle-localized enzymes related to genome replication, including DNA polymerase, DNA primase, DNA helicase, DNA topoisomerase, single-stranded DNA maintenance protein, DNA ligase, primer removal enzyme, and several DNA recombination-related enzymes, have been identified. In the reference Eudicot plant Arabidopsis thaliana, the replication-related enzymes of plastids and mitochondria are similar because many of them are dual targeted to both organelles, whereas in the red alga Cyanidioschyzon merolae, plastids and mitochondria contain different replication machinery components. The enzymes involved in organellar genome replication in green plants and red algae were derived from different origins, including proteobacterial, cyanobacterial, and eukaryotic lineages. In the present review, we summarize the available data for enzymes related to organellar genome replication in green plants and red algae. In addition, based on the type and distribution of replication enzymes in photosynthetic eukaryotes, we discuss the transitional history of replication enzymes in the organelles of plants.
Aoyama, Shoki; Terada, Saki; Sanagi, Miho; Hasegawa, Yoko; Lu, Yu; Morita, Yoshie; Chiba, Yukako; Sato, Takeo; Yamaguchi, Junji
2017-09-09
Ubiquitin ligases play important roles in regulating various cellular processes by modulating the protein function of specific ubiquitination targets. The Arabidopsis Tóxicos en Levadura (ATL) family is a group of plant-specific RING-type ubiquitin ligases that localize to membranes via their N-terminal transmembrane-like domains. To date, 91 ATL isoforms have been identified in the Arabidopsis genome, with several ATLs reported to be involved in regulating plant responses to environmental stresses. However, the functions of most ATLs remain unknown. This study, involving transcriptome database analysis, identifies ATL15 as a sugar responsive ATL gene in Arabidopsis. ATL15 expression was rapidly down-regulated in the presence of sugar. The ATL15 protein showed ubiquitin ligase activity in vitro and localized to plasma membrane and endomembrane compartments. Further genetic analyses demonstrated that the atl15 knockout mutants are insensitive to high glucose concentrations, whereas ATL15 overexpression depresses plant growth. In addition, endogenous glucose and starch amounts were reciprocally affected in the atl15 knockout mutants and the ATL15 overexpressors. These results suggest that ATL15 protein plays a significant role as a membrane-localized ubiquitin ligase that regulates sugar-responsive plant growth in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Dianov, Grigory L.; Sleeth, Kate M.; Dianova, Irina I.; Allinson, Sarah L
2003-10-29
Repair of both normal and reduced AP sites is activated by AP endonuclease, which recognizes and cleaves a phosphodiester bond 5' to the AP site. For a short period of time an incised AP site is occupied by poly(ADP-ribose) polymerase and then DNA polymerase {beta} adds one nucleotide into the repair gap and simultaneously removes the 5'-sugar phosphate. Finally, the DNA ligase III/XRCC1 complex accomplishes repair by sealing disrupted DNA ends. However, long-patch BER pathway, which is involved in the removal of reduced abasic sites, requires further DNA synthesis resulting in strand displacement and the generation of a damage-containing flap that is later removed by the flap endonuclease. Strand-displacement DNA synthesis is accomplished by DNA polymerase {delta}/{epsilon} and DNA ligase I restores DNA integrity. DNA synthesis by DNA polymerase {delta}/{epsilon} is dependent on proliferating cell nuclear antigen, which also stimulates the DNA ligase I and flap endonuclease. These repair events are supported by multiple protein-protein interactions.
Energy Technology Data Exchange (ETDEWEB)
Miao, Min [Ministry of Education Key Laboratory for Bio-resource and Eco-environment, College of Life Science, State Key Laboratory of Hydraulics and Mountain River Engineering, Sichuan University, Chengdu 610064 (China); School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei 230009 (China); Department of Plant, Soil and Entomological Sciences, University of Idaho, Moscow, ID 83844-2339 (United States); Zhu, Yunye [School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei 230009 (China); Qiao, Maiju [Ministry of Education Key Laboratory for Bio-resource and Eco-environment, College of Life Science, State Key Laboratory of Hydraulics and Mountain River Engineering, Sichuan University, Chengdu 610064 (China); Tang, Xiaofeng [Ministry of Education Key Laboratory for Bio-resource and Eco-environment, College of Life Science, State Key Laboratory of Hydraulics and Mountain River Engineering, Sichuan University, Chengdu 610064 (China); School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei 230009 (China); Zhao, Wei [School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei 230009 (China); Xiao, Fangming [Department of Plant, Soil and Entomological Sciences, University of Idaho, Moscow, ID 83844-2339 (United States); Liu, Yongsheng, E-mail: liuyongsheng1122@hfut.edu.cn [Ministry of Education Key Laboratory for Bio-resource and Eco-environment, College of Life Science, State Key Laboratory of Hydraulics and Mountain River Engineering, Sichuan University, Chengdu 610064 (China); School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei 230009 (China)
2014-08-08
Highlights: • We identify DDI1 as a DAMAGED DNA BINDING PROTEIN1 (DDB1)-interacting protein. • DDI1 interacts with the CUL4–DDB1-based ubiquitin ligase in the nucleus. • DDI1 plays a positive role in regulating abiotic stress response in tomato. - Abstract: CULLIN4(CUL4)–DAMAGED DNA BINDING PROTEIN1 (DDB1)-based ubiquitin ligase plays significant roles in multiple physiological processes via ubiquitination-mediated degradation of relevant target proteins. The DDB1–CUL4-associated factor (DCAF) acts as substrate receptor in the CUL4–DDB1 ubiquitin ligase complex and determines substrate specificity. In this study, we identified a tomato (Solanum lycopersicum) DDB1-interacting (DDI1) protein as a DCAF protein involved in response to abiotic stresses, including UV radiation, high salinity and osmotic stress. Co-immunoprecipitation and bimolecular fluorescence complementation assay indicated that DDI1 associates with CUL4–DDB1 in the nucleus. Quantitative RT-PCR analysis indicated the DDI1 gene is induced by salt, mannitol and UV-C treatment. Moreover, transgenic tomato plants with overexpression or knockdown of the DDI1 gene exhibited enhanced or attenuated tolerance to salt/mannitol/UV-C, respectively. Thus, our data suggest that DDI1 functions as a substrate receptor of the CUL4–DDB1 ubiquitin ligase, positively regulating abiotic stress response in tomato.
International Nuclear Information System (INIS)
Miao, Min; Zhu, Yunye; Qiao, Maiju; Tang, Xiaofeng; Zhao, Wei; Xiao, Fangming; Liu, Yongsheng
2014-01-01
Highlights: • We identify DDI1 as a DAMAGED DNA BINDING PROTEIN1 (DDB1)-interacting protein. • DDI1 interacts with the CUL4–DDB1-based ubiquitin ligase in the nucleus. • DDI1 plays a positive role in regulating abiotic stress response in tomato. - Abstract: CULLIN4(CUL4)–DAMAGED DNA BINDING PROTEIN1 (DDB1)-based ubiquitin ligase plays significant roles in multiple physiological processes via ubiquitination-mediated degradation of relevant target proteins. The DDB1–CUL4-associated factor (DCAF) acts as substrate receptor in the CUL4–DDB1 ubiquitin ligase complex and determines substrate specificity. In this study, we identified a tomato (Solanum lycopersicum) DDB1-interacting (DDI1) protein as a DCAF protein involved in response to abiotic stresses, including UV radiation, high salinity and osmotic stress. Co-immunoprecipitation and bimolecular fluorescence complementation assay indicated that DDI1 associates with CUL4–DDB1 in the nucleus. Quantitative RT-PCR analysis indicated the DDI1 gene is induced by salt, mannitol and UV-C treatment. Moreover, transgenic tomato plants with overexpression or knockdown of the DDI1 gene exhibited enhanced or attenuated tolerance to salt/mannitol/UV-C, respectively. Thus, our data suggest that DDI1 functions as a substrate receptor of the CUL4–DDB1 ubiquitin ligase, positively regulating abiotic stress response in tomato
A new non-catalytic role for ubiquitin ligase RNF8 in unfolding higher-order chromatin structure
DEFF Research Database (Denmark)
Luijsterburg, Martijn S; Acs, Klara; Ackermann, Leena
2012-01-01
The ubiquitin ligases RNF8 and RNF168 orchestrate DNA damage signalling through the ubiquitylation of histone H2A and the recruitment of downstream repair factors. Here, we demonstrate that RNF8, but not RNF168 or the canonical H2A ubiquitin ligase RNF2, mediates extensive chromatin decondensation....... Our data show that CHD4, the catalytic subunit of the NuRD complex, interacts with RNF8 and is essential for RNF8-mediated chromatin unfolding. The chromatin remodelling activity of CHD4 promotes efficient ubiquitin conjugation and assembly of RNF168 and BRCA1 at DNA double-strand breaks....... Interestingly, RNF8-mediated recruitment of CHD4 and subsequent chromatin remodelling were independent of the ubiquitin-ligase activity of RNF8, but involved a non-canonical interaction with the forkhead-associated (FHA) domain. Our study reveals a new mechanism of chromatin remodelling-assisted ubiquitylation...
DEFF Research Database (Denmark)
Xing, Mengtan; Bjørås, Magnar; Daniel, Jeremy A
2017-01-01
DNA double-strand breaks (DSBs) are recognized and repaired by the Classical Non-Homologous End-Joining (C-NHEJ) and Homologous Recombination pathways. C-NHEJ includes the core Ku70 and Ku80 (or Ku86) heterodimer that binds DSBs and thus promotes recruitment of accessory downstream NHEJ factors XLF......, PAXX, DNA-PKcs, Artemis and other core subunits, XRCC4 and DNA Ligase 4 (Lig4). In the absence of core C-NHEJ factors, DNA repair can be performed by Alternative End-Joining, which likely depends on DNA Ligase 1 and DNA Ligase 3. Genetic inactivation of C-NHEJ factors, such as Ku70, Ku80, XLF, PAXX...... with severe apoptosis in the central nervous system. Here, we demonstrate that inactivation of the Ku70 gene rescues the synthetic lethality between XLF and DNA-PKcs, resulting in triple knockout mice that are indistinguishable from Ku70-deficient littermates by size or levels of genomic instability. Moreover...
DEFF Research Database (Denmark)
Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A
2010-01-01
Nucleotide synthesis is a universal response to DNA damage, but how this response facilitates DNA repair and cell survival is unclear. Here we establish a role for DNA damage-induced nucleotide synthesis in homologous recombination (HR) repair in fission yeast. Using a genetic screen, we found...... the Ddb1-Cul4(Cdt)² ubiquitin ligase complex and ribonucleotide reductase (RNR) to be required for HR repair of a DNA double-strand break (DSB). The Ddb1-Cul4(Cdt)² ubiquitin ligase complex is required for degradation of Spd1, an inhibitor of RNR in fission yeast. Accordingly, deleting spd1(+) suppressed...
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
Enzyme-linked electrochemical DNA ligation assay using magnetic beads.
Stejskalová, Eva; Horáková, Petra; Vacek, Jan; Bowater, Richard P; Fojta, Miroslav
2014-07-01
DNA ligases are essential enzymes in all cells and have been proposed as targets for novel antibiotics. Efficient DNA ligase activity assays are thus required for applications in biomedical research. Here we present an enzyme-linked electrochemical assay based on two terminally tagged probes forming a nicked junction upon hybridization with a template DNA. Nicked DNA bearing a 5' biotin tag is immobilized on the surface of streptavidin-coated magnetic beads, and ligated product is detected via a 3' digoxigenin tag recognized by monoclonal antibody-alkaline phosphatase conjugate. Enzymatic conversion of napht-1-yl phosphate to napht-1-ol enables sensitive detection of the voltammetric signal on a pyrolytic graphite electrode. The technique was tested under optimal conditions and various situations limiting or precluding the ligation reaction (such as DNA substrates lacking 5'-phosphate or containing a base mismatch at the nick junction, or application of incompatible cofactor), and utilized for the analysis of the nick-joining activity of a range of recombinant Escherichia coli DNA ligase constructs. The novel technique provides a fast, versatile, specific, and sensitive electrochemical assay of DNA ligase activity.
Succinate-CoA ligase deficiency due to mutations in SUCLA2 and SUCLG1
DEFF Research Database (Denmark)
Carrozzo, Rosalba; Verrigni, Daniela; Rasmussen, Magnhild
2016-01-01
BACKGROUND: The encephalomyopathic mtDNA depletion syndrome with methylmalonic aciduria is associated with deficiency of succinate-CoA ligase, caused by mutations in SUCLA2 or SUCLG1. We report here 25 new patients with succinate-CoA ligase deficiency, and review the clinical and molecular findings...... deficiency of complexes I and IV, but normal histological and biochemical findings in muscle did not preclude a diagnosis of succinate-CoA ligase deficiency. In five patients, the urinary excretion of methylmalonic acid was only marginally elevated, whereas elevated plasma methylmalonic acid was consistently...
Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.
Lama, Lodoe; Ryan, Kevin
2016-01-01
Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Wang, Li Kai; Nair, Pravin A; Shuman, Stewart
2008-08-22
NAD(+)-dependent DNA ligases (LigAs) are ubiquitous in bacteria and essential for growth. LigA enzymes have a modular structure in which a central catalytic core composed of nucleotidyltransferase and oligonucleotide-binding (OB) domains is linked via a tetracysteine zinc finger to distal helix-hairpin-helix (HhH) and BRCT (BRCA1-like C-terminal) domains. The OB and HhH domains contribute prominently to the protein clamp formed by LigA around nicked duplex DNA. Here we conducted a structure-function analysis of the OB and HhH domains of Escherichia coli LigA by alanine scanning and conservative substitutions, entailing 43 mutations at 22 amino acids. We thereby identified essential functional groups in the OB domain that engage the DNA phosphodiester backbone flanking the nick (Arg(333)); penetrate the minor grove and distort the nick (Val(383) and Ile(384)); or stabilize the OB fold (Arg(379)). The essential constituents of the HhH domain include: four glycines (Gly(455), Gly(489), Gly(521), Gly(553)), which bind the phosphate backbone across the minor groove at the outer margins of the LigA-DNA interface; Arg(487), which penetrates the minor groove at the outer margin on the 3 (R)-OH side of the nick; and Arg(446), which promotes protein clamp formation via contacts to the nucleotidyltransferase domain. We find that the BRCT domain is required in its entirety for effective nick sealing and AMP-dependent supercoil relaxation.
The evolutionarily conserved E3 ubiquitin ligase AtCHIP contributes to plant immunity
Directory of Open Access Journals (Sweden)
Xin eLi
2016-03-01
Full Text Available Plants possess a sophisticated immune system to recognize and respond to microbial threats in their environment. The level of immune signaling must be tightly regulated so that immune responses can be quickly activated in the presence of pathogens, while avoiding autoimmunity. HSP90s, along with their diverse array of co-chaperones, forms chaperone complexes that have been shown to play both positive and negative roles in regulating the accumulation of immune receptors and regulators. In this study, we examined the role of AtCHIP, an evolutionarily conserved E3 ligase that was known to interact with chaperones including HSP90s in multicellular organisms including fruit fly, C. elegans, plants and human. Atchip knockout mutants display enhanced disease susceptibility to a virulent oomycete pathogen, and overexpression of AtCHIP causes enhanced disease resistance at low temperature. Although CHIP was reported to target HSP90 for ubiquitination and degradation, accumulation of HSP90.3 was not affected in Atchip plants. In addition, protein accumulation of nucleotide-binding, leucine-rich repeat domain immune receptor (NLR SNC1 is not altered in Atchip mutant. Thus, while AtCHIP plays a role in immunity, it does not seem to regulate the turnover of HSP90 or SNC1. Further investigation is needed in order to determine the exact mechanism behind AtCHIP’s role in regulating plant immune responses.
Impact of DNA3'pp5'G capping on repair reactions at DNA 3' ends.
Das, Ushati; Chauleau, Mathieu; Ordonez, Heather; Shuman, Stewart
2014-08-05
Many biological scenarios generate "dirty" DNA 3'-PO4 ends that cannot be sealed by classic DNA ligases or extended by DNA polymerases. The noncanonical ligase RtcB can "cap" these ends via a unique chemical mechanism entailing transfer of GMP from a covalent RtcB-GMP intermediate to a DNA 3'-PO4 to form DNA3'pp5'G. Here, we show that capping protects DNA 3' ends from resection by Escherichia coli exonucleases I and III and from end-healing by T4 polynucleotide 3' phosphatase. By contrast, the cap is an effective primer for DNA synthesis. E. coli DNA polymerase I and Mycobacterium DinB1 extend the DNAppG primer to form an alkali-labile DNApp(rG)pDNA product. The addition of dNTP depends on pairing of the cap guanine with an opposing cytosine in the template strand. Aprataxin, an enzyme implicated in repair of A5'pp5'DNA ends formed during abortive ligation by classic ligases, is highly effective as a DNA 3' decapping enzyme, converting DNAppG to DNA3'p and GMP. We conclude that the biochemical impact of DNA capping is to prevent resection and healing of a 3'-PO4 end, while permitting DNA synthesis, at the price of embedding a ribonucleotide and a pyrophosphate linkage in the repaired strand. Aprataxin affords a means to counter the impact of DNA capping.
Cheng, Xin; Ivessa, Andreas S
2012-10-01
Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Rakesh Kumar Singh
Full Text Available Core histone proteins are essential for packaging the genomic DNA into chromatin in all eukaryotes. Since multiple genes encode these histone proteins, there is potential for generating more histones than what is required for chromatin assembly. The positively charged histones have a very high affinity for negatively charged molecules such as DNA, and any excess of histone proteins results in deleterious effects on genomic stability and cell viability. Hence, histone levels are known to be tightly regulated via transcriptional, posttranscriptional and posttranslational mechanisms. We have previously elucidated the posttranslational regulation of histone protein levels by the ubiquitin-proteasome pathway involving the E2 ubiquitin conjugating enzymes Ubc4/5 and the HECT (Homologous to E6-AP C-Terminus domain containing E3 ligase Tom1 in the budding yeast. Here we report the identification of four additional E3 ligases containing the RING (Really Interesting New Gene finger domains that are involved in the ubiquitylation and subsequent degradation of excess histones in yeast. These E3 ligases are Pep5, Snt2 as well as two previously uncharacterized Open Reading Frames (ORFs YKR017C and YDR266C that we have named Hel1 and Hel2 (for Histone E3 Ligases respectively. Mutants lacking these E3 ligases are sensitive to histone overexpression as they fail to degrade excess histones and accumulate high levels of endogenous histones on histone chaperones. Co-immunoprecipitation assays showed that these E3 ligases interact with the major E2 enzyme Ubc4 that is involved in the degradation related ubiquitylation of histones. Using mutagenesis we further demonstrate that the RING domains of Hel1, Hel2 and Snt2 are required for histone regulation. Lastly, mutants corresponding to Hel1, Hel2 and Pep5 are sensitive to replication inhibitors. Overall, our results highlight the importance of posttranslational histone regulatory mechanisms that employ multiple E3
Maréchal, Alexandre; Li, Ju-Mei; Ji, Xiao Ye; Wu, Ching-Shyi; Yazinski, Stephanie A; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E; Jin, Jianping; Zou, Lee
2014-01-23
PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). Although the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 directly binds RPA and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA-damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ataxia telangiectasia mutated and Rad3-related (ATR) kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, recovery of stalled replication forks, and progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. Copyright © 2014 Elsevier Inc. All rights reserved.
The role of DNA dependent protein kinase in synapsis of DNA ends.
Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C
2003-12-15
DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.
Energy Technology Data Exchange (ETDEWEB)
Lu, Yong-Zhi; Sheng, Yu [Institute for Nanobiomedical Technology and Membrane Biology, West China Hospital, Sichuan University, Chengdu 610065, Sichuan (China); Li, Lan-Fen [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Tang, De-Wei [Institute for Nanobiomedical Technology and Membrane Biology, West China Hospital, Sichuan University, Chengdu 610065, Sichuan (China); Liu, Xiang-Yu [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Zhao, Xiaojun, E-mail: zhaoxj@scu.edu.cn [Institute for Nanobiomedical Technology and Membrane Biology, West China Hospital, Sichuan University, Chengdu 610065, Sichuan (China); Liang, Yu-He, E-mail: zhaoxj@scu.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Institute for Nanobiomedical Technology and Membrane Biology, West China Hospital, Sichuan University, Chengdu 610065, Sichuan (China)
2007-09-01
A potential target for antibiotic drug design, d-alanine-d-alanine ligase from S. mutans, was expressed in E. coli, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. d-Alanine-d-alanine ligase is encoded by the gene ddl (SMU-599) in Streptococcus mutans. This ligase plays a very important role in cell-wall biosynthesis and may be a potential target for drug design. To study the structure and function of this ligase, the gene ddl was amplified from S. mutans genomic DNA and cloned into the expression vector pET28a. The protein was expressed in soluble form in Escherichia coli strain BL21 (DE3). Homogeneous protein was obtained using a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Purified protein was crystallized and the cube-shaped crystal diffracted to 2.4 Å. The crystal belongs to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 79.50, c = 108.97 Å. There is one molecule per asymmetric unit.
International Nuclear Information System (INIS)
Lu, Yong-Zhi; Sheng, Yu; Li, Lan-Fen; Tang, De-Wei; Liu, Xiang-Yu; Zhao, Xiaojun; Liang, Yu-He; Su, Xiao-Dong
2007-01-01
A potential target for antibiotic drug design, d-alanine-d-alanine ligase from S. mutans, was expressed in E. coli, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. d-Alanine-d-alanine ligase is encoded by the gene ddl (SMU-599) in Streptococcus mutans. This ligase plays a very important role in cell-wall biosynthesis and may be a potential target for drug design. To study the structure and function of this ligase, the gene ddl was amplified from S. mutans genomic DNA and cloned into the expression vector pET28a. The protein was expressed in soluble form in Escherichia coli strain BL21 (DE3). Homogeneous protein was obtained using a two-step procedure consisting of Ni 2+ -chelating and size-exclusion chromatography. Purified protein was crystallized and the cube-shaped crystal diffracted to 2.4 Å. The crystal belongs to space group P3 1 21 or P3 2 21, with unit-cell parameters a = b = 79.50, c = 108.97 Å. There is one molecule per asymmetric unit
Herrera, Alfa; Vu, Bao G; Stach, Christopher S; Merriman, Joseph A; Horswill, Alexander R; Salgado-Pabón, Wilmara; Schlievert, Patrick M
2016-05-03
β-Toxin is an important virulence factor of Staphylococcus aureus, contributing to colonization and development of disease [Salgado-Pabon, W., et al. (2014) J. Infect. Dis. 210, 784-792; Huseby, M. J., et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 14407-14412; Katayama, Y., et al. (2013) J. Bacteriol. 195, 1194-1203]. This cytotoxin has two distinct mechanisms of action: sphingomyelinase activity and DNA biofilm ligase activity. However, the distinct mechanism that is most important for its role in infective endocarditis is unknown. We characterized the active site of β-toxin DNA biofilm ligase activity by examining deficiencies in site-directed mutants through in vitro DNA precipitation and biofilm formation assays. Possible conformational changes in mutant structure compared to that of wild-type toxin were assessed preliminarily by trypsin digestion analysis, retention of sphingomyelinase activity, and predicted structures based on the native toxin structure. We addressed the contribution of each mechanism of action to producing infective endocarditis and sepsis in vivo in a rabbit model. The H289N β-toxin mutant, lacking sphingomyelinase activity, exhibited lower sepsis lethality and infective endocarditis vegetation formation compared to those of the wild-type toxin. β-Toxin mutants with disrupted biofilm ligase activity did not exhibit decreased sepsis lethality but were deficient in infective endocarditis vegetation formation compared to the wild-type protein. Our study begins to characterize the DNA biofilm ligase active site of β-toxin and suggests β-toxin functions importantly in infective endocarditis through both of its mechanisms of action.
Yang, Liang; Liu, Qiaohong; Liu, Zhibin; Yang, Hao; Wang, Jianmei; Li, Xufeng; Yang, Yi
2016-01-01
Degradation of proteins via the ubiquitin system is an important step in many stress signaling pathways in plants. E3 ligases recognize ligand proteins and dictate the high specificity of protein degradation, and thus, play a pivotal role in ubiquitination. Here, we identified a gene, named Arabidopsis thaliana abscisic acid (ABA)-insensitive RING protein 4 (AtAIRP4), which is induced by ABA and other stress treatments. AtAIRP4 encodes a cellular protein with a C3HC4-RING finger domain in its C-terminal side, which has in vitro E3 ligase activity. Loss of AtAIRP4 leads to a decrease in sensitivity of root elongation and stomatal closure to ABA, whereas overexpression of this gene in the T-DNA insertion mutant atairp4 effectively recovered the ABA-associated phenotypes. AtAIRP4 overexpression plants were hypersensitive to salt and osmotic stresses during seed germination, and showed drought avoidance compared with the wild-type and atairp4 mutant plants. In addition, the expression levels of ABA- and drought-induced marker genes in AtAIRP4 overexpression plants were markedly higher than those in the wild-type and atairp4 mutant plants. Hence, these results indicate that AtAIRP4 may act as a positive regulator of ABA-mediated drought avoidance and a negative regulator of salt tolerance in Arabidopsis. © 2015 The Authors. Journal of Integrative Plant Biology published by Wiley Publishing Asia Pty Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.
Identification of the DNA repair defects in a case of Dubowitz syndrome.
Directory of Open Access Journals (Sweden)
Jingyin Yue
Full Text Available Dubowitz Syndrome is an autosomal recessive disorder with a unique set of clinical features including microcephaly and susceptibility to tumor formation. Although more than 140 cases of Dubowitz syndrome have been reported since 1965, the genetic defects of this disease has not been identified. In this study, we systematically analyzed the DNA damage response and repair capability of fibroblasts established from a Dubowitz Syndrome patient. Dubowitz syndrome fibroblasts are hypersensitive to ionizing radiation, bleomycin, and doxorubicin. However, they have relatively normal sensitivities to mitomycin-C, cisplatin, and camptothecin. Dubowitz syndrome fibroblasts also have normal DNA damage signaling and cell cycle checkpoint activations after DNA damage. These data implicate a defect in repair of DNA double strand break (DSB likely due to defective non-homologous end joining (NHEJ. We further sequenced several genes involved in NHEJ, and identified a pair of novel compound mutations in the DNA Ligase IV gene. Furthermore, expression of wild type DNA ligase IV completely complement the DNA repair defects in Dubowitz syndrome fibroblasts, suggesting that the DNA ligase IV mutation is solely responsible for the DNA repair defects. These data suggests that at least subset of Dubowitz syndrome can be attributed to DNA ligase IV mutations.
Wright, Douglas; DeBeaux, Austin; Shi, Runhua; Doherty, Aidan J; Harrison, Lynn
2010-09-01
We previously established an Escherichia coli strain capable of re-circularizing linear plasmid DNA by expressing the Mycobacterium tuberculosis Ku (Mt-Ku) and Mycobacterium tuberculosis ligase D (Mt-LigD) proteins from the E.coli chromosome. Repair was predominately mutagenic due to deletions at the termini. We hypothesized that these deletions could be due to a nuclease activity of Mt-LigD that was previously detected in vitro. Mt-LigD has three domains: an N-terminal polymerase domain (PolDom), a central domain with 3'-phosphoesterase and nuclease activity and a C-terminal ligase domain (LigDom). We generated bacterial strains expressing Mt-Ku and mutant versions of Mt-LigD. Plasmid re-circularization experiments in bacteria showed that the PolDom alone had no re-circularization activity. However, an increase in the total and accurate repair was found when the central domain was deleted. This provides further evidence that this central domain does have nuclease activity that can generate deletions during repair. Deletion of only the PolDom of Mt-LigD resulted in a complete loss of accurate repair and a significant reduction in total repair. This is in agreement with published in vitro work indicating that the PolDom is the major Mt-Ku-binding site. Interestingly, the LigDom alone was able to re-circularize plasmid DNA but only in an Mt-Ku-dependent manner, suggesting a potential second site for Ku-LigD interaction. This work has increased our understanding of the mutagenic repair by Mt-Ku and Mt-LigD and has extended the in vitro biochemical experiments by examining the importance of the Mt-LigD domains during repair in bacteria.
Energy Technology Data Exchange (ETDEWEB)
Dardalhon-Samsonoff, M; Averbeck, D [Institut du Radium, 75 - Paris (France). Lab. Curie
1980-07-01
The DNA-membrane complex in Micrococcus radiodurans was shown to be essentially constituted of proteins, lipids and DNA. The complex was dissociated immediately after X-irradiation of cells and restored during post-incubation in complete medium. In X-irradiated protoplasts some DNA remained associated with the complex. Restoration of the complex during post-incubation was only seen in a medium favouring DNA polymerase and ligase activities. Under this condition no DNA synthesis occurred, suggesting that complex restoration may involve ligase activity. The complex restoration in the wild type and the X-ray sensitive mutant UV17 of M. radiodurans was strictly dependent on the X-ray dose. It was correlated with survival and DNA degradation but always preceded the onset of DNA synthesis after X-irradiation. At the same dose the complex restoration was about 2 fold lower in mutant than in wild type cells indicating that the restoration of the complex is related to repair capacity. The results are consistent with the idea that the complex protects X-irradiated DNA of M. radiodurans from further breakdown and, subsequently, permits DNA synthesis and repair to occur.
LENUS (Irish Health Repository)
O'Connor, T M
2012-02-03
BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.
Feng, Youjun; Chin, Chui-Yoke; Chakravartty, Vandana; Gao, Rongsui; Crispell, Emily K.
2015-01-01
ABSTRACT The physiological function of biotin requires biotin protein ligase activity in order to attach the coenzyme to its cognate proteins, which are enzymes involved in central metabolism. The model intracellular pathogen Francisella novicida is unusual in that it encodes two putative biotin protein ligases rather than the usual single enzyme. F. novicida BirA has a ligase domain as well as an N-terminal DNA-binding regulatory domain, similar to the prototypical BirA protein in E. coli. However, the second ligase, which we name BplA, lacks the N-terminal DNA binding motif. It has been unclear why a bacterium would encode these two disparate biotin protein ligases, since F. novicida contains only a single biotinylated protein. In vivo complementation and enzyme assays demonstrated that BirA and BplA are both functional biotin protein ligases, but BplA is a much more efficient enzyme. BirA, but not BplA, regulated transcription of the biotin synthetic operon. Expression of bplA (but not birA) increased significantly during F. novicida infection of macrophages. BplA (but not BirA) was required for bacterial replication within macrophages as well as in mice. These data demonstrate that F. novicida has evolved two distinct enzymes with specific roles; BplA possesses the major ligase activity, whereas BirA acts to regulate and thereby likely prevent wasteful synthesis of biotin. During infection BplA seems primarily employed to maximize the efficiency of biotin utilization without limiting the expression of biotin biosynthetic genes, representing a novel adaptation strategy that may also be used by other intracellular pathogens. PMID:26060274
A DNA barcode for land plants.
2009-08-04
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.
Choosing and Using a Plant DNA Barcode
Hollingsworth, Peter M.; Graham, Sean W.; Little, Damon P.
2011-01-01
The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1 (CO1) mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. In this paper, we review the process of selecting and refining a plant barcode; evaluate the factors which influence the discriminatory power of the approach; describe some early applications of plant barcoding and summarise major emerging projects; and outline tool development that will be necessary for plant DNA barcoding to advance. PMID:21637336
Choosing and using a plant DNA barcode.
Directory of Open Access Journals (Sweden)
Peter M Hollingsworth
Full Text Available The main aim of DNA barcoding is to establish a shared community resource of DNA sequences that can be used for organismal identification and taxonomic clarification. This approach was successfully pioneered in animals using a portion of the cytochrome oxidase 1 (CO1 mitochondrial gene. In plants, establishing a standardized DNA barcoding system has been more challenging. In this paper, we review the process of selecting and refining a plant barcode; evaluate the factors which influence the discriminatory power of the approach; describe some early applications of plant barcoding and summarise major emerging projects; and outline tool development that will be necessary for plant DNA barcoding to advance.
Plant DNA banks for genetic resources conservation (review
Directory of Open Access Journals (Sweden)
Н. Е. Волкова
2016-12-01
Full Text Available Purpose. Literature review of DNA banks creation as the current strategy of plant genetic resources conservation. Results. The current state of plant genetic resources conservation was analyzed in the context of the threat of genetic erosion. The importance of DNA banks was shown which function is to store DNA samples and associated products and disseminate them for research purposes. The main DNA banks in the world were described, including the Republican DNA Bank of Human, Animals, Plants and Microorganisms at the Institute of Genetics and Cytology of the National Academy of Sciences of Belarus. Stages of DNA banking were considered: tissue sampling (usually from leaves, cell destruction, DNA extraction, DNA storage. Different methods of tissue sampling, extraction and DNA storage were compared. The need for Plant DNA Bank creation in Ukraine was highlighted. Conclusions. DNA collections is an important resource in the global effort to overcome the crisis in biodiversity, for managing world genetic resources and maximizing their potential.
Targeted ubiquitination of CDT1 by the DDB1-CUL4A-ROC1 ligase in response to DNA damage.
Hu, Jian; McCall, Chad M; Ohta, Tomohiko; Xiong, Yue
2004-10-01
Cullins assemble a potentially large number of ubiquitin ligases by binding to the RING protein ROC1 to catalyse polyubiquitination, as well as binding to various specificity factors to recruit substrates. The Cul4A gene is amplified in human breast and liver cancers, and loss-of-function of Cul4 results in the accumulation of the replication licensing factor CDT1 in Caenorhabditis elegans embryos and ultraviolet (UV)-irradiated human cells. Here, we report that human UV-damaged DNA-binding protein DDB1 associates stoichiometrically with CUL4A in vivo, and binds to an amino-terminal region in CUL4A in a manner analogous to SKP1, SOCS and BTB binding to CUL1, CUL2 and CUL3, respectively. As with SKP1-CUL1, the DDB1-CUL4A association is negatively regulated by the cullin-associated and neddylation-dissociated protein, CAND1. Recombinant DDB1 and CDT1 bind directly to each other in vitro, and ectopically expressed DDB1 bridges CDT1 to CUL4A in vivo. Silencing DDB1 prevented UV-induced rapid CDT1 degradation in vivo and CUL4A-mediated CDT1 ubiquitination in vitro. We suggest that DDB1 targets CDT1 for ubiquitination by a CUL4A-dependent ubiquitin ligase, CDL4A(DDB1), in response to UV irradiation.
Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.
2009-01-01
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622
DNA damage and repair in plants
International Nuclear Information System (INIS)
Britt, A.B.
1996-01-01
The biological impact of any DNA damaging agent is a combined function of the chemical nature of the induced lesions and the efficiency and accuracy of their repair. Although much has been learned frommicrobes and mammals about both the repair of DNA damage and the biological effects of the persistence of these lesions, much remains to be learned about the mechanism and tissue-specificity of repair in plants. This review focuses on recent work on the induction and repair of DNA damage in higher plants, with special emphasis on UV-induced DNA damage products. (author)
TRAIP is a PCNA-binding ubiquitin ligase that protects genome stability after replication stress
DEFF Research Database (Denmark)
Hoffmann, Saskia; Smedegaard, Stine; Nakamura, Kyosuke
2016-01-01
ATR-dependent checkpoint signaling in human cells by facilitating the generation of RPA-bound single-stranded DNA regions upon replication stress in a manner that critically requires its E3 ligase activity and is potentiated by the PIP box. Consequently, loss of TRAIP function leads to enhanced...
Directory of Open Access Journals (Sweden)
Raymond Buser
2016-02-01
Full Text Available Faithful DNA replication and repair requires the activity of cullin 4-based E3 ubiquitin ligases (CRL4, but the underlying mechanisms remain poorly understood. The budding yeast Cul4 homologue, Rtt101, in complex with the linker Mms1 and the putative substrate adaptor Mms22 promotes progression of replication forks through damaged DNA. Here we characterized the interactome of Mms22 and found that the Rtt101(Mms22 ligase associates with the replisome progression complex during S-phase via the amino-terminal WD40 domain of Ctf4. Moreover, genetic screening for suppressors of the genotoxic sensitivity of rtt101Δ cells identified a cluster of replication proteins, among them a component of the fork protection complex, Mrc1. In contrast to rtt101Δ and mms22Δ cells, mrc1Δ rtt101Δ and mrc1Δ mms22Δ double mutants complete DNA replication upon replication stress by facilitating the repair/restart of stalled replication forks using a Rad52-dependent mechanism. Our results suggest that the Rtt101(Mms22 E3 ligase does not induce Mrc1 degradation, but specifically counteracts Mrc1's replicative function, possibly by modulating its interaction with the CMG (Cdc45-MCM-GINS complex at stalled forks.
Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B
2016-09-06
The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.
Chakkyarath, Vijina; Natarajan, Jeyakumar
2017-10-31
Enterobacter aerogenes have been reported as important opportunistic and multi-resistant bacterial pathogens for humans during the last three decades in hospital wards. The emergence of drug-resistant E. aerogenes demands the need for developing new drugs. Peptidoglycan is an important component of the cell wall of bacteria and the peptidoglycan biochemical pathway is considered as the best source of antibacterial targets. Within this pathway, four Mur ligases MurC, MurD, MurE, and MurF are responsible for the successive additions of L-alanine and suitable targets for developing novel antibacterial drugs. As an inference from this fact, we modeled the three-dimensional structure of above Mur ligases using best template structures available in PDB and analyzed its common binding features. Structural refinement and energy minimization of the predicted Mur ligases models is also being done using molecular dynamics studies. The models of Mur ligases were further investigated for in silico docking studies using bioactive plant compounds from the literature. Interestingly, these results indicate that four plant compounds Isojuripidine, Atroviolacegenin, Porrigenin B, and Nummularogenin showing better docking results in terms of binding energy and number of hydrogen bonds. All these four compounds are spirostan-based compounds with differences in side chains and the amino acid such as ASN, LYS, THR, HIS, ARG (polar) and PHE, GLY, VAL, ALA, MET (non-polar) playing active role in binding site of all four Mur ligases. Overall, in the predicted model, the four plant compounds with its binding features could pave way to design novel multi-targeted antibacterial plant-based bioactive compounds specific to Mur ligases for the treatment of Enterobacter infections.
Directory of Open Access Journals (Sweden)
Alina Avanesyan
2014-02-01
Full Text Available Premise of the study: A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. Methods and Results: The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. Conclusions: The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant “movement” during food consumption, to detecting plant–insect interactions.
DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.
Sucher, Nikolaus J; Hennell, James R; Carles, Maria C
2012-01-01
DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.
DNA damage in plant herbarium tissue.
Staats, M.; Cuenca, A.; Richardson, J.E.; Ginkel, R.V.; Petersen, G.; Seberg, O.; Bakker, F.T.
2011-01-01
Dried plant herbarium specimens are potentially a valuable source of DNA. Efforts to obtain genetic information from this source are often hindered by an inability to obtain amplifiable DNA as herbarium DNA is typically highly degraded. DNA post-mortem damage may not only reduce the number of
DNA maintenance in plastids and mitochondria of plants
Directory of Open Access Journals (Sweden)
Delene J Oldenburg
2015-10-01
Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.
Directory of Open Access Journals (Sweden)
Chen Yun-Ru
2012-09-01
Full Text Available Abstract Background Deep sequencing is a powerful tool for novel small RNA discovery. Illumina small RNA sequencing library preparation requires a pre-adenylated 3’ end adapter containing a 5’,5’-adenyl pyrophosphoryl moiety. In the absence of ATP, this adapter can be ligated to the 3’ hydroxyl group of small RNA, while RNA self-ligation and concatenation are repressed. Pre-adenylated adapters are one of the most essential and costly components required for library preparation, and few are commercially available. Results We demonstrate that DNA oligo with 5’ phosphate and 3’ amine groups can be enzymatically adenylated by T4 RNA ligase 1 to generate customized pre-adenylated adapters. We have constructed and sequenced a small RNA library for tomato (Solanum lycopersicum using the T4 RNA ligase 1 adenylated adapter. Conclusion We provide an efficient and low-cost method for small RNA sequencing library preparation, which takes two days to complete and costs around $20 per library. This protocol has been tested in several plant species for small RNA sequencing including sweet potato, pepper, watermelon, and cowpea, and could be readily applied to any RNA samples.
Lectin cDNA and transgenic plants derived therefrom
Raikhel, Natasha V.
2000-10-03
Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.
Implication of SUMO E3 ligases in nucleotide excision repair.
Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji
2015-08-01
Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.
Avanesyan, Alina
2014-01-01
• Premise of the study: A PCR-based method of identifying ingested plant DNA in gut contents of Melanoplus grasshoppers was developed. Although previous investigations have focused on a variety of insects, there are no protocols available for plant DNA detection developed for grasshoppers, agricultural pests that significantly influence plant community composition. • Methods and Results: The developed protocol successfully used the noncoding region of the chloroplast trnL (UAA) gene and was tested in several feeding experiments. Plant DNA was obtained at seven time points post-ingestion from whole guts and separate gut sections, and was detectable up to 12 h post-ingestion in nymphs and 22 h post-ingestion in adult grasshoppers. • Conclusions: The proposed protocol is an effective, relatively quick, and low-cost method of detecting plant DNA from the grasshopper gut and its different sections. This has important applications, from exploring plant “movement” during food consumption, to detecting plant–insect interactions. PMID:25202604
DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli
International Nuclear Information System (INIS)
Dorson, J.W.; Moses, R.E.
1978-01-01
DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair
Real-Time PCR Quantification of Chloroplast DNA Supports DNA Barcoding of Plant Species.
Kikkawa, Hitomi S; Tsuge, Kouichiro; Sugita, Ritsuko
2016-03-01
Species identification from extracted DNA is sometimes needed for botanical samples. DNA quantification is required for an accurate and effective examination. If a quantitative assay provides unreliable estimates, a higher quantity of DNA than the estimated amount may be used in additional analyses to avoid failure to analyze samples from which extracting DNA is difficult. Compared with conventional methods, real-time quantitative PCR (qPCR) requires a low amount of DNA and enables quantification of dilute DNA solutions accurately. The aim of this study was to develop a qPCR assay for quantification of chloroplast DNA from taxonomically diverse plant species. An absolute quantification method was developed using primers targeting the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene using SYBR Green I-based qPCR. The calibration curve was generated using the PCR amplicon as the template. DNA extracts from representatives of 13 plant families common in Japan. This demonstrates that qPCR analysis is an effective method for quantification of DNA from plant samples. The results of qPCR assist in the decision-making will determine the success or failure of DNA analysis, indicating the possibility of optimization of the procedure for downstream reactions.
Directory of Open Access Journals (Sweden)
Zdepski Anna
2011-05-01
Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.
Kwun, H J; Wendzicki, J A; Shuda, Y; Moore, P S; Chang, Y
2017-12-07
The formation of a bipolar mitotic spindle is an essential process for the equal segregation of duplicated DNA into two daughter cells during mitosis. As a result of deregulated cellular signaling pathways, cancer cells often suffer a loss of genome integrity that might etiologically contribute to carcinogenesis. Merkel cell polyomavirus (MCV) small T (sT) oncoprotein induces centrosome overduplication, aneuploidy, chromosome breakage and the formation of micronuclei by targeting cellular ligases through a sT domain that also inhibits MCV large T oncoprotein turnover. These results provide important insight as to how centrosome number and chromosomal stability can be affected by the E3 ligase targeting capacity of viral oncoproteins such as MCV sT, which may contribute to Merkel cell carcinogenesis.
Origin and diversification of TRIM ubiquitin ligases.
Directory of Open Access Journals (Sweden)
Ignacio Marín
Full Text Available Most proteins of the TRIM family (also known as RBCC family are ubiquitin ligases that share a peculiar protein structure, characterized by including an N-terminal RING finger domain closely followed by one or two B-boxes. Additional protein domains found at their C termini have been used to classify TRIM proteins into classes. TRIMs are involved in multiple cellular processes and many of them are essential components of the innate immunity system of animal species. In humans, it has been shown that mutations in several TRIM-encoding genes lead to diverse genetic diseases and contribute to several types of cancer. They had been hitherto detected only in animals. In this work, by comprehensively analyzing the available diversity of TRIM and TRIM-like protein sequences and evaluating their evolutionary patterns, an improved classification of the TRIM family is obtained. Members of one of the TRIM subfamilies defined, called Subfamily A, turn to be present not only in animals, but also in many other eukaryotes, such as fungi, apusozoans, alveolates, excavates and plants. The rest of subfamilies are animal-specific and several of them originated only recently. Subfamily A proteins are characterized by containing a MATH domain, suggesting a potential evolutionary connection between TRIM proteins and a different type of ubiquitin ligases, known as TRAFs, which contain quite similar MATH domains. These results indicate that the TRIM family emerged much earlier than so far thought and contribute to our understanding of its origin and diversification. The structural and evolutionary links with the TRAF family of ubiquitin ligases can be experimentally explored to determine whether functional connections also exist.
Identification of Arabidopsis MYB56 as a novel substrate for CRL3BPM E3 ligases.
Chen, Liyuan; Bernhardt, Anne; Lee, JooHyun; Hellmann, Hanjo
2014-10-24
Controlled stability of proteins is a highly efficient mechanism to direct diverse processes in living cells. A key regulatory system for protein stability is given by the ubiquitin proteasome pathway, which uses E3 ligases to mark specific proteins for degradation. In this work MYB56 is identified as a novel target of a CULLIN3 (CUL3)-based E3 ligase. Its stability depends on the presence of MATH-BTB/POZ (BPM) proteins, which function as substrate adaptors to the E3 ligase. Genetic studies pointed out that MYB56 is a negative regulator of flowering, while BPMs positively affect this developmental program. The interaction between BPMs and MYB56 occurs at the promoter of FLOWERING LOCUS T (FT), a key regulator in initiating flowering in Arabidopsis, and results in instability of MYB56. Overall the work establishes MYB transcription factors as substrates of BPM proteins, and provides novel information on components that participate in controlling the flowering time point in plants. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.
Influence of the complexity of radiation-induced DNA damage on enzyme recognition
International Nuclear Information System (INIS)
Palmer, Philip
2002-01-01
Ionising radiation is unique in inducing DNA clustered damage together with the simple isolated lesions. Understanding how these complex lesions are recognised and repaired by the cell is key to understanding the health risks associated with radiation exposure. This study focuses on whether ionising radiation-induced complex single-strand breaks (SSB) are recognised by DNA-PK and PARP, and whether the complexity of DSB influence their ligation by either DNA ligase lV/XRCC4 (LX) complex or T4 DNA ligase. Plasmid DNA, irradiated in aqueous solution using sparsely ionising γ-rays and densely ionising α-particles produce different yields of complex DNA damages, used as substrates for in vitro DNA-PK and PARP activity assays. The activity of DNA-PK to phosphorylate a peptide was determined using HF19 cell nuclear extracts as a source of DNA-PK. PARP ADP-ribosylation activity was determined using purified PARP enzyme. The activation of DNA-PK and PARP by irradiated DNA is due to SSB and not the low yield of DSB (linear plasmid DNA <10%). A ∼2 fold increase in DNA-PK activation and a ∼3-fold reduction in PARP activity seen on increasing the ionising density of the radiation (proportion of complex damage) are proposed to reflect changes in the complexity of SSB and may relate to damage signalling. Complex DSB synthesised as double-stranded oligonucleotides, with a 2 bp 5'-overhang, and containing modified lesions, 8-oxoguanine and abasic sites, at known positions relative to the termini were used as substrates for in vitro ligation by DNA ligase IV/XRCC4 or T4 ligase. The presence of a modified lesion 2 or 3 bp but not 4 bp from the 3'-termini and 2 or 6 bp from the 5'-termini caused a drastic reduction in the extent of ligation. Therefore, the presence of modified lesions near to the termini of a DSB may compromise their rejoining by non-homologous end-joining (NHEJ) involving the LX complex. (author)
Directory of Open Access Journals (Sweden)
Yanming Wang
2015-06-01
Full Text Available Uncontrolled immune responses to intracellular DNA have been shown to induce autoimmune diseases. Homeostasis regulation of immune responses to cytosolic DNA is critical for limiting the risk of autoimmunity and survival of the host. Here, we report that the E3 ubiquitin ligase tripartite motif protein 30α (TRIM30α was induced by herpes simplex virus type 1 (HSV-1 infection in dendritic cells (DCs. Knockdown or genetic ablation of TRIM30α augmented the type I IFNs and interleukin-6 response to intracellular DNA and DNA viruses. Trim30α-deficient mice were more resistant to infection by DNA viruses. Biochemical analyses showed that TRIM30α interacted with the stimulator of interferon genes (STING, which is a critical regulator of the DNA-sensing response. Overexpression of TRIM30α promoted the degradation of STING via K48-linked ubiquitination at Lys275 through a proteasome-dependent pathway. These findings indicate that E3 ligase TRIM30α is an important negative-feedback regulator of innate immune responses to DNA viruses by targeting STING.
Polito, David; Cukras, Scott; Wang, Xiaozhe; Spence, Paige; Moreau, Lisa; D'Andrea, Alan D; Kee, Younghoon
2014-03-07
Fanconi anemia (FA) is a genome instability syndrome characterized by bone marrow failure and cellular hypersensitivity to DNA cross-linking agents. In response to DNA damage, the FA pathway is activated through the cooperation of 16 FA proteins. A central player in the pathway is a multisubunit E3 ubiquitin ligase complex or the FA core complex, which monoubiquitinates its substrates FANCD2 and FANCI. FANCE, a subunit of the FA core complex, plays an essential role by promoting the integrity of the complex and by directly recognizing FANCD2. To delineate its role in substrate ubiquitination from the core complex assembly, we analyzed a series of mutations within FANCE. We report that a phenylalanine located at the highly conserved extreme C terminus, referred to as Phe-522, is a critical residue for mediating the monoubiquitination of the FANCD2-FANCI complex. Using the FANCE mutant that specifically disrupts the FANCE-FANCD2 interaction as a tool, we found that the interaction-deficient mutant conferred cellular sensitivity in reconstituted FANCE-deficient cells to a similar degree as FANCE null cells, suggesting the significance of the FANCE-FANCD2 interaction in promoting cisplatin resistance. Intriguingly, ectopic expression of the FANCE C terminus fragment alone in FA normal cells disrupts DNA repair, consolidating the importance of the FANCE-FANCD2 interaction in the DNA cross-link repair.
Polito, David; Cukras, Scott; Wang, Xiaozhe; Spence, Paige; Moreau, Lisa; D'Andrea, Alan D.; Kee, Younghoon
2014-01-01
Fanconi anemia (FA) is a genome instability syndrome characterized by bone marrow failure and cellular hypersensitivity to DNA cross-linking agents. In response to DNA damage, the FA pathway is activated through the cooperation of 16 FA proteins. A central player in the pathway is a multisubunit E3 ubiquitin ligase complex or the FA core complex, which monoubiquitinates its substrates FANCD2 and FANCI. FANCE, a subunit of the FA core complex, plays an essential role by promoting the integrity of the complex and by directly recognizing FANCD2. To delineate its role in substrate ubiquitination from the core complex assembly, we analyzed a series of mutations within FANCE. We report that a phenylalanine located at the highly conserved extreme C terminus, referred to as Phe-522, is a critical residue for mediating the monoubiquitination of the FANCD2-FANCI complex. Using the FANCE mutant that specifically disrupts the FANCE-FANCD2 interaction as a tool, we found that the interaction-deficient mutant conferred cellular sensitivity in reconstituted FANCE-deficient cells to a similar degree as FANCE null cells, suggesting the significance of the FANCE-FANCD2 interaction in promoting cisplatin resistance. Intriguingly, ectopic expression of the FANCE C terminus fragment alone in FA normal cells disrupts DNA repair, consolidating the importance of the FANCE-FANCD2 interaction in the DNA cross-link repair. PMID:24451376
Nature of the end groups of breaks induced by ionizing radiation in dna in vivo
Energy Technology Data Exchange (ETDEWEB)
Gaziev, A I [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki
1975-01-01
DNA of gamma-irradiated E.coli cells contains singlestranded breaks with 5'Oh, 5'PO/sub 4/ and 3'OH ends assayed by phosphatase, polynucleotide kinase and DNA-ligase reactions. The number of breaks with 5'OH ends corresponds to the breaks detected by DNA sedimentation in alkaline sucrose gradient. The relative amount of breaks with different ends varies with the dose of irradiation. The majority of single-stranded breaks with 5'PO/sub 4/ and 3'OH ends in sealed by ligase.
Contribution of CoA ligases to benzenoid biosynthesis in petunia flowers.
Klempien, Antje; Kaminaga, Yasuhisa; Qualley, Anthony; Nagegowda, Dinesh A; Widhalm, Joshua R; Orlova, Irina; Shasany, Ajit Kumar; Taguchi, Goro; Kish, Christine M; Cooper, Bruce R; D'Auria, John C; Rhodes, David; Pichersky, Eran; Dudareva, Natalia
2012-05-01
Biosynthesis of benzoic acid from Phe requires shortening of the side chain by two carbons, which can occur via the β-oxidative or nonoxidative pathways. The first step in the β-oxidative pathway is cinnamoyl-CoA formation, likely catalyzed by a member of the 4-coumarate:CoA ligase (4CL) family that converts a range of trans-cinnamic acid derivatives into the corresponding CoA thioesters. Using a functional genomics approach, we identified two potential CoA-ligases from petunia (Petunia hybrida) petal-specific cDNA libraries. The cognate proteins share only 25% amino acid identity and are highly expressed in petunia corollas. Biochemical characterization of the recombinant proteins revealed that one of these proteins (Ph-4CL1) has broad substrate specificity and represents a bona fide 4CL, whereas the other is a cinnamate:CoA ligase (Ph-CNL). RNA interference suppression of Ph-4CL1 did not affect the petunia benzenoid scent profile, whereas downregulation of Ph-CNL resulted in a decrease in emission of benzylbenzoate, phenylethylbenzoate, and methylbenzoate. Green fluorescent protein localization studies revealed that the Ph-4CL1 protein is localized in the cytosol, whereas Ph-CNL is in peroxisomes. Our results indicate that subcellular compartmentalization of enzymes affects their involvement in the benzenoid network and provide evidence that cinnamoyl-CoA formation by Ph-CNL in the peroxisomes is the committed step in the β-oxidative pathway.
DNA barcoding as a means for identifying medicinal plants of Pakistan
International Nuclear Information System (INIS)
Schori, M.; Showalter, A.M.
2011-01-01
DNA barcoding involves the generation of DNA sequencing data from particular genetic regions in an organism and the use of these sequence data to identify or 'barcode' that organism and distinguish it from other species. Here, DNA barcoding is being used to identify several medicinal plants found in Pakistan and distinguished them from other similar species. Several challenges to the successful implementation of plant DNA barcoding are presented and discussed. Despite these challenges, DNA barcoding has the potential to uniquely identify medicinal plants and provide quality control and standardization of the plant material supplied to the pharmaceutical industry. (author)
DNA internal standard for the quantitative determination of hallucinogenic plants in plant mixtures.
Luciano, Pino; Bertea, Cinzia M; Temporale, Giovanni; Maffei, Massimo E
2007-12-01
Here, we show a new, simple, and rapid SYBR Green-based Real-Time PCR assay for the quantification of hallucinogenic plants in plant mixtures. As a test plant, Salvia divinorum Epling & Játiva-M., a perennial herb belonging to the Lamiaceae family able to induce hallucinations, changes in perception, or other psychologically induced changes with similar potency as LSD, was used. The method was tested on seven mixtures 100/0%, 80/20%, 60/40%, 40/60%, 20/80%, 10/90%, 0/100% (w/w) S. divinorum versus a non-hallucinogenic plant, Salvia officinalis. Total DNA was extracted from samples and quantified by Real-Time PCR. Arabidopsis thaliana genomic DNA was added, as internal standard, at the beginning of each extraction. A new formula for the interpretation of Real-Time PCR data, based on the relative quantification of DNA extracted from mixture versus a reference DNA extracted from a known amount of pure S. divinorum, was developed. The results of this work show an almost perfect correspondence between Real-Time PCR-calculated weight and the weight estimated by an analytical weighted method, proving the effectiveness of this method for the quantitative analysis of a given species in a plant mixture.
Tichy, Elisia D; Pillai, Resmi; Deng, Li; Liang, Li; Tischfield, Jay; Schwemberger, Sandy J; Babcock, George F; Stambrook, Peter J
2010-11-01
Embryonic stem (ES) cells give rise to all cell types of an organism. Since mutations at this embryonic stage would affect all cells and be detrimental to the overall health of an organism, robust mechanisms must exist to ensure that genomic integrity is maintained. To test this proposition, we compared the capacity of murine ES cells to repair DNA double-strand breaks with that of differentiated cells. Of the 2 major pathways that repair double-strand breaks, error-prone nonhomologous end joining (NHEJ) predominated in mouse embryonic fibroblasts, whereas the high fidelity homologous recombinational repair (HRR) predominated in ES cells. Microhomology-mediated end joining, an emerging repair pathway, persisted at low levels in all cell types examined. The levels of proteins involved in HRR and microhomology-mediated end joining were highly elevated in ES cells compared with mouse embryonic fibroblasts, whereas those for NHEJ were quite variable, with DNA Ligase IV expression low in ES cells. The half-life of DNA Ligase IV protein was also low in ES cells. Attempts to increase the abundance of DNA Ligase IV protein by overexpression or inhibition of its degradation, and thereby elevate NHEJ in ES cells, were unsuccessful. When ES cells were induced to differentiate, however, the level of DNA Ligase IV protein increased, as did the capacity to repair by NHEJ. The data suggest that preferential use of HRR rather than NHEJ may lend ES cells an additional layer of genomic protection and that the limited levels of DNA Ligase IV may account for the low level of NHEJ activity.
Overcoming DNA extraction problems from carnivorous plants
Directory of Open Access Journals (Sweden)
Fleischmann, Andreas
2009-12-01
Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.
Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.
Successful modification of plant cell wall composition without compromising plant integrity is dependent on being able to modify the expression of specific genes, but can be very challenging when the target genes are members of multigene families. 4-Coumarate:CoA ligase (4CL) catalyzes the formatio...
Lindahl, Tomas
2013-02-01
I completed my medical studies at the Karolinska Institute in Stockholm but have always been devoted to basic research. My longstanding interest is to understand fundamental DNA repair mechanisms in the fields of cancer therapy, inherited human genetic disorders and ancient DNA. I initially measured DNA decay, including rates of base loss and cytosine deamination. I have discovered several important DNA repair proteins and determined their mechanisms of action. The discovery of uracil-DNA glycosylase defined a new category of repair enzymes with each specialized for different types of DNA damage. The base excision repair pathway was first reconstituted with human proteins in my group. Cell-free analysis for mammalian nucleotide excision repair of DNA was also developed in my laboratory. I found multiple distinct DNA ligases in mammalian cells, and led the first genetic and biochemical work on DNA ligases I, III and IV. I discovered the mammalian exonucleases DNase III (TREX1) and IV (FEN1). Interestingly, expression of TREX1 was altered in some human autoimmune diseases. I also showed that the mutagenic DNA adduct O(6)-methylguanine (O(6)mG) is repaired without removing the guanine from DNA, identifying a surprising mechanism by which the methyl group is transferred to a residue in the repair protein itself. A further novel process of DNA repair discovered by my research group is the action of AlkB as an iron-dependent enzyme carrying out oxidative demethylation. Copyright © 2013. Production and hosting by Elsevier Ltd.
Ultra-fast repair of single-strand breaks in DNA of. gamma. -irradiated Chinese hamster cells
Energy Technology Data Exchange (ETDEWEB)
Leontjeva, G A; Mantzighin, Yu A; Gaziev, A I [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki
1976-12-01
Studies of the effect of thermal treatment of Chinese hamster cells on sedimentation of DNA in the alkaline sucrose gradient showed that heating the cells to 68/sup 0/C for 15 min caused the same degradation as ..gamma..-irradiation with 5 to 7 krad at 37/sup 0/C. The inhibition of cellular repair enzymes by heating was therefore unacceptable. The process of ultra-fast repair is essentially determined by the DNA-ligase reaction, which is activated in the presence of Mg ions, and inhibited in mammalian cells in the presence of EDTA and pyrophosphate. Sedimentation profiles were therefore measured for the DNA of Chinese hamster cells ..gamma..-irradiated (5 krad) at 0/sup 0/C or 22/sup 0/C in the presence of Mg/sup + +/, or EDTA and pyrophosphate, and the results demonstrated ultra-fast repair only at 20 to 37/sup 0/C, in contrast to bacteria. A study was made of the temperature dependence of the activity of the DNA ligases isolated from E.coli and rabbit bone marrow. The NAD-dependent bacterial DNA ligase was active at temperatures from 0 to 40/sup 0/C, whereas ATP-dependent DNA ligase of mammals only showed activity in the range 15 to 40/sup 0/C. The differing temperature dependences of ultra-fast repair in bacterial and mammalian cells are in agreement with the temperature dependences of the activities of isolated enzymes, and the results suggest that the process of ultra-fast repair of single-strand breaks of DNA takes place in both bacterial and mammalian cells.
Directory of Open Access Journals (Sweden)
Beatriz Orosa
2017-01-01
Full Text Available Hypersensitive response programmed cell death (HR-PCD is a critical feature in plant immunity required for pathogen restriction and prevention of disease development. The precise control of this process is paramount to cell survival and an effective immune response. The discovery of new components that function to suppress HR-PCD will be instrumental in understanding the regulation of this fundamental mechanism. Here we report the identification and characterisation of a BTB domain E3 ligase protein, POB1, that functions to suppress HR-PCD triggered by evolutionarily diverse pathogens. Nicotiana benthamiana and tobacco plants with reduced POB1 activity show accelerated HR-PCD whilst those with increased POB1 levels show attenuated HR-PCD. We demonstrate that POB1 dimerization and nuclear localization are vital for its function in HR-PCD suppression. Using protein-protein interaction assays, we identify the Plant U-Box E3 ligase PUB17, a well established positive regulator of plant innate immunity, as a target for POB1-mediated proteasomal degradation. Using confocal imaging and in planta immunoprecipitation assays we show that POB1 interacts with PUB17 in the nucleus and stimulates its degradation. Mutated versions of POB1 that show reduced interaction with PUB17 fail to suppress HR-PCD, indicating that POB1-mediated degradation of PUB17 U-box E3 ligase is an important step for negative regulation of specific immune pathways in plants. Our data reveals a new mechanism for BTB domain proteins in suppressing HR-PCD in plant innate immune responses.
SUMO-targeted ubiquitin ligases.
Sriramachandran, Annie M; Dohmen, R Jürgen
2014-01-01
Covalent posttranslational modification with SUMO (small ubiquitin-related modifier) modulates functions of a wide range of proteins in eukaryotic cells. Sumoylation affects the activity, interaction properties, subcellular localization and the stability of its substrate proteins. The recent discovery of a novel class of ubiquitin ligases (E3), termed ULS (E3-S) or STUbL, that recognize sumoylated proteins, links SUMO modification to the ubiquitin/proteasome system. Here we review recent insights into the properties and function of these ligases and their roles in regulating sumoylated proteins. This article is part of a Special Issue entitled: Ubiquitin-Proteasome System. Guest Editors: Thomas Sommer and Dieter H. Wolf. © 2013. Published by Elsevier B.V. All rights reserved.
DNA Damage Repair System in Plants: A Worldwide Research Update.
Gimenez, Estela; Manzano-Agugliaro, Francisco
2017-10-30
Living organisms are usually exposed to various DNA damaging agents so the mechanisms to detect and repair diverse DNA lesions have developed in all organisms with the result of maintaining genome integrity. Defects in DNA repair machinery contribute to cancer, certain diseases, and aging. Therefore, conserving the genomic sequence in organisms is key for the perpetuation of life. The machinery of DNA damage repair (DDR) in prokaryotes and eukaryotes is similar. Plants also share mechanisms for DNA repair with animals, although they differ in other important details. Plants have, surprisingly, been less investigated than other living organisms in this context, despite the fact that numerous lethal mutations in animals are viable in plants. In this manuscript, a worldwide bibliometric analysis of DDR systems and DDR research in plants was made. A comparison between both subjects was accomplished. The bibliometric analyses prove that the first study about DDR systems in plants (1987) was published thirteen years later than that for other living organisms (1975). Despite the increase in the number of papers about DDR mechanisms in plants in recent decades, nowadays the number of articles published each year about DDR systems in plants only represents 10% of the total number of articles about DDR. The DDR research field was done by 74 countries while the number of countries involved in the DDR & Plant field is 44. This indicates the great influence that DDR research in the plant field currently has, worldwide. As expected, the percentage of studies published about DDR systems in plants has increased in the subject area of agricultural and biological sciences and has diminished in medicine with respect to DDR studies in other living organisms. In short, bibliometric results highlight the current interest in DDR research in plants among DDR studies and can open new perspectives in the research field of DNA damage repair.
Specificity of DNA import into isolated mitochondria from plants and mammals
Directory of Open Access Journals (Sweden)
Koulintchenko M. V.
2014-01-01
Full Text Available Aim. Investigation of different features of DNA import into plant and human mitochondria, for a better understanding of mitochondrial genetics and generation of biotechnological tools. Methods. DNA up-take experiments with isolated plant mitochondria, using as substrates various sequences associated or not with the specific terminal inverted repeats (TIRs present at each end of the plant mitochondrial linear plasmids. Results. It was established that the DNA import efficiency has a non-linear dependence on DNA size. It was shown that import into plant mitochondria of DNA molecules of «medium» sizes, i. e. between 4 and 7 kb, barely has any sequence specificity: neither TIRs from the 11.6 kb Brassica plasmid, nor TIRs from the Zea mays S-plasmids influenced DNA import into Solanum tuberosum mitochondria. Conclusions. The data obtained support the hypothesis about species-specific import mechanism operating under the mitochondrial linear plasmids transfer into plant mitochondria.
Contribution of CoA Ligases to Benzenoid Biosynthesis in Petunia Flowers[W
Klempien, Antje; Kaminaga, Yasuhisa; Qualley, Anthony; Nagegowda, Dinesh A.; Widhalm, Joshua R.; Orlova, Irina; Shasany, Ajit Kumar; Taguchi, Goro; Kish, Christine M.; Cooper, Bruce R.; D’Auria, John C.; Rhodes, David; Pichersky, Eran; Dudareva, Natalia
2012-01-01
Biosynthesis of benzoic acid from Phe requires shortening of the side chain by two carbons, which can occur via the β-oxidative or nonoxidative pathways. The first step in the β-oxidative pathway is cinnamoyl-CoA formation, likely catalyzed by a member of the 4-coumarate:CoA ligase (4CL) family that converts a range of trans-cinnamic acid derivatives into the corresponding CoA thioesters. Using a functional genomics approach, we identified two potential CoA-ligases from petunia (Petunia hybrida) petal-specific cDNA libraries. The cognate proteins share only 25% amino acid identity and are highly expressed in petunia corollas. Biochemical characterization of the recombinant proteins revealed that one of these proteins (Ph-4CL1) has broad substrate specificity and represents a bona fide 4CL, whereas the other is a cinnamate:CoA ligase (Ph-CNL). RNA interference suppression of Ph-4CL1 did not affect the petunia benzenoid scent profile, whereas downregulation of Ph-CNL resulted in a decrease in emission of benzylbenzoate, phenylethylbenzoate, and methylbenzoate. Green fluorescent protein localization studies revealed that the Ph-4CL1 protein is localized in the cytosol, whereas Ph-CNL is in peroxisomes. Our results indicate that subcellular compartmentalization of enzymes affects their involvement in the benzenoid network and provide evidence that cinnamoyl-CoA formation by Ph-CNL in the peroxisomes is the committed step in the β-oxidative pathway. PMID:22649270
Regulation and function of DNA methylation in plants and animals
He, Xinjian
2011-02-15
DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.
Analysis of T-DNA/Host-Plant DNA Junction Sequences in Single-Copy Transgenic Barley Lines
Directory of Open Access Journals (Sweden)
Joanne G. Bartlett
2014-01-01
Full Text Available Sequencing across the junction between an integrated transfer DNA (T-DNA and a host plant genome provides two important pieces of information. The junctions themselves provide information regarding the proportion of T-DNA which has integrated into the host plant genome, whilst the transgene flanking sequences can be used to study the local genetic environment of the integrated transgene. In addition, this information is important in the safety assessment of GM crops and essential for GM traceability. In this study, a detailed analysis was carried out on the right-border T-DNA junction sequences of single-copy independent transgenic barley lines. T-DNA truncations at the right-border were found to be relatively common and affected 33.3% of the lines. In addition, 14.3% of lines had rearranged construct sequence after the right border break-point. An in depth analysis of the host-plant flanking sequences revealed that a significant proportion of the T-DNAs integrated into or close to known repetitive elements. However, this integration into repetitive DNA did not have a negative effect on transgene expression.
Vaghchhipawala, Zarir E.; Vasudevan, Balaji; Lee, Seonghee; Morsy, Mustafa R.; Mysore, Kirankumar S.
2012-01-01
Agrobacterium tumefaciens is a soilborne pathogen that causes crown gall disease in many dicotyledonous plants by transfer of a portion of its tumor-inducing plasmid (T-DNA) into the plant genome. Several plant factors that play a role in Agrobacterium attachment to plant cells and transport of T-DNA to the nucleus have been identified, but the T-DNA integration step during transformation is poorly understood and has been proposed to occur via nonhomologous end-joining (NHEJ)–mediated double-strand DNA break (DSB) repair. Here, we report a negative role of X-RAY CROSS COMPLEMENTATION GROUP4 (XRCC4), one of the key proteins required for NHEJ, in Agrobacterium T-DNA integration. Downregulation of XRCC4 in Arabidopsis and Nicotiana benthamiana increased stable transformation due to increased T-DNA integration. Overexpression of XRCC4 in Arabidopsis decreased stable transformation due to decreased T-DNA integration. Interestingly, XRCC4 directly interacted with Agrobacterium protein VirE2 in a yeast two-hybrid system and in planta. VirE2-expressing Arabidopsis plants were more susceptible to the DNA damaging chemical bleomycin and showed increased stable transformation. We hypothesize that VirE2 titrates or excludes active XRCC4 protein available for DSB repair, thus delaying the closure of DSBs in the chromosome, providing greater opportunity for T-DNA to integrate. PMID:23064322
A conserved role for the ARC1 E3 ligase in Brassicaceae self-incompatibility
Directory of Open Access Journals (Sweden)
Daphne eGoring
2014-05-01
Full Text Available Ubiquitination plays essential roles in the regulation of many processes in plants including pollen rejection in self-incompatible species. In the Brassicaceae (mustard family, self-incompatibility drives the rejection of self-pollen by preventing pollen hydration following pollen contact with the stigmatic surface. Self-pollen is recognized by a ligand-receptor pair: the pollen S-locus Cysteine Rich/S-locus Protein 11 (SCR/SP11 ligand and the pistil S Receptor Kinase (SRK. Following self-pollen contact, the SCR/SP11 ligand on the pollen surface binds to SRK on the pistil surface, and the SRK-activated signaling pathway is initiated. This pathway includes the ARM Repeat Containing 1 (ARC1 protein, a member of the Plant U-box (PUB family of E3 ubiquitin ligases. ARC1 is a functional E3 ligase and is required downstream of SRK for the self-incompatibility response. This mini review highlights our recent progress in establishing ARC1’s conserved role in self-pollen rejection in Brassica and Arabidopsis species and discusses future research directions in this field.
Pendini, Nicole R; Yap, Min Y; Traore, D A K; Polyak, Steven W; Cowieson, Nathan P; Abell, Andrew; Booker, Grant W; Wallace, John C; Wilce, Jacqueline A; Wilce, Matthew C J
2013-06-01
The essential metabolic enzyme biotin protein ligase (BPL) is a potential target for the development of new antibiotics required to combat drug-resistant pathogens. Staphylococcus aureus BPL (SaBPL) is a bifunctional protein, possessing both biotin ligase and transcription repressor activities. This positions BPL as a key regulator of several important metabolic pathways. Here, we report the structural analysis of both holo- and apo-forms of SaBPL using X-ray crystallography. We also present small-angle X-ray scattering data of SaBPL in complex with its biotin-carboxyl carrier protein substrate as well as the SaBPL:DNA complex that underlies repression. This has revealed the molecular basis of ligand (biotinyl-5'-AMP) binding and conformational changes associated with catalysis and repressor function. These data provide new information to better understand the bifunctional activities of SaBPL and to inform future strategies for antibiotic discovery. © 2013 The Protein Society.
Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S
2015-06-01
Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.
The E3 ubiquitin ligase RNF185 facilitates the cGAS-mediated innate immune response.
Directory of Open Access Journals (Sweden)
Qiang Wang
2017-03-01
Full Text Available The cyclic GMP-AMP synthase (cGAS, upon cytosolic DNA stimulation, catalyzes the formation of the second messenger 2'3'-cGAMP, which then binds to stimulator of interferon genes (STING and activates downstream signaling. It remains to be elucidated how the cGAS enzymatic activity is modulated dynamically. Here, we reported that the ER ubiquitin ligase RNF185 interacted with cGAS during HSV-1 infection. Ectopic-expression or knockdown of RNF185 respectively enhanced or impaired the IRF3-responsive gene expression. Mechanistically, RNF185 specifically catalyzed the K27-linked poly-ubiquitination of cGAS, which promoted its enzymatic activity. Additionally, Systemic Lupus Erythematosus (SLE patients displayed elevated expression of RNF185 mRNA. Collectively, this study uncovers RNF185 as the first E3 ubiquitin ligase of cGAS, shedding light on the regulation of cGAS activity in innate immune responses.
Molecular DNA identification of medicinal plants used by traditional healers in Malaysia.
Aziz, N A A; Ahmad, M I; Naim, D M
2015-12-07
Plants have been used throughout human history for food and medicine. However, many plants are toxic, and cannot easily be morphologically distinguished from non-toxic plants. DNA identification solves this problem and is widely used. Nonetheless, plant DNA barcode identification faces a number of challenges, and many studies have been conducted to find suitable barcodes. The present study was conducted to test the efficiency of commonly used primers, namely ITS2, rpoC1, and trnH-psbA, in order to find the best DNA barcode markers for the identification of medicinal plants in Malaysia. Fresh leaves from 12 medicinal plants that are commonly used by Malay traditional healers were collected from the Tropical Spice Garden, Pulau Pinang, and subjected to polymerase chain reaction amplification using ITS2, rpoC1, and trnH-psbA DNA markers. We found that trnH-psbA is the best DNA marker for the species-level identification of medicinal plants in Malaysia.
Spampinato, Claudia P
2017-05-01
The genome integrity of all organisms is constantly threatened by replication errors and DNA damage arising from endogenous and exogenous sources. Such base pair anomalies must be accurately repaired to prevent mutagenesis and/or lethality. Thus, it is not surprising that cells have evolved multiple and partially overlapping DNA repair pathways to correct specific types of DNA errors and lesions. Great progress in unraveling these repair mechanisms at the molecular level has been made by several talented researchers, among them Tomas Lindahl, Aziz Sancar, and Paul Modrich, all three Nobel laureates in Chemistry for 2015. Much of this knowledge comes from studies performed in bacteria, yeast, and mammals and has impacted research in plant systems. Two plant features should be mentioned. Plants differ from higher eukaryotes in that they lack a reserve germline and cannot avoid environmental stresses. Therefore, plants have evolved different strategies to sustain genome fidelity through generations and continuous exposure to genotoxic stresses. These strategies include the presence of unique or multiple paralogous genes with partially overlapping DNA repair activities. Yet, in spite (or because) of these differences, plants, especially Arabidopsis thaliana, can be used as a model organism for functional studies. Some advantages of this model system are worth mentioning: short life cycle, availability of both homozygous and heterozygous lines for many genes, plant transformation techniques, tissue culture methods and reporter systems for gene expression and function studies. Here, I provide a current understanding of DNA repair genes in plants, with a special focus on A. thaliana. It is expected that this review will be a valuable resource for future functional studies in the DNA repair field, both in plants and animals.
Maintaining epigenetic inheritance during DNA replication in plants
Directory of Open Access Journals (Sweden)
Francisco eIglesias
2016-02-01
Full Text Available Biotic and abiotic stresses alter the pattern of gene expression in plants. Depending on the frequency and duration of stress events, the effects on the transcriptional state of genes are remembered temporally or transmitted to daughter cells and, in some instances, even to offspring (transgenerational epigenetic inheritance. This memory effect, which can be found even in the absence of the original stress, has an epigenetic basis, through molecular mechanisms that take place at the chromatin and DNA level but do not imply changes in the DNA sequence. Many epigenetic mechanisms have been described and involve covalent modifications on the DNA and histones, such as DNA methylation, histone acetylation and methylation, and RNAi dependent silencing mechanisms. Some of these chromatin modifications need to be stable through cell division in order to be truly epigenetic. During DNA replication, histones are recycled during the formation of the new nucleosomes and this process is tightly regulated. Perturbations to the DNA replication process and/or the recycling of histones lead to epigenetic changes. In this mini-review, we discuss recent evidence aimed at linking DNA replication process to epigenetic inheritance in plants.
Use of DNA barcodes to identify flowering plants
Kress, W. John; Wurdack, Kenneth J.; Zimmer, Elizabeth A.; Weigt, Lee A.; Janzen, Daniel H.
2005-01-01
Methods for identifying species by using short orthologous DNA sequences, known as “DNA barcodes,” have been proposed and initiated to facilitate biodiversity studies, identify juveniles, associate sexes, and enhance forensic analyses. The cytochrome c oxidase 1 sequence, which has been found to be widely applicable in animal barcoding, is not appropriate for most species of plants because of a much slower rate of cytochrome c oxidase 1 gene evolution in higher plants than in animals. We ther...
DEFF Research Database (Denmark)
Mosbech, Anna; Lukas, Claudia; Bekker-Jensen, Simon
2013-01-01
Protein recruitment to DNA double-strand breaks (DSBs) relies on ubiquitylation of the surrounding chromatin by the RING finger ubiquitin ligases RNF8 and RNF168. Flux through this pathway is opposed by several deubiquitylating enzymes (DUBs), including OTUB1 and USP3. By analyzing the effect...... of individually overexpressing the majority of human DUBs on RNF8/RNF168-mediated 53BP1 retention at DSB sites, we found that USP44 and USP29 powerfully inhibited this response at the level of RNF168 accrual. Both USP44 and USP29 promoted efficient deubiquitylation of histone H2A, but unlike USP44, USP29...... displayed non-specific reactivity towards ubiquitylated substrates. Moreover, USP44 but not other H2A DUBs was recruited to RNF168-generated ubiquitylation products at DSB sites. Individual depletion of these DUBs only mildly enhanced accumulation of ubiquitin conjugates and 53BP1 at DSBs, suggesting...
An Examination of the Plastid DNA of Hypohaploid Nicotiana plumbaginifolia Plants
Cannon, Gordon C.; Van, K. Tran Thanh; Heinhorst, Sabine; Trinh, T. H.; Weissbach, Arthur
1989-01-01
DNA was extracted from different morphological types of hypohaploid Nicotiana plumbaginifolia plants. The cellular levels of chloroplast DNA (expressed as percent of total DNA) were found to be approximately two- to threefold higher in two albino hypohaploids than in a green hypohaploid. The level of chloroplast DNA in the green hypohaploid was not significantly different from either in vitro or in vivo grown haploid N. plumbaginifolia plants. Molecular hybridization with DNA probes for the large subunit of ribulose bisphosphate carboxylase from spinach and with Pvull fragments representing the entire Nicotiana tabacum chloroplast genome revealed no gross qualitative differences in the chloroplast DNAs of hypohaploid plants. Based on these observations we have concluded that the lack of chloroplast function observed in the albino forms of hypohaploid N. plumbaginifolia plants is not due to changes in the chloroplast genome. Images Figure 1 Figure 2 PMID:16666781
HSV-1 ICP0: An E3 Ubiquitin Ligase That Counteracts Host Intrinsic and Innate Immunity
Directory of Open Access Journals (Sweden)
Mirna Perusina Lanfranca
2014-05-01
Full Text Available The herpes simplex virus type 1 (HSV-1 encoded E3 ubiquitin ligase, infected cell protein 0 (ICP0, is required for efficient lytic viral replication and regulates the switch between the lytic and latent states of HSV-1. As an E3 ubiquitin ligase, ICP0 directs the proteasomal degradation of several cellular targets, allowing the virus to counteract different cellular intrinsic and innate immune responses. In this review, we will focus on how ICP0’s E3 ubiquitin ligase activity inactivates the host intrinsic defenses, such as nuclear domain 10 (ND10, SUMO, and the DNA damage response to HSV-1 infection. In addition, we will examine ICP0’s capacity to impair the activation of interferon (innate regulatory mediators that include IFI16 (IFN γ-inducible protein 16, MyD88 (myeloid differentiation factor 88, and Mal (MyD88 adaptor-like protein. We will also consider how ICP0 allows HSV-1 to evade activation of the NF-κB (nuclear factor kappa B inflammatory signaling pathway. Finally, ICP0’s paradoxical relationship with USP7 (ubiquitin specific protease 7 and its roles in intrinsic and innate immune responses to HSV-1 infection will be discussed.
Identification of Arabidopsis MYB56 as a novel substrate for CRL3(BPM) E3 ligases.
Chen, Liyuan; Bernhardt, Anne; Lee, JooHyun; Hellmann, Hanjo
2015-02-01
Controlled stability of proteins is a highly efficient mechanism to direct diverse processes in living cells. A key regulatory system for protein stability is given by the ubiquitin proteasome pathway, which uses E3 ligases to mark specific proteins for degradation. In this work, MYB56 is identified as a novel target of a CULLIN3 (CUL3)-based E3 ligase. Its stability depends on the presence of MATH-BTB/POZ (BPM) proteins, which function as substrate adaptors to the E3 ligase. Genetic studies have indicated that MYB56 is a negative regulator of flowering, while BPMs positively affect this developmental program. The interaction between BPMs and MYB56 occurs at the promoter of FLOWERING LOCUS T (FT), a key regulator in initiating flowering in Arabidopsis, and results in instability of MYB56. Overall the work establishes MYB transcription factors as substrates of BPM proteins, and provides novel information on components that participate in controlling flowering time in plants. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
Two mini-preparation protocols to DNA extraction from plants with ...
African Journals Online (AJOL)
Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...
Recent advances in DNA repair and recombination.
Iwanejko, L A; Jones, N J
1998-09-11
The subjects of the talks at this 1-day DNA Repair Network meeting, held at City University, London on December 15, 1997, encompassed a range of topics and reflected some of the current areas of research in the United Kingdom. Topics included DNA double-strand break repair, V(D)J recombination, DNA ligases, the RecQ family of helicases and Bloom's syndrome, UVB and immunosuppression, the repair of oxidative damage and mismatch repair mechanisms.
Functional Characterization of the Apple RING E3 Ligase MdMIEL1 in Transgenic Arabidopsis
Directory of Open Access Journals (Sweden)
Jianping AN
2017-03-01
Full Text Available E3 ubiquitin ligases are involved in various physiological processes, and they play pivotal roles in growth and development. In this study, we identified a previously unknown gene in the apple fruit (Malus × domestica and named it MdMIEL1. The MdMIEL1 gene encoded a protein that contained a zinc-finger domain at its N-terminus and a RING-finger motif at its C-terminus. To investigate MdMIEL1 functions, we generated transgenic Arabidopsis lines expressing the MdMIEL1 gene under the control of the Cauliflower mosaic virus 35S promoter. Interestingly, ectopic expression of MdMIEL1 in Arabidopsis produced multiple phenotypes, including early germination, early flowering and a lateral root number increase relative to wild-type plants. Further analysis indicated that MdMIEL1 regulated lateral root initiation by increasing auxin accumulation in the roots. In a word, these results suggest that, MdMIEL1 as a novel RING-finger ubiquitin ligase influences plant growth and development, and highlight that MdMIEL1 regulates lateral root growth.
Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants
Directory of Open Access Journals (Sweden)
Yang Moon-Sik
2004-09-01
Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.
Boboila, Cristian; Jankovic, Mila; Yan, Catherine T; Wang, Jing H; Wesemann, Duane R; Zhang, Tingting; Fazeli, Alex; Feldman, Lauren; Nussenzweig, Andre; Nussenzweig, Michel; Alt, Frederick W
2010-02-16
Class switch recombination (CSR) in B lymphocytes is initiated by introduction of multiple DNA double-strand breaks (DSBs) into switch (S) regions that flank immunoglobulin heavy chain (IgH) constant region exons. CSR is completed by joining a DSB in the donor S mu to a DSB in a downstream acceptor S region (e.g., S gamma1) by end-joining. In normal cells, many CSR junctions are mediated by classical nonhomologous end-joining (C-NHEJ), which employs the Ku70/80 complex for DSB recognition and XRCC4/DNA ligase 4 for ligation. Alternative end-joining (A-EJ) mediates CSR, at reduced levels, in the absence of C-NHEJ, even in combined absence of Ku70 and ligase 4, demonstrating an A-EJ pathway totally distinct from C-NHEJ. Multiple DSBs are introduced into S mu during CSR, with some being rejoined or joined to each other to generate internal switch deletions (ISDs). In addition, S-region DSBs can be joined to other chromosomes to generate translocations, the level of which is increased by absence of a single C-NHEJ component (e.g., XRCC4). We asked whether ISD and S-region translocations occur in the complete absence of C-NHEJ (e.g., in Ku70/ligase 4 double-deficient B cells). We found, unexpectedly, that B-cell activation for CSR generates substantial ISD in both S mu and S gamma1 and that ISD in both is greatly increased by the absence of C-NHEJ. IgH chromosomal translocations to the c-myc oncogene also are augmented in the combined absence of Ku70 and ligase 4. We discuss the implications of these findings for A-EJ in normal and abnormal DSB repair.
An improved method of DNA extraction from plants for pathogen ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.
The effect of vinblastine on DNA metabolism in tumour cells
International Nuclear Information System (INIS)
Cabela, E.; Klein, W.
1976-01-01
Studies on the influence of Vinblastine on normal and tumor cells show that semiconservative DNA-synthesis correlates with the enzymatic activity of thymidinkinase. DNA-repair-investigations performed with Yoshida-Ascites cells indicate an inhibition effect on the ligase system after Vinblastine-treatment and gamma irradiation. (author)
Directory of Open Access Journals (Sweden)
Da-Wei Xin
Full Text Available Type 3 effector proteins secreted via the bacterial type 3 secretion system (T3SS are not only virulence factors of pathogenic bacteria, but also influence symbiotic interactions between nitrogen-fixing nodule bacteria (rhizobia and leguminous host plants. In this study, we characterized NopM (nodulation outer protein M of Rhizobium sp. strain NGR234, which shows sequence similarities with novel E3 ubiquitin ligase (NEL domain effectors from the human pathogens Shigella flexneri and Salomonella enterica. NopM expressed in Escherichia coli, but not the non-functional mutant protein NopM-C338A, showed E3 ubiquitin ligase activity in vitro. In vivo, NopM, but not inactive NopM-C338A, promoted nodulation of the host plant Lablab purpureus by NGR234. When NopM was expressed in yeast, it inhibited mating pheromone signaling, a mitogen-activated protein (MAP kinase pathway. When expressed in the plant Nicotiana benthamiana, NopM inhibited one part of the plant's defense response, as shown by a reduced production of reactive oxygen species (ROS in response to the flagellin peptide flg22, whereas it stimulated another part, namely the induction of defense genes. In summary, our data indicate the potential for NopM as a functional NEL domain E3 ubiquitin ligase. Our findings that NopM dampened the flg22-induced ROS burst in N. benthamiana but promoted defense gene induction are consistent with the concept that pattern-triggered immunity is split in two separate signaling branches, one leading to ROS production and the other to defense gene induction.
Czech Academy of Sciences Publication Activity Database
Waterworth, W.M.; Kozák, Jaroslav; Provost, C.M.; Bray, C.M.; Angelis, Karel; West, C.E.
2009-01-01
Roč. 9, art.no.79 (2009), s. 1-12 ISSN 1471-2229 R&D Projects: GA MŠk 1M0505; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50380511 Keywords : ARABIDOPSIS-THALIANA * T-DNA * COMET ASSAY Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.774, year: 2009
Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua
2009-03-01
A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.
DEFF Research Database (Denmark)
Cho, Seok Keun; Bae, Hansol; Ryu, Moonyoung
2015-01-01
and PUB23, two U-box E3 ligase homologs, tether ubiquitins to 19S proteasome regulatory particle (RP) subunit RPN6, leading to its degradation. RPN6 was identified as an interacting substrate of PUB22 by yeast two-hybrid screening, and in vitro pull-down assay confirmed that RPN6 interacts not only......Drought stress strongly affects plant growth and development, directly connected with crop yields, accordingly. However, related to the function of U-BOX E3 ligases, the underlying molecular mechanisms of desiccation stress response in plants are still largely unknown. Here we report that PUB22...
The influence of tolmetine on the DNA metabolism
International Nuclear Information System (INIS)
Klein, G.; Wottawa, A.; Altmann, H.
1975-07-01
The influence of the antirheumatic drug ''Tolmetin'' on DNA repair has been investigated. ''Tolmetin'' reduces DNA synthesis above a concentration of 100 μg/ml. On the other hand, it does not significantly inhibit any of the repair enzymes exonucleoase, polymerase and ligase. ''Tolmetin'' seems therefore not contraindicated in its use in rheuma therapy. (G.G.)
A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering.
Nørholm, Morten H H
2010-03-16
The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.
Matsuhashi, Saeko; Doi, Hideyuki; Fujiwara, Ayaka; Watanabe, Sonoko; Minamoto, Toshifumi
2016-01-01
The environmental DNA (eDNA) method has increasingly been recognized as a powerful tool for monitoring aquatic animal species; however, its application for monitoring aquatic plants is limited. To evaluate eDNA analysis for estimating the distribution of aquatic plants, we compared its estimated distributions with eDNA analysis, visual observation, and past distribution records for the submerged species Hydrilla verticillata. Moreover, we conducted aquarium experiments using H. verticillata and Egeria densa and analyzed the relationships between eDNA concentrations and plant biomass to investigate the potential for biomass estimation. The occurrences estimated by eDNA analysis closely corresponded to past distribution records, and eDNA detections were more frequent than visual observations, indicating that the method is potentially more sensitive. The results of the aquarium experiments showed a positive relationship between plant biomass and eDNA concentration; however, the relationship was not always significant. The eDNA concentration peaked within three days of the start of the experiment in most cases, suggesting that plants do not release constant amounts of DNA. These results showed that eDNA analysis can be used for distribution surveys, and has the potential to estimate the biomass of aquatic plants.
The MIEL1 E3 Ubiquitin Ligase Negatively Regulates Cuticular Wax Biosynthesis in Arabidopsis Stems.
Lee, Hong Gil; Kim, Juyoung; Suh, Mi Chung; Seo, Pil Joon
2017-07-01
Cuticular wax is an important hydrophobic layer that covers the plant aerial surface. Cuticular wax biosynthesis is shaped by multiple layers of regulation. In particular, a pair of R2R3-type MYB transcription factors, MYB96 and MYB30, are known to be the main participants in cuticular wax accumulation. Here, we report that the MYB30-INTERACTING E3 LIGASE 1 (MIEL1) E3 ubiquitin ligase controls the protein stability of the two MYB transcription factors and thereby wax biosynthesis in Arabidopsis. MIEL1-deficient miel1 mutants exhibit increased wax accumulation in stems, with up-regulation of wax biosynthetic genes targeted by MYB96 and MYB30. Genetic analysis reveals that wax accumulation of the miel1 mutant is compromised by myb96 or myb30 mutation, but MYB96 is mainly epistatic to MIEL1, playing a predominant role in cuticular wax deposition. These observations indicate that the MIEL1-MYB96 module is important for balanced cuticular wax biosynthesis in developing inflorescence stems. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
E3 ubiquitin ligases as drug targets and prognostic biomarkers in melanoma
Directory of Open Access Journals (Sweden)
Kristina Bielskienė
2015-01-01
E3 ligases are of interest as drug targets for their ability to regulate proteins stability and functions. Compared to the general proteasome inhibitor bortezomib, which blocks the entire protein degradation, drugs that target a particular E3 ligase are expected to have better selectivity with less associated toxicity. Components of different E3 ligases complexes (FBW7, MDM2, RBX1/ROC1, RBX2/ROC2, cullins and many others are known as oncogenes or tumor suppressors in melanomagenesis. These proteins participate in regulation of different cellular pathways and such important proteins in cancer development as p53 and Notch. In this review we summarized published data on the role of known E3 ligases in the development of melanoma and discuss the inhibitors of E3 ligases as a novel approach for the treatment of malignant melanomas.
DNA damage in plant herbarium tissue.
Staats, Martijn; Cuenca, Argelia; Richardson, James E; Vrielink-van Ginkel, Ria; Petersen, Gitte; Seberg, Ole; Bakker, Freek T
2011-01-01
Dried plant herbarium specimens are potentially a valuable source of DNA. Efforts to obtain genetic information from this source are often hindered by an inability to obtain amplifiable DNA as herbarium DNA is typically highly degraded. DNA post-mortem damage may not only reduce the number of amplifiable template molecules, but may also lead to the generation of erroneous sequence information. A qualitative and quantitative assessment of DNA post-mortem damage is essential to determine the accuracy of molecular data from herbarium specimens. In this study we present an assessment of DNA damage as miscoding lesions in herbarium specimens using 454-sequencing of amplicons derived from plastid, mitochondrial, and nuclear DNA. In addition, we assess DNA degradation as a result of strand breaks and other types of polymerase non-bypassable damage by quantitative real-time PCR. Comparing four pairs of fresh and herbarium specimens of the same individuals we quantitatively assess post-mortem DNA damage, directly after specimen preparation, as well as after long-term herbarium storage. After specimen preparation we estimate the proportion of gene copy numbers of plastid, mitochondrial, and nuclear DNA to be 2.4-3.8% of fresh control DNA and 1.0-1.3% after long-term herbarium storage, indicating that nearly all DNA damage occurs on specimen preparation. In addition, there is no evidence of preferential degradation of organelle versus nuclear genomes. Increased levels of C→T/G→A transitions were observed in old herbarium plastid DNA, representing 21.8% of observed miscoding lesions. We interpret this type of post-mortem DNA damage-derived modification to have arisen from the hydrolytic deamination of cytosine during long-term herbarium storage. Our results suggest that reliable sequence data can be obtained from herbarium specimens.
Mimura, Satoru; Yamaguchi, Tsuyoshi; Ishii, Satoru; Noro, Emiko; Katsura, Tomoya; Obuse, Chikashi; Kamura, Takumi
2010-01-01
The budding yeast, Saccharomyces cerevisiae, has three cullin proteins, which act as platforms for Cullin-based E3 ubiquitin ligases. Genetic evidence indicates that Cul8, together with Mms1, Mms22, and Esc4, is involved in the repair of DNA damage that can occur during DNA replication. Cul8 is thought to form a complex with these proteins, but the composition and the function of Cul8-based E3 ubiquitin ligases remain largely uncharacterized. Herein, we report a comprehensive biochemical anal...
International Nuclear Information System (INIS)
Billen, D.
1981-01-01
In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is observed. This is an exaggerated repair synthesis which can be abruptly terminated by the addition of the DNA ligase cofactor, nicotinamide adenine dinucleotide. This communication describes experiments which bear on the relationship between measurable strand breaks, DNA polymerase I-directed, exaggerated repair synthesis, and strand-break repair
Henke, Sarah K; Cronan, John E
2016-11-01
Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.
Deviating T-DNA transfer from Agrobacterium tumefaciens to plants
DEFF Research Database (Denmark)
van der Graaff, Eric; den Dulk-Ras, A; Hooykaas, P J
1996-01-01
-region. On the basis of the structure of the transferred DNA we propose that in these lines T-DNA transfer started at the left-border repeat, continued through the vector part, passed the right border repeat, and ended only after reaching again this left-border repeat.......We analyzed 29 T-DNA inserts in transgenic Arabidopsis thaliana plants for the junction of the right border sequences and the flanking plant DNA. DNA sequencing showed that in most lines the right border sequences transferred had been preserved during integration, corroborating literature data....... Surprisingly, in four independent transgenic lines a complete right border repeat was present followed by binary vector sequences. Cloning of two of these T-DNA inserts by plasmid rescue showed that in these lines the transferred DNA consisted of the complete binary vector sequences in addition to the T...
Virtual screening for potential inhibitors of bacterial MurC and MurD ligases.
Tomašić, Tihomir; Kovač, Andreja; Klebe, Gerhard; Blanot, Didier; Gobec, Stanislav; Kikelj, Danijel; Mašič, Lucija Peterlin
2012-03-01
Mur ligases are bacterial enzymes involved in the cytoplasmic steps of peptidoglycan biosynthesis and are viable targets for antibacterial drug discovery. We have performed virtual screening for potential ATP-competitive inhibitors targeting MurC and MurD ligases, using a protocol of consecutive hierarchical filters. Selected compounds were evaluated for inhibition of MurC and MurD ligases, and weak inhibitors possessing dual inhibitory activity have been identified. These compounds represent new scaffolds for further optimisation towards multiple Mur ligase inhibitors with improved inhibitory potency.
Directory of Open Access Journals (Sweden)
Shuangchen Chen
2017-06-01
Full Text Available Ubiquitination is a common regulatory mechanism, playing a critical role in diverse cellular and developmental processes in eukaryotes. However, a few reports on the functional correlation between E3 ubiquitin ligases and reactive oxygen species (ROS or reactive nitrogen species (RNS metabolism in response to stress are currently available in plants. In the present study, the E3 ubiquitin ligase gene AdBiL (Adi3 Binding E3 Ligase was introduced into tomato line Ailsa Craig via Agrobacterium-mediated method. Transgenic lines were confirmed for integration into the tomato genome using PCR. Transcription of AdBiL in various transgenic lines was determined using real-time PCR. Evaluation of stress tolerance showed that T1 generation of transgenic tomato lines showed only mild symptoms of chilling injury as evident by higher biomass accumulation and chlorophyll content than those of non-transformed plants. Compared with wild-type plants, the contents of AsA, AsA/DHA, GSH and the activity of GaILDH, γ-GCS and GSNOR were increased, while H2O2, O2.−, MDA, NO, SNOs, and GSNO accumulations were significantly decreased in AdBiL overexpressing plants in response to chilling stress. Furthermore, transgenic tomato plants overexpressing AdBiL showed higher activities of enzymes such as G6PDH, 6PGDH, NADP-ICDH, and NADP-ME involved in pentose phosphate pathway (PPP. The transgenic tomato plants also exhibited an enhanced tolerance against the necrotrophic fungus Cladosporium fulvum. Tyrosine nitration protein was activated in the plants infected with leaf mold disease, while the inhibition could be recovered in AdBiL gene overexpressing lines. Taken together, our results revealed a possible physiological role of AdBiL in the activation of the key enzymes of AsA–GSH cycle, PPP and down-regulation of GSNO reductase, thereby reducing oxidative and nitrosative stress in plants. This study demonstrates an optimized transgenic strategy using AdBiL gene for crop
Directory of Open Access Journals (Sweden)
Shin-Yi Shyu
2013-12-01
Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.
Directory of Open Access Journals (Sweden)
Joo Yong Kim
2016-08-01
Full Text Available Ubiquitination and sumoylation are essential post-translational modifications that regulate growth and development processes in plants, including control of hormone signaling mechanisms and responses to stress. This study showed that COP1 (Constitutive photomorphogenic 1 regulated the activity of Arabidopsis E3 SUMO (Small ubiquitin-related modifier ligase AtSIZ1 through its E3 ubiquitin ligase activity. Yeast two hybrid analysis demonstrated that COP1 and AtSIZ1 directly interacted with one another, and subcellular localization assays indicated that COP1 and AtSIZ1 co-localized in nuclear bodies. Analysis of ubiquitination showed that AtSIZ1 was polyubiquitinated by COP1. The AtSIZ1 level was higher in cop1-4 mutants than in wild-type seedlings under light or dark conditions, and overexpression of a dominant-negative (DN-COP1 mutant led to a substantial increase in AtSIZ1 accumulation. In addition, under drought, cold, and high salt conditions, SUMO-conjugate levels were elevated in DN-COP1-overexpressing plants and cop1-4 mutant plants compared to wild-type plants. Taken together, our results indicate that COP1 controls responses to abiotic stress by modulation of AtSIZ1 levels and activity.
AQUATIC PLANT SPECIATION AFFECTED BY DIVERSIFYING SELECTION OF ORGANELLE DNA REGIONS(1).
Kato, Syou; Misawa, Kazuharu; Takahashi, Fumio; Sakayama, Hidetoshi; Sano, Satomi; Kosuge, Keiko; Kasai, Fumie; Watanabe, Makoto M; Tanaka, Jiro; Nozaki, Hisayoshi
2011-10-01
Many of the genes that control photosynthesis are carried in the chloroplast. These genes differ among species. However, evidence has yet to be reported revealing the involvement of organelle genes in the initial stages of plant speciation. To elucidate the molecular basis of aquatic plant speciation, we focused on the unique plant species Chara braunii C. C. Gmel. that inhabits both shallow and deep freshwater habitats and exhibits habitat-based dimorphism of chloroplast DNA (cpDNA). Here, we examined the "shallow" and "deep" subpopulations of C. braunii using two nuclear DNA (nDNA) markers and cpDNA. Genetic differentiation between the two subpopulations was measured in both nDNA and cpDNA regions, although phylogenetic analyses suggested nuclear gene flow between subpopulations. Neutrality tests based on Tajima's D demonstrated diversifying selection acting on organelle DNA regions. Furthermore, both "shallow" and "deep" haplotypes of cpDNA detected in cultures originating from bottom soils of three deep environments suggested that migration of oospores (dormant zygotes) between the two habitats occurs irrespective of the complete habitat-based dimorphism of cpDNA from field-collected vegetative thalli. Therefore, the two subpopulations are highly selected by their different aquatic habitats and show prezygotic isolation, which represents an initial process of speciation affected by ecologically based divergent selection of organelle genes. © 2011 Phycological Society of America.
International Nuclear Information System (INIS)
Low, F.C.; Atan, S.; Jaafar, H.
1998-01-01
Rubber (Hevea brasiliensis) plants derived from anther and ovule culture as well as gamma-irradiated plants were examined by several DNA marker techniques. These include restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), sequence tagged microsatellite sites (STMS), DNA amplification fingerprinting (DAF) and amplified fragment length polymorphisms (AFLPs). Compared to control plants produced by vegetative propagation (cutting and budding), plants produced by in vitro culture appeared to have a reduction in the number of rDNA loci. Two RAPD protocols were compared and found to be similar in amplification of the major DNA bands. After confirmation that the RAPD method adopted was reproducible, the technique was applied to the present studies. Eight out of the 60 primers screened were able to elicit polymorphisms between pooled DNA from in vitro culture plants. Variations in DNA patterns were observed between pooled DNA samples of anther-derived plants as well as between anther-derived and ovule-derived plants. Comparisons of RAPD patterns obtained between anther-derived plants exposed to increasing dosages of gamma-irradiation with non irradiated anther-derived plants revealed distinct DNA polymorphisms. The changes in DNA profiles did not appear to be correlated to the dosage of irradiation. Since somaclonal variation was detected, it was difficult to identify changes which were specifically caused by irradiation. Application of the STMS technique to tag micro satellite sequences (GA) n , (TA) n and (TTA) n in the hydroxymethylglutaryl coenzyme A reductase-1 (hmgr-1) gene failed to detect differences between plants derived from anther and ovule culture. Although restriction endonuclease digestions with methylation sensitive enzymes suggested that four in vitro culture plants examined exhibited similar digestion patterns as the controls, a change in cytosine methylation in one anther-derived plant was detected. Examination of
Plant DNA sequences from feces: potential means for assessing diets of wild primates.
Bradley, Brenda J; Stiller, Mathias; Doran-Sheehy, Diane M; Harris, Tara; Chapman, Colin A; Vigilant, Linda; Poinar, Hendrik
2007-06-01
Analyses of plant DNA in feces provides a promising, yet largely unexplored, means of documenting the diets of elusive primates. Here we demonstrate the promise and pitfalls of this approach using DNA extracted from fecal samples of wild western gorillas (Gorilla gorilla) and black and white colobus monkeys (Colobus guereza). From these DNA extracts we amplified, cloned, and sequenced small segments of chloroplast DNA (part of the rbcL gene) and plant nuclear DNA (ITS-2). The obtained sequences were compared to sequences generated from known plant samples and to those in GenBank to identify plant taxa in the feces. With further optimization, this method could provide a basic evaluation of minimum primate dietary diversity even when knowledge of local flora is limited. This approach may find application in studies characterizing the diets of poorly-known, unhabituated primate species or assaying consumer-resource relationships in an ecosystem. (c) 2007 Wiley-Liss, Inc.
Characterization of bacteriophage KVP40 and T4 RNA ligase 2
International Nuclear Information System (INIS)
Yin Shenmin; Kiong Ho, C.; Miller, Eric S.; Shuman, Stewart
2004-01-01
Bacteriophage T4 RNA ligase 2 (Rnl2) exemplifies a subfamily of RNA strand-joining enzymes that includes the trypanosome RNA editing ligases. A homolog of T4 Rnl2 is encoded in the 244-kbp DNA genome of vibriophage KVP40. We show that the 335-amino acid KVP40 Rnl2 is a monomeric protein that catalyzes RNA end-joining through ligase-adenylate and RNA-adenylate (AppRNA) intermediates. In the absence of ATP, pre-adenylated KVP40 Rnl2 reacts with an 18-mer 5'-PO 4 single-strand RNA (pRNA) to form an 18-mer RNA circle. In the presence of ATP, Rnl2 generates predominantly AppRNA. Isolated AppRNA can be circularized by KVP40 Rnl2 in the absence of ATP. The reactivity of phage Rnl2 and the distribution of the products are affected by the length of the pRNA substrate. Whereas 18-mer and 15-mer pRNAs undergo intramolecular sealing by T4 Rnl2 to form monomer circles, a 12-mer pRNA is ligated intermolecularly to form dimers, and a 9-mer pRNA is unreactive. In the presence of ATP, the 15-mer and 12-mer pRNAs are converted to AppRNAs, but the 9-mer pRNA is not. A single 5' deoxynucleotide substitution of an 18-mer pRNA substrate has no apparent effect on the 5' adenylation or circularization reactions of T4 Rnl2. In contrast, a single deoxyribonucleoside at the 3' terminus strongly and selectively suppresses the sealing step, thereby resulting in accumulation of high levels of AppRNA in the absence of ATP. The ATP-dependent 'capping' of RNA with AMP by Rnl2 is reminiscent of the capping of eukaryotic mRNA with GMP by GTP:RNA guanylyltransferase and suggests an evolutionary connection between bacteriophage Rnl2 and eukaryotic RNA capping enzymes
DNA Damage and Repair in Plants under Ultraviolet and Ionizing Radiations
Gill, Sarvajeet S.; Gill, Ritu; Jha, Manoranjan; Tuteja, Narendra
2015-01-01
Being sessile, plants are continuously exposed to DNA-damaging agents present in the environment such as ultraviolet (UV) and ionizing radiations (IR). Sunlight acts as an energy source for photosynthetic plants; hence, avoidance of UV radiations (namely, UV-A, 315–400 nm; UV-B, 280–315 nm; and UV-C, important target for UV-B induced damage. On the other hand, IR causes water radiolysis, which generates highly reactive hydroxyl radicals (OH•) and causes radiogenic damage to important cellular components. However, to maintain genomic integrity under UV/IR exposure, plants make use of several DNA repair mechanisms. In the light of recent breakthrough, the current minireview (a) introduces UV/IR and overviews UV/IR-mediated DNA damage products and (b) critically discusses the biochemistry and genetics of major pathways responsible for the repair of UV/IR-accrued DNA damage. The outcome of the discussion may be helpful in devising future research in the current context. PMID:25729769
Directory of Open Access Journals (Sweden)
Jeong-Woong Park
2017-05-01
Full Text Available Objective This study was performed to reveal the molecular structure and expression patterns of horse glutamate-cysteine ligase catalytic subunit (GCLC and glutamate-cysteine ligase modifier subunit (GCLM genes whose products form glutamate cysteine ligase, which were identified as differentially expressed genes in the previous study. Methods We performed bioinformatics analyses, and gene expression assay with quantitative polymerase chain reaction (qPCR for horse GCLC and GCLM genes in muscle and blood leukocytes of Thoroughbred horses Results Expression of GCLC showed the same pattern in both blood and muscle tissues after exercise. Expression of GCLC increased in the muscle and blood of Thoroughbreds, suggesting a tissue-specific regulatory mechanism for the expression of GCLC. In addition, expression of the GCLM gene increased after exercise in both the blood and muscle of Thoroughbreds. Conclusion We established the expression patterns of GCLC and GCLM in the skeletal muscle and blood of Thoroughbred horses in response to exercise. Further study is now warranted to uncover the functional importance of these genes in exercise and recovery in racehorses.
Isolation of Retroelement from Plant Genomic DNA
sprotocols
2014-01-01
Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...
Zhao, Huayan; Zhang, Huoming; Cui, Peng; Ding, Feng; Wang, Guangchao; Li, Rongjun; Jenks, Matthew A.; Lü , Shiyou; Xiong, Liming
2014-01-01
The ECERIFERUM9 (CER9) gene encodes a putative E3 ubiquitin ligase that functions in cuticle biosynthesis and the maintenance of plant water status. Here, we found that CER9 is also involved in abscisic acid (ABA) signaling in seeds and young
TGF-β1 accelerates the DNA damage response in epithelial cells via Smad signaling
Energy Technology Data Exchange (ETDEWEB)
Lee, Jeeyong; Kim, Mi-Ra; Kim, Hyun-Ji; An, You Sun; Yi, Jae Youn, E-mail: yjy_71@kcch.re.kr
2016-08-05
The evidence suggests that transforming growth factor-beta (TGF-β) regulates the DNA-damage response (DDR) upon irradiation, and we previously reported that TGF-β1 induced DNA ligase IV (Lig4) expression and enhanced the nonhomologous end-joining repair pathway in irradiated cells. In the present study, we investigated the effects of TGF-β1 on the irradiation-induced DDRs of A431 and HaCaT cells. Cells were pretreated with or without TGF-β1 and irradiated. At 30 min post-irradiation, DDRs were detected by immunoblotting of phospho-ATM, phospho-Chk2, and the presence of histone foci (γH2AX). The levels of all three factors were similar right after irradiation regardless of TGF-β1 pretreatment. However, they soon thereafter exhibited downregulation in TGF-β1-pretreated cells, indicating the acceleration of the DDR. Treatment with a TGF-β type I receptor inhibitor (SB431542) or transfections with siRNAs against Smad2/3 or DNA ligase IV (Lig4) reversed this acceleration of the DDR. Furthermore, the frequency of irradiation-induced apoptosis was decreased by TGF-β1 pretreatment in vivo, but this effect was abrogated by SB431542. These results collectively suggest that TGF-β1 could enhance cell survival by accelerating the DDR via Smad signaling and Lig4 expression. -- Highlights: •TGF-β1 pretreatment accelerates γ-radiation-induced DNA damage response. •TGF-β1-accelerated DNA damage response is dependent on Smad signaling and DNA Ligase IV. •TGF-β1 pretreatment protects epithelial cells from γ-radiation in vivo.
Ramirez-Garcés, Diana; Camborde, Laurent; Pel, Michiel J C; Jauneau, Alain; Martinez, Yves; Néant, Isabelle; Leclerc, Catherine; Moreau, Marc; Dumas, Bernard; Gaulin, Elodie
2016-04-01
To successfully colonize their host, pathogens produce effectors that can interfere with host cellular processes. Here we investigated the function of CRN13 candidate effectors produced by plant pathogenic oomycetes and detected in the genome of the amphibian pathogenic chytrid fungus Batrachochytrium dendrobatidis (BdCRN13). When expressed in Nicotiana, AeCRN13, from the legume root pathogen Aphanomyces euteiches, increases the susceptibility of the leaves to the oomycete Phytophthora capsici. When transiently expressed in amphibians or plant cells, AeCRN13 and BdCRN13 localize to the cell nuclei, triggering aberrant cell development and eventually causing cell death. Using Förster resonance energy transfer experiments in plant cells, we showed that both CRN13s interact with nuclear DNA and trigger plant DNA damage response (DDR). Mutating key amino acid residues in a predicted HNH-like endonuclease motif abolished the interaction of AeCRN13 with DNA, the induction of DDR and the enhancement of Nicotiana susceptibility to P. capsici. Finally, H2AX phosphorylation, a marker of DNA damage, and enhanced expression of genes involved in the DDR were observed in A. euteiches-infected Medicago truncatula roots. These results show that CRN13 from plant and animal eukaryotic pathogens promotes host susceptibility by targeting nuclear DNA and inducing DDR. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Sabri Bousbia
Full Text Available BACKGROUND: Hospital-acquired infections such as nosocomial pneumonia are a serious cause of mortality for hospitalized patients, especially for those admitted to intensive care units (ICUs. Despite the number of the studies reported to date, the causative agents of pneumonia are not completely known. Herein, we found by molecular technique that vegetable and tobacco DNA may be detected in the bronchoalveolar lavage from patients with ventilator-associated pneumonia (VAP. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, we studied bronchoalveolar lavage (BAL from patients admitted to ICUs with ventilator-associated pneumonia. BAL fluids were assessed with molecular tests, culture and blood culture. We successfully identified plant DNA in six patients out of 106 (6% with ventilator-associated pneumonia. Inhalation was confirmed in four cases and suspected in the other two cases. Inhalation was significantly frequent in patients with plant DNA (four out of six patients than those without plant DNA (three out of 100 patients (P<0.001. Nicotiana tabacum chloroplast DNA was identified in three patients who were smokers (cases 2, 3 and 6. Cucurbita pepo, Morus bombycis and Triticum aestivum DNA were identified in cases 1, 4 and 5 respectively. Twenty-three different bacterial species, two viruses and five fungal species were identified from among these six patients by using molecular and culture techniques. Several of the pathogenic microorganisms identified are reported to be food-borne or tobacco plant-associated pathogens. CONCLUSIONS/SIGNIFICANCE: Our study shows that plants DNA may be identified in the BAL fluid of pneumonia patients, especially when exploring aspiration pneumonia, but the significance of the presence of plant DNA and its role in the pathogenesis of pneumonia is unknown and remains to be investigated. However, the identification of these plants may be a potential marker of aspiration in patients with pneumonia.
Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.
2001-07-01
The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.
Deepu Mathew
2015-01-01
This book chapter details the protocols for DNA barcoding in plants, starting from DNA isolation, sequencing, sequence annotation using MEGA, till identification of barcode gaps. A good chapter for beginners in plant taxonomy
DNA repair in human cells: Methods for the determination of calmodulin involvement
International Nuclear Information System (INIS)
Charp, P.A.
1987-01-01
Exposure of DNA to either physical or chemical agents can result in the formation of a number of different lesions which must be repaired enzymatically in order for DNA to carry on normal replication and transcription. In most cases, the enzymes involved in this repair of damaged DNA include endonucleases, exonucleases, glycosylases, polymerases, and ligases. Each group of enzymes is involved in precise steps in DNA repair. Exposure to physical agents such as ultraviolet light (UV) at a wavelength of 254 nm is repaired by two distinct and different mechanisms. One mode of enzymatic repair of pyrimidine dimers is accomplished in situ by photoreactivation of UV-induced pyrimidine dimers by photoreactivating light. The second mode of enzymatic repair is the excision repair of pyrimidine dimers involving several different enzymes including endonuclease, exonuclease, and DNA ligase. A summary of the sequence of enzymatic steps involved is shown. It has been observed that specific drugs which bind to and alter the action of calmodulin in cells block DNA synthesis. This suggests that calmodulin may play a role both in normal DNA replication and repair. Others using an indirect method measuring the degree of DNA nucleoid sedimentation, showed that the specific anti-calmodulin agent W-13 slowed the rate of DNA repair. Others showed that DNA synthesis in T51B rat liver cells could be blocked with the addition of either chlorpromazine or trifluoperazine
Directory of Open Access Journals (Sweden)
Ketut Suriasih
2015-03-01
Full Text Available Gene cloning in lactic acid bacteria (LAB is crucial in term to increase their ability to hydrolyze milk protein such as proline. This proline could be hydrolyzed when the LAB undergone cloning on their genome coding the enzyme. The cloning process need technology to separate/isolate the gene capable of proline hydrolyze. Isolation of DNA containing prolidase gene, need DNA genome cutting. After isolation of DNA gene coding prolidase, it is then recombined with other bacterial DNA to obtained recombinant gene. The process need ligase. In gene cloning, knowledge of cutting and joining the DNA should be understood. The enzyme take the role in cutting and joining the DNA were restriction endonuclease and ligase. The restriction enzyme function (1 in inserting a gen into plasmid contained in a vector during gene cloning, and gene expression experiment, and (2 to identify the gene. It is important that the researcher already have standardized sequenced gene as control. The DNA contained target gene was cut using some restriction enzyme, then the gene was arrayed in electrophoresis gel using southern blot technique. DNA sequence was elucidated by addition of ethydium bromide. To identify/characterize the isolated gene, this DNA sequence was encountered the control DNA.
Directory of Open Access Journals (Sweden)
Wouter Boomsma
2016-02-01
Full Text Available The ubiquitin-proteasome system targets misfolded proteins for degradation. Since the accumulation of such proteins is potentially harmful for the cell, their prompt removal is important. E3 ubiquitin-protein ligases mediate substrate ubiquitination by bringing together the substrate with an E2 ubiquitin-conjugating enzyme, which transfers ubiquitin to the substrate. For misfolded proteins, substrate recognition is generally delegated to molecular chaperones that subsequently interact with specific E3 ligases. An important exception is San1, a yeast E3 ligase. San1 harbors extensive regions of intrinsic disorder, which provide both conformational flexibility and sites for direct recognition of misfolded targets of vastly different conformations. So far, no mammalian ortholog of San1 is known, nor is it clear whether other E3 ligases utilize disordered regions for substrate recognition. Here, we conduct a bioinformatics analysis to examine >600 human and S. cerevisiae E3 ligases to identify enzymes that are similar to San1 in terms of function and/or mechanism of substrate recognition. An initial sequence-based database search was found to detect candidates primarily based on the homology of their ordered regions, and did not capture the unique disorder patterns that encode the functional mechanism of San1. However, by searching specifically for key features of the San1 sequence, such as long regions of intrinsic disorder embedded with short stretches predicted to be suitable for substrate interaction, we identified several E3 ligases with these characteristics. Our initial analysis revealed that another remarkable trait of San1 is shared with several candidate E3 ligases: long stretches of complete lysine suppression, which in San1 limits auto-ubiquitination. We encode these characteristic features into a San1 similarity-score, and present a set of proteins that are plausible candidates as San1 counterparts in humans. In conclusion, our work
COP9 signalosome: a provider of DNA building blocks
DEFF Research Database (Denmark)
Nielsen, Olaf
2003-01-01
In fission yeast, the COP9 signalosome is required to activate ribonucleotide reductase for DNA synthesis. This is mediated via the ubiquitin ligase Pcu4, activation of which leads to degradation of the scaffold protein Spd1, which anchors the small ribonucleotide reductase subunit in the nucleus...
The ubiquitin ligase ASB4 promotes trophoblast differentiation through the degradation of ID2.
Directory of Open Access Journals (Sweden)
W H Davin Townley-Tilson
Full Text Available Vascularization of the placenta is a critical developmental process that ensures fetal viability. Although the vascular health of the placenta affects both maternal and fetal well being, relatively little is known about the early stages of placental vascular development. The ubiquitin ligase Ankyrin repeat, SOCS box-containing 4 (ASB4 promotes embryonic stem cell differentiation to vascular lineages and is highly expressed early in placental development. The transcriptional regulator Inhibitor of DNA binding 2 (ID2 negatively regulates vascular differentiation during development and is a target of many ubiquitin ligases. Due to their overlapping spatiotemporal expression pattern in the placenta and contrasting effects on vascular differentiation, we investigated whether ASB4 regulates ID2 through its ligase activity in the placenta and whether this activity mediates vascular differentiation. In mouse placentas, ASB4 expression is restricted to a subset of cells that express both stem cell and endothelial markers. Placentas that lack Asb4 display immature vascular patterning and retain expression of placental progenitor markers, including ID2 expression. Using JAR placental cells, we determined that ASB4 ubiquitinates and represses ID2 expression in a proteasome-dependent fashion. Expression of ASB4 in JAR cells and primary isolated trophoblast stem cells promotes the expression of differentiation markers. In functional endothelial co-culture assays, JAR cells ectopically expressing ASB4 increased endothelial cell turnover and stabilized endothelial tube formation, both of which are hallmarks of vascular differentiation within the placenta. Co-transfection of a degradation-resistant Id2 mutant with Asb4 inhibits both differentiation and functional responses. Lastly, deletion of Asb4 in mice induces a pathology that phenocopies human pre-eclampsia, including hypertension and proteinuria in late-stage pregnant females. These results indicate that
[Effect of BSA on random amplified polymorphic DNA (RAPD) in plants].
Bian, Cai-Miao; Li, Jun-Min; Jin, Ze-Xin; Ge, Ming-Ju
2002-05-01
Using Metasequoia glyptostroboides and Heptacodium miconioides DNA as templates,the effect of bovine serum albumin (BSA) on RAPD in plants was studied. The results showed that suitable concentrations of BSA used in Metasequoia glyptostroboides and Heptacodium miconioides RAPD were different, which were 0.6 microg/microl and 1 microg/microl, respectively. The inhibition of acetylated BSA on the amplification of plant RAPD could be relieved by BSA. BSA could reduce the dosage of Taq DNA polymerase.
An efficient DNA isolation method for tropical plants
African Journals Online (AJOL)
walkinnet
2013-05-08
May 8, 2013 ... 2Key Laboratory of Biology and Genetic Resources of Tropical Crops, Ministry of Agriculture, P. R. ... yielded high-quality DNA from 10 tropical plants including cassava, rubber tree, banana, etc. ..... Major Projects (GrantNo.
Reference: 32 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 32 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u12753583i Friesner Jo...0- and DNA ligase IV-deficient plants are sensitive to ionizing radiation and defective in T-DNA integration. 4 427-40 12753583 2003 May The Plant journal Britt Anne B|Friesner Joanna
Regulation of chloroplast number and DNA synthesis in higher plants. Final report
Energy Technology Data Exchange (ETDEWEB)
Mullet, J.E.
1995-11-10
The long term objective of this research is to understand the process of chloroplast development and its coordination with leaf development in higher plants. This is important because the photosynthetic capacity of plants is directly related to leaf and chloroplast development. This research focuses on obtaining a detailed description of leaf development and the early steps in chloroplast development including activation of plastid DNA synthesis, changes in plastid DNA copy number, activation of chloroplast transcription and increases in plastid number per cell. The grant will also begin analysis of specific biochemical mechanisms by isolation of the plastid DNA polymerase, and identification of genetic mutants which are altered in their accumulation of plastid DNA and plastid number per cell.
Functional characterization of DnSIZ1, a SIZ/PIAS-type SUMO E3 ligase from Dendrobium.
Liu, Feng; Wang, Xiao; Su, Mengying; Yu, Mengyuan; Zhang, Shengchun; Lai, Jianbin; Yang, Chengwei; Wang, Yaqin
2015-09-17
SUMOylation is an important post-translational modification of eukaryotic proteins that involves the reversible conjugation of a small ubiquitin-related modifier (SUMO) polypeptide to its specific protein substrates, thereby regulating numerous complex cellular processes. The PIAS (protein inhibitor of activated signal transducers and activators of transcription [STAT]) and SIZ (scaffold attachment factor A/B/acinus/PIAS [SAP] and MIZ) proteins are SUMO E3 ligases that modulate SUMO conjugation. The characteristic features and SUMOylation mechanisms of SIZ1 protein in monocotyledon are poorly understood. Here, we examined the functions of a homolog of Arabidopsis SIZ1, a functional SIZ/PIAS-type SUMO E3 ligase from Dendrobium. In Dendrobium, the predicted DnSIZ1 protein has domains that are highly conserved among SIZ/PIAS-type proteins. DnSIZ1 is widely expressed in Dendrobium organs and has a up-regulated trend by treatment with cold, high temperature and wounding. The DnSIZ1 protein localizes to the nucleus and shows SUMO E3 ligase activity when expressed in an Escherichia coli reconstitution system. Moreover, ectopic expression of DnSIZ1 in the Arabidopsis siz1-2 mutant partially complements several phenotypes and results in enhanced levels of SUMO conjugates in plants exposed to heat shock conditions. We observed that DnSIZ1 acts as a negative regulator of flowering transition which may be via a vernalization-induced pathway. In addition, ABA-hypersensitivity of siz1-2 seed germination can be partially suppressed by DnSIZ1. Our results suggest that DnSIZ1 is a functional homolog of the Arabidopsis SIZ1 with SUMO E3 ligase activity and may play an important role in the regulation of Dendrobium stress responses, flowering and development.
All that is gold does not glitter? Age, taxonomy, and ancient plant DNA quality
Directory of Open Access Journals (Sweden)
JinHee Choi
2015-07-01
Full Text Available More than 600 herbarium samples from four distantly related groups of flowering plants were used for DNA extraction and subsequent measurements of DNA purity and concentration. We did not find any significant relation between DNA purity and the age of the sample. However, DNA yields were different between plant groups studied. We believe that there there should be no reservations about “old” samples if the goal is to extract more DNA of better purity. We argue that the older herbarium samples are the mine for the future DNA studies, and have the value not less than the “fresh” specimens.
Identification of Fabaceae plants using the DNA barcode matK.
Gao, Ting; Sun, Zhiying; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Ma, Xinye; Chen, Shilin
2011-01-01
In this study, we tested the applicability of the core DNA barcode MATK for identifying species within the Fabaceae family. Based on an evaluation of genetic variation, DNA barcoding gaps, and species discrimination power, MATK is a useful barcode for Fabaceae species. Of 1355 plant samples collected from 1079 species belonging to 409 diverse genera, MATK precisely identified approximately 80 % and 96 % of them at the species and genus levels, respectively. Therefore, our research indicates that the MATK region is a valuable marker for plant species within Fabaceae. © Georg Thieme Verlag KG Stuttgart · New York.
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
TALENs: customizable molecular DNA scissors for genome engineering of plants.
Chen, Kunling; Gao, Caixia
2013-06-20
Precise genome modification with engineered nucleases is a powerful tool for studying basic biology and applied biotechnology. Transcription activator-like effector nucleases (TALENs), consisting of an engineered specific (TALE) DNA binding domain and a Fok I cleavage domain, are newly developed versatile reagents for genome engineering in different organisms. Because of the simplicity of the DNA recognition code and their modular assembly, TALENs can act as customizable molecular DNA scissors inducing double-strand breaks (DSBs) at given genomic location. Thus, they provide a valuable approach to targeted genome modifications such as mutations, insertions, replacements or chromosome rearrangements. In this article, we review the development of TALENs, and summarize the principles and tools for TALEN-mediated gene targeting in plant cells, as well as current and potential strategies for use in plant research and crop improvement. Copyright © 2013. Published by Elsevier Ltd.
DNA barcoding the native flowering plants and conifers of Wales.
Directory of Open Access Journals (Sweden)
Natasha de Vere
Full Text Available We present the first national DNA barcode resource that covers the native flowering plants and conifers for the nation of Wales (1143 species. Using the plant DNA barcode markers rbcL and matK, we have assembled 97.7% coverage for rbcL, 90.2% for matK, and a dual-locus barcode for 89.7% of the native Welsh flora. We have sampled multiple individuals for each species, resulting in 3304 rbcL and 2419 matK sequences. The majority of our samples (85% are from DNA extracted from herbarium specimens. Recoverability of DNA barcodes is lower using herbarium specimens, compared to freshly collected material, mostly due to lower amplification success, but this is balanced by the increased efficiency of sampling species that have already been collected, identified, and verified by taxonomic experts. The effectiveness of the DNA barcodes for identification (level of discrimination is assessed using four approaches: the presence of a barcode gap (using pairwise and multiple alignments, formation of monophyletic groups using Neighbour-Joining trees, and sequence similarity in BLASTn searches. These approaches yield similar results, providing relative discrimination levels of 69.4 to 74.9% of all species and 98.6 to 99.8% of genera using both markers. Species discrimination can be further improved using spatially explicit sampling. Mean species discrimination using barcode gap analysis (with a multiple alignment is 81.6% within 10×10 km squares and 93.3% for 2×2 km squares. Our database of DNA barcodes for Welsh native flowering plants and conifers represents the most complete coverage of any national flora, and offers a valuable platform for a wide range of applications that require accurate species identification.
DNA repair in mutagen-injured higher plants
International Nuclear Information System (INIS)
Veleminsky, J.; Gichner, T.
1978-01-01
Data are summarized proving the occurrence of photoreactivation of UV-induced pyrimidine dimers in cells of Nicotiana tabucum, Gingko and carrot, the excision of dimers in cells of Nicotiana tabacum, Gingko and carrot, the excision of dimers in protoplasts of carrot and in embryos of Lathyrus sativus, and the repair of DNA single-strand breaks induced in carrot protoplasts and barley embryonic cells by ionizing radiation. In irradiated barley embryos the unscheduled DNA synthesis and higher accessibility of induced primers to DNA polymerase I of E. coli were observed preferentially in G 1 cells with diffused chromatin. These reactions were inhibited by caffeine and EDTA. Unscheduled DNA synthesis was also observed in synchronized irradiated root cuttings of Vicia faba and in barley embryos treated with 4-nitroquinoline oxide, the latter being inhibited by caffeine and hydroxyurea. Repair synthesis was also established in barley embryos treated with mutagenic N-methyl-N-nitrosourea under conditions that postponed the onset of germination after the treatment. The same conditions enhanced the repair of DNA single-strand breaks induced by this mutagen and several other monofunctional alkylating compounds. From tissues of barley and of Phaseolus multiflorus, endonucleases for apurinic sites were isolated and characterized. Some of them are located in chromatin, others in chloroplasts. The relation between DNA repair and genetic effects of mutagens in higher plants is also discussed. (Auth.)
Vassou, Sophie Lorraine; Nithaniyal, Stalin; Raju, Balaji; Parani, Madasamy
2016-07-18
Ayurveda is a system of traditional medicine that originated in ancient India, and it is still in practice. Medicinal plants are the backbone of Ayurveda, which heavily relies on the plant-derived therapeutics. While Ayurveda is becoming more popular in several countries throughout the World, lack of authenticated medicinal plant raw drugs is a growing concern. Our aim was to DNA barcode the medicinal plants that are listed in the Ayurvedic Pharmacopoeia of India (API) to create a reference DNA barcode library, and to use the same to authenticate the raw drugs that are sold in markets. We have DNA barcoded 347 medicinal plants using rbcL marker, and curated rbcL DNA barcodes for 27 medicinal plants from public databases. These sequences were used to create Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL). This library was used to authenticate 100 medicinal plant raw drugs, which were in the form of powders (82) and seeds (18). Ayurvedic Pharmacopoeia of India - Reference DNA Barcode Library (API-RDBL) was created with high quality and authentic rbcL barcodes for 374 out of the 395 medicinal plants that are included in the API. The rbcL DNA barcode differentiated 319 species (85 %) with the pairwise divergence ranging between 0.2 and 29.9 %. PCR amplification and DNA sequencing success rate of rbcL marker was 100 % even for the poorly preserved medicinal plant raw drugs that were collected from local markets. DNA barcoding revealed that only 79 % raw drugs were authentic, and the remaining 21 % samples were adulterated. Further, adulteration was found to be much higher with powders (ca. 25 %) when compared to seeds (ca. 5 %). The present study demonstrated the utility of DNA barcoding in authenticating medicinal plant raw drugs, and found that approximately one fifth of the market samples were adulterated. Powdered raw drugs, which are very difficult to be identified by taxonomists as well as common people, seem to be the easy
Prospects and Problems for Identification of Poisonous Plants in China using DNA Barcodes.
Xie, Lei; Wang, Ying Wei; Guan, Shan Yue; Xie, Li Jing; Long, Xin; Sun, Cheng Ye
2014-10-01
Poisonous plants are a deadly threat to public health in China. The traditional clinical diagnosis of the toxic plants is inefficient, fallible, and dependent upon experts. In this study, we tested the performance of DNA barcodes for identification of the most threatening poisonous plants in China. Seventy-four accessions of 27 toxic plant species in 22 genera and 17 families were sampled and three DNA barcodes (matK, rbcL, and ITS) were amplified, sequenced and tested. Three methods, Blast, pairwise global alignment (PWG) distance, and Tree-Building were tested for discrimination power. The primer universality of all the three markers was high. Except in the case of ITS for Hemerocallis minor, the three barcodes were successfully generated from all the selected species. Among the three methods applied, Blast showed the lowest discrimination rate, whereas PWG Distance and Tree-Building methods were equally effective. The ITS barcode showed highest discrimination rates using the PWG Distance and Tree-Building methods. When the barcodes were combined, discrimination rates were increased for the Blast method. DNA barcoding technique provides us a fast tool for clinical identification of poisonous plants in China. We suggest matK, rbcL, ITS used in combination as DNA barcodes for authentication of poisonous plants. Copyright © 2014 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Bridging Plant and Human Radiation Response and DNA Repair through an In Silico Approach
Directory of Open Access Journals (Sweden)
Zacharenia Nikitaki
2017-06-01
Full Text Available The mechanisms of response to radiation exposure are conserved in plants and animals. The DNA damage response (DDR pathways are the predominant molecular pathways activated upon exposure to radiation, both in plants and animals. The conserved features of DDR in plants and animals might facilitate interdisciplinary studies that cross traditional boundaries between animal and plant biology in order to expand the collection of biomarkers currently used for radiation exposure monitoring (REM in environmental and biomedical settings. Genes implicated in trans-kingdom conserved DDR networks often triggered by ionizing radiation (IR and UV light are deposited into biological databases. In this study, we have applied an innovative approach utilizing data pertinent to plant and human genes from publicly available databases towards the design of a ‘plant radiation biodosimeter’, that is, a plant and DDR gene-based platform that could serve as a REM reliable biomarker for assessing environmental radiation exposure and associated risk. From our analysis, in addition to REM biomarkers, a significant number of genes, both in human and Arabidopsis thaliana, not yet characterized as DDR, are suggested as possible DNA repair players. Last but not least, we provide an example on the applicability of an Arabidopsis thaliana—based plant system monitoring the role of cancer-related DNA repair genes BRCA1, BARD1 and PARP1 in processing DNA lesions.
Sculpting ion channel functional expression with engineered ubiquitin ligases
Kanner, Scott A; Morgenstern, Travis
2017-01-01
The functional repertoire of surface ion channels is sustained by dynamic processes of trafficking, sorting, and degradation. Dysregulation of these processes underlies diverse ion channelopathies including cardiac arrhythmias and cystic fibrosis. Ubiquitination powerfully regulates multiple steps in the channel lifecycle, yet basic mechanistic understanding is confounded by promiscuity among E3 ligase/substrate interactions and ubiquitin code complexity. Here we targeted the catalytic domain of E3 ligase, CHIP, to YFP-tagged KCNQ1 ± KCNE1 subunits with a GFP-nanobody to selectively manipulate this channel complex in heterologous cells and adult rat cardiomyocytes. Engineered CHIP enhanced KCNQ1 ubiquitination, eliminated KCNQ1 surface-density, and abolished reconstituted K+ currents without affecting protein expression. A chemo-genetic variation enabling chemical control of ubiquitination revealed KCNQ1 surface-density declined with a ~ 3.5 hr t1/2 by impaired forward trafficking. The results illustrate utility of engineered E3 ligases to elucidate mechanisms underlying ubiquitin regulation of membrane proteins, and to achieve effective post-translational functional knockdown of ion channels. PMID:29256394
DNA barcoding of medicinal plant material for identification
Because of the increasing demand for herbal remedies and for authentication of the source material, it is vital to provide a single database containing information about authentic plant materials and their potential adulterants. The database should provide DNA barcodes for data retrieval and similar...
Cut-and-Paste of DNA Using an Artificial Restriction DNA Cutter
Directory of Open Access Journals (Sweden)
Makoto Komiyama
2013-02-01
Full Text Available DNA manipulations using a completely chemistry-based DNA cutter (ARCUT have been reviewed. This cutter, recently developed by the authors, is composed of Ce(IV/EDTA complex and two strands of pseudo-complementary peptide nucleic acid. The site-selective scission proceeds via hydrolysis of targeted phosphodiester linkages, so that the resultant scission fragments can be easily ligated with other fragments by using DNA ligase. Importantly, scission-site and site-specificity of the cutter are freely tuned in terms of the Watson–Crick rule. Thus, when one should like to manipulate DNA according to the need, he or she does not have to think about (1 whether appropriate “restriction enzyme sites” exist near the manipulation site and (2 whether the site-specificity of the restriction enzymes, if any, are sufficient to cut only the aimed position without chopping the DNA at non-targeted sites. Even the human genome can be manipulated, since ARCUT can cut the genome at only one predetermined site. Furthermore, the cutter is useful to promote homologous recombination in human cells, converting a site to desired sequence. The ARCUT-based DNA manipulation should be promising for versatile applications.
High-throughput sequencing of ancient plant and mammal DNA preserved in herbivore middens
DEFF Research Database (Denmark)
Murray, Dáithí C.; Pearson, Stuart G.; Fullagar, Richard
2012-01-01
DNA analysis identified unreported plant and animal taxa, some of which are locally extinct or endemic. The survival and preservation of DNA in hot, arid environments is a complex and poorly understood process that is both sporadic and rare, but the survival of DNA through desiccation may be important......The study of arid palaeoenvironments is often frustrated by the poor or non-existent preservation of plant and animal material, yet these environments are of considerable environmental importance. The analysis of pollen and macrofossils isolated from herbivore middens has been an invaluable source...
Directory of Open Access Journals (Sweden)
Tharangamala Samarakoon
2013-01-01
Full Text Available Premise of the study: PCR amplification of DNA extracted from plants is sometimes difficult due to the presence of inhibitory compounds. An effective method to overcome the inhibitory effect of compounds that contaminate DNA from difficult plant specimens is needed. Methods and Results: The effectiveness of a PCR additive reagent containing trehalose, bovine serum albumin (BSA, and polysorbate-20 (Tween-20 (TBT-PAR was tested. PCR of DNA extracted from fresh, silica-dried, and herbarium leaf material of species of Achariaceae, Asteraceae, Lacistemataceae, and Samydaceae that failed using standard techniques were successful with the addition of TBT-PAR. Conclusions: The addition of TBT-PAR during routine PCR is an effective method to improve amplification of DNA extracted from herbarium specimens or plants that are known to contain PCR inhibitors.
Plant DNA barcodes can accurately estimate species richness in poorly known floras.
Costion, Craig; Ford, Andrew; Cross, Hugh; Crayn, Darren; Harrington, Mark; Lowe, Andrew
2011-01-01
Widespread uptake of DNA barcoding technology for vascular plants has been slow due to the relatively poor resolution of species discrimination (∼70%) and low sequencing and amplification success of one of the two official barcoding loci, matK. Studies to date have mostly focused on finding a solution to these intrinsic limitations of the markers, rather than posing questions that can maximize the utility of DNA barcodes for plants with the current technology. Here we test the ability of plant DNA barcodes using the two official barcoding loci, rbcLa and matK, plus an alternative barcoding locus, trnH-psbA, to estimate the species diversity of trees in a tropical rainforest plot. Species discrimination accuracy was similar to findings from previous studies but species richness estimation accuracy proved higher, up to 89%. All combinations which included the trnH-psbA locus performed better at both species discrimination and richness estimation than matK, which showed little enhanced species discriminatory power when concatenated with rbcLa. The utility of the trnH-psbA locus is limited however, by the occurrence of intraspecific variation observed in some angiosperm families to occur as an inversion that obscures the monophyly of species. We demonstrate for the first time, using a case study, the potential of plant DNA barcodes for the rapid estimation of species richness in taxonomically poorly known areas or cryptic populations revealing a powerful new tool for rapid biodiversity assessment. The combination of the rbcLa and trnH-psbA loci performed better for this purpose than any two-locus combination that included matK. We show that although DNA barcodes fail to discriminate all species of plants, new perspectives and methods on biodiversity value and quantification may overshadow some of these shortcomings by applying barcode data in new ways.
Genetics of repair of radiation damage to DNA in bacteria
International Nuclear Information System (INIS)
Billen, D.; Hadden, C.T.
1984-01-01
The purpose of this study was to determine whether chemical protection against single-strand breaks observed in toluene-treated E. coli (AB3063) subjected to X irradiation in air was due to the removal of OH radicals, or resulted from the production of secondary radicals. In toluene-treated cells DNA strand-break production can be measured without the complication of strand ligation during or immediately following x-ray exposure since such cells are deficient in DNA ligase activity
Radiation-induced XRCC4 association with chromatin DNA analyzed by biochemical fractionation
International Nuclear Information System (INIS)
Kamdar, R.P.; Matsumoto, Yoshihisa
2010-01-01
XRCC4, in association with DNA ligase IV, is thought to play a critical role in the ligation of two DNA ends in DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ) pathway. In the present study, we captured radiation-induced chromatin-recruitment of XRCC4 by biochemical fractionation using detergent Nonidet P-40. A subpopulation of XRCC4 changed into a form that is resistant to the extraction with 0.5% Nonidet P-40-containing buffer after irradiation. This form of XRCC4 was liberated by micrococcal nuclease treatment, indicating that it had been tethered to chromatin DNA. This chromatin-recruitment of XRCC4 could be seen immediately (<0.1 hr) after irradiation and remained up to 4 hr after 20 Gy irradiation. It was seen even after irradiation of small doses, id est (i.e.), 2 Gy, but the residence of XRCC4 on chromatin was very transient after 2 Gy irradiation, returning to near normal level in 0.2-0.5 hr after irradiation. The chromatin-bound XRCC4 represented only -1% of total XRCC4 molecules even after 20 Gy irradiation and the quantitative analysis using purified protein as the reference suggested that only a few XRCC4-DNA ligase IV complexes were recruited to each DNA end. We further show that the chromatin-recruitment of XRCC4 was not attenuated by wortmannin, an inhibitor of DNA-PK, or siRNA-mediated knockdown of the DNA-PK catalytic subunit (DNA-PKcs), indicating that this process does not require DNA-PKcs. These results would provide us with useful experimental tools and important insights to understand the DNA repair process through NHEJ pathway. (author)
Regulation of DNA repair by parkin
International Nuclear Information System (INIS)
Kao, Shyan-Yuan
2009-01-01
Mutation of parkin is one of the most prevalent causes of autosomal recessive Parkinson's disease (PD). Parkin is an E3 ubiquitin ligase that acts on a variety of substrates, resulting in polyubiquitination and degradation by the proteasome or monoubiquitination and regulation of biological activity. However, the cellular functions of parkin that relate to its pathological involvement in PD are not well understood. Here we show that parkin is essential for optimal repair of DNA damage. Parkin-deficient cells exhibit reduced DNA excision repair that can be restored by transfection of wild-type parkin, but not by transfection of a pathological parkin mutant. Parkin also protects against DNA damage-induced cell death, an activity that is largely lost in the pathological mutant. Moreover, parkin interacts with the proliferating cell nuclear antigen (PCNA), a protein that coordinates DNA excision repair. These results suggest that parkin promotes DNA repair and protects against genotoxicity, and implicate DNA damage as a potential pathogenic mechanism in PD.
Energy Technology Data Exchange (ETDEWEB)
Harvey, S.D.; Clauss, T.W.; Fellows, R.J.; Cataldo, D.A.
1995-08-01
Genetic damage to deoxyribonucleic acid (DNA) has long been suspected of being a fundamental event leading to cancer. A variety of causal factors can result in DNA damage including photodimerization of base pairs, ionizing radiation, specific reaction of DNA with environmental pollutants, and nonspecific oxidative damage caused by the action of highly reactive oxidizing agents produced by metabolism. Because organisms depend on an unadulterated DNA template for reproduction, DNA repair mechanisms are an important defense for maintaining genomic integrity. The objective of this exploratory project was to evaluate the potential for TNT to form DNA adducts in plants. These adducts, if they exist in sufficient quantities, could be potential biomarkers of munitions exposure. The ultimate goal is to develop a simple analytical assay for the determination of blomarkers that is indicative of munitions contamination. DNA repair exists in dynamic equilibrium with DNA damage. Repair mechanisms are capable of keeping DNA damage at remarkably low concentrations provided that the repair capacity is not overwhelmed.
Action of some drugs on enzymes involved in DNA-repair and semiconservative DNA-synthesis
International Nuclear Information System (INIS)
Wawra, E.; Klein, W.; Kocsis, F.; Weniger, P.
1975-07-01
Different antirheumatic and cytostatic drugs had been tested by measurement of the thymidine incorporation into DNA of spleen cells under conditions, under which either DNA-synthesis or repair after gamma- or UV-irradiation takes place. There are substances, which inhibit either only the semiconservative DNA-synthesis (vinblastine, isonicotinic acid hydracide) or only DNA-repair after gamma-irradiation (mixture of penicillin-G and procaine-penicillin-G) or both (cyclophosphamide, phenylbutazone, procarbazine, nalidixic acid). Vincristine shows no effect on the thymidine incorporation in DNA, but by density gradient centrifugation it has been found that it influences the ligase reaction. Two DNA polymerases had been isolated from spleen cells, one of the low molecular and one of the high molecular weight type. The influences of the described drugs on these enzymes and on a deoxyribonuclease I from beef pancreas have been tested in ''in vitro'' systems. In all cases, it has been found that there is no effect or only a very small one, compared with the action of well known inhibitors as e.g. ethidium bromide and p-chloromercuribenzoate, and this cannot be responsible for the suppressions found in DNA-repair and semiconservative DNA-synthesis. (author)
Evaluation of DNA damage and mutagenicity induced by lead in tobacco plants.
Gichner, Tomás; Znidar, Irena; Száková, Jirina
2008-04-30
Tobacco (Nicotiana tabacum L. var. xanthi) seedlings were treated with aqueous solutions of lead nitrate (Pb2+) at concentrations ranging from 0.4 mM to 2.4 mM for 24 h and from 25 microM to 200 microM for 7 days. The DNA damage measured by the comet assay was high in the root nuclei, but in the leaf nuclei a slight but significant increase in DNA damage could be demonstrated only after a 7-day treatment with 200 microM Pb2+. In tobacco plants growing for 6 weeks in soil polluted with Pb2+ severe toxic effects, expressed by the decrease in leaf area, and a slight but significant increase in DNA damage were observed. The tobacco plants with increased levels of DNA damage were severely injured and showed stunted growth, distorted leaves and brown root tips. The frequency of somatic mutations in tobacco plants growing in the Pb2+-polluted soil did not significantly increase. Analytical studies by inductively coupled plasma optical emission spectrometry demonstrate that after a 24-h treatment of tobacco with 2.4 mM Pb2+, the accumulation of the heavy metal is 40-fold higher in the roots than in the above-ground biomass. Low Pb2+ accumulation in the above-ground parts may explain the lower levels or the absence of Pb2+-induced DNA damage in leaves.
Xu, Panglian; Yuan, Dongke; Liu, Ming; Li, Chunxin; Liu, Yiyang; Zhang, Shengchun; Yao, Nan; Yang, Chengwei
2013-04-01
Plants maintain stem cells in meristems to sustain lifelong growth; these stem cells must have effective DNA damage responses to prevent mutations that can propagate to large parts of the plant. However, the molecular links between stem cell functions and DNA damage responses remain largely unexplored. Here, we report that the small ubiquitin-related modifier E3 ligase AtMMS21 (for methyl methanesulfonate sensitivity gene21) acts to maintain the root stem cell niche by mediating DNA damage responses in Arabidopsis (Arabidopsis thaliana). Mutation of AtMMS21 causes defects in the root stem cell niche during embryogenesis and postembryonic stages. AtMMS21 is essential for the proper expression of stem cell niche-defining transcription factors. Moreover, mms21-1 mutants are hypersensitive to DNA-damaging agents, have a constitutively increased DNA damage response, and have more DNA double-strand breaks (DSBs) in the roots. Also, mms21-1 mutants exhibit spontaneous cell death within the root stem cell niche, and treatment with DSB-inducing agents increases this cell death, suggesting that AtMMS21 is required to prevent DSB-induced stem cell death. We further show that AtMMS21 functions as a subunit of the STRUCTURAL MAINTENANCE OF CHROMOSOMES5/6 complex, an evolutionarily conserved chromosomal ATPase required for DNA repair. These data reveal that AtMMS21 acts in DSB amelioration and stem cell niche maintenance during Arabidopsis root development.
Natural separation of the acyl-CoA ligase reaction results in a non-adenylating enzyme.
Wang, Nan; Rudolf, Jeffrey D; Dong, Liao-Bin; Osipiuk, Jerzy; Hatzos-Skintges, Catherine; Endres, Michael; Chang, Chin-Yuan; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2018-06-04
Acyl-coenzyme A (CoA) ligases catalyze the activation of carboxylic acids via a two-step reaction of adenylation followed by thioesterification. Here, we report the discovery of a non-adenylating acyl-CoA ligase PtmA2 and the functional separation of an acyl-CoA ligase reaction. Both PtmA1 and PtmA2, two acyl-CoA ligases from the biosynthetic pathway of platensimycin and platencin, are necessary for the two steps of CoA activation. Gene inactivation of ptmA1 and ptmA2 resulted in the accumulation of free acid and adenylate intermediates, respectively. Enzymatic and structural characterization of PtmA2 confirmed its ability to only catalyze thioesterification. Structural characterization of PtmA2 revealed it binds both free acid and adenylate substrates and undergoes the established mechanism of domain alternation. Finally, site-directed mutagenesis restored both the adenylation and complete CoA activation reactions. This study challenges the currently accepted paradigm of adenylating enzymes and inspires future investigations on functionally separated acyl-CoA ligases and their ramifications in biology.
Enzyme-linked electrochemical DNA ligation assay using magnetic beads
Czech Academy of Sciences Publication Activity Database
Stejskalová, Eva; Horáková Brázdilová, Petra; Vacek, J.; Bowater, R. P.; Fojta, Miroslav
2014-01-01
Roč. 406, č. 17 (2014), s. 4129-4136 ISSN 1618-2642 R&D Projects: GA ČR(CZ) GPP206/11/P739; GA ČR(CZ) GAP206/11/1638; GA AV ČR(CZ) IAA400040901 Institutional support: RVO:68081707 Keywords : Electrochemistry * Enzyme labeling * DNA ligase Subject RIV: BO - Biophysics Impact factor: 3.436, year: 2014
International Nuclear Information System (INIS)
Zhuang Jing; Li Fan; Liu Xuan; Liu Zhiping; Lin Jianxian; Ge Yihong; Kaminski, Joseph M.; Summers, James Bradley; Wang Zhichong; Ge Jian; Yu Keming
2009-01-01
Lithium chloride is a therapeutic agent for treatment of bipolar affective disorders. Increasing numbers of studies have indicated that lithium has neuroprotective effects. However, the molecular mechanisms underlying the actions of lithium have not been fully elucidated. This study aimed to investigate whether lithium chloride produces neuroprotective function by improving DNA repair pathway in retinal neurocyte. In vitro, the primary cultured retinal neurocytes (85.7% are MAP-2 positive cells) were treated with lithium chloride, then cultured with serum-free media to simulate the nutrient deprived state resulting from ischemic insult. The neurite outgrowth of the cultured cells increased significantly in a dose-dependent manner when exposed to different levels of lithium chloride. Genomic DNA electrophoresis demonstrated greater DNA integrity of retinal neurocytes when treated with lithium chloride as compared to the control. Moreover, mRNA and protein levels of Ligase IV (involved in DNA non-homologous end-joining (NHEJ) pathway) in retinal neurocytes increased with lithium chloride. The end joining activity assay was performed to determine the role of lithium on NHEJ in the presence of extract from retinal neurocytes. The rejoining levels in retinal neurocytes treated with lithium were significantly increased as compared to the control. Furthermore, XRCC4, the Ligase IV partner, and the transcriptional factor, CREB and CTCF, were up-regulated in retinal cells after treating with 1.0 mM lithium chloride. Therefore, our data suggest that lithium chloride protects the retinal neural cells from nutrient deprivation in vitro, which may be similar to the mechanism of cell death in glaucoma. The improvement in DNA repair pathway involving in Ligase IV might have an important role in lithium neuroprotection. This study provides new insights into the neural protective mechanisms of lithium chloride.
Han, Li; Yu, Kefei
2008-11-24
Immunoglobulin heavy chain class switch recombination (CSR) is believed to occur through the generation and repair of DNA double-strand breaks (DSBs) in the long and repetitive switch regions. Although implied, the role of the major vertebrate DSB repair pathway, nonhomologous end joining (NHEJ), in CSR has been controversial. By somatic gene targeting of DNA ligase IV (Lig4; a key component of NHEJ) in a B cell line (CH12F3) capable of highly efficient CSR in vitro, we found that NHEJ is required for efficient CSR. Disruption of the Lig4 gene in CH12F3 cells severely inhibits the initial rate of CSR and causes a late cell proliferation defect under cytokine stimulation. However, unlike V(D)J recombination, which absolutely requires NHEJ, CSR accumulates to a substantial level in Lig4-null cells. The data revealed a fast-acting NHEJ and a slow-acting alterative end joining of switch region breaks during CSR.
Identification of species adulteration in traded medicinal plant raw drugs using DNA barcoding.
Nithaniyal, Stalin; Vassou, Sophie Lorraine; Poovitha, Sundar; Raju, Balaji; Parani, Madasamy
2017-02-01
Plants are the major source of therapeutic ingredients in complementary and alternative medicine (CAM). However, species adulteration in traded medicinal plant raw drugs threatens the reliability and safety of CAM. Since morphological features of medicinal plants are often not intact in the raw drugs, DNA barcoding was employed for species identification. Adulteration in 112 traded raw drugs was tested after creating a reference DNA barcode library consisting of 1452 rbcL and matK barcodes from 521 medicinal plant species. Species resolution of this library was 74.4%, 90.2%, and 93.0% for rbcL, matK, and rbcL + matK, respectively. DNA barcoding revealed adulteration in about 20% of the raw drugs, and at least 6% of them were derived from plants with completely different medicinal or toxic properties. Raw drugs in the form of dried roots, powders, and whole plants were found to be more prone to adulteration than rhizomes, fruits, and seeds. Morphological resemblance, co-occurrence, mislabeling, confusing vernacular names, and unauthorized or fraudulent substitutions might have contributed to species adulteration in the raw drugs. Therefore, this library can be routinely used to authenticate traded raw drugs for the benefit of all stakeholders: traders, consumers, and regulatory agencies.
Diversity, expansion, and evolutionary novelty of plant DNA-binding transcription factor families.
Lehti-Shiu, Melissa D; Panchy, Nicholas; Wang, Peipei; Uygun, Sahra; Shiu, Shin-Han
2017-01-01
Plant transcription factors (TFs) that interact with specific sequences via DNA-binding domains are crucial for regulating transcriptional initiation and are fundamental to plant development and environmental response. In addition, expansion of TF families has allowed functional divergence of duplicate copies, which has contributed to novel, and in some cases adaptive, traits in plants. Thus, TFs are central to the generation of the diverse plant species that we see today. Major plant agronomic traits, including those relevant to domestication, have also frequently arisen through changes in TF coding sequence or expression patterns. Here our goal is to provide an overview of plant TF evolution by first comparing the diversity of DNA-binding domains and the sizes of these domain families in plants and other eukaryotes. Because TFs are among the most highly expanded gene families in plants, the birth and death process of TFs as well as the mechanisms contributing to their retention are discussed. We also provide recent examples of how TFs have contributed to novel traits that are important in plant evolution and in agriculture.This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer. Copyright © 2016 Elsevier B.V. All rights reserved.
Plant DNA barcodes can accurately estimate species richness in poorly known floras.
Directory of Open Access Journals (Sweden)
Craig Costion
Full Text Available BACKGROUND: Widespread uptake of DNA barcoding technology for vascular plants has been slow due to the relatively poor resolution of species discrimination (∼70% and low sequencing and amplification success of one of the two official barcoding loci, matK. Studies to date have mostly focused on finding a solution to these intrinsic limitations of the markers, rather than posing questions that can maximize the utility of DNA barcodes for plants with the current technology. METHODOLOGY/PRINCIPAL FINDINGS: Here we test the ability of plant DNA barcodes using the two official barcoding loci, rbcLa and matK, plus an alternative barcoding locus, trnH-psbA, to estimate the species diversity of trees in a tropical rainforest plot. Species discrimination accuracy was similar to findings from previous studies but species richness estimation accuracy proved higher, up to 89%. All combinations which included the trnH-psbA locus performed better at both species discrimination and richness estimation than matK, which showed little enhanced species discriminatory power when concatenated with rbcLa. The utility of the trnH-psbA locus is limited however, by the occurrence of intraspecific variation observed in some angiosperm families to occur as an inversion that obscures the monophyly of species. CONCLUSIONS/SIGNIFICANCE: We demonstrate for the first time, using a case study, the potential of plant DNA barcodes for the rapid estimation of species richness in taxonomically poorly known areas or cryptic populations revealing a powerful new tool for rapid biodiversity assessment. The combination of the rbcLa and trnH-psbA loci performed better for this purpose than any two-locus combination that included matK. We show that although DNA barcodes fail to discriminate all species of plants, new perspectives and methods on biodiversity value and quantification may overshadow some of these shortcomings by applying barcode data in new ways.
Simulaton of the Avedøreværket Unit 1 Cogeneration Plant with DNA
DEFF Research Database (Denmark)
Elmegaard, Brian; Houbak, Niels
2003-01-01
The simulator contest proposed for the ECOS 2003 conference has been solved using the DNA energy system simulator. The contest concerns the steam process of the Avedøreværket Unit 1 (AVV1) power plant. The plant is a 250 MWCHP plant with a maximum district heat production of 330 MJ/s. The plant has...... a net electric efficiency of 42% and a maximum energy utilization of 92%. In this paper it is demonstrated, that the DNA model of AVV1 can calculate the whole flow sheet balance at any load point, i.e., any possible combination of power production and district heat production. The paper also contains...
Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.
Directory of Open Access Journals (Sweden)
Eiko E Kuramae
Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.
Samuel, Marcus A; Mudgil, Yashwanti; Salt, Jennifer N; Delmas, Frédéric; Ramachandran, Shaliny; Chilelli, Andrea; Goring, Daphne R
2008-08-01
The Arabidopsis (Arabidopsis thaliana) genome encompasses multiple receptor kinase families with highly variable extracellular domains. Despite their large numbers, the various ligands and the downstream interacting partners for these kinases have been deciphered only for a few members. One such member, the S-receptor kinase, is known to mediate the self-incompatibility (SI) response in Brassica. S-receptor kinase has been shown to interact and phosphorylate a U-box/ARM-repeat-containing E3 ligase, ARC1, which, in turn, acts as a positive regulator of the SI response. In an effort to identify conserved signaling pathways in Arabidopsis, we performed yeast two-hybrid analyses of various S-domain receptor kinase family members with representative Arabidopsis plant U-box/ARM-repeat (AtPUB-ARM) E3 ligases. The kinase domains from S-domain receptor kinases were found to interact with ARM-repeat domains from AtPUB-ARM proteins. These kinase domains, along with M-locus protein kinase, a positive regulator of SI response, were also able to phosphorylate the ARM-repeat domains in in vitro phosphorylation assays. Subcellular localization patterns were investigated using transient expression assays in tobacco (Nicotiana tabacum) BY-2 cells and changes were detected in the presence of interacting kinases. Finally, potential links to the involvement of these interacting modules to the hormone abscisic acid (ABA) were investigated. Interestingly, AtPUB9 displayed redistribution to the plasma membrane of BY-2 cells when either treated with ABA or coexpressed with the active kinase domain of ARK1. As well, T-DNA insertion mutants for ARK1 and AtPUB9 lines were altered in their ABA sensitivity during germination and acted at or upstream of ABI3, indicating potential involvement of these proteins in ABA responses.
SUMO-2 Orchestrates Chromatin Modifiers in Response to DNA Damage
DEFF Research Database (Denmark)
Hendriks, Ivo A; Treffers, Louise W; Verlaan-de Vries, Matty
2015-01-01
dynamically SUMOylated interaction networks of chromatin modifiers, transcription factors, DNA repair factors, and nuclear body components. SUMOylated chromatin modifiers include JARID1B/KDM5B, JARID1C/KDM5C, p300, CBP, PARP1, SetDB1, and MBD1. Whereas SUMOylated JARID1B was ubiquitylated by the SUMO......-targeted ubiquitin ligase RNF4 and degraded by the proteasome in response to DNA damage, JARID1C was SUMOylated and recruited to the chromatin to demethylate histone H3K4....
Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species.
Chen, Shilin; Yao, Hui; Han, Jianping; Liu, Chang; Song, Jingyuan; Shi, Linchun; Zhu, Yingjie; Ma, Xinye; Gao, Ting; Pang, Xiaohui; Luo, Kun; Li, Ying; Li, Xiwen; Jia, Xiaocheng; Lin, Yulin; Leon, Christine
2010-01-07
The plant working group of the Consortium for the Barcode of Life recommended the two-locus combination of rbcL+matK as the plant barcode, yet the combination was shown to successfully discriminate among 907 samples from 550 species at the species level with a probability of 72%. The group admits that the two-locus barcode is far from perfect due to the low identification rate, and the search is not over. Here, we compared seven candidate DNA barcodes (psbA-trnH, matK, rbcL, rpoC1, ycf5, ITS2, and ITS) from medicinal plant species. Our ranking criteria included PCR amplification efficiency, differential intra- and inter-specific divergences, and the DNA barcoding gap. Our data suggest that the second internal transcribed spacer (ITS2) of nuclear ribosomal DNA represents the most suitable region for DNA barcoding applications. Furthermore, we tested the discrimination ability of ITS2 in more than 6600 plant samples belonging to 4800 species from 753 distinct genera and found that the rate of successful identification with the ITS2 was 92.7% at the species level. The ITS2 region can be potentially used as a standard DNA barcode to identify medicinal plants and their closely related species. We also propose that ITS2 can serve as a novel universal barcode for the identification of a broader range of plant taxa.
Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.
Kar, Indrani; Chattopadhyaya, Rajagopal
2017-11-01
The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.
International Nuclear Information System (INIS)
Yagi, A.; Sato, Y.; Miwa, Y.; Kabbash, A.; Moustafa, S.; Shimomura, K.; El-Bassuony, A.
2006-01-01
A comparison of the sequences in an internally transcribed spacer (ITS) 1 region of rDNA between clonally regenerated A.vera and same species in Japan, USA and Egypt revealed the presence of two types of nucleotide sequences, 252 and 254 bps. Based on the findings in the ITS 1 region, A.vera having 252 and 254 bps clearly showed a stable sequence similarity, suggesting high conversation of the base peak sequence in the ITS 1 region. However, frequent base substitutions in the 252 bps samples leaves that came from callus tissue and micropropagated plants were observed around the regions of nucleotide positions 66, 99 and 199-201. The minor deviation in clonally regenerated A.vera may be due to the stage of regeneration and cell specification in cases of the callus tissue. In the present study, the base peak sequence of the Its 1 region of rDNA was adopted as a molecular marker for differentiating A.vera plants from geographically distributed and clonally regenerated A.vera plants and it was suggested that the base peak substitutions in the ITS 1 region may arise from the different nutritional and environmental factors in cultivation and plant growth stages. (author)
International Nuclear Information System (INIS)
Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.
2008-01-01
The biotin protein ligase from S. aureus has been overexpressed in E. coli, purified, crystallized by the hanging-drop vapour-diffusion method and analysed using X-ray diffraction. Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4 2 2 1 2, with unit-cell parameters a = b = 93.665, c = 131.95
Miao, Min; Niu, Xiangli; Kud, Joanna; Du, Xinran; Avila, Julian; Devarenne, Timothy P; Kuhl, Joseph C; Liu, Yongsheng; Xiao, Fangming
2016-07-01
We recently identified a defense-related tomato (Solanum lycopersicum) NAC (NAM, ATAF1,2, CUC2) transcription factor, NAC1, that is subjected to ubiquitin-proteasome system-dependent degradation in plant cells. In this study, we identified a tomato ubiquitin ligase (termed SEVEN IN ABSENTIA3; SINA3) that ubiquitinates NAC1, promoting its degradation. We conducted coimmunoprecipitation and bimolecular fluorescence complementation to determine that SINA3 specifically interacts with the NAC1 transcription factor in the nucleus. Moreover, we found that SINA3 ubiquitinates NAC1 in vitro and promotes NAC1 degradation via polyubiquitination in vivo, indicating that SINA3 is a ubiquitin ligase that ubiquitinates NAC1, promoting its degradation. Our real-time PCR analysis indicated that, in contrast to our previous finding that NAC1 mRNA abundance increases upon Pseudomonas infection, the SINA3 mRNA abundance decreases in response to Pseudomonas infection. Moreover, using Agrobacterium-mediated transient expression, we found that overexpression of SINA3 interferes with the hypersensitive response cell death triggered by multiple plant resistance proteins. These results suggest that SINA3 ubiquitinates a defense-related NAC transcription factor for degradation and plays a negative role in defense signaling. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
JMJD1C demethylates MDC1 to regulate the RNF8 and BRCA1-mediated chromatin response to DNA breaks
DEFF Research Database (Denmark)
Watanabe, Sugiko; Watanabe, Kenji; Akimov, Vyacheslav
2013-01-01
Chromatin ubiquitylation flanking DNA double-strand breaks (DSBs), mediated by RNF8 and RNF168 ubiquitin ligases, orchestrates a two-branch pathway, recruiting repair factors 53BP1 or the RAP80-BRCA1 complex. We report that human demethylase JMJD1C regulates the RAP80-BRCA1 branch of this DNA...
International Nuclear Information System (INIS)
Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.
2003-01-01
Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus
Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy
2014-10-09
A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.
Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution
Energy Technology Data Exchange (ETDEWEB)
Caetano-Anolles, G [Department of Biology, University of Oslo, Oslo (Norway)
2001-11-01
Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)
Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution
International Nuclear Information System (INIS)
Caetano-Anolles, G.
2001-01-01
Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)
Directory of Open Access Journals (Sweden)
Chao Luo
2016-09-01
Full Text Available Oxidative stress is unavoidable for aerobic organisms. When abiotic and biotic stresses are encountered, oxidative damage could occur in cells. To avoid this damage, defense mechanisms must be timely and efficiently modulated. While the response to oxidative stress has been extensively studied in plants, little is known about how the activated response is switched off when oxidative stress is diminished. By studying Arabidopsis mutant paraquat tolerance3, we identified the genetic locus PARAQUAT TOLERANCE3 (PQT3 as a major negative regulator of oxidative stress tolerance. PQT3, encoding an E3 ubiquitin ligase, is rapidly down-regulated by oxidative stress. PQT3 has E3 ubiquitin ligase activity in ubiquitination assay. Subsequently, we identified PRMT4b as a PQT3-interacting protein. By histone methylation, PRMT4b upregulates the expression of APX1 and GPX1, encoding two key enzymes against oxidative stress. On the other hand, PRMT4b is recognized by PQT3 for targeted degradation via 26S proteasome. Therefore, we have identified PQT3 as an E3 ligase that acts as a negative regulator of activated response to oxidative stress and found that histone modification by PRMT4b at APX1 and GPX1 loci plays an important role in oxidative stress tolerance.
Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection
Directory of Open Access Journals (Sweden)
Han Yih Lau
2017-12-01
Full Text Available Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail.
Mazzoleni, Stefano; Bonanomi, Giuliano; Incerti, Guido; Chiusano, Maria Luisa; Termolino, Pasquale; Mingo, Antonio; Senatore, Mauro; Giannino, Francesco; Cartenì, Fabrizio; Rietkerk, Max; Lanzotti, Virginia
2015-02-01
Plant-soil negative feedback (NF) is recognized as an important factor affecting plant communities. The objectives of this work were to assess the effects of litter phytotoxicity and autotoxicity on root proliferation, and to test the hypothesis that DNA is a driver of litter autotoxicity and plant-soil NF. The inhibitory effect of decomposed litter was studied in different bioassays. Litter biochemical changes were evaluated with nuclear magnetic resonance (NMR) spectroscopy. DNA accumulation in litter and soil was measured and DNA toxicity was assessed in laboratory experiments. Undecomposed litter caused nonspecific inhibition of root growth, while autotoxicity was produced by aged litter. The addition of activated carbon (AC) removed phytotoxicity, but was ineffective against autotoxicity. Phytotoxicity was related to known labile allelopathic compounds. Restricted (13) C NMR signals related to nucleic acids were the only ones negatively correlated with root growth on conspecific substrates. DNA accumulation was observed in both litter decomposition and soil history experiments. Extracted total DNA showed evident species-specific toxicity. Results indicate a general occurrence of litter autotoxicity related to the exposure to fragmented self-DNA. The evidence also suggests the involvement of accumulated extracellular DNA in plant-soil NF. Further studies are needed to further investigate this unexpected function of extracellular DNA at the ecosystem level and related cellular and molecular mechanisms. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.
Lima, Leonardo H G de M; Mesquita, Marcelo R; Skrip, Laura; de Souza Freitas, Moisés T; Silva, Vladimir C; Kirstein, Oscar D; Abassi, Ibrahim; Warburg, Alon; Balbino, Valdir de Q; Costa, Carlos H N
2016-07-20
Little is known about the feeding behavior of hematophagous insects that require plant sugar to complete their life cycles. We studied plant feeding of Lutzomyia longipalpis sand flies, known vectors of Leishmania infantum/chagasi parasites, in a Brazilian city endemic with visceral leishmaniasis. The DNA barcode technique was applied to identify plant food source of wild-caught L. longipalpis using specific primers for a locus from the chloroplast genome, ribulose diphosphate carboxylase. DNA from all trees or shrubs within a 100-meter radius from the trap were collected to build a barcode reference library. While plants from the Anacardiaceae and Meliaceae families were the most abundant at the sampling site (25.4% and 12.7% of the local plant population, respectively), DNA from these plant families was found in few flies; in contrast, despite its low abundance (2.9%), DNA from the Fabaceae family was detected in 94.7% of the sand flies. The proportion of sand flies testing positive for DNA from a given plant family was not significantly associated with abundance, distance from the trap, or average crown expansion of plants from that family. The data suggest that there may indeed be a feeding preference of L. longipalpis for plants in the Fabaceae family.
Energy Technology Data Exchange (ETDEWEB)
Fukuchi, Mikoto; Wanotayan, Rujira; Liu, Sicheng; Imamichi, Shoji; Sharma, Mukesh Kumar; Matsumoto, Yoshihisa, E-mail: yoshim@nr.titech.ac.jp
2015-06-12
XRCC4 and DNA Ligase IV (LIG4) cooperate to join two DNA ends at the final step of DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ). However, it is not fully understood how these proteins are localized to the nucleus. Here we created XRCC4{sup K271R} mutant, as Lys271 lies within the putative nuclear localization signal (NLS), and XRCC4{sup K210R} mutant, as Lys210 was reported to undergo SUMOylation, implicated in the nuclear localization of XRCC4. Wild-type and mutated XRCC4 with EGFP tag were introduced into HeLa cell, in which endogenous XRCC4 had been knocked down using siRNA directed to 3′-untranslated region, and tested for the nuclear localization function by fluorescence microscopy. XRCC4{sup K271R} was defective in the nuclear localization of itself and LIG4, whereas XRCC4{sup K210R} was competent for the nuclear localization with LIG4. To examine DSB repair function, wild-type and mutated XRCC4 were introduced into XRCC4-deficient M10. M10-XRCC4{sup K271R}, but not M10-XRCC4{sup K210R}, showed significantly reduced surviving fraction after 2 Gy γ-ray irradiation as compared to M10-XRCC4{sup WT}. The number of γ-H2AX foci remaining 2 h after 2 Gy γ-ray irradiation was significantly greater in M10-XRCC4{sup K271R} than in M10-XRCC4{sup WT}, whereas it was only marginally increased in M10-XRCC4{sup K210R} as compared to M10-XRCC4{sup WT}. The present results collectively indicated that Lys271, but not Lys210, of XRCC4 is required for the nuclear localization of XRCC4 and LIG4 and that the nuclear localizing ability is essential for DSB repair function of XRCC4. - Highlights: • XRCC4{sup K271R} is defective in the nuclear localization of itself and LIG4. • XRCC4{sup K210R} is competent for the nuclear localization of itself and LIG4. • XRCC4{sup K271R} is deficient in DSB repair function. • XRCC4{sup K210R} is mostly normal in DSB repair function.
International Nuclear Information System (INIS)
Ouyang, Yan; Kwon, Yong Tae; An, Jee Young; Eller, Danny; Tsai, S.-C.; Diaz-Perez, Silvia; Troke, Joshua J.; Teitell, Michael A.; Marahrens, York
2006-01-01
The N-end rule pathway of protein degradation targets proteins with destabilizing N-terminal residues. Ubr2 is one of the E3 ubiquitin ligases of the mouse N-end rule pathway. We have previously shown that Ubr2 -/- male mice are infertile, owing to the arrest of spermatocytes between the leptotene/zygotene and pachytene of meiosis I, the failure of chromosome pairing, and subsequent apoptosis. Here, we report that mouse fibroblast cells derived from Ubr2 -/- embryos display genome instability. The frequency of chromosomal bridges and micronuclei were much higher in Ubr2 -/- fibroblasts than in +/+ controls. Metaphase chromosome spreads from Ubr2 -/- cells revealed a high incidence of spontaneous chromosomal gaps, indicating chromosomal fragility. These fragile sites were generally replicated late in S phase. Ubr2 -/- cells were hypersensitive to mitomycin C, a DNA cross-linking agent, but displayed normal sensitivity to gamma-irradiation. A reporter assay showed that Ubr2 -/- cells are significantly impaired in the homologous recombination repair of a double strand break. In contrast, Ubr2 -/- cells appeared normal in an assay for non-homologous end joining. Our results therefore unveil the role of the ubiquitin ligase Ubr2 in maintaining genome integrity and in homologous recombination repair
Energy Technology Data Exchange (ETDEWEB)
Ouyang, Yan [Department of Human Genetics, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Kwon, Yong Tae [Center for Pharmacogenetics and Department of Pharmaceutical Sciences, University of Pittsburgh, Pittsburgh, PA 15261 (United States); An, Jee Young [Center for Pharmacogenetics and Department of Pharmaceutical Sciences, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Eller, Danny [Department of Human Genetics, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Tsai, S.-C. [Department of Human Genetics, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Diaz-Perez, Silvia [Department of Human Genetics, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Troke, Joshua J. [Department of Pathology and Laboratory Medicine, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Teitell, Michael A. [Department of Pathology and Laboratory Medicine, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States); Marahrens, York [Department of Human Genetics, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095 (United States)]. E-mail: ymarahrens@mednet.ucla.edu
2006-04-11
The N-end rule pathway of protein degradation targets proteins with destabilizing N-terminal residues. Ubr2 is one of the E3 ubiquitin ligases of the mouse N-end rule pathway. We have previously shown that Ubr2{sup -/-} male mice are infertile, owing to the arrest of spermatocytes between the leptotene/zygotene and pachytene of meiosis I, the failure of chromosome pairing, and subsequent apoptosis. Here, we report that mouse fibroblast cells derived from Ubr2{sup -/-} embryos display genome instability. The frequency of chromosomal bridges and micronuclei were much higher in Ubr2{sup -/-} fibroblasts than in +/+ controls. Metaphase chromosome spreads from Ubr2{sup -/-} cells revealed a high incidence of spontaneous chromosomal gaps, indicating chromosomal fragility. These fragile sites were generally replicated late in S phase. Ubr2{sup -/-} cells were hypersensitive to mitomycin C, a DNA cross-linking agent, but displayed normal sensitivity to gamma-irradiation. A reporter assay showed that Ubr2{sup -/-} cells are significantly impaired in the homologous recombination repair of a double strand break. In contrast, Ubr2{sup -/-} cells appeared normal in an assay for non-homologous end joining. Our results therefore unveil the role of the ubiquitin ligase Ubr2 in maintaining genome integrity and in homologous recombination repair.
Testing the Efficacy of DNA Barcodes for Identifying the Vascular Plants of Canada.
Braukmann, Thomas W A; Kuzmina, Maria L; Sills, Jesse; Zakharov, Evgeny V; Hebert, Paul D N
2017-01-01
Their relatively slow rates of molecular evolution, as well as frequent exposure to hybridization and introgression, often make it difficult to discriminate species of vascular plants with the standard barcode markers (rbcL, matK, ITS2). Previous studies have examined these constraints in narrow geographic or taxonomic contexts, but the present investigation expands analysis to consider the performance of these gene regions in discriminating the species in local floras at sites across Canada. To test identification success, we employed a DNA barcode reference library with sequence records for 96% of the 5108 vascular plant species known from Canada, but coverage varied from 94% for rbcL to 60% for ITS2 and 39% for matK. Using plant lists from 27 national parks and one scientific reserve, we tested the efficacy of DNA barcodes in identifying the plants in simulated species assemblages from six biogeographic regions of Canada using BLAST and mothur. Mean pairwise distance (MPD) and mean nearest taxon distance (MNTD) were strong predictors of barcode performance for different plant families and genera, and both metrics supported ITS2 as possessing the highest genetic diversity. All three genes performed strongly in assigning the taxa present in local floras to the correct genus with values ranging from 91% for rbcL to 97% for ITS2 and 98% for matK. However, matK delivered the highest species discrimination (~81%) followed by ITS2 (~72%) and rbcL (~44%). Despite the low number of plant taxa in the Canadian Arctic, DNA barcodes had the least success in discriminating species from this biogeographic region with resolution ranging from 36% with rbcL to 69% with matK. Species resolution was higher in the other settings, peaking in the Woodland region at 52% for rbcL and 87% for matK. Our results indicate that DNA barcoding is very effective in identifying Canadian plants to a genus, and that it performs well in discriminating species in regions where floristic diversity is
KF-1 ubiquitin ligase: an anxiety suppressor
Directory of Open Access Journals (Sweden)
Tamotsu Hashimoto-Gotoh
2009-05-01
Full Text Available Anxiety is an instinct that may have developed to promote adaptive survival by evading unnecessary danger. However, excessive anxiety is disruptive and can be a basic disorder of other psychiatric diseases such as depression. The KF-1, a ubiquitin ligase located to the endoplasmic reticulum (ER, may prevent excessive anxiety; kf-1−/− mice exhibit selectively elevated anxiety-like behavior against light or heights. Thus, KF-1 may degrade some target proteins, responsible for promoting anxiety, through the ER-associated degradation pathway, similar to Parkin in Parkinson's disease (PD. Parkin, another ER-ubiquitin ligase, prevents the degeneration of dopaminergic neurons by degrading the target proteins responsible for PD. Molecular phylogenetic studies have revealed that the prototype of kf-1 appeared in the very early phase of animal evolution but was lost, unlike parkin, in the lineage leading up to Drosophila. Therefore, kf-1−/− mice, be a powerful tool for elucidating the molecular mechanisms involved in emotional regulation, and for screening novel anxiolytic/antidepressant compounds.
Using faecal DNA to determine consumption by kangaroos of plants considered palatable to sheep.
Ho, K W; Krebs, G L; McCafferty, P; van Wyngaarden, S P; Addison, J
2010-02-01
Disagreement exists within the scientific community with regards to the level of competition for feed between sheep and kangaroos in the Australian rangelands. The greatest challenge to solving this debate is finding effective means of determining the composition of the diets of these potential grazing competitors. An option is to adopt a non-invasive approach that combines faecal collection and molecular techniques that focus on faecal DNA as the primary source of dietary information. As proof-of-concept, we show that a DNA reference data bank on plant species can be established. This DNA reference data bank was then used as a library to identify plant species in kangaroo faeces collected in the southern rangelands of Western Australia. To enhance the method development and to begin the investigation of competitive grazing between sheep and kangaroos, 16 plant species known to be palatable to sheep were initially targeted for collection. To ensure that only plant sequences were studied, PCR amplification was performed using a universal primer pair previously shown to be specific to the chloroplast transfer RNA leucine (trnL) UAA gene intron. Overall, genus-specific, single and differently sized amplicons were reliably and reproducibly generated; enabling the differentiation of reference plants by PCR product length heterogeneity. However, there were a few plants that could not be clearly differentiated on the basis of size alone. This prompted the adoption of a post-PCR step that enabled further differentiation according to base sequence variation. Restriction endonucleases make sequence-specific cleavages on DNA to produce discrete and reproducible fragments having unique sizes and base compositions. Their availability, affordability and simplicity-of-use put restriction enzyme sequence (RES) profiling as a logical post-PCR step for confirming plant species identity. We demonstrate that PCR-RES profiling of plant and faecal matter is useful for the identification
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Directory of Open Access Journals (Sweden)
Aurélie Kapusta
2011-04-01
Full Text Available During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs, each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs, which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5' overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ, are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi-mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5'-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3' ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a "cut-and-close" mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new
Kapusta, Aurélie; Matsuda, Atsushi; Marmignon, Antoine; Ku, Michael; Silve, Aude; Meyer, Eric; Forney, James D; Malinsky, Sophie; Bétermier, Mireille
2011-04-01
During the sexual cycle of the ciliate Paramecium, assembly of the somatic genome includes the precise excision of tens of thousands of short, non-coding germline sequences (Internal Eliminated Sequences or IESs), each one flanked by two TA dinucleotides. It has been reported previously that these genome rearrangements are initiated by the introduction of developmentally programmed DNA double-strand breaks (DSBs), which depend on the domesticated transposase PiggyMac. These DSBs all exhibit a characteristic geometry, with 4-base 5' overhangs centered on the conserved TA, and may readily align and undergo ligation with minimal processing. However, the molecular steps and actors involved in the final and precise assembly of somatic genes have remained unknown. We demonstrate here that Ligase IV and Xrcc4p, core components of the non-homologous end-joining pathway (NHEJ), are required both for the repair of IES excision sites and for the circularization of excised IESs. The transcription of LIG4 and XRCC4 is induced early during the sexual cycle and a Lig4p-GFP fusion protein accumulates in the developing somatic nucleus by the time IES excision takes place. RNAi-mediated silencing of either gene results in the persistence of free broken DNA ends, apparently protected against extensive resection. At the nucleotide level, controlled removal of the 5'-terminal nucleotide occurs normally in LIG4-silenced cells, while nucleotide addition to the 3' ends of the breaks is blocked, together with the final joining step, indicative of a coupling between NHEJ polymerase and ligase activities. Taken together, our data indicate that IES excision is a "cut-and-close" mechanism, which involves the introduction of initiating double-strand cleavages at both ends of each IES, followed by DSB repair via highly precise end joining. This work broadens our current view on how the cellular NHEJ pathway has cooperated with domesticated transposases for the emergence of new mechanisms
Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants
Directory of Open Access Journals (Sweden)
Aleksić Jelena M.
2016-01-01
Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005
The biology of Mur ligases as an antibacterial target.
Kouidmi, Imène; Levesque, Roger C; Paradis-Bleau, Catherine
2014-10-01
With antibiotic resistance mechanisms increasing in diversity and spreading among bacterial pathogens, the development of new classes of antibacterial agents against judiciously chosen targets is a high-priority task. The biochemical pathway for peptidoglycan biosynthesis is one of the best sources of antibacterial targets. Within this pathway are the Mur ligases, described in this review as highly suitable targets for the development of new classes of antibacterial agents. The amide ligases MurC, MurD, MurE and MurF function with the same catalytic mechanism and share conserved amino acid regions and structural features that can conceivably be exploited for the design of inhibitors that simultaneously target more than one enzyme. This would provide multi-target antibacterial weapons with minimized likelihood of target-mediated resistance development. © 2014 John Wiley & Sons Ltd.
Uson, Maria Loressa; Ghosh, Shreya; Shuman, Stewart
2017-09-01
We characterize Mycobacterium smegmatis FenA as a manganese-dependent 5'-flap endonuclease homologous to the 5'-exonuclease of DNA polymerase I. FenA incises a nicked 5' flap between the first and second nucleotides of the duplex segment to yield a 1-nucleotide gapped DNA, which is then further resected in dinucleotide steps. Initial FenA cleavage at a Y-flap or nick occurs between the first and second nucleotides of the duplex. However, when the template 3' single strand is eliminated to create a 5'-tailed duplex, FenA incision shifts to between the second and third nucleotides. A double-flap substrate with a mobile junction (mimicking limited strand displacement synthesis during gap repair) is preferentially incised as the 1-nucleotide 3'-flap isomer, with the scissile phosphodiester shifted by one nucleotide versus a static double flap. FenA efficiently removes the 5' App(dN) terminus of an aborted nick ligation reaction intermediate, thereby highlighting FenA as an agent of repair of such lesions, which are formed under a variety of circumstances by bacterial NAD + -dependent DNA ligases and especially by mycobacterial DNA ligases D and C. IMPORTANCE Structure-specific DNA endonucleases are implicated in bacterial DNA replication, repair, and recombination, yet there is scant knowledge of the roster and catalytic repertoire of such nucleases in Mycobacteria This study identifies M. smegmatis FenA as a stand-alone endonuclease homologous to the 5'-exonuclease domain of mycobacterial DNA polymerase 1. FenA incises 5' flaps, 5' nicks, and 5' App(dN) intermediates of aborted nick ligation. The isolated N-terminal domain of M. smegmatis Pol1 is also shown to be a flap endonuclease. Copyright © 2017 American Society for Microbiology.
International Nuclear Information System (INIS)
Nakada, Shinichiro
2016-01-01
The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway
Chemical and biological consequences of the radioactive decay of iodine-125 in plasmid DNA
International Nuclear Information System (INIS)
Linz, U.
1983-09-01
The consequences of the decay of iodine-125 incorporated into DNA were studied on a molecular basis. Doubly ( 14 C and 125 I) labelled 5-iodo-2'-deoxycytidine 5'-triphosphate (IdCTP) was synthesized and incorporated enzymatically into the SalI-cutting site of the plasmid pBR 322. Part of the radioiodinated DNA was treated with T4-DNA ligase in order to restore the circular structure of the native plasmid molecule. After 4 months of storage under various conditions the stable end products were analyzed by radio GC, radio HPLC and electron microscopy. The experiments were not only carried out with doubly-labelled DNA but also with solutions of 14 C-labelled DNA containing Na 125 I as internal radiation source. The results clearly indicate that radiolysis alone causes only minor damage. Transmutation of the covalently bound iodine, on the other hand, leads to complete destruction of the labelled nucleotide, giving rise to 14 CO 2 and 14 CO as main products. The production of 14 CO 2 which originates from both the base as well as the sugar component shows a strong solvent effect. The electron microscopy analysis of the DNA reveals that the local effects are always connected with at least one double strand break directly at the site of decay. In addition, one finds DNA double strand breaks in areas which are hundreds of base pairs apart from that site. Under certain circumstances most of the DNA molecules exhibit up to 10 breaks. A comparison between ligase-treated and untreated DNA shows that the configuration of the DNA and the position of the labelled nucleotide play in important role in the extent of the overall damage. It could be demonstrated that there is a linear correlation between gaseous fragmentation products and the number of double strand breaks. (orig./MG) [de
Directory of Open Access Journals (Sweden)
Roozbeh Hushiarian
2015-12-01
This technique was found to be reliably repeatable. The indirect detection of genomic DNA using this method is significantly improved and showed high efficiency in small amounts of samples with the detection limit of 5.37 × 10−14 M.
Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob
2016-01-01
In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.
DNA barcoding for biosecurity: case studies from the UK plant protection program.
Hodgetts, Jennifer; Ostojá-Starzewski, Jozef C; Prior, Thomas; Lawson, Rebecca; Hall, Jayne; Boonham, Neil
2016-11-01
Since its conception, DNA barcoding has seen a rapid uptake within the research community. Nevertheless, as with many new scientific tools, progression towards the point of routine deployment within diagnostic laboratories has been slow. In this paper, we discuss the application of DNA barcoding in the Defra plant health diagnostic laboratories, where DNA barcoding is used primarily for the identification of invertebrate pests. We present a series of case studies that demonstrate the successful application of DNA barcoding but also reveal some potential limitations to expanded use. The regulated plant pest, Bursephalenchus xylophilus, and one of its vectors, Monochamus alternatus, were found in dining chairs. Some traded wood products are potentially high risk, allowing the movement of longhorn beetles; Trichoferus campestris, Leptura quadrifasciata, and Trichoferus holosericeus were found in a wooden cutlery tray, a railway sleeper, and a dining chair, respectively. An outbreak of Meloidogyne fallax was identified in Allium ampeloprasum and in three weed species. Reference sequences for UK native psyllids were generated to enable the development of rapid diagnostics to be used for monitoring following the release of Aphalara itadori as a biological control agent for Fallopia japonica.
DNA fragments assembly based on nicking enzyme system.
Directory of Open Access Journals (Sweden)
Rui-Yan Wang
Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.
Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas
2016-06-02
Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Kryukova, L.M.; Medvedkova, V.V.
1981-01-01
Effect of the exogenous gibberellin on the DNA of plants irradiated with high doses of γ-radiation is studied. Repair of the molecular weight of DNA can be judged on according to electrophoretic mobility in 1% agar sludge of DNA samples denaturated in alkaline. Investigation results reaffirm that exogenous gibberellin promotes to the repair of the DNA of plants damaged with high doses of radiation. The mechanism of the effect of the hormone is not yet studied, but it is supposed that physiological action of the phytohormone is realized through the ferment systems of plants [ru
DEFF Research Database (Denmark)
Epp, L. S.; Gussarova, C.; Boessenkool, S.
2015-01-01
temperatures. Lake sediments contain DNA paleorecords of the surrounding ecosystems and can be used to retrieve a variety of organismal groups from a single sample. In this study, we analyzed vascular plant, bryophyte, algal (in particular diatom) and copepod DNA retrieved from a sediment core spanning...... phases, and distinct temporal changes in plant presence were recovered. The plant DNA was mostly in agreement with expected vegetation history, but very early occurrences of vascular plants, including the woody Empetrum nigrum, document terrestrial vegetation very shortly after glacial retreat. Our study...... core. Our DNA record was stratigraphically coherent, with no indication of leaching between layers, and our cross-taxon comparisons were in accordance with previously inferred local ecosystem changes. Authentic ancient plant DNA was retrieved from nearly all layers, both from the marine and the limnic...
Energy Technology Data Exchange (ETDEWEB)
Quezada, C.; Hicks, S; Galan, J; Stebbins, C
2009-01-01
Processes as diverse as receptor binding and signaling, cytoskeletal dynamics, and programmed cell death are manipulated by mimics of host proteins encoded by pathogenic bacteria. We show here that the Salmonella virulence factor SspH2 belongs to a growing class of bacterial effector proteins that harness and subvert the eukaryotic ubiquitination pathway. This virulence protein possesses ubiquitination activity that depends on a conserved cysteine residue. A crystal structure of SspH2 reveals a canonical leucine-rich repeat (LRR) domain that interacts with a unique E{sub 3} ligase [which we have termed NEL for Novel E{sub 3} Ligase] C-terminal fold unrelated to previously observed HECT or RING-finger E{sub 3} ligases. Moreover, the LRR domain sequesters the catalytic cysteine residue contained in the NEL domain, and we suggest a mechanism for activation of the ligase requiring a substantial conformational change to release the catalytic domain for function. We also show that the N-terminal domain targets SspH2 to the apical plasma membrane of polarized epithelial cells and propose a model whereby binding of the LRR to proteins at the target site releases the ligase domain for site-specific function.
Alba, Rob; Fei, Zhangjun; Payton, Paxton; Liu, Yang; Moore, Shanna L; Debbie, Paul; Cohn, Jonathan; D'Ascenzo, Mark; Gordon, Jeffrey S; Rose, Jocelyn K C; Martin, Gregory; Tanksley, Steven D; Bouzayen, Mondher; Jahn, Molly M; Giovannoni, Jim
2004-09-01
Gene expression profiling holds tremendous promise for dissecting the regulatory mechanisms and transcriptional networks that underlie biological processes. Here we provide details of approaches used by others and ourselves for gene expression profiling in plants with emphasis on cDNA microarrays and discussion of both experimental design and downstream analysis. We focus on methods and techniques emphasizing fabrication of cDNA microarrays, fluorescent labeling, cDNA hybridization, experimental design, and data processing. We include specific examples that demonstrate how this technology can be used to further our understanding of plant physiology and development (specifically fruit development and ripening) and for comparative genomics by comparing transcriptome activity in tomato and pepper fruit.
In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage
International Nuclear Information System (INIS)
Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa
2016-01-01
XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells
Samuel, Marcus A.; Mudgil, Yashwanti; Salt, Jennifer N.; Delmas, Frédéric; Ramachandran, Shaliny; Chilelli, Andrea; Goring, Daphne R.
2008-01-01
The Arabidopsis (Arabidopsis thaliana) genome encompasses multiple receptor kinase families with highly variable extracellular domains. Despite their large numbers, the various ligands and the downstream interacting partners for these kinases have been deciphered only for a few members. One such member, the S-receptor kinase, is known to mediate the self-incompatibility (SI) response in Brassica. S-receptor kinase has been shown to interact and phosphorylate a U-box/ARM-repeat-containing E3 ligase, ARC1, which, in turn, acts as a positive regulator of the SI response. In an effort to identify conserved signaling pathways in Arabidopsis, we performed yeast two-hybrid analyses of various S-domain receptor kinase family members with representative Arabidopsis plant U-box/ARM-repeat (AtPUB-ARM) E3 ligases. The kinase domains from S-domain receptor kinases were found to interact with ARM-repeat domains from AtPUB-ARM proteins. These kinase domains, along with M-locus protein kinase, a positive regulator of SI response, were also able to phosphorylate the ARM-repeat domains in in vitro phosphorylation assays. Subcellular localization patterns were investigated using transient expression assays in tobacco (Nicotiana tabacum) BY-2 cells and changes were detected in the presence of interacting kinases. Finally, potential links to the involvement of these interacting modules to the hormone abscisic acid (ABA) were investigated. Interestingly, AtPUB9 displayed redistribution to the plasma membrane of BY-2 cells when either treated with ABA or coexpressed with the active kinase domain of ARK1. As well, T-DNA insertion mutants for ARK1 and AtPUB9 lines were altered in their ABA sensitivity during germination and acted at or upstream of ABI3, indicating potential involvement of these proteins in ABA responses. PMID:18552232
Apicoplast lipoic acid protein ligase B is not essential for Plasmodium falciparum.
Directory of Open Access Journals (Sweden)
Svenja Günther
2007-12-01
Full Text Available Lipoic acid (LA is an essential cofactor of alpha-keto acid dehydrogenase complexes (KADHs and the glycine cleavage system. In Plasmodium, LA is attached to the KADHs by organelle-specific lipoylation pathways. Biosynthesis of LA exclusively occurs in the apicoplast, comprising octanoyl-[acyl carrier protein]: protein N-octanoyltransferase (LipB and LA synthase. Salvage of LA is mitochondrial and scavenged LA is ligated to the KADHs by LA protein ligase 1 (LplA1. Both pathways are entirely independent, suggesting that both are likely to be essential for parasite survival. However, disruption of the LipB gene did not negatively affect parasite growth despite a drastic loss of LA (>90%. Surprisingly, the sole, apicoplast-located pyruvate dehydrogenase still showed lipoylation, suggesting that an alternative lipoylation pathway exists in this organelle. We provide evidence that this residual lipoylation is attributable to the dual targeted, functional lipoate protein ligase 2 (LplA2. Localisation studies show that LplA2 is present in both mitochondrion and apicoplast suggesting redundancy between the lipoic acid protein ligases in the erythrocytic stages of P. falciparum.
The C-Terminal Domain of Cernunnos/XLF Is Dispensable for DNA Repair In Vivo▿ †
Malivert, Laurent; Callebaut, Isabelle; Rivera-Munoz, Paola; Fischer, Alain; Mornon, Jean-Paul; Revy, Patrick; de Villartay, Jean-Pierre
2009-01-01
The core nonhomologous end-joining DNA repair pathway is composed of seven factors: Ku70, Ku80, DNA-PKcs, Artemis, XRCC4 (X4), DNA ligase IV (L4), and Cernunnos/XLF (Cernunnos). Although Cernunnos and X4 are structurally related and participate in the same complex together with L4, they have distinct functions during DNA repair. L4 relies on X4 but not on Cernunnos for its stability, and L4 is required for optimal interaction of Cernunnos with X4. We demonstrate here, using in vitro-generated Cernunnos mutants and a series of functional assays in vivo, that the C-terminal region of Cernunnos is dispensable for its activity during DNA repair. PMID:19103754
DEFF Research Database (Denmark)
Gibbs-Seymour, Ian; Oka, Yasuyoshi; Rajendra, Eeson
2015-01-01
We show that central components of the Fanconi anemia (FA) DNA repair pathway, the tumor suppressor proteins FANCI and FANCD2 (the ID complex), are SUMOylated in response to replication fork stalling. The ID complex is SUMOylated in a manner that depends on the ATR kinase, the FA ubiquitin ligase...
Pendini, Nicole R; Yap, Min Y; Polyak, Steven W; Cowieson, Nathan P; Abell, Andrew; Booker, Grant W; Wallace, John C; Wilce, Jacqueline A; Wilce, Matthew C J
2013-01-01
The essential metabolic enzyme biotin protein ligase (BPL) is a potential target for the development of new antibiotics required to combat drug-resistant pathogens. Staphylococcus aureus BPL (SaBPL) is a bifunctional protein, possessing both biotin ligase and transcription repressor activities. This positions BPL as a key regulator of several important metabolic pathways. Here, we report the structural analysis of both holo- and apo-forms of SaBPL using X-ray crystallography. We also present ...
DNA from soil mirrors plant taxonomic and growth form diversity
Czech Academy of Sciences Publication Activity Database
Yoccoz, N. G.; Brathen, K. A.; Gielly, L.; Haile, J.; Edwards, M. E.; Goslar, T.; von Stedingk, H.; Brysting, A.; Coissac, E.; Pompanon, F.; Sonstebo, J. H.; Miquel, C.; Valentini, A.; de Bello, Francesco; Chave, J.; Thuiller, W.; Wincker, P.; Cruaud, C.; Gavory, F.; Rasmussen, M.; Gilbert, M. T. P.; Orlando, L.; Brochmann, C.; Willerslev, E.; Taberlet, P.
2012-01-01
Roč. 21, č. 15 (2012), s. 3647-3655 ISSN 0962-1083 R&D Projects: GA ČR GAP505/12/1296 Institutional research plan: CEZ:AV0Z60050516 Institutional support: RVO:67985939 Keywords : biodiversity assessment * environmental sequencing * plant diversity * DNA Subject RIV: EH - Ecology, Behaviour Impact factor: 6.275, year: 2012
International Nuclear Information System (INIS)
Brewer, E.N.; Nygaard, O.F.; Kuncio, G.
1978-01-01
Isolated nuclei and intact plasmodia of Physarum contain a heat-stable stimulator of nuclear DNA replication. This substance has been purified extensively and found to contain both protein and carbohydrate. The molecular weight, estimated by gel filtration, is ca. 30,000 d. The purified material does not exhibit DNA polymerase or DNase activity, and does not stimulate DNA polymerase activity per se. In the presence of the stimulatory factor, DNA chain elongation occurs at an elevated rate, and continues for a longer time than in its absence, but G 2 nuclei are not stimulated to initiate DNA synthesis. Double-strand breaks in nuclear DNA of irradiated plasmodia are repaired in vitro to a greater extent following nuclear isolation during G 2 , and the DNA of unirradiated plasmodia is less susceptible to double-strand breakage during cell-free nuclear incubation, than is the DNA of S-phase nuclei. This correlation suggests a common basis for both observations, for example an increase in deoxyribonuclease activity or a decrease in DNA ligase activity during the S period. This, in turn, may account for the cell cycle-dependent sensitivity of this organism, in terms of mitotic delay, to ionizing radiation
Histone H1 couples initiation and amplification of ubiquitin signalling after DNA damage
DEFF Research Database (Denmark)
Thorslund, Tina; Ripplinger, Anita; Hoffmann, Saskia
2015-01-01
DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions that trigger non-proteolytic ubiquitylation of adjacent chromatin areas to generate binding sites for DNA repair factors. This depends on the sequential actions of the E3 ubiquitin ligases RNF8 and RNF168 (refs 1-6), and UBC13 (also...... known as UBE2N), an E2 ubiquitin-conjugating enzyme that specifically generates K63-linked ubiquitin chains. Whereas RNF168 is known to catalyse ubiquitylation of H2A-type histones, leading to the recruitment of repair factors such as 53BP1 (refs 8-10), the critical substrates of RNF8 and K63-linked...
TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism.
Harley, Margaret E; Murina, Olga; Leitch, Andrea; Higgs, Martin R; Bicknell, Louise S; Yigit, Gökhan; Blackford, Andrew N; Zlatanou, Anastasia; Mackenzie, Karen J; Reddy, Kaalak; Halachev, Mihail; McGlasson, Sarah; Reijns, Martin A M; Fluteau, Adeline; Martin, Carol-Anne; Sabbioneda, Simone; Elcioglu, Nursel H; Altmüller, Janine; Thiele, Holger; Greenhalgh, Lynn; Chessa, Luciana; Maghnie, Mohamad; Salim, Mahmoud; Bober, Michael B; Nürnberg, Peter; Jackson, Stephen P; Hurles, Matthew E; Wollnik, Bernd; Stewart, Grant S; Jackson, Andrew P
2016-01-01
DNA lesions encountered by replicative polymerases threaten genome stability and cell cycle progression. Here we report the identification of mutations in TRAIP, encoding an E3 RING ubiquitin ligase, in patients with microcephalic primordial dwarfism. We establish that TRAIP relocalizes to sites of DNA damage, where it is required for optimal phosphorylation of H2AX and RPA2 during S-phase in response to ultraviolet (UV) irradiation, as well as fork progression through UV-induced DNA lesions. TRAIP is necessary for efficient cell cycle progression and mutations in TRAIP therefore limit cellular proliferation, providing a potential mechanism for microcephaly and dwarfism phenotypes. Human genetics thus identifies TRAIP as a component of the DNA damage response to replication-blocking DNA lesions.
Mixing of maize and wheat genomic DNA by somatic hybridization in regenerated sterile maize plants.
Szarka, B.; Göntér, I.; Molnár-Láng, M.; Mórocz, S.; Dudits, D.
2002-07-01
Intergeneric somatic hybridization was performed between albino maize ( Zea mays L.) protoplasts and mesophyll protoplasts of wheat ( Triticum aestivum L.) by polyethylene glycol (PEG) treatments. None of the parental protoplasts were able to produce green plants without fusion. The maize cells regenerated only rudimentary albino plantlets of limited viability, and the wheat mesophyll protoplasts were unable to divide. PEG-mediated fusion treatments resulted in hybrid cells with mixed cytoplasm. Six months after fusion green embryogenic calli were selected as putative hybrids. The first-regenerates were discovered as aborted embryos. Regeneration of intact, green, maize-like plants needed 6 months of further subcultures on hormone-free medium. These plants were sterile, although had both male and female flowers. The cytological analysis of cells from callus tissues and root tips revealed 56 chromosomes, but intact wheat chromosomes were not observed. Using total DNA from hybrid plants, three RAPD primer combinations produced bands resembling the wheat profile. Genomic in situ hybridization (GISH) using total wheat DNA as a probe revealed the presence of wheat DNA islands in the maize chromosomal background. The increased viability and the restored green color were the most-significant new traits as compared to the original maize parent. Other intermediate morphological traits of plants with hybrid origin were not found.
Mechanisms of DNA replication termination.
Dewar, James M; Walter, Johannes C
2017-08-01
Genome duplication is carried out by pairs of replication forks that assemble at origins of replication and then move in opposite directions. DNA replication ends when converging replication forks meet. During this process, which is known as replication termination, DNA synthesis is completed, the replication machinery is disassembled and daughter molecules are resolved. In this Review, we outline the steps that are likely to be common to replication termination in most organisms, namely, fork convergence, synthesis completion, replisome disassembly and decatenation. We briefly review the mechanism of termination in the bacterium Escherichia coli and in simian virus 40 (SV40) and also focus on recent advances in eukaryotic replication termination. In particular, we discuss the recently discovered E3 ubiquitin ligases that control replisome disassembly in yeast and higher eukaryotes, and how their activity is regulated to avoid genome instability.
Auto-ubiquitination of Mdm2 Enhances Its Substrate Ubiquitin Ligase Activity*
Ranaweera, Ruchira S.; Yang, Xiaolu
2013-01-01
The RING domain E3 ubiquitin ligase Mdm2 is the master regulator of the tumor suppressor p53. It targets p53 for proteasomal degradation, restraining the potent activity of p53 and enabling cell survival and proliferation. Like most E3 ligases, Mdm2 can also ubiquitinate itself. How Mdm2 auto-ubiquitination may influence its substrate ubiquitin ligase activity is undefined. Here we show that auto-ubiquitination of Mdm2 is an activating event. Mdm2 that has been conjugated to polyubiquitin chains, but not to single ubiquitins, exhibits substantially enhanced activity to polyubiquitinate p53. Mechanistically, auto-ubiquitination of Mdm2 facilitates the recruitment of the E2 ubiquitin-conjugating enzyme. This occurs through noncovalent interactions between the ubiquitin chains on Mdm2 and the ubiquitin binding domain on E2s. Mutations that diminish the noncovalent interactions render auto-ubiquitination unable to stimulate Mdm2 substrate E3 activity. These results suggest a model in which polyubiquitin chains on an E3 increase the local concentration of E2 enzymes and permit the processivity of substrate ubiquitination. They also support the notion that autocatalysis may be a prevalent mode for turning on the activity of latent enzymes. PMID:23671280
Zhu, Yanfei; Li, Yingbo; Fei, Fei; Wang, Zongkuan; Wang, Wei; Cao, Aizhong; Liu, Yuan; Han, Shuang; Xing, Liping; Wang, Haiyan; Chen, Wei; Tang, Sanyuan; Huang, Xiahe; Shen, Qianhua; Xie, Qi; Wang, Xiue
2015-10-01
Powdery mildew is one of the most devastating wheat fungal diseases. A diploid wheat relative, Haynaldia villosa L., is highly resistant to powdery mildew, and its genetic resource of resistances, such as the Pm21 locus, is now widely used in wheat breeding. Here we report the cloning of a resistance gene from H. villosa, designated CMPG1-V, that encodes a U-box E3 ubiquitin ligase. Expression of the CMPG1-V gene was induced in the leaf and stem of H. villosa upon inoculation with Blumeria graminis f. sp. tritici (Bgt) fungus, and the presence of Pm21 is essential for its rapid induction of expression. CMPG1-V has conserved key residues for E3 ligase, and possesses E3 ligase activity in vitro and in vivo. CMPG1-V is localized in the nucleus, endoplasmic reticulum, plasma membrane and partially in trans-Golgi network/early endosome vesicles. Transgenic wheat over-expressing CMPG1-V showed improved broad-spectrum powdery mildew resistance at seedling and adult stages, associated with an increase in expression of salicylic acid-responsive genes, H2 O2 accumulation, and cell-wall protein cross-linking at the Bgt infection sites, and the expression of CMPG1-V in H. villosa was increased when treated with salicylic acid, abscisic acid and H2 O2 . These results indicate the involvement of E3 ligase in defense responses to Bgt fungus in wheat, particularly in broad-spectrum disease resistance, and suggest association of reactive oxidative species and the phytohormone pathway with CMPG1-V-mediated powdery mildew resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Matsuura, K; Huang, N-J; Cocce, K; Zhang, L; Kornbluth, S
2017-01-01
Evasion of apoptosis allows many cancers to resist chemotherapy. Apoptosis is mediated by the serial activation of caspase family proteins. These proteases are often activated upon the release of cytochrome c from the mitochondria, which is promoted by the proapoptotic Bcl-2 family protein, Bax. This function of Bax is enhanced by the MOAP-1 (modulator of apoptosis protein 1) protein in response to DNA damage. Previously, we reported that MOAP-1 is targeted for ubiquitylation and degradation by the APC/CCdh1 ubiquitin ligase. In this study, we identify the HECT (homologous to the E6-AP carboxyl terminus) family E3 ubiquitin ligase, UBR5, as a novel ubiquitin ligase for MOAP-1. We demonstrate that UBR5 interacts physically with MOAP-1, ubiquitylates MOAP-1 in vitro and inhibits MOAP-1 stability in cultured cells. In addition, we show that Dyrk2 kinase, a reported UBR5 interactor, cooperates with UBR5 in mediating MOAP-1 ubiquitylation. Importantly, we found that cisplatin-resistant ovarian cancer cell lines exhibit lower levels of MOAP-1 accumulation than their sensitive counterparts upon cisplatin treatment, consistent with the previously reported role of MOAP-1 in modulating cisplatin-induced apoptosis. Accordingly, UBR5 knockdown increased MOAP-1 expression, enhanced Bax activation and sensitized otherwise resistant cells to cisplatin-induced apoptosis. Furthermore, UBR5 expression was higher in ovarian cancers from cisplatin-resistant patients than from cisplatin-responsive patients. These results show that UBR5 downregulates proapoptotic MOAP-1 and suggest that UBR5 can confer cisplatin resistance in ovarian cancer. Thus UBR5 may be an attractive therapeutic target for ovarian cancer treatment. PMID:27721409
Directory of Open Access Journals (Sweden)
Grégory Hoff
2016-11-01
Full Text Available Non homologous end-joining (NHEJ is a double strand break (DSB repair pathway which does not require any homologous template and can ligate two DNA ends together. The basic bacterial NHEJ machinery involves two partners: the Ku protein, a DNA end binding protein for DSB recognition and the multifunctional LigD protein composed a ligase, a nuclease and a polymerase domain, for end processing and ligation of the broken ends. In silico analyses performed in the 38 sequenced genomes of Streptomyces species revealed the existence of a large panel of NHEJ-like genes. Indeed, ku genes or ligD domain homologues are scattered throughout the genome in multiple copies and can be distinguished in two categories: the core NHEJ gene set constituted of conserved loci and the variable NHEJ gene set constituted of NHEJ-like genes present in only a part of the species. In Streptomyces ambofaciens ATCC 23877, not only the deletion of core genes but also that of variable genes led to an increased sensitivity to DNA damage induced by electron beam irradiation. Multiple mutants of ku, ligase or polymerase encoding genes showed an aggravated phenotype compared to single mutants. Biochemical assays revealed the ability of Ku-like proteins to protect and to stimulate ligation of DNA ends. RT-qPCR and GFP fusion experiments suggested that ku-like genes show a growth phase dependent expression profile consistent with their involvement in DNA repair during spores formation and/or germination.
Xu, Jianing; Xing, Shanshan; Cui, Haoran; Chen, Xuesen; Wang, Xiaoyun
2016-04-01
The ubiquitin-protein ligases (E3s) directly participate in ubiquitin (Ub) transferring to the target proteins in the ubiquitination pathway. The HECT ubiquitin-protein ligase (UPL), one type of E3s, is characterized as containing a conserved HECT domain of approximately 350 amino acids in the C terminus. Some UPLs were found to be involved in trichome development and leaf senescence in Arabidopsis. However, studies on plant UPLs, such as characteristics of the protein structure, predicted functional motifs of the HECT domain, and the regulatory expression of UPLs have all been limited. Here, we present genome-wide identification of the genes encoding UPLs (HECT gene) in apple. The 13 genes (named as MdUPL1-MdUPL13) from ten different chromosomes were divided into four groups by phylogenetic analysis. Among these groups, the encoding genes in the intron-exon structure and the included additional functional domains were quite different. Notably, the F-box domain was first found in MdUPL7 in plant UPLs. The HECT domain in different MdUPL groups also presented different spatial features and three types of conservative motifs were identified. The promoters of each MdUPL member carried multiple stress-response related elements by cis-acting element analysis. Experimental results demonstrated that the expressions of several MdUPLs were quite sensitive to cold-, drought-, and salt-stresses by qRT-PCR assay. The results of this study helped to elucidate the functions of HECT proteins, especially in Rosaceae plants.
Extraction of DNA from plant and fungus tissues in situ
Directory of Open Access Journals (Sweden)
Abu Almakarem Amal S
2012-06-01
Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt
Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection
Lau, Han Yih; Botella, Jose R.
2017-01-01
Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care di...
X-Ray induced DNA damage – why use plants?
Directory of Open Access Journals (Sweden)
John William Einset
2015-06-01
Full Text Available The comet assay was used to monitor DNA repair after X-ray exposures caused by 0.2-15 Gy. A clear distinction in the time course of DNA repair after 2 Gy was observed with an early ‘rapid phase’, lasting 20-40 minutes, being followed by a ‘slow phase’ which actually consists of a period of negligible repair and then rapid repair during 140-160 minutes. The fact that homozygous mutants for both ATM and BRCA1 fail to repair DNA completely during 3 hours after 2 Gy exposures indicates that repair processes occurring during the ‘slow phase’ involve ds breaks in DNA. Both BRCA1 and Rad51 expression are strongly upregulated by X-rays in Arabidopsis. Rye grass, Norway spruce and Sawara cypress also have ‘slow phase’ repair similar to Arabidopsis, suggesting that the requisite enzymes have to be induced in these plants as well. To look at the effect of genome size in relation to sensitivity to DNA damage, we exposed isolated nuclei from Norway spruce (19.2 Gbp genome, celery (14.1 Gbp, spinach (12.6 Gbp Sawara cypress (8.9 Gbp, lettuce (2.6 Gbp and Arabidopsis (0.135 Gbp to X-rays. After a 1 Gy exposure, a linear relationship was seen between % tails and genome size, confirming the idea that larger genomes are more sensitive to X-ray damage.
Lin, Xiao-Li; Niu, De; Hu, Zi-Liang; Kim, Dae Heon; Jin, Yin Hua; Cai, Bin; Liu, Peng; Miura, Kenji; Yun, Dae-Jin; Kim, Woe-Yeon; Lin, Rongcheng; Jin, Jing Bo
2016-01-01
COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1), a ubiquitin E3 ligase, is a central negative regulator of photomorphogenesis. However, how COP1 activity is regulated by post-translational modifications remains largely unknown. Here we show that SUMO (small ubiquitin-like modifier) modification enhances COP1 activity. Loss-of-function siz1 mutant seedlings exhibit a weak constitutive photomorphogenic phenotype. SIZ1 physically interacts with COP1 and mediates the sumoylation of COP1. A K193R substitution in COP1 blocks its SUMO modification and reduces COP1 activity in vitro and in planta. Consistently, COP1 activity is reduced in siz1 and the level of HY5, a COP1 target protein, is increased in siz1. Sumoylated COP1 may exhibits higher transubiquitination activity than does non-sumoylated COP1, but SIZ1-mediated SUMO modification does not affect COP1 dimerization, COP1-HY5 interaction, and nuclear accumulation of COP1. Interestingly, prolonged light exposure reduces the sumoylation level of COP1, and COP1 mediates the ubiquitination and degradation of SIZ1. These regulatory mechanisms may maintain the homeostasis of COP1 activity, ensuing proper photomorphogenic development in changing light environment. Our genetic and biochemical studies identify a function for SIZ1 in photomorphogenesis and reveal a novel SUMO-regulated ubiquitin ligase, COP1, in plants.
Lin, Xiao-Li
2016-04-29
COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1), a ubiquitin E3 ligase, is a central negative regulator of photomorphogenesis. However, how COP1 activity is regulated by post-translational modifications remains largely unknown. Here we show that SUMO (small ubiquitin-like modifier) modification enhances COP1 activity. Loss-of-function siz1 mutant seedlings exhibit a weak constitutive photomorphogenic phenotype. SIZ1 physically interacts with COP1 and mediates the sumoylation of COP1. A K193R substitution in COP1 blocks its SUMO modification and reduces COP1 activity in vitro and in planta. Consistently, COP1 activity is reduced in siz1 and the level of HY5, a COP1 target protein, is increased in siz1. Sumoylated COP1 may exhibits higher transubiquitination activity than does non-sumoylated COP1, but SIZ1-mediated SUMO modification does not affect COP1 dimerization, COP1-HY5 interaction, and nuclear accumulation of COP1. Interestingly, prolonged light exposure reduces the sumoylation level of COP1, and COP1 mediates the ubiquitination and degradation of SIZ1. These regulatory mechanisms may maintain the homeostasis of COP1 activity, ensuing proper photomorphogenic development in changing light environment. Our genetic and biochemical studies identify a function for SIZ1 in photomorphogenesis and reveal a novel SUMO-regulated ubiquitin ligase, COP1, in plants.
Directory of Open Access Journals (Sweden)
Ramesh C. Gupta
2008-03-01
Full Text Available DNA damage is a pre-requisite for the initiation of cancer and agents that reduce this damage are useful in cancer prevention. In this study, we evaluated the ability of whole berries and berry phytochemical, ellagic acid to reduce endogenous oxidative DNA damage. Ellagic acid was selected based on > 95% inhibition of 8-oxodeoxyguosine (8-oxodG and other unidentified oxidative DNA adducts induced by 4-hydroxy-17B;-estradiol and CuCl2 in vitro. Inhibition of the latter occurred at lower concentrations (10 u(microM than that for 8-oxodG (100 u(microM. In the in vivo study, female CD-1 mice (n=6 were fed either a control diet or diet supplemented with ellagic acid (400 ppm and dehydrated berries (5% w/w with varying ellagic acid contents -- blueberry (low, strawberry (medium and red raspberry (high, for 3 weeks. Blueberry and strawberry diets showed moderate reductions in endogenous DNA adducts (25%. However, both red raspberry and ellagic acid diets showed a significant reduction of 59% (p < 0.001 and 48% (p < 0.01, respectively. Both diets also resulted in a 3-8 fold over-expression of genes involved in DNA repair such as xeroderma pigmentosum group A complementing protein (XPA, DNA excision repair protein (ERCC5 and DNA ligase III (DNL3. These results suggest that red raspberry and ellagic acid reduce endogenous oxidative DNA damage by mechanisms which may involve increase in DNA repair.
Blomme, Jonas
2017-04-19
In addition to the nucleus, mitochondria and chloroplasts in plant cells also contain genomes. Efficient DNA repair pathways are crucial in these organelles to fix damage resulting from endogenous and exogenous factors. Plant organellar genomes are complex compared with their animal counterparts, and although several plant-specific mediators of organelle DNA repair have been reported, many regulators remain to be identified. Here, we show that a mitochondrial SWI/SNF (nucleosome remodeling) complex B protein, SWIB5, is capable of associating with mitochondrial DNA (mtDNA) in Arabidopsis thaliana. Gainand loss-of-function mutants provided evidence for a role of SWIB5 in influencing mtDNA architecture and homologous recombination at specific intermediate-sized repeats both under normal and genotoxic conditions. SWIB5 interacts with other mitochondrial SWIB proteins. Gene expression and mutant phenotypic analysis of SWIB5 and SWIB family members suggests a link between organellar genome maintenance and cell proliferation. Taken together, our work presents a protein family that influences mtDNA architecture and homologous recombination in plants and suggests a link between organelle functioning and plant development.
Růžička, Kamil; Zhang, Mi; Campilho, Ana; Bodi, Zsuzsanna; Kashif, Muhammad; Saleh, Mária; Eeckhout, Dominique; El-Showk, Sedeer; Li, Hongying; Zhong, Silin; De Jaeger, Geert; Mongan, Nigel P; Hejátko, Jan; Helariutta, Ykä; Fray, Rupert G
2017-07-01
N6-adenosine methylation (m 6 A) of mRNA is an essential process in most eukaryotes, but its role and the status of factors accompanying this modification are still poorly understood. Using combined methods of genetics, proteomics and RNA biochemistry, we identified a core set of mRNA m 6 A writer proteins in Arabidopsis thaliana. The components required for m 6 A in Arabidopsis included MTA, MTB, FIP37, VIRILIZER and the E3 ubiquitin ligase HAKAI. Downregulation of these proteins led to reduced relative m 6 A levels and shared pleiotropic phenotypes, which included aberrant vascular formation in the root, indicating that correct m 6 A methylation plays a role in developmental decisions during pattern formation. The conservation of these proteins amongst eukaryotes and the demonstration of a role in writing m 6 A for the E3 ubiquitin ligase HAKAI is likely to be of considerable relevance beyond the plant sciences. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
DNA barcodes for Mexican Cactaceae, plants under pressure from wild collecting.
Yesson, Chris; Bárcenas, Rolando T; Hernández, Héctor M; Ruiz-Maqueda, María de la Luz; Prado, Alberto; Rodríguez, Víctor M; Hawkins, Julie A
2011-09-01
DNA barcodes could be a useful tool for plant conservation. Of particular importance is the ability to identify unknown plant material, such as from customs seizures of illegally collected specimens. Mexican cacti are an example of a threatened group, under pressure because of wild collection for the xeriscaping trade and private collectors. Mexican cacti also provide a taxonomically and geographically coherent group with which to test DNA barcodes. Here, we sample the matK barcode for 528 species of Cactaceae including approximately 75% of Mexican species and test the utility of the matK region for species-level identification. We find that the matK DNA barcode can be used to identify uniquely 77% of species sampled, and 79-87% of species of particular conservation importance. However, this is far below the desired rate of 95% and there are significant issues for PCR amplification because of the variability of primer sites. Additionally, we test the nuclear ITS regions for the cactus subfamily Opuntioideae and for the genus Ariocarpus (subfamily Cactoideae). We observed higher rates of variation for ITS (86% unique for Opuntioideae sampled) but a much lower PCR success, encountering significant intra-individual polymorphism in Ariocarpus precluding the use of this marker in this taxon. We conclude that the matK region should provide useful information as a DNA barcode for Cactaceae if the problems with primers can be addressed, but matK alone is not sufficiently variable to achieve species-level identification. Additional complementary regions should be investigated as ITS is shown to be unsuitable. © 2011 Blackwell Publishing Ltd.
Ret Finger Protein: An E3 Ubiquitin Ligase Juxtaposed to the XY Body in Meiosis
Directory of Open Access Journals (Sweden)
Isabelle Gillot
2009-01-01
Full Text Available During prophase I of male meiosis, the sex chromosomes form a compact structure called XY body that associates with the nuclear membrane of pachytene spermatocytes. Ret Finger Protein is a transcriptional repressor, able to interact with both nuclear matrix-associated proteins and double-stranded DNA. We report the precise and unique localization of Ret Finger Protein in pachytene spermatocytes, in which Ret Finger Protein takes place of lamin B1, between the XY body and the inner nuclear membrane. This localization of Ret Finger Protein does not seem to be associated with O-glycosylation or sumoylation. In addition, we demonstrate that Ret Finger Protein contains an E3 ubiquitin ligase activity. These observations lead to an attractive hypothesis in which Ret Finger Protein would be involved in the positioning and the attachment of XY body to the nuclear lamina of pachytene spermatocytes.
Biotin protein ligase from Corynebacterium glutamicum: role for growth and L: -lysine production.
Peters-Wendisch, P; Stansen, K C; Götker, S; Wendisch, V F
2012-03-01
Corynebacterium glutamicum is a biotin auxotrophic Gram-positive bacterium that is used for large-scale production of amino acids, especially of L-glutamate and L-lysine. It is known that biotin limitation triggers L-glutamate production and that L-lysine production can be increased by enhancing the activity of pyruvate carboxylase, one of two biotin-dependent proteins of C. glutamicum. The gene cg0814 (accession number YP_225000) has been annotated to code for putative biotin protein ligase BirA, but the protein has not yet been characterized. A discontinuous enzyme assay of biotin protein ligase activity was established using a 105aa peptide corresponding to the carboxyterminus of the biotin carboxylase/biotin carboxyl carrier protein subunit AccBC of the acetyl CoA carboxylase from C. glutamicum as acceptor substrate. Biotinylation of this biotin acceptor peptide was revealed with crude extracts of a strain overexpressing the birA gene and was shown to be ATP dependent. Thus, birA from C. glutamicum codes for a functional biotin protein ligase (EC 6.3.4.15). The gene birA from C. glutamicum was overexpressed and the transcriptome was compared with the control strain revealing no significant gene expression changes of the bio-genes. However, biotin protein ligase overproduction increased the level of the biotin-containing protein pyruvate carboxylase and entailed a significant growth advantage in glucose minimal medium. Moreover, birA overexpression resulted in a twofold higher L-lysine yield on glucose as compared with the control strain.
International Nuclear Information System (INIS)
Bhanjadeo, Madhabi M.; Nayak, Ashok K.; Subudhi, Umakanta
2017-01-01
DNA based self-assembled nanostructures and DNA origami has proven useful for organizing nanomaterials with firm precision. However, for advanced applications like nanoelectronics and photonics, large-scale organization of self-assembled branched DNA (bDNA) into periodic lattices is desired. In this communication for the first time we report a facile method of self-assembly of Y-shaped bDNA nanostructures on the cationic surface of Aluminum (Al) foil to prepare periodic two dimensional (2D) bDNA lattice. Particularly those Y-shaped bDNA structures having smaller overhangs and unable to self-assemble in solution, they are easily assembled on the surface of Al foil in the absence of ligase. Field emission scanning electron microscopy (FESEM) analysis shows homogenous distribution of two-dimensional bDNA lattices across the Al foil. When the assembled bDNA structures were recovered from the Al foil and electrophoresed in nPAGE only higher order polymeric bDNA structures were observed without a trace of monomeric structures which confirms the stability and high yield of the bDNA lattices. Therefore, this enzyme-free economic and efficient strategy for developing bDNA lattices can be utilized in assembling various nanomaterials for functional molecular components towards development of DNA based self-assembled nanodevices. - Highlights: • Al foil surface-assisted self-assembly of monomeric structures into larger branched DNA lattice. • FESEM study confirms the uniform distribution of two-dimensional bDNA lattice structures across the surface of Al foil. • Enzyme-free and economic strategy to prepare higher order structures from simpler DNA nanostructures have been confirmed by recovery assay. • Use of well proven sequences for the preparation of pure Y-shaped monomeric DNA nanostructure with high yield.
DEFF Research Database (Denmark)
Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin
2013-01-01
Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...
Directory of Open Access Journals (Sweden)
Javed Iqbal Wattoo
2016-11-01
Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.
Reconstructing a herbivore's diet using a novel rbcL DNA mini-barcode for plants.
Erickson, David L; Reed, Elizabeth; Ramachandran, Padmini; Bourg, Norman A; McShea, William J; Ottesen, Andrea
2017-05-01
Next Generation Sequencing and the application of metagenomic analyses can be used to answer questions about animal diet choice and study the consequences of selective foraging by herbivores. The quantification of herbivore diet choice with respect to native versus exotic plant species is particularly relevant given concerns of invasive species establishment and their effects on ecosystems. While increased abundance of white-tailed deer ( Odocoileus virginianus ) appears to correlate with increased incidence of invasive plant species, data supporting a causal link is scarce. We used a metabarcoding approach (PCR amplicons of the plant rbc L gene) to survey the diet of white-tailed deer (fecal samples), from a forested site in Warren County, Virginia with a comprehensive plant species inventory and corresponding reference collection of plant barcode and chloroplast sequences. We sampled fecal pellet piles and extracted DNA from 12 individual deer in October 2014. These samples were compared to a reference DNA library of plant species collected within the study area. For 72 % of the amplicons, we were able to assign taxonomy at the species level, which provides for the first time-sufficient taxonomic resolution to quantify the relative frequency at which native and exotic plant species are being consumed by white-tailed deer. For each of the 12 individual deer we collected three subsamples from the same fecal sample, resulting in sequencing 36 total samples. Using Qiime, we quantified the plant DNA found in all 36 samples, and found that variance within samples was less than variance between samples ( F = 1.73, P = 0.004), indicating additional subsamples may not be necessary. Species level diversity ranged from 60 to 93 OTUs per individual and nearly 70 % of all plant sequences recovered were from native plant species. The number of species detected did reduce significantly (range 4-12) when we excluded species whose OTU composed plants inventoried
Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J
2008-06-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.
Two mini-preparation protocols to DNA extraction from plants with ...
African Journals Online (AJOL)
AJB SERVER
2006-10-16
Oct 16, 2006 ... samples to process and it is also a non expensive protocol. This method also ... because many of those chemicals inhibit PCR reactions. (Pandey et al., 1996) ... Spin at 15,000 rpm for 15 min and wash the DNA pellet with 1.2 ml ... Protocol: To 200 mg frozen and ground tissue plant material, add 900 µl of.
Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.
Roa, Fernando; Guerra, Marcelo
2015-01-01
5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.
Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.
Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y
2015-12-28
Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.
Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth
2007-06-15
The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.
DNA barcoding of invasive plants in China: A resource for identifying invasive plants.
Xu, Song-Zhi; Li, Zhen-Yu; Jin, Xiao-Hua
2018-01-01
Invasive plants have aroused attention globally for causing ecological damage and having a negative impact on the economy and human health. However, it can be extremely challenging to rapidly and accurately identify invasive plants based on morphology because they are an assemblage of many different families and many plant materials lack sufficient diagnostic characteristics during border inspections. It is therefore urgent to evaluate candidate loci and build a reliable genetic library to prevent invasive plants from entering China. In this study, five common single markers (ITS, ITS2, matK, rbcL and trnH-psbA) were evaluated using 634 species (including 469 invasive plant species in China, 10 new records to China, 16 potentially invasive plant species around the world but not introduced into China yet and 139 plant species native to China) based on three different methods. Our results indicated that ITS2 displayed largest intra- and interspecific divergence (1.72% and 91.46%). Based on NJ tree method, ITS2, ITS, matK, rbcL and trnH-psbA provided 76.84%, 76.5%, 63.21%, 52.86% and 50.68% discrimination rates, respectively. The combination of ITS + matK performed best and provided 91.03% discriminatory power, followed by ITS2 + matK (85.78%). For identifying unknown individuals, ITS + matK had 100% correct identification rate based on our database, followed by ITS/ITS2 (both 93.33%) and ITS2 + matK (91.67%). Thus, we propose ITS/ITS2 + matK as the most suitable barcode for invasive plants in China. This study also demonstrated that DNA barcoding is an efficient tool for identifying invasive species. © 2017 John Wiley & Sons Ltd.
Reconstructing a herbivore’s diet using a novel rbcL DNA mini-barcode for plants
Erickson, David L.; Reed, Elizabeth; Ramachandran, Padmini; Bourg, Norman; McShea, William J.; Ottesen, Andrea
2017-01-01
Next Generation Sequencing and the application of metagenomic analyses can be used to answer questions about animal diet choice and study the consequences of selective foraging by herbivores. The quantification of herbivore diet choice with respect to native versus exotic plant species is particularly relevant given concerns of invasive species establishment and their effects on ecosystems. While increased abundance of white-tailed deer (Odocoileus virginianus) appears to correlate with increased incidence of invasive plant species, data supporting a causal link is scarce. We used a metabarcoding approach (PCR amplicons of the plant rbcL gene) to survey the diet of white-tailed deer (fecal samples), from a forested site in Warren County, Virginia with a comprehensive plant species inventory and corresponding reference collection of plant barcode and chloroplast sequences. We sampled fecal pellet piles and extracted DNA from 12 individual deer in October 2014. These samples were compared to a reference DNA library of plant species collected within the study area. For 72 % of the amplicons, we were able to assign taxonomy at the species level, which provides for the first time—sufficient taxonomic resolution to quantify the relative frequency at which native and exotic plant species are being consumed by white-tailed deer. For each of the 12 individual deer we collected three subsamples from the same fecal sample, resulting in sequencing 36 total samples. Using Qiime, we quantified the plant DNA found in all 36 samples, and found that variance within samples was less than variance between samples (F = 1.73, P = 0.004), indicating additional subsamples may not be necessary. Species level diversity ranged from 60 to 93 OTUs per individual and nearly 70 % of all plant sequences recovered were from native plant species. The number of species detected did reduce significantly (range 4–12) when we excluded species whose OTU composed behaviour may favour
Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library
Directory of Open Access Journals (Sweden)
Kuzmina Maria L
2012-11-01
Full Text Available Abstract Background Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK and a supplemental ribosomal DNA (ITS2 marker for a well-studied flora near Churchill, Manitoba. Results This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years. ITS2 worked equally well for the fresh and herbarium material (89% and 88%. However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples. A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69% was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Conclusions Our results
Identification of the vascular plants of Churchill, Manitoba, using a DNA barcode library.
Kuzmina, Maria L; Johnson, Karen L; Barron, Hannah R; Hebert, Paul Dn
2012-11-28
Because arctic plant communities are highly vulnerable to climate change, shifts in their composition require rapid, accurate identifications, often for specimens that lack diagnostic floral characters. The present study examines the role that DNA barcoding can play in aiding floristic evaluations in the arctic by testing the effectiveness of the core plant barcode regions (rbcL, matK) and a supplemental ribosomal DNA (ITS2) marker for a well-studied flora near Churchill, Manitoba. This investigation examined 900 specimens representing 312 of the 354 species of vascular plants known from Churchill. Sequencing success was high for rbcL: 95% for fresh specimens and 85% for herbarium samples (mean age 20 years). ITS2 worked equally well for the fresh and herbarium material (89% and 88%). However, sequencing success was lower for matK, despite two rounds of PCR amplification, which reflected less effective primer binding and sensitivity to the DNA degradation (76% of fresh, 45% of herbaria samples). A species was considered as taxonomically resolved if its members showed at least one diagnostic difference from any other taxon in the study and formed a monophyletic clade. The highest species resolution (69%) was obtained by combining information from all three genes. The joint sequence information for rbcL and matK distinguished 54% of 286 species, while rbcL and ITS2 distinguished 63% of 285 species. Discrimination of species within Salix, which constituted 8% of the flora, was particularly problematic. Despite incomplete resolution, the barcode results revealed 22 misidentified herbarium specimens, and enabled the identification of field specimens which were otherwise too immature to identify. Although seven cases of ITS2 paralogy were noted in the families Cyperaceae, Juncaceae and Juncaginaceae, this intergenic spacer played an important role in resolving congeneric plant species at Churchill. Our results provided fast and cost-effective solution to create a
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
International Nuclear Information System (INIS)
Tanner, N.K.; Hanna, M.M.; Abelson, J.
1988-01-01
Yeast tRNA ligase, from Saccharomyces cerevisiae, is one of the protein components that is involved in the splicing reaction of intron-containing yeast precursor tRNAs. It is an unusual protein because it has three distinct catalytic activities. It functions as a polynucleotide kinase, as a cyclic phosphodiesterase, and as an RNA ligase. We have studied the binding interactions between ligase and precursor tRNAs containing two photoreactive uridine analogues, 4-thiouridine and 5-bromouridine. When irradiated with long ultraviolet light, RNA containing these analogues can form specific covalent bonds with associated proteins. In this paper, we show that 4-thiouridine triphosphate and 5-bromouridine triphosphate were readily incorporated into a precursor tRNA(Phe) that was synthesized, in vitro, with bacteriophage T7 RNA polymerase. The analogue-containing precursor tRNAs were authentic substrates for the two splicing enzymes that were tested (endonuclease and ligase), and they formed specific covalent bonds with ligase when they were irradiated with long-wavelength ultraviolet light. We have determined the position of three major cross-links and one minor cross-link on precursor tRNA(Phe) that were located within the intron and near the 3' splice site. On the basis of these data, we present a model for the in vivo splicing reaction of yeast precursor tRNAs
Marek, Martin; Zouhar, Miloslav; Douda, Ondřej; Maňasová, Marie; Ryšánek, Pavel
2014-03-01
The use of DNA-based analyses in molecular plant nematology research has dramatically increased over recent decades. Therefore, the development and adaptation of simple, robust, and cost-effective DNA purification procedures are required to address these contemporary challenges. The solid-phase-based approach developed by Flinders Technology Associates (FTA) has been shown to be a powerful technology for the preparation of DNA from different biological materials, including blood, saliva, plant tissues, and various human and plant microbial pathogens. In this work, we demonstrate, for the first time, that this FTA-based technology is a valuable, low-cost, and time-saving approach for the sampling, long-term archiving, and molecular analysis of plant-parasitic nematodes. Despite the complex structure and anatomical organization of the multicellular bodies of nematodes, we report the successful and reliable DNA-based analysis of nematode high-copy and low-copy genes using the FTA technology. This was achieved by applying nematodes to the FTA cards either in the form of a suspension of individuals, as intact or pestle-crushed nematodes, or by the direct mechanical printing of nematode-infested plant tissues. We further demonstrate that the FTA method is also suitable for the so-called "one-nematode-assay", in which the target DNA is typically analyzed from a single individual nematode. More surprisingly, a time-course experiment showed that nematode DNA can be detected specifically in the FTA-captured samples many years after initial sampling occurs. Collectively, our data clearly demonstrate the applicability and the robustness of this FTA-based approach for molecular research and diagnostics concerning phytonematodes; this research includes economically important species such as the stem nematode (Ditylenchus dipsaci), the sugar beet nematode (Heterodera schachtii), and the Northern root-knot nematode (Meloidogyne hapla).
DEFF Research Database (Denmark)
Yamada, M.; Watanabe, K.; Mistrik, M.
2013-01-01
replication. Stalled DNA replication evoked stabilization of the Cdc7-ASK (Dbf4) complex in a manner dependent on ATR-Chk1-mediated checkpoint signaling and its interplay with the anaphase-promoting complex/cyclosomeCdh1 (APC/C) ubiquitin ligase. Mechanistically, Chk1 kinase inactivates APC/C through...... degradation of Cdh1 upon replication block, thereby stabilizing APC/C substrates, including Cdc7-ASK (Dbf4). Furthermore, motif C of ASK (Dbf4) interacts with the N-terminal region of RAD18 ubiquitin ligase, and this interaction is required for chromatin binding of RAD18. Impaired interaction of ASK (Dbf4...
International Nuclear Information System (INIS)
Matsumoto, Yoshihisa
1996-01-01
This review described findings hitherto and future perspective on the DNA-PK. The enzyme was activated by double-strand DNA, required the end of the DNA and was the major component of p350 protein. Ku-antigen (an autoimmune antigen) was found a subunit. It phosphorylated p53, c-Myc, RPAp34, DNA ligase I, DNA topoisomerase I and II. Therefore DNA-PK can be a trigger factor which recognizes DNA break induced by radiation, and phosphorylates proteins participating in the DNA repair, cell cycle regulation and cell death. Recently p350 was found to be a responsible gene product to SCID syndrome of mice hypersensitive to ionizing radiation. The review included; On the DNA-PK: Discovery, relation to Ku antigen and molecular properties. On the DNA-PK and radiation sensitivity, and V(D)J recombination: Ku80 was the product of X-ray repair cross-complementing (XRCC). p350 was found the gene product whose lack causing SCID syndrome of radiosensitive mice. On the significance of phosphorylation of DNA-PK and the substrate: p53. RPA (replication protein A, alias RF-A or SSB). P1/MCM3, a possible substrate. On the other properties of DNA-PK: DNA-helicase activity. Suppression of transcription by RNA polymerase. DNA-PKp350 and ATM (ataxia-telangiectasia). Family molecules of p53 and ATM (MEI-41, Tel1p and Mec1p, and Rad3). (H.O). 70 refs
Robu, Mihaela; Shah, Rashmi G; Purohit, Nupur K; Zhou, Pengbo; Naegeli, Hanspeter; Shah, Girish M
2017-08-15
Xeroderma pigmentosum C (XPC) protein initiates the global genomic subpathway of nucleotide excision repair (GG-NER) for removal of UV-induced direct photolesions from genomic DNA. The XPC has an inherent capacity to identify and stabilize at the DNA lesion sites, and this function is facilitated in the genomic context by UV-damaged DNA-binding protein 2 (DDB2), which is part of a multiprotein UV-DDB ubiquitin ligase complex. The nuclear enzyme poly(ADP-ribose) polymerase 1 (PARP1) has been shown to facilitate the lesion recognition step of GG-NER via its interaction with DDB2 at the lesion site. Here, we show that PARP1 plays an additional DDB2-independent direct role in recruitment and stabilization of XPC at the UV-induced DNA lesions to promote GG-NER. It forms a stable complex with XPC in the nucleoplasm under steady-state conditions before irradiation and rapidly escorts it to the damaged DNA after UV irradiation in a DDB2-independent manner. The catalytic activity of PARP1 is not required for the initial complex formation with XPC in the nucleoplasm but it enhances the recruitment of XPC to the DNA lesion site after irradiation. Using purified proteins, we also show that the PARP1-XPC complex facilitates the handover of XPC to the UV-lesion site in the presence of the UV-DDB ligase complex. Thus, the lesion search function of XPC in the genomic context is controlled by XPC itself, DDB2, and PARP1. Our results reveal a paradigm that the known interaction of many proteins with PARP1 under steady-state conditions could have functional significance for these proteins.
Kuzmina, Maria L; Braukmann, Thomas W A; Fazekas, Aron J; Graham, Sean W; Dewaard, Stephanie L; Rodrigues, Anuar; Bennett, Bruce A; Dickinson, Timothy A; Saarela, Jeffery M; Catling, Paul M; Newmaster, Steven G; Percy, Diana M; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R; Zakharov, Evgeny V; Hebert, Paul D N
2017-12-01
Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa.
Role of DNA-PK in cellular responses to DNA double-strand breaks
International Nuclear Information System (INIS)
Chen, D.J.
2003-01-01
DNA double-strand breaks (DSBs) are probably the most dangerous of the many different types of DNA damage that occur within the cell. DSBs are generated by exogenous agents such as ionizing radiation (IR) or by endogenously generated reactive oxygen species and occur as intermediates during meiotic and V(D)J recombination. The repair of DSBs is of paramount importance to the cell as misrepair of DSBs can lead to cell death or promote tumorigenesis. In eukaryotes there exists two distinct mechanisms for DNA DSB repair: homologous recombination (HR) and non-homologous end joining (NHEJ). In mammalian cells, however, it is clear that nonhomologous repair of DSBs is highly active and plays a major role in conferring radiation resistance to the cell. The NHEJ machinery minimally consists of the DNA-dependent Protein Kinase (DNA-PK) and a complex of XRCC4 and DNA Ligase IV. The DNA-PK complex is composed of a 470 kDa catalytic subunit (DNA-PKcs), and the heterodimeric Ku70 and Ku80 DNA end-binding complex. DNA-PKcs is a PI-3 kinase with homology to ATM and ATR in its C-terminal kinase domain. The DNA-PK complex protects and tethers the ends, and directs assembly and, perhaps, the activation of other NHEJ proteins. We have previously demonstrated that the kinase activity of DNA-PK is essential for DNA DSB repair and V(D)J recombination. It is, therefore, of immense interest to determine the in vivo targets of DNA-PKcs and the mechanisms by which phosphorylation of these targets modulates NHEJ. Recent studies have resulted in the identification of a number of protein targets that are phosphorylated by and/or interact with DNA-PKcs. Our laboratory has recently identified autophosphorylation site(s) on DNA-PKcs. We find that phosphorylation at these sites in vivo is an early and essential response to DSBs and demonstrate, for the first time, the localization of DNA-PKcs to the sites of DNA damage in vivo. Furthermore, mutation of these phosphorylation sites in mammalian
International Nuclear Information System (INIS)
Tabassum, Sartaj; Al–Asbahy, Waddhaah M.; Afzal, Mohd.; Shamsi, Manal; Arjmand, Farukh
2012-01-01
A new water soluble complex [Zn(glygly)(ssz)(H 2 O)]·6H 2 O, 1 derived from dipeptide (glycyl glycine) and sulfasalazine was synthesized and characterized by spectroscopic (IR, UV–vis, NMR, ESI–MS) and analytical methods. The in vitro DNA binding studies of complex 1 with calf–thymus DNA were carried out by employing various biophysical methods and molecular docking technique which reveals strong electrostatic binding via phosphate backbone of DNA helix, in addition to partial intercalation. To gain further insight into the molecular recognition at the target site, interaction studies of complex 1 with 5′-TMP and 5′-GMP were carried out by UV–vis titration which was validated by 1 H and 31 P NMR with 5′-TMP, which implicate the preferential selectivity of 1 towards N3 of thymine. Complex 1 is accessible to minor groove of DNA and cleaved pBR322 DNA via hydrolytic pathway (validated by T4 ligase assay). - Graphical abstract: Synthesis, characterization, DNA binding and cleavage studies of [Zn(glygly)(ssz)(H 2 O)]·6H 2 O (1) containing glycyl glycine and sulfasalazine ligand. Complex 1 recognize minor groove of DNA and show hydrolytic DNA cleavage. Highlights: ► Novel Zn(II) complex 1 bearing bioactive glycyl glycine and sulfasalazine ligand scaffold. ► Cleavage activity of 1 was enhanced in presence of activators: H 2 O 2 >MPA>GSH>Asc. ► Complex 1 recognize minor groove as depicted in the cleavage pattern and molecular docking. ► Complex 1 cleaves pBR322 DNA via hydrolytic mechanism and validated by T4 DNA ligase experiments.
Proteolytic regulation of metabolic enzymes by E3 ubiquitin ligase complexes: lessons from yeast.
Nakatsukasa, Kunio; Okumura, Fumihiko; Kamura, Takumi
2015-01-01
Eukaryotic organisms use diverse mechanisms to control metabolic rates in response to changes in the internal and/or external environment. Fine metabolic control is a highly responsive, energy-saving process that is mediated by allosteric inhibition/activation and/or reversible modification of preexisting metabolic enzymes. In contrast, coarse metabolic control is a relatively long-term and expensive process that involves modulating the level of metabolic enzymes. Coarse metabolic control can be achieved through the degradation of metabolic enzymes by the ubiquitin-proteasome system (UPS), in which substrates are specifically ubiquitinated by an E3 ubiquitin ligase and targeted for proteasomal degradation. Here, we review select multi-protein E3 ligase complexes that directly regulate metabolic enzymes in Saccharomyces cerevisiae. The first part of the review focuses on the endoplasmic reticulum (ER) membrane-associated Hrd1 and Doa10 E3 ligase complexes. In addition to their primary roles in the ER-associated degradation pathway that eliminates misfolded proteins, recent quantitative proteomic analyses identified native substrates of Hrd1 and Doa10 in the sterol synthesis pathway. The second part focuses on the SCF (Skp1-Cul1-F-box protein) complex, an abundant prototypical multi-protein E3 ligase complex. While the best-known roles of the SCF complex are in the regulation of the cell cycle and transcription, accumulating evidence indicates that the SCF complex also modulates carbon metabolism pathways. The increasing number of metabolic enzymes whose stability is directly regulated by the UPS underscores the importance of the proteolytic regulation of metabolic processes for the acclimation of cells to environmental changes.
RavN is a member of a previously unrecognized group of Legionella pneumophila E3 ubiquitin ligases
Lin, Yi-Han; Evans, Timothy R.; Doms, Alexandra G.; Beauchene, Nicole A.; Hierro, Aitor
2018-01-01
The eukaryotic ubiquitylation machinery catalyzes the covalent attachment of the small protein modifier ubiquitin to cellular target proteins in order to alter their fate. Microbial pathogens exploit this post-translational modification process by encoding molecular mimics of E3 ubiquitin ligases, eukaryotic enzymes that catalyze the final step in the ubiquitylation cascade. Here, we show that the Legionella pneumophila effector protein RavN belongs to a growing class of bacterial proteins that mimic host cell E3 ligases to exploit the ubiquitylation pathway. The E3 ligase activity of RavN was located within its N-terminal region and was dependent upon interaction with a defined subset of E2 ubiquitin-conjugating enzymes. The crystal structure of the N-terminal region of RavN revealed a U-box-like motif that was only remotely similar to other U-box domains, indicating that RavN is an E3 ligase relic that has undergone significant evolutionary alteration. Substitution of residues within the predicted E2 binding interface rendered RavN inactive, indicating that, despite significant structural changes, the mode of E2 recognition has remained conserved. Using hidden Markov model-based secondary structure analyses, we identified and experimentally validated four additional L. pneumophila effectors that were not previously recognized to possess E3 ligase activity, including Lpg2452/SdcB, a new paralog of SidC. Our study provides strong evidence that L. pneumophila is dedicating a considerable fraction of its effector arsenal to the manipulation of the host ubiquitylation pathway. PMID:29415051
Ku recruits XLF to DNA double-strand breaks.
Yano, Ken-ichi; Morotomi-Yano, Keiko; Wang, Shih-Ya; Uematsu, Naoya; Lee, Kyung-Jong; Asaithamby, Aroumougame; Weterings, Eric; Chen, David J
2008-01-01
XRCC4-like factor (XLF)--also known as Cernunnos--has recently been shown to be involved in non-homologous end-joining (NHEJ), which is the main pathway for the repair of DNA double-strand breaks (DSBs) in mammalian cells. XLF is likely to enhance NHEJ by stimulating XRCC4-ligase IV-mediated joining of DSBs. Here, we report mechanistic details of XLF recruitment to DSBs. Live cell imaging combined with laser micro-irradiation showed that XLF is an early responder to DSBs and that Ku is essential for XLF recruitment to DSBs. Biochemical analysis showed that Ku-XLF interaction occurs on DNA and that Ku stimulates XLF binding to DNA. Unexpectedly, XRCC4 is dispensable for XLF recruitment to DSBs, although photobleaching analysis showed that XRCC4 stabilizes the binding of XLF to DSBs. Our observations showed the direct involvement of XLF in the dynamic assembly of the NHEJ machinery and provide mechanistic insights into DSB recognition.
Reconstructing a herbivore’s diet using a novel rbcL DNA mini-barcode for plants
Erickson, David L.; Reed, Elizabeth; Ramachandran, Padmini; Bourg, Norman; McShea, William J.; Ottesen, Andrea
2017-01-01
Next Generation Sequencing and the application of metagenomic analyses can be used to answer questions about animal diet choice and study the consequences of selective foraging by herbivores. The quantification of herbivore diet choice with respect to native versus exotic plant species is particularly relevant given concerns of invasive species establishment and their effects on ecosystems. While increased abundance of white-tailed deer (Odocoileus virginianus) appears to correlate with increased incidence of invasive plant species, data supporting a causal link is scarce. We used a metabarcoding approach (PCR amplicons of the plant rbcL gene) to survey the diet of white-tailed deer (fecal samples), from a forested site in Warren County, Virginia with a comprehensive plant species inventory and corresponding reference collection of plant barcode and chloroplast sequences. We sampled fecal pellet piles and extracted DNA from 12 individual deer in October 2014. These samples were compared to a reference DNA library of plant species collected within the study area. For 72 % of the amplicons, we were able to assign taxonomy at the species level, which provides for the first time—sufficient taxonomic resolution to quantify the relative frequency at which native and exotic plant species are being consumed by white-tailed deer. For each of the 12 individual deer we collected three subsamples from the same fecal sample, resulting in sequencing 36 total samples. Using Qiime, we quantified the plant DNA found in all 36 samples, and found that variance within samples was less than variance between samples (F = 1.73, P = 0.004), indicating additional subsamples may not be necessary. Species level diversity ranged from 60 to 93 OTUs per individual and nearly 70 % of all plant sequences recovered were from native plant species. The number of species detected did reduce significantly (range 4–12) when we excluded species whose OTU composed <1 % of each
Coincident In Vitro Analysis of DNA-PK-Dependent and -Independent Nonhomologous End Joining
Directory of Open Access Journals (Sweden)
Cynthia L. Hendrickson
2010-01-01
Full Text Available In mammalian cells, DNA double-strand breaks (DSBs are primarily repaired by nonhomologous end joining (NHEJ. The current model suggests that the Ku 70/80 heterodimer binds to DSB ends and recruits DNA-PKcs to form the active DNA-dependent protein kinase, DNA-PK. Subsequently, XRCC4, DNA ligase IV, XLF and most likely, other unidentified components participate in the final DSB ligation step. Therefore, DNA-PK plays a key role in NHEJ due to its structural and regulatory functions that mediate DSB end joining. However, recent studies show that additional DNA-PK-independent NHEJ pathways also exist. Unfortunately, the presence of DNA-PKcs appears to inhibit DNA-PK-independent NHEJ, and in vitro analysis of DNA-PK-independent NHEJ in the presence of the DNA-PKcs protein remains problematic. We have developed an in vitro assay that is preferentially active for DNA-PK-independent DSB repair based solely on its reaction conditions, facilitating coincident differential biochemical analysis of the two pathways. The results indicate the biochemically distinct nature of the end-joining mechanisms represented by the DNA-PK-dependent and -independent NHEJ assays as well as functional differences between the two pathways.
TRIM56-mediated monoubiquitination of cGAS for cytosolic DNA sensing.
Seo, Gil Ju; Kim, Charlotte; Shin, Woo-Jin; Sklan, Ella H; Eoh, Hyungjin; Jung, Jae U
2018-02-09
Intracellular nucleic acid sensors often undergo sophisticated modifications that are critical for the regulation of antimicrobial responses. Upon recognition of DNA, the cytosolic sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) produces the second messenger cGAMP, which subsequently initiates downstream signaling to induce interferon-αβ (IFNαβ) production. Here we report that TRIM56 E3 ligase-induced monoubiquitination of cGAS is important for cytosolic DNA sensing and IFNαβ production to induce anti-DNA viral immunity. TRIM56 induces the Lys335 monoubiquitination of cGAS, resulting in a marked increase of its dimerization, DNA-binding activity, and cGAMP production. Consequently, TRIM56-deficient cells are defective in cGAS-mediated IFNαβ production upon herpes simplex virus-1 (HSV-1) infection. Furthermore, TRIM56-deficient mice show impaired IFNαβ production and high susceptibility to lethal HSV-1 infection but not to influenza A virus infection. This adds TRIM56 as a crucial component of the cytosolic DNA sensing pathway that induces anti-DNA viral innate immunity.
Mutagenic effects of carbon ions near the range end in plants
Energy Technology Data Exchange (ETDEWEB)
Hase, Yoshihiro, E-mail: hase.yoshihiro@jaea.go.jp [Ion Beam Mutagenesis Research Group, Quantum Beam Science Directorate, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan); Yoshihara, Ryouhei; Nozawa, Shigeki; Narumi, Issay [Ion Beam Mutagenesis Research Group, Quantum Beam Science Directorate, Japan Atomic Energy Agency, 1233 Watanuki, Takasaki, Gunma 370-1292 (Japan)
2012-03-01
To gain insight into the mutagenic effects of accelerated heavy ions in plants, the mutagenic effects of carbon ions near the range end (mean linear energy transfer (LET): 425 keV/{mu}m) were compared with the effects of carbon ions penetrating the seeds (mean LET: 113 keV/{mu}m). Mutational analysis by plasmid rescue of Escherichia coli rpsL from irradiated Arabidopsis plants showed a 2.7-fold increase in mutant frequency for 113 keV/{mu}m carbon ions, whereas no enhancement of mutant frequency was observed for carbon ions near the range end. This suggested that carbon ions near the range end induced mutations that were not recovered by plasmid rescue. An Arabidopsis DNA ligase IV mutant, deficient in non-homologous end-joining repair, showed hyper-sensitivity to both types of carbon-ion irradiation. The difference in radiation sensitivity between the wild type and the repair-deficient mutant was greatly diminished for carbon ions near the range end, suggesting that these ions induce irreparable DNA damage. Mutational analysis of the Arabidopsis GL1 locus showed that while the frequency of generation of glabrous mutant sectors was not different between the two types of carbon-ion irradiation, large deletions (>{approx}30 kb) were six times more frequently induced by carbon ions near the range end. When 352 keV/{mu}m neon ions were used, these showed a 6.4 times increase in the frequency of induced large deletions compared with the 113 keV/{mu}m carbon ions. We suggest that the proportion of large deletions increases with LET in plants, as has been reported for mammalian cells. The nature of mutations induced in plants by carbon ions near the range end is discussed in relation to mutation detection by plasmid rescue and transmissibility to progeny.
Extreme growth failure is a common presentation of ligase IV deficiency
Murray, J.E.; Bicknell, L.S.; Yigit, G.; Duker, A.L.; Kogelenberg, M. van; Haghayegh, S.; Wieczorek, D.; Kayserili, H.; Albert, M.H.; Wise, C.A.; Brandon, J.; Kleefstra, T.; Warris, A.; Flier, M. van der; Bamforth, J.S.; Doonanco, K.; Ades, L.; Ma, A.; Field, M.; Johnson, D.; Shackley, F.; Firth, H.; Woods, C.G.; Nurnberg, P.; Gatti, R.A.; Hurles, M.; Bober, M.B.; Wollnik, B.; Jackson, A.P.
2014-01-01
Ligase IV syndrome is a rare differential diagnosis for Nijmegen breakage syndrome owing to a shared predisposition to lympho-reticular malignancies, significant microcephaly, and radiation hypersensitivity. Only 16 cases with mutations in LIG4 have been described to date with phenotypes varying
Forensic botany II, DNA barcode for land plants: Which markers after the international agreement?
Ferri, G; Corradini, B; Ferrari, F; Santunione, A L; Palazzoli, F; Alu', M
2015-03-01
The ambitious idea of using a short piece of DNA for large-scale species identification (DNA barcoding) is already a powerful tool for scientists and the application of this standard technique seems promising in a range of fields including forensic genetics. While DNA barcoding enjoyed a remarkable success for animal identification through cytochrome c oxidase I (COI) analysis, the attempts to identify a single barcode for plants remained a vain hope for a longtime. From the beginning, the Consortium for the Barcode of Life (CBOL) showed a lack of agreement on a core plant barcode, reflecting the diversity of viewpoints. Different research groups advocated various markers with divergent set of criteria until the recent publication by the CBOL-Plant Working Group. After a four-year effort, in 2009 the International Team concluded to agree on standard markers promoting a multilocus solution (rbcL and matK), with 70-75% of discrimination to the species level. In 2009 our group firstly proposed the broad application of DNA barcoding principles as a tool for identification of trace botanical evidence through the analysis of two chloroplast loci (trnH-psbA and trnL-trnF) in plant species belonging to local flora. Difficulties and drawbacks that were encountered included a poor coverage of species in specific databases and the lack of authenticated reference sequences for the selected markers. Successful preliminary results were obtained providing an approach to progressively identify unknown plant specimens to a given taxonomic rank, usable by any non-specialist botanist or in case of a shortage of taxonomic expertise. Now we considered mandatory to update and to compare our previous findings with the new selected plastid markers (matK+rbcL), taking into account forensic requirements. Features of all the four loci (the two previously analyzed trnH-psbA+trnL-trnF and matK+rbcL) were compared singly and in multilocus solutions to assess the most suitable combination for
Vietina, Michelangelo; Agrimonti, Caterina; Marmiroli, Nelson
2013-12-15
Extra virgin olive oil is frequently subjected to adulterations with addition of oils obtained from plants other than olive. DNA analysis is a fast and economic tool to identify plant components in oils. Extraction and amplification of DNA by PCR was tested in olives, in milled seeds and in oils, to investigate its use in olive oil traceability. DNA was extracted from different oils made of hazelnut, maize, sunflower, peanut, sesame, soybean, rice and pumpkin. Comparing the DNA melting profiles in reference plant materials and in the oils, it was possible to identify any plant components in oils and mixtures of oils. Real-Time PCR (RT-PCR) platform has been added of the new methodology of high resolution melting (HRM), both were used to analyse olive oils mixed with different percentage of other oils. Results showed HRM a cost effective method for efficient detection of adulterations in olive oils. Copyright © 2013 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Tabassum, Sartaj [Department of Chemistry, Aligarh Muslim University, Aligarh, UP 202002 (India); Al-Asbahy, Waddhaah M.; Afzal, Mohd.; Shamsi, Manal; Arjmand, Farukh [Department of Chemistry, Aligarh Muslim University, Aligarh, UP 202002 (India)
2012-11-15
A new water soluble complex [Zn(glygly)(ssz)(H{sub 2}O)]{center_dot}6H{sub 2}O, 1 derived from dipeptide (glycyl glycine) and sulfasalazine was synthesized and characterized by spectroscopic (IR, UV-vis, NMR, ESI-MS) and analytical methods. The in vitro DNA binding studies of complex 1 with calf-thymus DNA were carried out by employing various biophysical methods and molecular docking technique which reveals strong electrostatic binding via phosphate backbone of DNA helix, in addition to partial intercalation. To gain further insight into the molecular recognition at the target site, interaction studies of complex 1 with 5 Prime -TMP and 5 Prime -GMP were carried out by UV-vis titration which was validated by {sup 1}H and {sup 31}P NMR with 5 Prime -TMP, which implicate the preferential selectivity of 1 towards N3 of thymine. Complex 1 is accessible to minor groove of DNA and cleaved pBR322 DNA via hydrolytic pathway (validated by T4 ligase assay). - Graphical abstract: Synthesis, characterization, DNA binding and cleavage studies of [Zn(glygly)(ssz)(H{sub 2}O)]{center_dot}6H{sub 2}O (1) containing glycyl glycine and sulfasalazine ligand. Complex 1 recognize minor groove of DNA and show hydrolytic DNA cleavage. Highlights: Black-Right-Pointing-Pointer Novel Zn(II) complex 1 bearing bioactive glycyl glycine and sulfasalazine ligand scaffold. Black-Right-Pointing-Pointer Cleavage activity of 1 was enhanced in presence of activators: H{sub 2}O{sub 2}>MPA>GSH>Asc. Black-Right-Pointing-Pointer Complex 1 recognize minor groove as depicted in the cleavage pattern and molecular docking. Black-Right-Pointing-Pointer Complex 1 cleaves pBR322 DNA via hydrolytic mechanism and validated by T4 DNA ligase experiments.
Pfirrmann, Thorsten; Villavicencio-Lorini, Pablo; Subudhi, Abinash K; Menssen, Ruth; Wolf, Dieter H; Hollemann, Thomas
2015-01-01
In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of the skin and its suppression results in malformations of the fore- and midbrain. We therefore suggest that Xenopus laevis Rmnd5, as a subunit of the CTLH complex, is a ubiquitin-ligase targeting an unknown factor for polyubiquitination and subsequent proteasomal degradation for proper fore- and midbrain development.
Directory of Open Access Journals (Sweden)
Thorsten Pfirrmann
Full Text Available In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of the skin and its suppression results in malformations of the fore- and midbrain. We therefore suggest that Xenopus laevis Rmnd5, as a subunit of the CTLH complex, is a ubiquitin-ligase targeting an unknown factor for polyubiquitination and subsequent proteasomal degradation for proper fore- and midbrain development.
Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A
2015-12-29
Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.
Anuradha, C M; Mulakayala, Chaitanya; Babajan, Banaganapalli; Naveen, M; Rajasekhar, Chikati; Kumar, Chitta Suresh
2010-01-01
Multi drug resistance capacity for Mycobacterium tuberculosis (MDR-Mtb) demands the profound need for developing new anti-tuberculosis drugs. The present work is on Mtb-MurC ligase, which is an enzyme involved in biosynthesis of peptidoglycan, a component of Mtb cell wall. In this paper the 3-D structure of Mtb-MurC has been constructed using the templates 1GQQ and 1P31. Structural refinement and energy minimization of the predicted Mtb-MurC ligase model has been carried out by molecular dynamics. The streochemical check failures in the energy minimized model have been evaluated through Procheck, Whatif ProSA, and Verify 3D. Further torsion angles for the side chains of amino acid residues of the developed model were determined using Predictor. Docking analysis of Mtb-MurC model with ligands and natural substrates enabled us to identify specific residues viz. Gly125, Lys126, Arg331, and Arg332, within the Mtb-MurC binding pocket to play an important role in ligand and substrate binding affinity and selectivity. The availability of Mtb-MurC ligase built model, together with insights gained from docking analysis will promote the rational design of potent and selective Mtb-MurC ligase inhibitors as antituberculosis therapeutics.
Kuzmina, Maria L.; Braukmann, Thomas W. A.; Fazekas, Aron J.; Graham, Sean W.; Dewaard, Stephanie L.; Rodrigues, Anuar; Bennett, Bruce A.; Dickinson, Timothy A.; Saarela, Jeffery M.; Catling, Paul M.; Newmaster, Steven G.; Percy, Diana M.; Fenneman, Erin; Lauron-Moreau, Aurélien; Ford, Bruce; Gillespie, Lynn; Subramanyam, Ragupathy; Whitton, Jeannette; Jennings, Linda; Metsger, Deborah; Warne, Connor P.; Brown, Allison; Sears, Elizabeth; Dewaard, Jeremy R.; Zakharov, Evgeny V.; Hebert, Paul D. N.
2017-01-01
Premise of the study: Constructing complete, accurate plant DNA barcode reference libraries can be logistically challenging for large-scale floras. Here we demonstrate the promise and challenges of using herbarium collections for building a DNA barcode reference library for the vascular plant flora of Canada. Methods: Our study examined 20,816 specimens representing 5076 of 5190 vascular plant species in Canada (98%). For 98% of the specimens, at least one of the DNA barcode regions was recovered from the plastid loci rbcL and matK and from the nuclear ITS2 region. We used beta regression to quantify the effects of age, type of preservation, and taxonomic affiliation (family) on DNA sequence recovery. Results: Specimen age and method of preservation had significant effects on sequence recovery for all markers, but influenced some families more (e.g., Boraginaceae) than others (e.g., Asteraceae). Discussion: Our DNA barcode library represents an unparalleled resource for metagenomic and ecological genetic research working on temperate and arctic biomes. An observed decline in sequence recovery with specimen age may be associated with poor primer matches, intragenomic variation (for ITS2), or inhibitory secondary compounds in some taxa. PMID:29299394
Analysis of DNA strand break induction and repair in plants from the vicinity of Chernobyl
International Nuclear Information System (INIS)
Syomov, A.B.; Ptitsyna, S.N.; Sergeeva, S.A.
1992-01-01
For 3 years following the Chernobyl accident DNA repair efficiency was studied in irradiated and control populations of various plan species. Compared with the control populations, some irradiated populations exhibited increases in the yield of DNA single-strand breaks per unit dose of challenge radiation. The effect was registered in low-dose-rate alpha-irradiated populations, but was absent in plant populations growing in conditions of low-dose-rate beta-irradiation. The efficiency of single-strand DNA repair was identical in control and irradiated populations and approximated 100%. (author). 12 refs.; 1 fig.; 2 tabs
Kitevski-Leblanc, Julianne; Fradet-Turcotte, Amélie; Kukic, Predrag; Wilson, Marcus D.; Portella, Guillem; Yuwen, Tairan; Panier, Stephanie; Duan, Shili; Canny, Marella D.; Van Ingen, Hugo; Arrowsmith, Cheryl H.; Rubinstein, John L.; Vendruscolo, Michele; Durocher, Daniel; Kay, Lewis E
2017-01-01
Site-specific histone ubiquitylation plays a central role in orchestrating the response to DNA double-strand breaks (DSBs). DSBs elicit a cascade of events controlled by the ubiquitin ligase RNF168, which promotes the accumulation of repair factors such as 53BP1 and BRCA1 on the chromatin flanking
Methylated DNMT1 and E2F1 are targeted for proteolysis by L3MBTL3 and CRL4DCAF5 ubiquitin ligase.
Leng, Feng; Yu, Jiekai; Zhang, Chunxiao; Alejo, Salvador; Hoang, Nam; Sun, Hong; Lu, Fei; Zhang, Hui
2018-04-24
Many non-histone proteins are lysine methylated and a novel function of this modification is to trigger the proteolysis of methylated proteins. Here, we report that the methylated lysine 142 of DNMT1, a major DNA methyltransferase that preserves epigenetic inheritance of DNA methylation patterns during DNA replication, is demethylated by LSD1. A novel methyl-binding protein, L3MBTL3, binds the K142-methylated DNMT1 and recruits a novel CRL4 DCAF5 ubiquitin ligase to degrade DNMT1. Both LSD1 and PHF20L1 act primarily in S phase to prevent DNMT1 degradation by L3MBTL3-CRL4 DCAF5 . Mouse L3MBTL3/MBT-1 deletion causes accumulation of DNMT1 protein, increased genomic DNA methylation, and late embryonic lethality. DNMT1 contains a consensus methylation motif shared by many non-histone proteins including E2F1, a key transcription factor for S phase. We show that the methylation-dependent E2F1 degradation is also controlled by L3MBTL3-CRL4 DCAF5 . Our studies elucidate for the first time a novel mechanism by which the stability of many methylated non-histone proteins are regulated.
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
DNA binding by the plant-specific NAC transcription factors in crystal and solution
DEFF Research Database (Denmark)
Welner, Ditte Hededam; Lindemose, Søren; Grossmann, J. Günter
2012-01-01
angle X-ray scattering on complexes with oligonucleotides, mutagenesis and (DNase I and uranyl photo-) footprinting, is combined to form a structural view of DNA-binding, and for the first time provide experimental evidence for the speculated relationship between plant-specific NAC proteins, WRKY...
Löser, Dana A; Shibata, Atsushi; Shibata, Akiko K; Woodbine, Lisa J; Jeggo, Penny A; Chalmers, Anthony J
2010-06-01
As single agents, chemical inhibitors of poly(ADP-ribose) polymerase (PARP) are nontoxic and have clinical efficacy against BRCA1- and BRCA2-deficient tumors. PARP inhibitors also enhance the cytotoxicity of ionizing radiation and alkylating agents but will only improve clinical outcomes if tumor sensitization exceeds effects on normal tissues. It is unclear how tumor DNA repair proficiency affects the degree of sensitization. We have previously shown that the radiosensitizing effect of PARP inhibition requires DNA replication and will therefore affect rapidly proliferating tumors more than normal tissues. Because many tumors exhibit defective DNA repair, we investigated the impact of double-strand break (DSB) repair integrity on the sensitizing effects of the PARP inhibitor olaparib. Sensitization to ionizing radiation and the alkylating agent methylmethane sulfonate was enhanced in DSB repair-deficient cells. In Artemis(-/-) and ATM(-/-) mouse embryo fibroblasts, sensitization was replication dependent and associated with defective repair of replication-associated damage. Radiosensitization of Ligase IV(-/-) mouse embryo fibroblasts was independent of DNA replication and is explained by inhibition of "alternative" end joining. After methylmethane sulfonate treatment, PARP inhibition promoted replication-independent accumulation of DSB, repair of which required Ligase IV. Our findings predict that the sensitizing effects of PARP inhibitors will be more pronounced in rapidly dividing and/or DNA repair defective tumors than normal tissues and show their potential to enhance the therapeutic ratio achieved by conventional DNA-damaging agents.
Mms1 is an assistant for regulating G-quadruplex DNA structures.
Schwindt, Eike; Paeschke, Katrin
2017-11-02
The preservation of genome stability is fundamental for every cell. Genomic integrity is constantly challenged. Among those challenges are also non-canonical nucleic acid structures. In recent years, scientists became aware of the impact of G-quadruplex (G4) structures on genome stability. It has been shown that folded G4-DNA structures cause changes in the cell, such as transcriptional up/down-regulation, replication stalling, or enhanced genome instability. Multiple helicases have been identified to regulate G4 structures and by this preserve genome stability. Interestingly, although these helicases are mostly ubiquitous expressed, they show specificity for G4 regulation in certain cellular processes (e.g., DNA replication). To this date, it is not clear how this process and target specificity of helicases are achieved. Recently, Mms1, an ubiquitin ligase complex protein, was identified as a novel G4-DNA-binding protein that supports genome stability by aiding Pif1 helicase binding to these regions. In this perspective review, we discuss the question if G4-DNA interacting proteins are fundamental for helicase function and specificity at G4-DNA structures.
Puthiyaveetil, Abdul Gafoor; Reilly, Christopher M; Pardee, Timothy S; Caudell, David L
2013-01-01
Chromosomal translocations typically impair cell differentiation and often require secondary mutations for malignant transformation. However, the role of a primary translocation in the development of collaborating mutations is debatable. To delineate the role of leukemic translocation NUP98-HOXD13 (NHD13) in secondary mutagenesis, DNA break and repair mechanisms in stimulated mouse B lymphocytes expressing NHD13 were analyzed. Our results showed significantly reduced expression of non-homologous end joining (NHEJ)-mediated DNA repair genes, DNA Pkcs, DNA ligase4, and Xrcc4 leading to cell cycle arrest at G2/M phase. Our results showed that expression of NHD13 fusion gene resulted in impaired NHEJ-mediated DNA break repair. Copyright © 2012 Elsevier Ltd. All rights reserved.
Wright, Douglas G; Castore, Reneau; Shi, Runhua; Mallick, Amrita; Ennis, Don G; Harrison, Lynn
2017-03-01
Mycobacterium tuberculosis and Mycobacterium smegmatis express a Ku protein and a DNA ligase D and are able to repair DNA double strand breaks (DSBs) by non-homologous end-joining (NHEJ). This pathway protects against DNA damage when bacteria are in stationary phase. Mycobacterium marinum is a member of this mycobacterium family and like M. tuberculosis is pathogenic. M. marinum lives in water, forms biofilms and infects fish and frogs. M. marinum is a biosafety level 2 (BSL2) organism as it can infect humans, although infections are limited to the skin. M. marinum is accepted as a model to study mycobacterial pathogenesis, as M. marinum and M. tuberculosis are genetically closely related and have similar mechanisms of survival and persistence inside macrophage. The aim of this study was to determine whether M. marinum could be used as a model to understand M. tuberculosis NHEJ repair. We identified and cloned the M. marinum genes encoding NHEJ proteins and generated E. coli strains that express the M. marinum Ku (Mm-Ku) and ligase D (Mm-Lig) individually or together (LHmKumLig strain) from expression vectors integrated at phage attachment sites in the genome. We demonstrated that Mm-Ku and Mm-Lig are both required to re-circularize Cla I-linearized plasmid DNA in E. coli. We compared repair of strain LHmKumLig with that of an E. coli strain (BWKuLig#2) expressing the M. tuberculosis Ku (Mt-Ku) and ligase D (Mt-Lig), and found that LHmKumLig performed 3.5 times more repair and repair was more accurate than BWKuLig#2. By expressing the Mm-Ku with the Mt-Lig, or the Mt-Ku with the Mm-Lig in E. coli, we have shown that the NHEJ proteins from M. marinum and M. tuberculosis can function together to join DNA DSBs. NHEJ repair is therefore conserved between the two species. Consequently, M. marinum is a good model to study NHEJ repair during mycobacterial pathogenesis. © The Author 2016. Published by Oxford University Press on behalf of the UK Environmental Mutagen
International Nuclear Information System (INIS)
Korzhnev, Dmitry M.; Neculai, Dante; Dhe-Paganon, Sirano; Arrowsmith, Cheryl H.; Bezsonova, Irina
2016-01-01
HLTF is a SWI2/SNF2-family ATP-dependent chromatin remodeling enzyme that acts in the error-free branch of DNA damage tolerance (DDT), a cellular mechanism that enables replication of damaged DNA while leaving damage repair for a later time. Human HLTF and a closely related protein SHPRH, as well as their yeast homologue Rad5, are multi-functional enzymes that share E3 ubiquitin-ligase activity required for activation of the error-free DDT. HLTF and Rad5 also function as ATP-dependent dsDNA translocases and possess replication fork reversal activities. Thus, they can convert Y-shaped replication forks into X-shaped Holliday junction structures that allow error-free replication over DNA lesions. The fork reversal activity of HLTF is dependent on 3′-ssDNA-end binding activity of its N-terminal HIRAN domain. Here we present the solution NMR structure of the human HLTF HIRAN domain, an OB-like fold module found in organisms from bacteria (as a stand-alone domain) to plants, fungi and metazoan (in combination with SWI2/SNF2 helicase-like domain). The obtained structure of free HLTF HIRAN is similar to recently reported structures of its DNA bound form, while the NMR analysis also reveals that the DNA binding site of the free domain exhibits conformational heterogeneity. Sequence comparison of N-terminal regions of HLTF, SHPRH and Rad5 aided by knowledge of the HLTF HIRAN structure suggests that the SHPRH N-terminus also includes an uncharacterized structured module, exhibiting weak sequence similarity with HIRAN regions of HLTF and Rad5, and potentially playing a similar functional role.
Energy Technology Data Exchange (ETDEWEB)
Korzhnev, Dmitry M. [University of Connecticut Health, Department of Molecular Biology and Biophysics (United States); Neculai, Dante [Zhejiang University, School of Medicine (China); Dhe-Paganon, Sirano [Dana-Farber Cancer Institute, Department of Cancer Biology (United States); Arrowsmith, Cheryl H. [University of Toronto, Structural Genomics Consortium (Canada); Bezsonova, Irina, E-mail: bezsonova@uchc.edu [University of Connecticut Health, Department of Molecular Biology and Biophysics (United States)
2016-11-15
HLTF is a SWI2/SNF2-family ATP-dependent chromatin remodeling enzyme that acts in the error-free branch of DNA damage tolerance (DDT), a cellular mechanism that enables replication of damaged DNA while leaving damage repair for a later time. Human HLTF and a closely related protein SHPRH, as well as their yeast homologue Rad5, are multi-functional enzymes that share E3 ubiquitin-ligase activity required for activation of the error-free DDT. HLTF and Rad5 also function as ATP-dependent dsDNA translocases and possess replication fork reversal activities. Thus, they can convert Y-shaped replication forks into X-shaped Holliday junction structures that allow error-free replication over DNA lesions. The fork reversal activity of HLTF is dependent on 3′-ssDNA-end binding activity of its N-terminal HIRAN domain. Here we present the solution NMR structure of the human HLTF HIRAN domain, an OB-like fold module found in organisms from bacteria (as a stand-alone domain) to plants, fungi and metazoan (in combination with SWI2/SNF2 helicase-like domain). The obtained structure of free HLTF HIRAN is similar to recently reported structures of its DNA bound form, while the NMR analysis also reveals that the DNA binding site of the free domain exhibits conformational heterogeneity. Sequence comparison of N-terminal regions of HLTF, SHPRH and Rad5 aided by knowledge of the HLTF HIRAN structure suggests that the SHPRH N-terminus also includes an uncharacterized structured module, exhibiting weak sequence similarity with HIRAN regions of HLTF and Rad5, and potentially playing a similar functional role.
Nuclear DNA content of the hybrid plant pathogen Phytophthora andina determined by flow cytometry.
Wang, Jianan; Presser, Jackson W; Goss, Erica M
2016-09-01
Phytophthora andina is a heterothallic plant pathogen of Andean solanaceous hosts and is an interspecific hybrid of P. infestans and an unknown Phytophthora species. The objective of this study was to estimate the nuclear DNA content of isolates in three clonal lineages of P. andina relative to P. infestans Twelve isolates of P. andina and six isolates of P. infestans were measured for nuclear DNA content by propidium iodide-stained flow cytometry. We found that the DNA content of P. andina was similar but slightly smaller, on average, than that of our sample of P. infestans isolates. This is consistent with P. andina being a homoploid hybrid rather than allopolyploid hybrid. Nuclear DNA content was more variable among a smaller sample of P. infestans isolates, including a putative triploid isolate from Mexico, but small differences in nuclear DNA content were also observed among P. andina isolates. Both species appear to be able to tolerate significant variation in genome size. © 2016 by The Mycological Society of America.
Directory of Open Access Journals (Sweden)
Laktionov P. P.
2012-07-01
Full Text Available Aim. To investigate the possibility of human cultured cells to incorporate isolated mitochondria together with exogenous DNA introduced into organelles. Methods. Two approaches were used for this purpose, fluorescent labelling of mitochondria and/or DNA with subsequent analysis of the cells subjected to incubation by microscopy or by quantitative PCR. Results. We have shown that human cultured cells lines, HeLa and HUVEC, are capable to uptake isolated plant mitochondria and that this process depends on the incubation time and concentration of organelles present in medium. The incorporated mitochondria can serve as vehicles to deliver exogenous DNA into human cells, this DNA is then distributed in different cell compartments. Conclusions. These results are preliminary and need further investigations, including testing the possibility of human cells to incorporate the mitochondria of human or animal origin and creating genetic construction which could provide certain selectivity or stability of the transferred exogenous DNA upon cell uptake of the mitochondria as vectors.
The Fanconi anemia DNA repair pathway: structural and functional insights into a complex disorder.
Walden, Helen; Deans, Andrew J
2014-01-01
Mutations in any of at least sixteen FANC genes (FANCA-Q) cause Fanconi anemia, a disorder characterized by sensitivity to DNA interstrand crosslinking agents. The clinical features of cytopenia, developmental defects, and tumor predisposition are similar in each group, suggesting that the gene products participate in a common pathway. The Fanconi anemia DNA repair pathway consists of an anchor complex that recognizes damage caused by interstrand crosslinks, a multisubunit ubiquitin ligase that monoubiquitinates two substrates, and several downstream repair proteins including nucleases and homologous recombination enzymes. We review progress in the use of structural and biochemical approaches to understanding how each FANC protein functions in this pathway.
Specificity of DNA repair in plants exposed at low dose-rate
International Nuclear Information System (INIS)
Semov, A.B.; Ptitsina, S.N.; Shevchenko, V.A.
1997-01-01
Intensity of gamma-ray induced unscheduled DNA synthesis (UDS) as well as yield and repair of single-strand DNA breaks (SSB) were investigated in control and exposed higher plant populations. Populations of V. cracca have been chronically irradiating by 90 Sr-beta-particles due to Kyshtym accident (South Ural) or have been growing on the uranium-miner tails (alpha-irradiation). In former case increased radioresistance was revealed (the phenomenon previously called radio-adaptation and that probably has something in common with adaptive response). This radioresistance correlates with higher intensity of UDS. On the basis of experiments with specific inhibitors of alpha- and beta- like DNA polymerases (aphidicolin, di-deoxy-thymidine) and protein synthesis (cycloheximide) it was assumed that the enhanced UDS in radioresistant population is an partially inducible process in which both DNA polymerases take part. In control population UDS is not inducible and totally inhibited by ddT. Differences in induction and repair of gamma-ray induced SSB between control and radioresistant populations were not registered. In case of chronic alpha-irradiation increased radiosensitivity and slightly decreased UDS were found. In this population and in some populations from Chernobyl vicinity, analyzed in 1986-1991, higher yield of SSB was registered but repair of SSB was not differ from control ones. (authors)
Ghahramanzadeh, R; Esselink, G; Kodde, L P; Duistermaat, H; van Valkenburg, J L C H; Marashi, S H; Smulders, M J M; van de Wiel, C C M
2013-01-01
Biological invasions are regarded as threats to global biodiversity. Among invasive aliens, a number of plant species belonging to the genera Myriophyllum, Ludwigia and Cabomba, and to the Hydrocharitaceae family pose a particular ecological threat to water bodies. Therefore, one would try to prevent them from entering a country. However, many related species are commercially traded, and distinguishing invasive from non-invasive species based on morphology alone is often difficult for plants in a vegetative stage. In this regard, DNA barcoding could become a good alternative. In this study, 242 samples belonging to 26 species from 10 genera of aquatic plants were assessed using the chloroplast loci trnH-psbA, matK and rbcL. Despite testing a large number of primer sets and several PCR protocols, the matK locus could not be amplified or sequenced reliably and therefore was left out of the analysis. Using the other two loci, eight invasive species could be distinguished from their respective related species, a ninth one failed to produce sequences of sufficient quality. Based on the criteria of universal application, high sequence divergence and level of species discrimination, the trnH-psbA noncoding spacer was the best performing barcode in the aquatic plant species studied. Thus, DNA barcoding may be helpful with enforcing a ban on trade of such invasive species, such as is already in place in the Netherlands. This will become even more so once DNA barcoding would be turned into machinery routinely operable by a nonspecialist in botany and molecular genetics. © 2012 Blackwell Publishing Ltd.
The NEDD8 modification pathway in plants
Directory of Open Access Journals (Sweden)
Claus eSchwechheimer
2014-03-01
Full Text Available NEDD8, in plants and yeasts also known as RELATED TO UBIQUITIN (RUB, is an evolutionarily conserved 76 amino acid protein highly related to ubiquitin. Like ubiquitin, NEDD8 can be conjugated to and deconjugated from target proteins, but unlike ubiquitin, NEDD8 has not been reported to form chains similar to the different polymeric ubiquitin chains that have a role in a diverse set of cellular processes. NEDD8-modification is best known as a posttranslational modification of the cullin subunits of cullin-RING E3 ubiquitin ligases. In this context, structural analyses have revealed that neddylation induces a conformation change of the cullin that brings the ubiquitylation substrates into proximity of the interacting E2 conjugating enzyme. In turn, NEDD8 deconjugation destabilizes the cullin RING ligase complex allowing for the exchange of substrate recognition subunits via the exchange factor CAND1. In plants, components of the neddylation and deneddylation pathway were identified based on mutants with defects in auxin and light responses and the characterization of these mutants has been instrumental for the elucidation of the neddylation pathway. More recently, there has been evidence from animal and plant systems that NEDD8 conjugation may also regulate the behavior or fate of non-cullin substrates in a number of ways. Here, the current knowledge on NEDD8 processing, conjugation and deconjugation is presented, where applicable, in the context of specific signaling pathways from plants.
Physico-chemical and biological study of excision-repair of UV-irradiated PHIX 174 RF DNA in vitro
International Nuclear Information System (INIS)
Heijneker, H.L.
1975-01-01
A study is presented on the excision repair of ultraviolet-irradiated PHIX 174 RFI DNA in vitro with UV-specific endonuclease from micrococcus luteus, DNA polymerase I from E. coli and DNA ligase from phage T 4 infected E. coli. Excision repair was measured by physico-chemical and by biological methods. It is shown that more than 90% of the pyrimidine dimers can be repaired in vitro and that the repaired molecules have regained full biological activity. Endonuclease III was not essential for excision repair in vitro and did not stimulate repair; from this it was concluded that UV-endo generates 3' OH endgroups. The usefulness of the methods with regard to the study of excision repair is discussed
Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.
Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A
2016-06-01
Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.
A comparison of the DNA and chromosome repair kinetics after #betta# irradiation
International Nuclear Information System (INIS)
Hittelman, W.N.; Pollard, M.
1982-01-01
The kinetics of repair at the chromosome and DNA levels were compared after #betta# irradiation of Chinese hamster ovary cells (CHO). Induction and repair of DNA damage were measured by the alkaline and neutral elution techniques, while chromosome damage and repair were determined by the technique of premature chromosome condensation. During and after #betta# irradiation, significant DNA repair occurred within 2 min. This fast repair could be inhibited by EDTA and pyrophosphate and probably reflected polynucleotide ligase activity. A slower component of DNA repair was detected between 15 and 60 min after irradiation, by which time most of the DNA had been repaired. In contrast, chromosome repair was not detectable until 45 min after irradiation, and nearly half of the chromatid breaks were repaired by 60 min. Cycloheximide, an inhibitor of protein synthesis, prevented chromosome break repair, yet had no effect on the immediate formation of chromatid exchanges or DNA repair. These results suggest the following: (1) the rapidly repairing DNA lesions are not important in the repair of chromosomes; (2) chromosome damage involves only a minority of the DNA lesions measured by alkaline and neutral DNA elution; and (3) chromosome repair may involve more than simply the repair of damaged DNA that can be detected by the alkaline and neutral elution assays
Cross-Talk between Carbon Metabolism and the DNA Damage Response in S. cerevisiae
Directory of Open Access Journals (Sweden)
Kobi J. Simpson-Lavy
2015-09-01
Full Text Available Yeast cells with DNA damage avoid respiration, presumably because products of oxidative metabolism can be harmful to DNA. We show that DNA damage inhibits the activity of the Snf1 (AMP-activated protein kinase (AMPK, which activates expression of genes required for respiration. Glucose and DNA damage upregulate SUMOylation of Snf1, catalyzed by the SUMO E3 ligase Mms21, which inhibits SNF1 activity. The DNA damage checkpoint kinases Mec1/ATR and Tel1/ATM, as well as the nutrient-sensing protein kinase A (PKA, regulate Mms21 activity toward Snf1. Mec1 and Tel1 are required for two SNF1-regulated processes—glucose sensing and ADH2 gene expression—even without exogenous genotoxic stress. Our results imply that inhibition of Snf1 by SUMOylation is a mechanism by which cells lower their respiration in response to DNA damage. This raises the possibility that activation of DNA damage checkpoint mechanisms could contribute to aerobic fermentation (Warburg effect, a hallmark of cancer cells.
Mazzoleni, Stefano; Bonanomi, Giuliano; Incerti, Guido; Chiusano, Maria Luisa; Termolino, Pasquale; Mingo, Antonio; Senatore, Mauro; Giannino, Francesco; Cartenì, Fabrizio; Rietkerk, Max; Lanzotti, Virginia
2015-01-01
Plant-soil negative feedback (NF) is recognized as an important factor affecting plant communities. The objectives of this work were to assess the effects of litter phytotoxicity and autotoxicity on root proliferation, and to test the hypothesis that DNA is a driver of litter autotoxicity and
International Nuclear Information System (INIS)
Tamaoki, Masanori; Matsuyama, Takashi; Nakajima, Nobuyoshi; Aono, Mitsuko; Kubo, Akihiro; Saji, Hikaru
2004-01-01
Plants in the field are subjected to numerous environmental stresses. Lengthy continuation of such environmental stresses or a rapid increase in their intensity is harmful to vegetation. Assessments of the phytotoxicity of various stresses have been performed in many countries, although they have largely been based on estimates of leaf injury. We developed a novel method of detecting plant stresses that is more sensitive and specific than those previously available. This method is based on the detection of mRNA expression changes in 205 ozone-responsive Arabidopsis expressed sequence tags (ESTs) by cDNA macroarray analysis. By using this method, we illustrated shifts in gene expression in response to stressors such as drought, salinity, UV-B, low temperature, high temperature, and acid rain, as distinct from those in response to ozone. We also made a mini-scale macroarray with 12 ESTs for diagnosis of the above environmental stresses in plants. These results illustrate the potential of our cDNA macroarray for diagnosis of various stresses in plants
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding.
Kushwaha, Ambuj K; Grove, Anne
2013-01-24
Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins.
INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM
Directory of Open Access Journals (Sweden)
L. S. Dyshlyuk
2014-01-01
Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.
Extracellular VirB5 enhances T-DNA transfer from Agrobacterium to the host plant.
Directory of Open Access Journals (Sweden)
Benoît Lacroix
Full Text Available VirB5 is a type 4 secretion system protein of Agrobacterium located on the surface of the bacterial cell. This localization pattern suggests a function for VirB5 which is beyond its known role in biogenesis and/or stabilization of the T-pilus and which may involve early interactions between Agrobacterium and the host cell. Here, we identify VirB5 as the first Agrobacterium virulence protein that can enhance infectivity extracellularly. Specifically, we show that elevating the amounts of the extracellular VirB5--by exogenous addition of the purified protein, its overexpression in the bacterium, or transgenic expression in and secretion out of the host cell--enhances the efficiency the Agrobacterium-mediated T-DNA transfer, as measured by transient expression of genes contained on the transferred T-DNA molecule. Importantly, the exogenous VirB5 enhanced transient T-DNA expression in sugar beet, a major crop recalcitrant to genetic manipulation. Increasing the pool of the extracellular VirB5 did not complement an Agrobacterium virB5 mutant, suggesting a dual function for VirB5: in the bacterium and at the bacterium-host cell interface. Consistent with this idea, VirB5 expressed in the host cell, but not secreted, had no effect on the transformation efficiency. That the increase in T-DNA expression promoted by the exogenous VirB5 was not due to its effects on bacterial growth, virulence gene induction, bacterial attachment to plant tissue, or host cell defense response suggests that VirB5 participates in the early steps of the T-DNA transfer to the plant cell.
Extracellular VirB5 enhances T-DNA transfer from Agrobacterium to the host plant.
Lacroix, Benoît; Citovsky, Vitaly
2011-01-01
VirB5 is a type 4 secretion system protein of Agrobacterium located on the surface of the bacterial cell. This localization pattern suggests a function for VirB5 which is beyond its known role in biogenesis and/or stabilization of the T-pilus and which may involve early interactions between Agrobacterium and the host cell. Here, we identify VirB5 as the first Agrobacterium virulence protein that can enhance infectivity extracellularly. Specifically, we show that elevating the amounts of the extracellular VirB5--by exogenous addition of the purified protein, its overexpression in the bacterium, or transgenic expression in and secretion out of the host cell--enhances the efficiency the Agrobacterium-mediated T-DNA transfer, as measured by transient expression of genes contained on the transferred T-DNA molecule. Importantly, the exogenous VirB5 enhanced transient T-DNA expression in sugar beet, a major crop recalcitrant to genetic manipulation. Increasing the pool of the extracellular VirB5 did not complement an Agrobacterium virB5 mutant, suggesting a dual function for VirB5: in the bacterium and at the bacterium-host cell interface. Consistent with this idea, VirB5 expressed in the host cell, but not secreted, had no effect on the transformation efficiency. That the increase in T-DNA expression promoted by the exogenous VirB5 was not due to its effects on bacterial growth, virulence gene induction, bacterial attachment to plant tissue, or host cell defense response suggests that VirB5 participates in the early steps of the T-DNA transfer to the plant cell.
Ocsoy, Ismail; Paret, Mathews L; Ocsoy, Muserref Arslan; Kunwar, Sanju; Chen, Tao; You, Mingxu; Tan, Weihong
2013-10-22
Bacterial spot caused by Xanthomonas perforans is a major disease of tomatoes, leading to reduction in production by 10-50%. While copper (Cu)-based bactericides have been used for disease management, most of the X. perforans strains isolated from tomatoes in Florida and other locations worldwide are Cu-resistant. We have developed DNA-directed silver (Ag) nanoparticles (NPs) grown on graphene oxide (GO). These Ag@dsDNA@GO composites effectively decrease X. perforans cell viability in culture and on plants. At the very low concentration of 16 ppm of Ag@dsDNA@GO, composites show excellent antibacterial capability in culture with significant advantages in improved stability, enhanced antibacterial activity, and stronger adsorption properties. Application of Ag@dsDNA@GO at 100 ppm on tomato transplants in a greenhouse experiment significantly reduced the severity of bacterial spot disease compared to untreated plants, giving results similar to those of the current grower standard treatment, with no phytotoxicity.
Repair of X-ray-induced single-strand breaks by a cell-free system
International Nuclear Information System (INIS)
Seki, Shuji; Ikeda, Shogo; Tsutui, Ken; Teraoka, Hirobumi
1990-01-01
Repair of X-ray-induced single-strand breaks of DNA was studied in vitro using an exonuclease purified from mouse ascites sarcoma (SR-C3H/He) cells. X-ray-dose-dependent unscheduled DNA synthesis was primed by the exonuclease. Repair of X-ray-induced single-strand breaks in pUC19 plasmid DNA was demonstrated by agarose gel electrophoresis after incubating the damaged DNA with the exonuclease, DNA polymerase (Klenow fragment of DNA polymerase I or DNA polymerase β purified from SR-C3H/He cells), four deoxynucleoside triphosphates, ATP and DNA ligase (T4 DNA ligase or DNA ligase I purified from calf thymus). The present results suggested that the exonuclease is involved in the initiation of repair of X-ray-induced single-strand breaks in removing 3' ends of X-ray-damaged DNA. (author)
DNA barcodes for bio-surveillance: regulated and economically important arthropod plant pests.
Ashfaq, Muhammad; Hebert, Paul D N
2016-11-01
Many of the arthropod species that are important pests of agriculture and forestry are impossible to discriminate morphologically throughout all of their life stages. Some cannot be differentiated at any life stage. Over the past decade, DNA barcoding has gained increasing adoption as a tool to both identify known species and to reveal cryptic taxa. Although there has not been a focused effort to develop a barcode library for them, reference sequences are now available for 77% of the 409 species of arthropods documented on major pest databases. Aside from developing the reference library needed to guide specimen identifications, past barcode studies have revealed that a significant fraction of arthropod pests are a complex of allied taxa. Because of their importance as pests and disease vectors impacting global agriculture and forestry, DNA barcode results on these arthropods have significant implications for quarantine detection, regulation, and management. The current review discusses these implications in light of the presence of cryptic species in plant pests exposed by DNA barcoding.
Default cycle phases determined after modifying discrete DNA sequences in plant cells
International Nuclear Information System (INIS)
Sans, J.; Leyton, C.
1997-01-01
After bromosubstituting DNA sequences replicated in the first, second, or third part of the S phase, in Allium cepa L. meristematic cells, radiation at 313 nm wavelength under anoxia allowed ascription of different sequences to both the positive and negative regulation of some cycle phase transitions. The present report shows that the radiation forced cells in late G 1 phase to advance into S, while those in G 2 remained in G 2 and cells in prophase returned to G 2 when both sets of sequences involved in the positive and negative controls were bromosubstituted and later irradiated. In this way, not only G 2 but also the S phase behaved as cycle phases where cells accumulated by default when signals of different sign functionally cancelled out. The treatment did not halt the rates of replication or transcription of plant bromosubstituted DNA. The irradiation under hypoxia apparently prevents the binding of regulatory proteins to Br-DNA. (author)
The APC/C Ubiquitin Ligase: From Cell Biology to Tumorigenesis
Energy Technology Data Exchange (ETDEWEB)
Penas, Clara; Ramachandran, Vimal [John P. Hussman Institute for Human Genomics, University of Miami Miller School of Medicine, Miami, FL (United States); Ayad, Nagi George, E-mail: nayad@med.miami.edu [John P. Hussman Institute for Human Genomics, University of Miami Miller School of Medicine, Miami, FL (United States); Department of Psychiatry and Behavioral Sciences, University of Miami Miller School of Medicine, Miami, FL (United States)
2012-01-09
The ubiquitin proteasome system (UPS) is required for normal cell proliferation, vertebrate development, and cancer cell transformation. The UPS consists of multiple proteins that work in concert to target a protein for degradation via the 26S proteasome. Chains of an 8.5-kDa protein called ubiquitin are attached to substrates, thus allowing recognition by the 26S proteasome. Enzymes called ubiquitin ligases or E3s mediate specific attachment to substrates. Although there are over 600 different ubiquitin ligases, the Skp1–Cullin–F-box (SCF) complexes and the anaphase promoting complex/cyclosome (APC/C) are the most studied. SCF involvement in cancer has been known for some time while APC/C’s cancer role has recently emerged. In this review we will discuss the importance of APC/C to normal cell proliferation and development, underscoring its possible contribution to transformation. We will also examine the hypothesis that modulating a specific interaction of the APC/C may be therapeutically attractive in specific cancer subtypes. Finally, given that the APC/C pathway is relatively new as a cancer target, therapeutic interventions affecting APC/C activity may be beneficial in cancers that are resistant to classical chemotherapy.
The APC/C Ubiquitin Ligase: From Cell Biology to Tumorigenesis
International Nuclear Information System (INIS)
Penas, Clara; Ramachandran, Vimal; Ayad, Nagi George
2012-01-01
The ubiquitin proteasome system (UPS) is required for normal cell proliferation, vertebrate development, and cancer cell transformation. The UPS consists of multiple proteins that work in concert to target a protein for degradation via the 26S proteasome. Chains of an 8.5-kDa protein called ubiquitin are attached to substrates, thus allowing recognition by the 26S proteasome. Enzymes called ubiquitin ligases or E3s mediate specific attachment to substrates. Although there are over 600 different ubiquitin ligases, the Skp1–Cullin–F-box (SCF) complexes and the anaphase promoting complex/cyclosome (APC/C) are the most studied. SCF involvement in cancer has been known for some time while APC/C’s cancer role has recently emerged. In this review we will discuss the importance of APC/C to normal cell proliferation and development, underscoring its possible contribution to transformation. We will also examine the hypothesis that modulating a specific interaction of the APC/C may be therapeutically attractive in specific cancer subtypes. Finally, given that the APC/C pathway is relatively new as a cancer target, therapeutic interventions affecting APC/C activity may be beneficial in cancers that are resistant to classical chemotherapy.
Pfirrmann, Thorsten; Villavicencio-Lorini, Pablo; Subudhi, Abinash K.; Menssen, Ruth; Wolf, Dieter H.; Hollemann, Thomas
2015-01-01
In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of t...
Craft, Kathleen J; Owens, Jeffrey D; Ashley, Mary V
2007-01-05
As highly polymorphic DNA markers become increasingly available for a wide range of plant and animal species, there will be increasing opportunities for applications to forensic investigations. To date, however, relatively few studies have reported using DNA profiles of non-human species to place suspects at or near crime scenes. Here we describe an investigation of a double homicide of a female and her near-term fetus. Leaf material taken from a suspect's vehicle was identified to be that of sand live oak, Quercus geminata, the same tree species that occurred near a shallow grave where the victims were found. Quercus-specific DNA microsatellites were used to genotype both dried and fresh material from trees located near the burial site and from the material taken from the suspect's car. Samples from the local population of Q. geminata were also collected and genotyped in order to demonstrate that genetic variation at four microsatellite loci was sufficient to assign leaves to an individual tree with high statistical certainty. The cumulative average probability of identity for these four loci was 2.06x10(-6). DNA was successfully obtained from the dried leaf material although PCR amplification was more difficult than amplification of DNA from fresh leaves. The DNA profiles of the dried leaves from the suspect's car did not match those of the trees near the crime scene. Although this investigation did not provide evidence that could be used against the suspect, it does demonstrate the potential for plant microsatellite markers providing physical evidence that links plant materials to live plants at or near crime scenes.
Monoterpene engineering in a woody plant Eucalyptus camaldulensis using a limonene synthase cDNA.
Ohara, Kazuaki; Matsunaga, Etsuko; Nanto, Kazuya; Yamamoto, Kyoko; Sasaki, Kanako; Ebinuma, Hiroyasu; Yazaki, Kazufumi
2010-01-01
Metabolic engineering aimed at monoterpene production has become an intensive research topic in recent years, although most studies have been limited to herbal plants including model plants such as Arabidopsis. The genus Eucalyptus includes commercially important woody plants in terms of essential oil production and the pulp industry. This study attempted to modify the production of monoterpenes, which are major components of Eucalyptus essential oil, by introducing two expression constructs containing Perilla frutescens limonene synthase (PFLS) cDNA, whose gene products were designed to be localized in either the plastid or cytosol, into Eucalyptus camaldulensis. The expression of the plastid-type and cytosol-type PFLS cDNA in transgenic E. camaldulensis was confirmed by real-time polymerase chain reaction (PCR). Gas chromatography with a flame ionization detector analyses of leaf extracts revealed that the plastidic and cytosolic expression of PFLS yielded 2.6- and 4.5-times more limonene than that accumulated in wild-type E. camaldulensis, respectively, while the ectopic expression of PFLS had only a small effect on the emission of limonene from the leaves of E. camaldulensis. Surprisingly, the high level of PFLS in Eucalyptus was accompanied by a synergistic increase in the production of 1,8-cineole and alpha-pinene, two major components of Eucalyptus monoterpenes. This genetic engineering of monoterpenes demonstrated a new potential for molecular breeding in woody plants.
Phospho-Ser/Thr-binding domains: navigating the cell cycle and DNA damage response.
Reinhardt, H Christian; Yaffe, Michael B
2013-09-01
Coordinated progression through the cell cycle is a complex challenge for eukaryotic cells. Following genotoxic stress, diverse molecular signals must be integrated to establish checkpoints specific for each cell cycle stage, allowing time for various types of DNA repair. Phospho-Ser/Thr-binding domains have emerged as crucial regulators of cell cycle progression and DNA damage signalling. Such domains include 14-3-3 proteins, WW domains, Polo-box domains (in PLK1), WD40 repeats (including those in the E3 ligase SCF(βTrCP)), BRCT domains (including those in BRCA1) and FHA domains (such as in CHK2 and MDC1). Progress has been made in our understanding of the motif (or motifs) that these phospho-Ser/Thr-binding domains connect with on their targets and how these interactions influence the cell cycle and DNA damage response.
Use of the cDNA microarray technology in thesafety assessment of GM food plants
DEFF Research Database (Denmark)
Pedersen, Jan W.; Knudsen, Ib; Eriksen, Folmer Damsted
This report focuses on new analytical approaches that might give more insight into possible changes in a genetically modified plant. Primarily the focus is on the new DNA microarray technique but also proteomics and metabolomics are discussed.The report describes the new techniques and evaluates ...
DNA extraction from herbarium specimens.
Drábková, Lenka Záveská
2014-01-01
With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).
Zn-binding AZUL domain of human ubiquitin protein ligase Ube3A
Energy Technology Data Exchange (ETDEWEB)
Lemak, Alexander; Yee, Adelinda [University of Toronto, and Northeast Structural Genomics Consortium, Ontario Cancer Institute, Campbell Family Cancer Research Institute and Department of Medical Biophysics (Canada); Bezsonova, Irina, E-mail: bezsonova@uchc.edu [University of Connecticut Health Center, Department of Molecular Microbial and Structural Biology (United States); Dhe-Paganon, Sirano, E-mail: sirano.dhepaganon@utoronto.ca [University of Toronto, Structural Genomics Consortium (Canada); Arrowsmith, Cheryl H., E-mail: carrow@uhnresearch.ca [University of Toronto, and Northeast Structural Genomics Consortium, Ontario Cancer Institute, Campbell Family Cancer Research Institute and Department of Medical Biophysics (Canada)
2011-09-15
Ube3A (also referred to as E6AP for E6 Associated Protein) is a E3 ubiquitin-protein ligase implicated in the development of Angelman syndrome by controlling degradation of synaptic protein Arc and oncogenic papilloma virus infection by controlling degradation of p53. This article describe the solution NMR structure of the conserved N-terminal domain of human Ube3A (residues 24-87) that contains two residues (Cys44 and Arg62) found to be mutated in patients with Angelman syndrome. The structure of this domain adopts a novel Zn-binding fold we called AZUL (Amino-terminal Zn-finger of Ube3a Ligase). The AZUL domain has a helix-loop-helix architecture with a Zn ion coordinated by four Cys residues arranged in Cys-X{sub 4}-Cys-X{sub 4}-Cys-X{sub 28}-Cys motif. Three of the Zn-bound residues are located in a 23-residue long and well structured loop that connects two {alpha}-helicies.
Zn-binding AZUL domain of human ubiquitin protein ligase Ube3A
International Nuclear Information System (INIS)
Lemak, Alexander; Yee, Adelinda; Bezsonova, Irina; Dhe-Paganon, Sirano; Arrowsmith, Cheryl H.
2011-01-01
Ube3A (also referred to as E6AP for E6 Associated Protein) is a E3 ubiquitin-protein ligase implicated in the development of Angelman syndrome by controlling degradation of synaptic protein Arc and oncogenic papilloma virus infection by controlling degradation of p53. This article describe the solution NMR structure of the conserved N-terminal domain of human Ube3A (residues 24-87) that contains two residues (Cys44 and Arg62) found to be mutated in patients with Angelman syndrome. The structure of this domain adopts a novel Zn-binding fold we called AZUL (Amino-terminal Zn-finger of Ube3a Ligase). The AZUL domain has a helix-loop-helix architecture with a Zn ion coordinated by four Cys residues arranged in Cys-X 4 -Cys-X 4 -Cys-X 28 -Cys motif. Three of the Zn-bound residues are located in a 23-residue long and well structured loop that connects two α-helicies.
Nicholson, Judith; Jevons, Sarah J; Groselj, Blaz; Ellermann, Sophie; Konietzny, Rebecca; Kerr, Martin; Kessler, Benedikt M; Kiltie, Anne E
2017-06-01
The MRE11/RAD50/NBS1 (MRN) complex mediates DNA repair pathways, including double-strand breaks induced by radiotherapy. Meiotic recombination 11 homolog (MRE11) is downregulated by histone deacetylase inhibition (HDACi), resulting in reduced levels of DNA repair in bladder cancer cells and radiosensitization. In this study, we show that the mechanism of this downregulation is posttranslational and identify a C-terminally truncated MRE11, which is formed after HDAC inhibition as full-length MRE11 is downregulated. Truncated MRE11 was stabilized by proteasome inhibition, exhibited a decreased half-life after treatment with panobinostat, and therefore represents a newly identified intermediate induced and degraded in response to HDAC inhibition. The E3 ligase cellular inhibitor of apoptosis protein 2 (cIAP2) was upregulated in response to HDAC inhibition and was validated as a new MRE11 binding partner whose upregulation had similar effects to HDAC inhibition. cIAP2 overexpression resulted in downregulation and altered ubiquitination patterns of MRE11 and mediated radiosensitization in response to HDAC inhibition. These results highlight cIAP2 as a player in the DNA damage response as a posttranscriptional regulator of MRE11 and identify cIAP2 as a potential target for biomarker discovery or chemoradiation strategies in bladder cancer. Cancer Res; 77(11); 3027-39. ©2017 AACR . ©2017 American Association for Cancer Research.
Hishiki, Asami; Hara, Kodai; Ikegaya, Yuzu; Yokoyama, Hideshi; Shimizu, Toshiyuki; Sato, Mamoru; Hashimoto, Hiroshi
2015-05-22
HLTF (helicase-like transcription factor) is a yeast RAD5 homolog found in mammals. HLTF has E3 ubiquitin ligase and DNA helicase activities, and plays a pivotal role in the template-switching pathway of DNA damage tolerance. HLTF has an N-terminal domain that has been designated the HIRAN (HIP116 and RAD5 N-terminal) domain. The HIRAN domain has been hypothesized to play a role in DNA binding; however, the structural basis of, and functional evidence for, the HIRAN domain in DNA binding has remained unclear. Here we show for the first time the crystal structure of the HIRAN domain of human HLTF in complex with DNA. The HIRAN domain is composed of six β-strands and two α-helices, forming an OB-fold structure frequently found in ssDNA-binding proteins, including in replication factor A (RPA). Interestingly, this study reveals that the HIRAN domain interacts with not only with a single-stranded DNA but also with a duplex DNA. Furthermore, the structure unexpectedly clarifies that the HIRAN domain specifically recognizes the 3'-end of DNA. These results suggest that the HIRAN domain functions as a sensor to the 3'-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. HLTF is recruited to a damaged site through the HIRAN domain at the stalled replication fork. Furthermore, our results have implications for the mechanism of template switching. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
International Nuclear Information System (INIS)
Tomilin, N.V.; Barenfeld, L.S.
1979-01-01
γ-endonuclease Y, an enzyme that hydrolyses phosphodiester bonds at alkali-stable lesions in γ-irradiated (N 2 , tris buffer) DNA, has been partially purified from Micrococcus luteus. The enzyme has a molecular weight of about 19 000, induces single-strand breaks with 3'OH-5'PO 4 termini and contains endonuclease activity towards DNA treated with 7-bromomethylbenz(a)anthracene. γ-endonuclease Y induces breaks in OsO 4 -treated poly(dA-dT) and apparently is specific towards γ-ray-induced base lesions of the t' type. The complete excision repair of γ-endonuclease Y substrate sites has been performed in vitro by γ-endonuclease Y, DNA polymerase and ligase. (author)
Energy Technology Data Exchange (ETDEWEB)
Tomilin, N V; Barenfeld, L S [AN SSSR, Leningrad. Inst. Tsitologii
1979-03-01
..gamma..-endonuclease Y, an enzyme that hydrolyses phosphodiester bonds at alkali-stable lesions in ..gamma..-irradiated (N/sub 2/, tris buffer) DNA, has been partially purified from Micrococcus luteus. The enzyme has a molecular weight of about 19 000, induces single-strand breaks with 3'OH-5'PO/sub 4/ termini and contains endonuclease activity towards DNA treated with 7-bromomethylbenz(a)anthracene. ..gamma..-endonuclease Y induces breaks in OsO/sub 4/-treated poly(dA-dT) and apparently is specific towards ..gamma..-ray-induced base lesions of the t' type. The complete excision repair of ..gamma..-endonuclease Y substrate sites has been performed in vitro by ..gamma..-endonuclease Y, DNA polymerase and ligase.
DEFF Research Database (Denmark)
Boomsma, Wouter Krogh; Nielsen, Sofie Vincents; Lindorff-Larsen, Kresten
2016-01-01
conduct a bioinformatics analysis to examine >600 human and S. cerevisiae E3 ligases to identify enzymes that are similar to San1 in terms of function and/or mechanism of substrate recognition. An initial sequence-based database search was found to detect candidates primarily based on the homology...
The Ku80 carboxy terminus stimulates joining and artemis-mediated processing of DNA ends
DEFF Research Database (Denmark)
Weterings, Eric; Verkaik, Nicole S; Keijzers, Guido
2008-01-01
Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PK(CS)) an......Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA......-PK(CS)) and the XRCC4/ligase IV complex. Activation of the DNA-PK(CS) serine/threonine kinase requires an interaction with Ku70/80 and is essential for NHEJ-mediated DSB repair. In contrast to previous models, we found that the carboxy terminus of Ku80 is not absolutely required for the recruitment and activation...... was phosphorylated to normal levels. This resulted in severely reduced levels of Artemis nuclease activity in vivo and in vitro. We therefore conclude that the Ku80 carboxy terminus is important to support DNA-PK(CS) autophosphorylation at specific sites, which facilitates DNA end processing by the Artemis...
Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A
2017-01-01
The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary
Zhang, Quan; Jia, Kai-Zhi; Xia, Shi-Tao; Xu, Yang-Hua; Liu, Rui-Sang; Li, Hong-Mei; Tang, Ya-Jie
2016-02-10
Ehrlich and demethiolation pathways as two competing branches converted amino acid into alcohols. Controlling both pathways offers considerable potential for industrial applications including alcohols overproduction, flavor-quality control and developing new flavors. While how to regulate ehrlich and demethiolation pathways is still not applicable. Taking the conversion of methionine into methionol and methanethiol for example, we constructed two suppression subtractive cDNA libraries of Clonostachys rosea by using suppression subtractive hybridization (SSH) technology for screening regulators controlling the conversion. E3 ubiquitin-protein ligase gene HUWE1 screened from forward SSH library was validated to be related with the biosynthesis of end products. Overexpressing HUWE1 in C. rosea and S. cerevisiae significantly increased the biosynthesis of methanethiol and its derivatives in demethiolation pathway, while suppressed the biosynthesis of methional and methionol in ehrlich pathway. These results attained the directional regulation of both pathways by overexpressing HUWE1. Thus, HUWE1 has potential to be a key target for controlling and enhancing alcohols production by metabolic engineering.
Directory of Open Access Journals (Sweden)
Tomoki Abe
2013-01-01
Full Text Available Background. Unloading stress induces skeletal muscle atrophy. We have reported that Cbl-b ubiquitin ligase is a master regulator of unloading-associated muscle atrophy. The present study was designed to elucidate whether dietary soy glycinin protein prevents denervation-mediated muscle atrophy, based on the presence of inhibitory peptides against Cbl-b ubiquitin ligase in soy glycinin protein. Methods. Mice were fed either 20% casein diet, 20% soy protein isolate diet, 10% glycinin diet containing 10% casein, or 20% glycinin diet. One week later, the right sciatic nerve was cut. The wet weight, cross sectional area (CSA, IGF-1 signaling, and atrogene expression in hindlimb muscles were examined at 1, 3, 3.5, or 4 days after denervation. Results. 20% soy glycinin diet significantly prevented denervation-induced decreases in muscle wet weight and myofiber CSA. Furthermore, dietary soy protein inhibited denervation-induced ubiquitination and degradation of IRS-1 in tibialis anterior muscle. Dietary soy glycinin partially suppressed the denervation-mediated expression of atrogenes, such as MAFbx/atrogin-1 and MuRF-1, through the protection of IGF-1 signaling estimated by phosphorylation of Akt-1. Conclusions. Soy glycinin contains a functional inhibitory sequence against muscle-atrophy-associated ubiquitin ligase Cbl-b. Dietary soy glycinin protein significantly prevented muscle atrophy after denervation in mice.
Structure of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).
Deva, Taru; Baker, Edward N; Squire, Christopher J; Smith, Clyde A
2006-12-01
The bacterial cell wall provides essential protection from the external environment and confers strength and rigidity to counteract internal osmotic pressure. Without this layer the cell would be easily ruptured and it is for this reason that biosynthetic pathways leading to the formation of peptidoglycan have for many years been a prime target for effective antibiotics. Central to this pathway are four similar ligase enzymes which add peptide groups to glycan moieties. As part of a program to better understand the structure-function relationships in these four enzymes, the crystal structure of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC) has been determined to 2.6 A resolution. The structure was solved by multiwavelength anomalous diffraction methods from a single selenomethionine-substituted crystal and refined to a crystallographic R factor of 0.212 (R(free) = 0.259). The enzyme has a modular multi-domain structure very similar to those of other members of the mur family of ATP-dependent amide-bond ligases. Detailed comparison of these four enzymes shows that considerable conformational changes are possible. These changes, together with the recruitment of two different N-terminal domains, allow this family of enzymes to bind a substrate which is identical at one end and at the other has the growing peptide tail which will ultimately become part of the rigid bacterial cell wall. Comparison of the E. coli and Haemophilus influenzae structures and analysis of the sequences of known MurC enzymes indicate the presence of a ;dimerization' motif in almost 50% of the MurC enzymes and points to a highly conserved loop in domain 3 that may play a key role in amino-acid ligand specificity.
International Nuclear Information System (INIS)
Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Kamdar, Radhika P.; Sicheng, Liu; Wanotayan, Rujira; Matsumoto, Yoshihisa
2014-01-01
Non-homologous end-joining (NHEJ) is the predominant pathway of DNA double strand breaks in higher eukaryotes and is active throughout the cell cycle. NHEJ repair includes many factors as Ku70/86, DNA-PKcs, XRCC4-Ligase IV complex and XLF (also known as Cernunnos). In these factors, DNA-PKcs acts as central regulator in NHEJ repair. It recruited at the DNA damages site after DNA damage and after association with Ku its kinase activity is activated. It phosphorylates many of important NHEJ proteins in vitro including XRCC4, Ku 70/86, Artemis, and even DNA-PKcs but till now, very less studies have been done to know the role and significance of phosphorylation in the NHEJ repair. Studies by other researchers identified various phosphorylation sites in XRCC4 by DNA-PK using mass spectrometry but these phosphorylation sites were shown to be dispensable for DSB repair. In the present investigation, we identified 3 serine and one new threonine phosphorylation sites in XRCC4 protein by DNA-PK. In vivo phosphorylation at these sites was verified by generating phosphorylation specific antibodies and the requirement for DNA-PK therein was verified by using DNA-PK inhibitor and DNA-PK proficient and deficient cell lines in response to radiation and zeocin treatment. We have also found that phosphorylation at these sites showed dose dependency in response to radiation treatment. The two serine and one threonine phosphorylation site is also biological important as their mutation into alanine significantly elevated radiosensitivity as measured by colony formation assay. Neutral comet assay showed delayed kinetics in DSB repair of these mutants. Furthermore, we have found a protein, with putative DSB repair function, which interacts with domain including the phosphorylation sites.These results indicate that these phosphorylation sites would mediate functional link between XRCC4 and DNA-PK. (author)
Lescasse, Rachel; Pobiega, Sabrina; Callebaut, Isabelle; Marcand, Stéphane
2013-03-20
In eukaryotes, permanent inhibition of the non-homologous end joining (NHEJ) repair pathway at telomeres ensures that chromosome ends do not fuse. In budding yeast, binding of Rap1 to telomere repeats establishes NHEJ inhibition. Here, we show that the Uls1 protein is required for the maintenance of NHEJ inhibition at telomeres. Uls1 protein is a non-essential Swi2/Snf2-related translocase and a Small Ubiquitin-related Modifier (SUMO)-Targeted Ubiquitin Ligase (STUbL) with unknown targets. Loss of Uls1 results in telomere-telomere fusions. Uls1 requirement is alleviated by the absence of poly-SUMO chains and by rap1 alleles lacking SUMOylation sites. Furthermore, Uls1 limits the accumulation of Rap1 poly-SUMO conjugates. We propose that one of Uls1 functions is to clear non-functional poly-SUMOylated Rap1 molecules from telomeres to ensure the continuous efficiency of NHEJ inhibition. Since Uls1 is the only known STUbL with a translocase activity, it can be the general molecular sweeper for the clearance of poly-SUMOylated proteins on DNA in eukaryotes.
Alternative end-joining pathway(s): bricolage at DNA breaks.
Frit, Philippe; Barboule, Nadia; Yuan, Ying; Gomez, Dennis; Calsou, Patrick
2014-05-01
To cope with DNA double strand break (DSB) genotoxicity, cells have evolved two main repair pathways: homologous recombination which uses homologous DNA sequences as repair templates, and non-homologous Ku-dependent end-joining involving direct sealing of DSB ends by DNA ligase IV (Lig4). During the last two decades a third player most commonly named alternative end-joining (A-EJ) has emerged, which is defined as any Ku- or Lig4-independent end-joining process. A-EJ increasingly appears as a highly error-prone bricolage on DSBs and despite expanding exploration, it still escapes full characterization. In the present review, we discuss the mechanism and regulation of A-EJ as well as its biological relevance under physiological and pathological situations, with a particular emphasis on chromosomal instability and cancer. Whether or not it is a genuine DSB repair pathway, A-EJ is emerging as an important cellular process and understanding A-EJ will certainly be a major challenge for the coming years. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
A biochemical defect in the repair of alkylated DNA in cells from an immunodeficient patient (46BR)
International Nuclear Information System (INIS)
Teo, I.A.; Broughton, B.C.; Day, R.S.; James, M.R.; Karran, P.; Mayne, L.V.; Lehmann, A.R.
1983-01-01
The fibroblast cell strain 46BR, derived from an immunodeficient individual, is hypersensitive to the lethal effects of a variety of DNA-damaging agents, this effect being particularly marked for monofunctional methylating agents. After U.V. irradiation 46BR cells show normal unscheduled DNA synthesis, daughter strand repair, and recovery of DNA and RNA synthesis. The inhibition of DNA replicative synthesis by U.V. is slightly less than that of normal cells. After gamma-irradiation the rejoining of strand breaks is normal as are the kinetics of replicative DNA synthesis. Following treatment with dimethylsulphate, replicative DNA synthesis is affected in a similar way to normal cells, unscheduled DNA synthesis may be increased relative to normal cells, but more strand breaks persist in 46BR than in normal cells. In addition 46BR cells are hypersensitive to the toxic effects of 3-aminobenzamide, an inhibitor of ADP-ribosyl transferase. This enzyme is involved in the ligation step of repair of alkylation damage. A hypothesis is presented suggesting that 46BR may be defective in DNA ligase I
Structure and catalytic activation of the TRIM23 RING E3 ubiquitin ligase: DAWIDZIAK et al.
Energy Technology Data Exchange (ETDEWEB)
Dawidziak, Daria M. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Sanchez, Jacint G. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Wagner, Jonathan M. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Ganser-Pornillos, Barbie K. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Pornillos, Owen [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia
2017-07-24
Tripartite motif (TRIM) proteins comprise a large family of RING-type ubiquitin E3 ligases that regulate important biological processes. An emerging general model is that TRIMs form elongated antiparallel coiled-coil dimers that prevent interaction of the two attendant RING domains. The RING domains themselves bind E2 conjugating enzymes as dimers, implying that an active TRIM ligase requires higher-order oligomerization of the basal coiled-coil dimers. Here, we report crystal structures of the TRIM23 RING domain in isolation and in complex with an E2–ubiquitin conjugate. Our results indicate that TRIM23 enzymatic activity requires RING dimerization, consistent with the general model of TRIM activation.
Morimoto, Kyoko; Ohama, Naohiko; Kidokoro, Satoshi; Mizoi, Junya; Takahashi, Fuminori; Todaka, Daisuke; Mogami, Junro; Sato, Hikaru; Qin, Feng; Kim, June-Sik; Fukao, Yoichiro; Fujiwara, Masayuki; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2017-10-03
DEHYDRATION-RESPONSIVE ELEMENT BINDING PROTEIN 2A (DREB2A) acts as a key transcription factor in both drought and heat stress tolerance in Arabidopsis and induces the expression of many drought- and heat stress-inducible genes. Although DREB2A expression itself is induced by stress, the posttranslational regulation of DREB2A, including protein stabilization, is required for its transcriptional activity. The deletion of a 30-aa central region of DREB2A known as the negative regulatory domain (NRD) transforms DREB2A into a stable and constitutively active form referred to as DREB2A CA. However, the molecular basis of this stabilization and activation has remained unknown for a decade. Here we identified BTB/POZ AND MATH DOMAIN proteins (BPMs), substrate adaptors of the Cullin3 (CUL3)-based E3 ligase, as DREB2A-interacting proteins. We observed that DREB2A and BPMs interact in the nuclei, and that the NRD of DREB2A is sufficient for its interaction with BPMs. BPM -knockdown plants exhibited increased DREB2A accumulation and induction of DREB2A target genes under heat and drought stress conditions. Genetic analysis indicated that the depletion of BPM expression conferred enhanced thermotolerance via DREB2A stabilization. Thus, the BPM-CUL3 E3 ligase is likely the long-sought factor responsible for NRD-dependent DREB2A degradation. Through the negative regulation of DREB2A stability, BPMs modulate the heat stress response and prevent an adverse effect of excess DREB2A on plant growth. Furthermore, we found the BPM recognition motif in various transcription factors, implying a general contribution of BPM-mediated proteolysis to divergent cellular responses via an accelerated turnover of transcription factors.
Use of ITS2 region as the universal DNA barcode for plants and animals.
Yao, Hui; Song, Jingyuan; Liu, Chang; Luo, Kun; Han, Jianping; Li, Ying; Pang, Xiaohui; Xu, Hongxi; Zhu, Yingjie; Xiao, Peigen; Chen, Shilin
2010-10-01
The internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA is regarded as one of the candidate DNA barcodes because it possesses a number of valuable characteristics, such as the availability of conserved regions for designing universal primers, the ease of its amplification, and sufficient variability to distinguish even closely related species. However, a general analysis of its ability to discriminate species in a comprehensive sample set is lacking. In the current study, 50,790 plant and 12,221 animal ITS2 sequences downloaded from GenBank were evaluated according to sequence length, GC content, intra- and inter-specific divergence, and efficiency of identification. The results show that the inter-specific divergence of congeneric species in plants and animals was greater than its corresponding intra-specific variations. The success rates for using the ITS2 region to identify dicotyledons, monocotyledons, gymnosperms, ferns, mosses, and animals were 76.1%, 74.2%, 67.1%, 88.1%, 77.4%, and 91.7% at the species level, respectively. The ITS2 region unveiled a different ability to identify closely related species within different families and genera. The secondary structure of the ITS2 region could provide useful information for species identification and could be considered as a molecular morphological characteristic. As one of the most popular phylogenetic markers for eukaryota, we propose that the ITS2 locus should be used as a universal DNA barcode for identifying plant species and as a complementary locus for CO1 to identify animal species. We have also developed a web application to facilitate ITS2-based cross-kingdom species identification (http://its2-plantidit.dnsalias.org).
Breitler, Jean-Christophe; Meynard, Donaldo; Van Boxtel, Jos; Royer, Monique; Bonnot, François; Cambillau, Laurence; Guiderdoni, Emmanuel
2004-06-01
A pilot binary vector was constructed to assess the potential of the 2 T-DNA system for generating selectable marker-free progeny plants in three elite rice cultivars (ZhongZuo321, Ariete and Khao Dawk Mali 105) known to exhibit contrasting amenabilities to transformation. The first T-DNA of the vector, delimited by Agrobacterium tumefaciens borders, contains the hygromycin phosphotransferase (hpt) selectable gene and the green fluorescent protein (gfp) reporter gene while the second T-DNA, delimited by Agrobacterium rhizogenes borders, bears the phosphinothricin acetyl transferase (bar) gene, featuring the gene of interest. 82-90% of the hygromycin-resistant primary transformants exhibited tolerance to ammonium glufosinate mediated by the bar gene suggesting very high co-transformation frequency in the three cultivars. All of the regenerated plants were analyzed by Southern blot which confirmed co-integration of the T-DNAs at frequencies consistent with those of co-expression and allowed determination of copy number for each gene as well as detection of two different vector backbone fragments extending between the two T-DNAs. Hygromycin susceptible, ammonium glufosinate tolerant phenotypes represented 14.4, 17.4 and 14.3% of the plants in T1 progenies of ZZ321, Ariete and KDML105 primary transformants, respectively. We developed a statistical model for deducing from the observed copy number of each T-DNA in T0 plants and phenotypic segregations in T1 progenies the most likely constitution and linkage of the T-DNA integration locus. Statistical analysis identified in 40 out of 42 lines a most likely linkage configuration theoretically allowing genetic separation of the two T-DNA types and out segregation of the T-DNA bearing the bar gene. Overall, though improvements of the technology would be beneficial, the 2 T-DNA system appeared to be a useful approach to generate selectable marker-free rice plants with a consistent frequency among cultivars.
Directory of Open Access Journals (Sweden)
Ledile Mankga
2013-12-01
Full Text Available Medicinal plants cover a broad range of taxa, which may be phylogenetically less related but morphologically very similar. Such morphological similarity between species may lead to misidentification and inappropriate use. Also the substitution of a medicinal plant by a cheaper alternative (e.g. other non-medicinal plant species, either due to misidentification, or deliberately to cheat consumers, is an issue of growing concern. In this study, we used DNA barcoding to identify commonly used medicinal plants in South Africa. Using the core plant barcodes, matK and rbcLa, obtained from processed and poorly conserved materials sold at the muthi traditional medicine market, we tested efficacy of the barcodes in species discrimination. Based on genetic divergence, PCR amplification efficiency and BLAST algorithm, we revealed varied discriminatory potentials for the DNA barcodes. In general, the barcodes exhibited high discriminatory power, indicating their effectiveness in verifying the identity of the most common plant species traded in South African medicinal markets. BLAST algorithm successfully matched 61% of the queries against a reference database, suggesting that most of the information supplied by sellers at traditional medicinal markets in South Africa is correct. Our findings reinforce the utility of DNA barcoding technique in limiting false identification that can harm public health.
The APC/C Ubiquitin Ligase: From Cell Biology to Tumorigenesis
Penas, Clara; Ramachandran, Vimal; Ayad, Nagi George
2011-01-01
The ubiquitin proteasome system (UPS) is required for normal cell proliferation, vertebrate development, and cancer cell transformation. The UPS consists of multiple proteins that work in concert to target a protein for degradation via the 26S proteasome. Chains of an 8.5-kDa protein called ubiquitin are attached to substrates, thus allowing recognition by the 26S proteasome. Enzymes called ubiquitin ligases or E3s mediate specific attachment to substrates. Although there are over 600 different ubiquitin ligases, the Skp1–Cullin–F-box (SCF) complexes and the anaphase promoting complex/cyclosome (APC/C) are the most studied. SCF involvement in cancer has been known for some time while APC/C’s cancer role has recently emerged. In this review we will discuss the importance of APC/C to normal cell proliferation and development, underscoring its possible contribution to transformation. We will also examine the hypothesis that modulating a specific interaction of the APC/C may be therapeutically attractive in specific cancer subtypes. Finally, given that the APC/C pathway is relatively new as a cancer target, therapeutic interventions affecting APC/C activity may be beneficial in cancers that are resistant to classical chemotherapy. PMID:22655255
Vegetables and PUFA-rich plant oil reduce DNA strand breaks in individuals with type 2 diabetes
DEFF Research Database (Denmark)
Müllner, Elisabeth; Brath, Helmut; Pleifer, Simone
2013-01-01
SCOPE: Type 2 diabetes is a multifactorial disease associated with increased oxidative stress, which may lead to increased DNA damage. The aim of this study was to investigate the effect of a healthy diet on DNA oxidation in diabetics and nondiabetics. METHODS AND RESULTS: Seventy-six diabetic...... and 21 nondiabetic individuals participated in this study. All subjects received information about the benefits of a healthy diet, while subjects randomly assigned to the intervention group received additionally 300 g of vegetables and 25 mL PUFA-rich plant oil per day. DNA damage in mononuclear cells...... increase in plasma antioxidant concentrations. Diabetic individuals of the intervention group showed a significant reduction in HbA1c and DNA strand breaks. Levels of HbA1c were also improved in diabetics of the information group, but oxidative damage to DNA was not altered. Urinary 8-oxodG and 8-oxo...
TMEM129 is a Derlin-1 associated ERAD E3 ligase essential for virus-induced degradation of MHC-I.
van den Boomen, Dick J H; Timms, Richard T; Grice, Guinevere L; Stagg, Helen R; Skødt, Karsten; Dougan, Gordon; Nathan, James A; Lehner, Paul J
2014-08-05
The US11 gene product of human cytomegalovirus promotes viral immune evasion by hijacking the endoplasmic reticulum (ER)-associated degradation (ERAD) pathway. US11 initiates dislocation of newly translocated MHC I from the ER to the cytosol for proteasome-mediated degradation. Despite the critical role for ubiquitin in this degradation pathway, the responsible E3 ligase is unknown. In a forward genetic screen for host ERAD components hijacked by US11 in near-haploid KBM7 cells, we identified TMEM129, an uncharacterized polytopic membrane protein. TMEM129 is essential and rate-limiting for US11-mediated MHC-I degradation and acts as a novel ER resident E3 ubiquitin ligase. TMEM129 contains an unusual cysteine-only RING with intrinsic E3 ligase activity and is recruited to US11 via Derlin-1. Together with its E2 conjugase Ube2J2, TMEM129 is responsible for the ubiquitination, dislocation, and subsequent degradation of US11-associated MHC-I. US11 engages two degradation pathways: a Derlin-1/TMEM129-dependent pathway required for MHC-I degradation and a SEL1L/HRD1-dependent pathway required for "free" US11 degradation. Our data show that TMEM129 is a novel ERAD E3 ligase and the central component of a novel mammalian ERAD complex.
DEFF Research Database (Denmark)
Li, Xin; Zhu, Jingde; Hu, Fengyi
2012-01-01
DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild rela...
Directory of Open Access Journals (Sweden)
Luis E. Rojas
2014-07-01
Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.
Directory of Open Access Journals (Sweden)
Veronika Lancíková
2014-02-01
Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.
Directory of Open Access Journals (Sweden)
Swarnalee Dutta
Full Text Available The outcome of an interaction between plant growth promoting rhizobacteria and plants may depend on the chemical composition of root exudates (REs. We report the colonization of tobacco, and not groundnut, roots by a non-rhizospheric Bacillus cereus (MTCC 430. There was a differential alteration in the cell wall components of B. cereus in response to the REs from tobacco and groundnut. Attenuated total reflectance infrared spectroscopy revealed a split in amide I region of B. cereus cells exposed to tobacco-root exudates (TRE, compared to those exposed to groundnut-root exudates (GRE. In addition, changes in exopolysaccharides and lipid-packing were observed in B. cereus grown in TRE-amended minimal media that were not detectable in GRE-amended media. Cell-wall proteome analyses revealed upregulation of oxidative stress-related alkyl hydroperoxide reductase, and DNA-protecting protein chain (Dlp-2, in response to GRE and TRE, respectively. Metabolism-related enzymes like 2-amino-3-ketobutyrate coenzyme A ligase and 2-methylcitrate dehydratase and a 60 kDa chaperonin were up-regulated in response to TRE and GRE. In response to B. cereus, the plant roots altered their exudate-chemodiversity with respect to carbohydrates, organic acids, alkanes, and polyols. TRE-induced changes in surface components of B. cereus may contribute to successful root colonization and subsequent plant growth promotion.
The Ku80 carboxy terminus stimulates joining and artemis-mediated processing of DNA ends.
Weterings, Eric; Verkaik, Nicole S; Keijzers, Guido; Florea, Bogdan I; Wang, Shih-Ya; Ortega, Laura G; Uematsu, Naoya; Chen, David J; van Gent, Dik C
2009-03-01
Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PK(CS)) and the XRCC4/ligase IV complex. Activation of the DNA-PK(CS) serine/threonine kinase requires an interaction with Ku70/80 and is essential for NHEJ-mediated DSB repair. In contrast to previous models, we found that the carboxy terminus of Ku80 is not absolutely required for the recruitment and activation of DNA-PK(CS) at DSBs, although cells that harbored a carboxy-terminal deletion in the Ku80 gene were sensitive to ionizing radiation and showed reduced end-joining capacity. More detailed analysis of this repair defect showed that DNA-PK(CS) autophosphorylation at Thr2647 was diminished, while Ser2056 was phosphorylated to normal levels. This resulted in severely reduced levels of Artemis nuclease activity in vivo and in vitro. We therefore conclude that the Ku80 carboxy terminus is important to support DNA-PK(CS) autophosphorylation at specific sites, which facilitates DNA end processing by the Artemis endonuclease and the subsequent joining reaction.
The Ku80 Carboxy Terminus Stimulates Joining and Artemis-Mediated Processing of DNA Ends▿
Weterings, Eric; Verkaik, Nicole S.; Keijzers, Guido; Florea, Bogdan I.; Wang, Shih-Ya; Ortega, Laura G.; Uematsu, Naoya; Chen, David J.; van Gent, Dik C.
2009-01-01
Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PKCS) and the XRCC4/ligase IV complex. Activation of the DNA-PKCS serine/threonine kinase requires an interaction with Ku70/80 and is essential for NHEJ-mediated DSB repair. In contrast to previous models, we found that the carboxy terminus of Ku80 is not absolutely required for the recruitment and activation of DNA-PKCS at DSBs, although cells that harbored a carboxy-terminal deletion in the Ku80 gene were sensitive to ionizing radiation and showed reduced end-joining capacity. More detailed analysis of this repair defect showed that DNA-PKCS autophosphorylation at Thr2647 was diminished, while Ser2056 was phosphorylated to normal levels. This resulted in severely reduced levels of Artemis nuclease activity in vivo and in vitro. We therefore conclude that the Ku80 carboxy terminus is important to support DNA-PKCS autophosphorylation at specific sites, which facilitates DNA end processing by the Artemis endonuclease and the subsequent joining reaction. PMID:19103741
Bridging plant and human radiation response and DNA repair through an in silico approach
Czech Academy of Sciences Publication Activity Database
Nikitaki, Z.; Pavlopoulou, A.; Holá, Marcela; Donà, M.; Michalopoulos, I.; Balestrazzi, A.; Angelis, Karel; Georgakilas, A. G.
2017-01-01
Roč. 9, č. 6 (2017), č. článku 65. ISSN 2072-6694 R&D Projects: GA ČR GA16-01137S Institutional support: RVO:61389030 Keywords : Bioinformatics * DNA damage repair * In silico analysis * Ionizing radiation * Plant radiation biodosimeter * Ultraviolet radiation Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Oncology
Base excision repair in Archaea: back to the future in DNA repair.
Grasso, Stefano; Tell, Gianluca
2014-09-01
Together with Bacteria and Eukarya, Archaea represents one of the three domain of life. In contrast with the morphological difference existing between Archaea and Eukarya, these two domains are closely related. Phylogenetic analyses confirm this evolutionary relationship showing that most of the proteins involved in DNA transcription and replication are highly conserved. On the contrary, information is scanty about DNA repair pathways and their mechanisms. In the present review the most important proteins involved in base excision repair, namely glycosylases, AP lyases, AP endonucleases, polymerases, sliding clamps, flap endonucleases, and ligases, will be discussed and compared with bacterial and eukaryotic ones. Finally, possible applications and future perspectives derived from studies on Archaea and their repair pathways, will be taken into account. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Elena Kuzminsky
2016-08-01
Full Text Available Abiotic stresses have considerable negative impact on Mediterranean plant ecosystems and better comprehension of the genetic control of response and adaptation of trees to global changes is urgently needed. The Single Cell Gel Electrophoresis assay could be considered a good estimator of DNA damage in an individual eukaryotic cell. This method has been mainly employed in animal tissues, because the plant cell wall represents an obstacle for the extraction of nuclei; moreover, in Mediterranean woody species, especially in the sclerophyll plants, this procedure can be quite difficult because of the presence of sclerenchyma and hardened cells. On the other hand, these plants represent an interesting material to be studied because of the ability of these plants to tolerate abiotic stress. For instance, holm oak (Quercus ilex L. has been selected as the model plant to identify critical levels of O3 for Southern European forests. Consequently, a quantitative method for the evaluation of cell injury of leaf tissues of this species is required. Optimal conditions for high-yield nuclei isolation were obtained by using protoplast technology and a detailed description of the method is provided and discussed. White poplar (Populus alba L. was used as an internal control for protoplast isolation. Such a method has not been previously reported in newly fully developed leaves of holm oak. This method combined with Single Cell Gel Electrophoresis assay represents a new tool for testing the DNA integrity of leaf tissues in higher plants under stress conditions.
International Nuclear Information System (INIS)
Solov'yan, V.T.; Kunaleh, V.A.; Shumnyl, V.K.; Vershinin, A.V.
1986-01-01
This paper attempts to assess the quantity of repeated sequences and degree of homology of DNA in the intact plant and two lines of callus tissue of Rauwolfia serpentina Benth maintained for 20 years, which differ among themselves in the level of biosynthesis of the pharmacologically valuable alkaloid ajmaline. The tritium-labeled repeats of plants and calli were used in direct and reverse hybridization on nitrocellulose filters. Hybridization of H 3-labeled repeats with phage 17 DNA was used as control. The radioactivity of filters after washing was measured in a liquid scintillation counter
Bass, Hank W; Wear, Emily E; Lee, Tae-Jin; Hoffman, Gregg G; Gumber, Hardeep K; Allen, George C; Thompson, William F; Hanley-Bowdoin, Linda
2014-06-01
The progress of nuclear DNA replication is complex in both time and space, and may reflect several levels of chromatin structure and 3-dimensional organization within the nucleus. To understand the relationship between DNA replication and developmental programmes, it is important to examine replication and nuclear substructure in different developmental contexts including natural cell-cycle progressions in situ. Plant meristems offer an ideal opportunity to analyse such processes in the context of normal growth of an organism. Our current understanding of large-scale chromosomal DNA replication has been limited by the lack of appropriate tools to visualize DNA replication with high resolution at defined points within S phase. In this perspective, we discuss a promising new system that can be used to visualize DNA replication in isolated maize (Zea mays L.) root tip nuclei after in planta pulse labelling with the thymidine analogue, 5-ethynyl-2'-deoxyuridine (EdU). Mixed populations of EdU-labelled nuclei are then separated by flow cytometry into sequential stages of S phase and examined directly using 3-dimensional deconvolution microscopy to characterize spatial patterns of plant DNA replication. Combining spatiotemporal analyses with studies of replication and epigenetic inheritance at the molecular level enables an integrated experimental approach to problems of mitotic inheritance and cellular differentiation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Use of the cDNA microarray technology in the safety assessment of GM food plants
Kok, E.J.; Kleter, G.A.; Dijk, van J.P.
2003-01-01
This report focuses on new analytical approaches that might give more insight into possible changes in a genetically modified plant. Primarily the focus is on the new DNA microarray technique but also proteomics and metabolomics are discussed.The report describes the new techniques and evaluates the
Directory of Open Access Journals (Sweden)
Trzewik Aleksandra
2016-01-01
Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.
Adkar-Purushothama, Charith Raj; Iyer, Pavithran Sridharan; Perreault, Jean-Pierre
2017-08-21
It is well established that viroid derived small RNA (vd-sRNA) induces RNA silencing of endogenous mRNA. However, it remains not clear how exactly viroid infections can lead to severe symptom induction given the fact that fewer vd-sRNAs binding the specific target mRNAs were recovered from the infected plants. To answer this question, the two least expressed (+) and (-) strand vd-sRNAs of potato spindle tuber viroid (PSTVd) binding to both the 3' UTR and the coding region of tomato mRNAs were analyzed by infecting tomato plants with two variants of PSTVd. As products of these putative target mRNAs are involved in plant phenotype, the effect of this viroid on these genes were analyzed by infecting tomato plants with two variants of PSTVd. The direct interaction between the vd-sRNAs and putative mRNAs was validated by artificial microRNA experiments in a transient expression system and by RNA ligase-mediated rapid amplification of cDNA ends. Parallel analysis of RNA ends of viroid infected plants revealed the widespread cleavage of the target mRNAs in locations other than the vd-sRNA binding site during the viroid infection implying the viroid-infection induced vd-sRNA independent degradation of endogenous mRNAs during viroid infection.
Application of an Acyl-CoA Ligase from Streptomyces aizunensis for Lactam Biosynthesis
DEFF Research Database (Denmark)
Zhang, Jingwei; Barajas, Jesus F.; Burdu, Mehmet
2017-01-01
lactams under ambient conditions. In this study, we demonstrated production of these chemicals using ORF26, an acyl-CoA ligase involved in the biosynthesis of ECO-02301 in Streptomyces aizunensis. This enzyme has a broad substrate spectrum and can cyclize 4-aminobutyric acid into γ-butyrolactam, 5...
International Nuclear Information System (INIS)
Riazuddin, S.; Grossman, L.
1977-01-01
Py--Py correndonucleases I and II from Micrococcus luteus act exclusively on thymine-thymine, cytosine-cytosine, and thymine-cytosine cyclobutyl dimers in DNA, catalyzing incision 5' to the damage and generating 3'-hydroxyl and 5'-phosphoryl termini. Both enzymes initiate excision of pyrimidine dimers in vitro by correxonucleases and DNA polymerase I. The respective incised DNAs, however, differ in their ability to act as substrate for phage T4 polynucleotide ligase or bacterial alkaline phosphatase, suggesting that each endonuclease is specific for a conformationally unique site. The possibility that their respective action generates termini which represent different degrees of single strandedness is suggested by the unequal protection by Escherichia coli binding protein from the hydrolytic action of exonuclease VII
Liu, Baoming; Panda, Debasis; Mendez-Rios, Jorge D; Ganesan, Sundar; Wyatt, Linda S; Moss, Bernard
2018-04-01
Genome uncoating is essential for replication of most viruses. For poxviruses, the process is divided into two stages: removal of the envelope, allowing early gene expression, and breaching of the core wall, allowing DNA release, replication, and late gene expression. Subsequent studies showed that the host proteasome and the viral D5 protein, which has an essential role in DNA replication, are required for vaccinia virus (VACV) genome uncoating. In a search for additional VACV uncoating proteins, we noted a report that described a defect in DNA replication and late expression when the gene encoding a 68-kDa ankyrin repeat/F-box protein (68k-ank), associated with the cellular SCF (Skp1, cullin1, F-box-containing complex) ubiquitin ligase complex, was deleted from the attenuated modified vaccinia virus Ankara (MVA). Here we showed that the 68k-ank deletion mutant exhibited diminished genome uncoating, formation of DNA prereplication sites, and degradation of viral cores as well as an additional, independent defect in DNA synthesis. Deletion of the 68k-ank homolog of VACV strain WR, however, was without effect, suggesting the existence of compensating genes. By inserting VACV genes into an MVA 68k-ank deletion mutant, we discovered that M2, a member of the poxvirus immune evasion (PIE) domain superfamily and a regulator of NF-κB, and C5, a member of the BTB/Kelch superfamily associated with cullin-3-based ligase complexes, independently rescued the 68k-ank deletion phenotype. Thus, poxvirus uncoating and DNA replication are intertwined processes involving at least three viral proteins with mutually redundant functions in addition to D5. IMPORTANCE Poxviruses comprise a family of large DNA viruses that infect vertebrates and invertebrates and cause diseases of medical and zoological importance. Poxviruses, unlike most other DNA viruses, replicate in the cytoplasm, and their large genomes usually encode 200 or more proteins with diverse functions. About 90 genes may
Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar
2016-05-01
The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.
Repair of DNA DSB in higher eukaryotes
International Nuclear Information System (INIS)
Wang, H.; Perrault, A.R.; Takeda, Y.; Iliakis, G.
2003-01-01
Cells of higher eukaryotes process within minutes double strand breaks (DSBs) in their genome using a NHEJ apparatus that engages DNA-PKcs, Ku, DNA ligase IV, XRCC4, and other as of yet unidentified factors. Although chemical inhibition, or mutation, in any of these factors delays processing, cells ultimately remove the majority of DNA DSBs using an alternative pathway operating with slower kinetics. This alternative pathway is active in mutants deficient in genes of the RAD52 epistasis group. We proposed, therefore, that it reflects an alternative form of NHEJ that operates as a backup (B-NHEJ) to the DNA-PK- dependent (D-NHEJ) pathway, rather than homology directed repair of DSBs. We studied the role of Ku and DNA-PKcs in the coordination of these pathways using as a model end joining of restriction endonuclease linearized plasmid DNA in whole cell extracts. Efficient error-free endjoining observed in such in-vitro reactions is strongly inhibited by anti-Ku antibodies. The inhibition requires DNA-PKcs, despite that fact that Ku efficiently binds DNA ends in the presence of antibodies, or in the absence of DNA-PKcs. Strong inhibition of DNA endjoining is also mediated by wortmannin, an inhibitor of DNA-PKcs, in the presence but not in the absence of Ku, and this inhibition can be rescued by pre-incubating the reaction with double stranded oligonucleotides. The results are compatible with a role of Ku in directing endjoining to a DNA-PK dependent pathway, mediated by efficient end binding and productive interactions with DNA-PKcs. On the other hand, efficient end joining is observed in extracts of cells lacking DNA-PKcs, as well as in Ku-depleted extracts sugggesting the operation of alternative pathways. Extracts depleted of Ku and DNA-PKcs rejoin blunt ends, as well as homologous ends with 3' or 5' protruding single strands with similar efficiency, but addition of Ku suppresses joining of blunt ends and homologous ends with 3' overhangs. We propose that the
Sorrentino, Vincenzo; Scheer, Lilith; Santos, Ana; Reits, Eric; Bleijlevens, Boris; Zelcer, Noam
2011-01-01
We recently identified the liver X receptor-regulated E3 ubiquitin ligase inducible degrader of the LDL receptor (IDOL) as a modulator of lipoprotein metabolism. Acting as an E3 ubiquitin ligase, IDOL triggers ubiquitination and subsequent degradation of the low density lipoprotein receptor (LDLR).
Global SUMO proteome responses guide gene regulation, mRNA biogenesis, and plant stress responses
Directory of Open Access Journals (Sweden)
Magdalena eMazur
2012-09-01
Full Text Available Small-ubiquitin-like MOdifier (SUMO is a key regulator of abiotic stress, disease resistance and development in plants. The identification of >350 plant SUMO targets has revealed many processes modulated by SUMO and potential consequences of SUMO on its targets. Importantly, highly related proteins are SUMO-modified in plants, yeast, and metazoans. Overlapping SUMO targets include heat-shock proteins, transcription regulators, histones, histone-modifying enzymes, proteins involved in DNA damage repair, but also proteins involved in mRNA biogenesis and nucleo-cytoplasmic transport. Proteomics studies indicate key roles for SUMO in gene repression by controlling histone (deacetylation activity at genomic loci. The responsible heavily sumoylated transcriptional repressor complexes are recruited by EAR (Ethylene-responsive element binding factor [ERF]-associated Amphiphilic Repression-motif containing transcription factors in plants. These transcription factors are not necessarily themselves a SUMO target. Conversely, SUMO acetylation prevents binding of downstream partners by preventing binding of SIMs (SUMO-interaction peptide motifs presents in these partners, while SUMO acetylation has emerged as mechanism to recruit specifically bromodomains; bromodomain are generally linked with gene activation. These findings strengthen the idea of a bidirectional sumo-/acetylation switch in gene regulation. Quantitative proteomics has highlighted that global sumoylation provides a dynamic response to protein damage involving SUMO chain-mediated protein degradation, but also SUMO E3 ligase-dependent transcription of HSP (Heat-shock protein genes. With these insights in SUMO function and novel technical advancements, we can now study SUMO dynamics in responses to (abiotic stress in plants.
International Nuclear Information System (INIS)
Takayanagi, Shinnosuke; Trunk, J.G.; Sutherland, J.C.; Sutherland, B.M.
1994-01-01
The relative UV sensitivities of alfalfa seedlings grown outdoors versus plants grown in a growth chamber under UV-filtered cool white fluorescent bulbs have been determined using three criteria: (1) level of endogenous DNA damage as sites for the UV endonuclease from Micrococcus luteus, (2) susceptibility to pyrimidine dimer induction by a UV challenge exposure and (3) ability to repair UV-induced damage. We find that outdoor-grown plants contain approximately equal frequencies of endogenous DNA damages, are less susceptible to dimer induction by a challenge exposure of broad-spectrum UV and photorepair dimers more rapidly than plants grown in an environmental chamber under cool white fluorescent lamps plus a filter removes most UV radiation. These data suggest that plants grown in a natural environment would be less sensitive to UVB-induced damage than would be predicted on the basis of studies on plants grown under minimum UV. (author)
A detailed experimental study of a DNA computer with two endonucleases.
Sakowski, Sebastian; Krasiński, Tadeusz; Sarnik, Joanna; Blasiak, Janusz; Waldmajer, Jacek; Poplawski, Tomasz
2017-07-14
Great advances in biotechnology have allowed the construction of a computer from DNA. One of the proposed solutions is a biomolecular finite automaton, a simple two-state DNA computer without memory, which was presented by Ehud Shapiro's group at the Weizmann Institute of Science. The main problem with this computer, in which biomolecules carry out logical operations, is its complexity - increasing the number of states of biomolecular automata. In this study, we constructed (in laboratory conditions) a six-state DNA computer that uses two endonucleases (e.g. AcuI and BbvI) and a ligase. We have presented a detailed experimental verification of its feasibility. We described the effect of the number of states, the length of input data, and the nondeterminism on the computing process. We also tested different automata (with three, four, and six states) running on various accepted input words of different lengths such as ab, aab, aaab, ababa, and of an unaccepted word ba. Moreover, this article presents the reaction optimization and the methods of eliminating certain biochemical problems occurring in the implementation of a biomolecular DNA automaton based on two endonucleases.
Siah1/2 Ubiquitin Ligases in ER Stress Signaling in Melanoma
2016-12-01
enriched (and downregulated) upon Siah2 KD (Fig 4). RNAseq to identify genes and pathways that are deregulated in the Siah2 KD melanomas, led us...June 2016), Signgene Symposium (Berlin, Germany ; Sept. 2016), European Society for Pigment Cell Research (Milano, Italy; Sept. 2016), Centre National...Flaherty KT, Ronai ZA. Downregulation of the Ubiquitin Ligase RNF125 Underlies Resistance of Melanoma Cells to BRAF Inhibitors via JAK1 Deregulation
Rsp5 ubiquitin ligase is required for protein trafficking in Saccharomyces cerevisiae COPI mutants.
Directory of Open Access Journals (Sweden)
Katarzyna Jarmoszewicz
Full Text Available Retrograde trafficking from the Golgi to the endoplasmic reticulum (ER depends on the formation of vesicles coated with the multiprotein complex COPI. In Saccharomyces cerevisiae ubiquitinated derivatives of several COPI subunits have been identified. The importance of this modification of COPI proteins is unknown. With the exception of the Sec27 protein (β'COP neither the ubiquitin ligase responsible for ubiquitination of COPI subunits nor the importance of this modification are known. Here we find that the ubiquitin ligase mutation, rsp5-1, has a negative effect that is additive with ret1-1 and sec28Δ mutations, in genes encoding α- and ε-COP, respectively. The double ret1-1 rsp5-1 mutant is also more severely defective in the Golgi-to-ER trafficking compared to the single ret1-1, secreting more of the ER chaperone Kar2p, localizing Rer1p mostly to the vacuole, and increasing sensitivity to neomycin. Overexpression of ubiquitin in ret1-1 rsp5-1 mutant suppresses vacuolar accumulation of Rer1p. We found that the effect of rsp5 mutation on the Golgi-to-ER trafficking is similar to that of sla1Δ mutation in a gene encoding actin cytoskeleton proteins, an Rsp5p substrate. Additionally, Rsp5 and Sla1 proteins were found by co-immunoprecipitation in a complex containing COPI subunits. Together, our results show that Rsp5 ligase plays a role in regulating retrograde Golgi-to-ER trafficking.
Pedersen, Mikkel Winther; Ginolhac, Aurélien; Orlando, Ludovic; Olsen, Jesper; Andersen, Kenneth; Holm, Jakob; Funder, Svend; Willerslev, Eske; Kjær, Kurt H.
2013-09-01
We use 2nd generation sequencing technology on sedimentary ancient DNA (sedaDNA) from a lake in South Greenland to reconstruct the local floristic history around a low-arctic lake and compare the results with those previously obtained from pollen and macrofossils in the same lake. Thirty-eight of thirty-nine samples from the core yielded putative DNA sequences. Using a multiple assignment strategy on the trnL g-h DNA barcode, consisting of two different phylogenetic and one sequence similarity assignment approaches, thirteen families of plants were identified, of which two (Scrophulariaceae and Asparagaceae) are absent from the pollen and macrofossil records. An age model for the sediment based on twelve radiocarbon dates establishes a chronology and shows that the lake record dates back to 10,650 cal yr BP. Our results suggest that sedaDNA analysis from lake sediments, although taxonomically less detailed than pollen and macrofossil analyses can be a complementary tool for establishing the composition of both terrestrial and aquatic local plant communities and a method for identifying additional taxa.
Mutation in SUMO E3 ligase, SIZ1, disrupts the mature female gametophyte in Arabidopsis
Ling, Yu
2012-01-09
Female gametophyte is the multicellular haploid structure that can produce embryo and endosperm after fertilization, which has become an attractive model system for investigating molecular mechanisms in nuclei migration, cell specification, cell-to-cell communication and many other processes. Previous reports found that the small ubiquitin-like modifier (SUMO) E3 ligase, SIZ1, participated in many processes depending on particular target substrates and suppression of salicylic acid (SA) accumulation. Here, we report that SIZ1 mediates the reproductive process. SIZ1 showed enhanced expression in female organs, but was not detected in the anther or pollen. A defect in the siz1-2 maternal source resulted in reduced seed-set regardless of high SA concentration within the plant. Moreover, aniline blue staining and scanning electron microscopy revealed that funicular and micropylar pollen tube guidance was arrested in siz1-2 plants. Some of the embryo sacs of ovules in siz1-2 were also disrupted quickly after stage FG7. There was no significant affects of the siz1-2 mutation on expression of genes involved in female gametophyte development- or pollen tube guidance in ovaries. Together, our results suggest that SIZ1 sustains the stability and normal function of the mature female gametophyte which is necessary for pollen tube guidance. © 2012 Ling et al.
International Nuclear Information System (INIS)
Nagara, S.; Tsurudome, K.; Tokizawa, T.
1999-05-01
For the purpose of effect of radioactive material concentration and radiation to DNA in plant, this study carried out laboratory experiment using soil from the Yotsugi mill-tailings dam which contained radionuclides such as uranium and radium. In present experiment, the Arabidopsis in which gene sequence had been clarified was used as a model plant, and the existence of the mutation of the gene was confirmed. In addition, the Imaging Plate method (IP) was applied to the detection of the radioactive material, and the applicability of IP for the analysis of the radioactive material migration was evaluated. In fiscal 1997, DNA amplification by the PCR (Polymerase Chain Reaction) method was carried out using DNA extracted from the Arabidopsis. The result showed that chalcone synthesis gene examined, when radiation and effect by the radioactive material are analyzed, could be amplified. From results of IP-image of the Arabidopsis which is grown in the soil from Yotsugi mill-tailings dam, it was able to be confirmed that radiation distribution in the plant body is measured, and the way opened it in the measuring method of the small radiation. This study promotes the experiment in the cooperation with Okayama Univ.. JNC was in charge of from the rearing of the plant to the DNA amplification operation. And Okayama Univ. was in charge of the operation that contains the DNA recombination experiment from sub-cloning to sequence. (author)
Detection of plant-based adulterants in turmeric powder using DNA barcoding.
Parvathy, V A; Swetha, V P; Sheeja, T E; Sasikumar, B
2015-01-01
In its powdered form, turmeric [Curcuma longa L. (Zingiberaceae)], a spice of medical importance, is often adulterated lowering its quality. The study sought to detect plant-based adulterants in traded turmeric powder using DNA barcoding. Accessions of Curcuma longa L., Curcuma zedoaria Rosc. (Zingiberaceae), and cassava starch served as reference samples. Three barcoding loci, namely ITS, rbcL, and matK, were used for PCR amplification of the reference samples and commercial samples representing 10 different companies. PCR success rate, sequencing efficiency, occurrence of SNPs, and BLAST analysis were used to assess the potential of the barcoding loci in authenticating the traded samples of turmeric. The PCR and sequencing success of the loci rbcL and ITS were found to be 100%, whereas matK showed no amplification. ITS proved to be the ideal locus because it showed greater variability than rbcL in discriminating the Curcuma species. The presence of C. zedoaria could be detected in one of the samples whereas cassava starch, wheat, barley, and rye in other two samples although the label claimed nothing other than turmeric powder in the samples. Unlabeled materials in turmeric powder are considered as adulterants or fillers, added to increase the bulk weight and starch content of the commodity for economic gains. These adulterants pose potential health hazards to consumers who are allergic to these plants, lowering the product's medicinal value and belying the claim that the product is gluten free. The study proved DNA barcoding as an efficient tool for testing the integrity and the authenticity of commercial products of turmeric.
Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko
2013-01-01
A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.
The effect of calcium salts on Dna-ase and Rna-ase activity of irradiated plants
International Nuclear Information System (INIS)
Arslanova, S.V.
1978-01-01
The influence of the post-radiation factor helping the restoration of radiation damages in the early sorts of cotton plant 1306'DV Goss. hirsutum was studied. In particular the action of treating the irradiated seed in the solution of calcium salts on the functional state of alcaline and acid forms of nucleases in cellular components was investigated. The dry seed of cotton was irradiated with gamma-rays at dose of 30 krad. It was found that irradiation of the dry seed at the radiosensitive organ (roots) increased the acid DNA-ase in the cellular nuclei, in the radioresistant (leaves) - the alcaline DNA-ase and RNA-ase. With irradiation both forms of DNA-ase in the mitochondriae diminished. After treatment of the irradiated seed in the solution of calcium salts the activity of acid nucleases and alcaline enzymes remained normal
Luis E. Rojas; Maritza Reyes; Naivy Pérez-Alonso; María I. Olóriz; Laisyn Posada-Pérez; Bárbara Ocaña; Orelvis Portal; Borys Chong-Pérez; Jorge L. Pérez Pérez
2014-01-01
The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol). In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR). From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend ...
The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.
Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J
2017-05-01
The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.
Aurora Kinase A Promotes AR Degradation via the E3 Ligase CHIP.
Sarkar, Sukumar; Brautigan, David L; Larner, James M
2017-08-01
Reducing the levels of the androgen receptor (AR) is one of the most viable approaches to combat castration-resistant prostate cancer. Previously, we observed that proteasomal-dependent degradation of AR in response to 2-methoxyestradiol (2-ME) depends primarily on the E3 ligase C-terminus of HSP70-interacting protein (STUB1/CHIP). Here, 2-ME stimulation activates CHIP by phosphorylation via Aurora kinase A (AURKA). Aurora A kinase inhibitors and RNAi knockdown of Aurora A transcript selectively blocked CHIP phosphorylation and AR degradation. Aurora A kinase is activated by 2-ME in the S-phase as well as during mitosis, and phosphorylates CHIP at S273. Prostate cancer cells expressing an S273A mutant of CHIP have attenuated AR degradation upon 2-ME treatment compared with cells expressing wild-type CHIP, supporting the idea that CHIP phosphorylation by Aurora A activates its E3 ligase activity for the AR. These results reveal a novel 2-ME→Aurora A→CHIP→AR pathway that promotes AR degradation via the proteasome that may offer novel therapeutic opportunities for prostate cancer. Mol Cancer Res; 15(8); 1063-72. ©2017 AACR . ©2017 American Association for Cancer Research.
Aβ-Induced Synaptic Alterations Require the E3 Ubiquitin Ligase Nedd4-1.
Rodrigues, Elizabeth M; Scudder, Samantha L; Goo, Marisa S; Patrick, Gentry N
2016-02-03
Alzheimer's disease (AD) is a neurodegenerative disease in which patients experience progressive cognitive decline. A wealth of evidence suggests that this cognitive impairment results from synaptic dysfunction in affected brain regions caused by cleavage of amyloid precursor protein into the pathogenic peptide amyloid-β (Aβ). Specifically, it has been shown that Aβ decreases surface AMPARs, dendritic spine density, and synaptic strength, and also alters synaptic plasticity. The precise molecular mechanisms by which this occurs remain unclear. Here we demonstrate a role for ubiquitination in Aβ-induced synaptic dysfunction in cultured rat neurons. We find that Aβ promotes the ubiquitination of AMPARs, as well as the redistribution and recruitment of Nedd4-1, a HECT E3 ubiquitin ligase we previously demonstrated to target AMPARs for ubiquitination and degradation. Strikingly, we show that Nedd4-1 is required for Aβ-induced reductions in surface AMPARs, synaptic strength, and dendritic spine density. Our findings, therefore, indicate an important role for Nedd4-1 and ubiquitin in the synaptic alterations induced by Aβ. Synaptic changes in Alzheimer's disease (AD) include surface AMPAR loss, which can weaken synapses. In a cell culture model of AD, we found that AMPAR loss correlates with increased AMPAR ubiquitination. In addition, the ubiquitin ligase Nedd4-1, known to ubiquitinate AMPARs, is recruited to synapses in response to Aβ. Strikingly, reducing Nedd4-1 levels in this model prevented surface AMPAR loss and synaptic weakening. These findings suggest that, in AD, Nedd4-1 may ubiquitinate AMPARs to promote their internalization and weaken synaptic strength, similar to what occurs in Nedd4-1's established role in homeostatic synaptic scaling. This is the first demonstration of Aβ-mediated control of a ubiquitin ligase to regulate surface AMPAR expression. Copyright © 2016 the authors 0270-6474/16/361590-06$15.00/0.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Neuromuscular regulation in zebrafish by a large AAA+ ATPase/ubiquitin ligase, mysterin/RNF213
Kotani, Yuri; Morito, Daisuke; Yamazaki, Satoru; Ogino, Kazutoyo; Kawakami, Koichi; Takashima, Seiji; Hirata, Hiromi; Nagata, Kazuhiro
2015-01-01
Mysterin (also known as RNF213) is a huge intracellular protein with two AAA+ ATPase modules and a RING finger ubiquitin ligase domain. Mysterin was originally isolated as a significant risk factor for the cryptogenic cerebrovascular disorder moyamoya disease, and was found to be involved in physiological angiogenesis in zebrafish. However, the function and the physiological significance of mysterin in other than blood vessels remain largely unknown, although mysterin is ubiquitously expressed in animal tissues. In this study, we performed antisense-mediated suppression of a mysterin orthologue in zebrafish larvae and revealed that mysterin-deficient larvae showed significant reduction in fast myofibrils and immature projection of primary motoneurons, leading to severe motor deficits. Fast muscle-specific restoration of mysterin expression cancelled these phenotypes, and interestingly both AAA+ ATPase and ubiquitin ligase activities of mysterin were indispensable for proper fast muscle formation, demonstrating an essential role of mysterin and its enzymatic activities in the neuromuscular regulation in zebrafish. PMID:26530008
Blocking an N-terminal acetylation–dependent protein interaction inhibits an E3 ligase
Energy Technology Data Exchange (ETDEWEB)
Scott, Daniel C.; Hammill, Jared T.; Min, Jaeki; Rhee, David Y.; Connelly, Michele; Sviderskiy, Vladislav O.; Bhasin, Deepak; Chen, Yizhe; Ong, Su-Sien; Chai, Sergio C.; Goktug, Asli N.; Huang, Guochang; Monda, Julie K.; Low, Jonathan; Kim, Ho Shin; Paulo, Joao A.; Cannon, Joe R.; Shelat, Anang A.; Chen, Taosheng; Kelsall, Ian R.; Alpi, Arno F.; Pagala, Vishwajeeth; Wang, Xusheng; Peng, Junmin; Singh , Bhuvanesh; Harper, J. Wade; Schulman, Brenda A.; Guy, R. Kip (MSKCC); (Dundee); (SJCH); (Harvard-Med); (MXPL)
2017-06-05
N-terminal acetylation is an abundant modification influencing protein functions. Because ~80% of mammalian cytosolic proteins are N-terminally acetylated, this modification is potentially an untapped target for chemical control of their functions. Structural studies have revealed that, like lysine acetylation, N-terminal acetylation converts a positively charged amine into a hydrophobic handle that mediates protein interactions; hence, this modification may be a druggable target. We report the development of chemical probes targeting the N-terminal acetylation–dependent interaction between an E2 conjugating enzyme (UBE2M or UBC12) and DCN1 (DCUN1D1), a subunit of a multiprotein E3 ligase for the ubiquitin-like protein NEDD8. The inhibitors are highly selective with respect to other protein acetyl-amide–binding sites, inhibit NEDD8 ligation in vitro and in cells, and suppress anchorage-independent growth of a cell line with DCN1 amplification. Overall, our data demonstrate that N-terminal acetyl-dependent protein interactions are druggable targets and provide insights into targeting multiprotein E2–E3 ligases.
Blomme, Jonas; Van Aken, Olivier; Van Leene, Jelle; Jé gu, Teddy; De Rycke, Riet Maria; De Bruyne, Michiel; Vercruysse, Jasmien; Nolf, Jonah; Van Daele, Twiggy; De Milde, Liesbeth; Vermeersch, Mattias; Colas des Francs-Small, Catherine; De Jaeger, Geert; Benhamed, Moussa; Millar, A. Harvey; Inzé , Dirk; Gonzalez, Nathalie
2017-01-01
In addition to the nucleus, mitochondria and chloroplasts in plant cells also contain genomes. Efficient DNA repair pathways are crucial in these organelles to fix damage resulting from endogenous and exogenous factors. Plant organellar genomes
Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA
Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.
1974-01-01
DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576
Polo-like kinase 1 inhibits DNA damage response during mitosis.
Benada, Jan; Burdová, Kamila; Lidak, Tomáš; von Morgen, Patrick; Macurek, Libor
2015-01-01
In response to genotoxic stress, cells protect their genome integrity by activation of a conserved DNA damage response (DDR) pathway that coordinates DNA repair and progression through the cell cycle. Extensive modification of the chromatin flanking the DNA lesion by ATM kinase and RNF8/RNF168 ubiquitin ligases enables recruitment of various repair factors. Among them BRCA1 and 53BP1 are required for homologous recombination and non-homologous end joining, respectively. Whereas mechanisms of DDR are relatively well understood in interphase cells, comparatively less is known about organization of DDR during mitosis. Although ATM can be activated in mitotic cells, 53BP1 is not recruited to the chromatin until cells exit mitosis. Here we report mitotic phosphorylation of 53BP1 by Plk1 and Cdk1 that impairs the ability of 53BP1 to bind the ubiquitinated H2A and to properly localize to the sites of DNA damage. Phosphorylation of 53BP1 at S1618 occurs at kinetochores and in cytosol and is restricted to mitotic cells. Interaction between 53BP1 and Plk1 depends on the activity of Cdk1. We propose that activity of Cdk1 and Plk1 allows spatiotemporally controlled suppression of 53BP1 function during mitosis.
RNF111/Arkadia is a SUMO-targeted ubiquitin ligase that facilitates the DNA damage response
DEFF Research Database (Denmark)
Poulsen, Sara L; Hansen, Rebecca K; Wagner, Sebastian A
2013-01-01
nonproteolytic, K63-linked ubiquitylation of SUMOylated target proteins. We demonstrate that RNF111 promoted ubiquitylation of SUMOylated XPC (xeroderma pigmentosum C) protein, a central DNA damage recognition factor in nucleotide excision repair (NER) extensively regulated by ultraviolet (UV...
Directory of Open Access Journals (Sweden)
Craig M. Costion
2016-02-01
Full Text Available A foundation for a DNA barcode reference library for the tropical plants of Australia is presented here. A total of 1572 DNA barcode sequences are compiled from 848 tropical Queensland species. The dataset represents 35% of the total flora of Queensland’s Wet Tropics Bioregion, 57% of its tree species and 28% of the shrub species. For approximately half of the sampled species, we investigated the occurrence of infraspecific molecular variation in DNA barcode loci rbcLa, matK, and the trnH-psbA intergenic spacer region across previously recognized biogeographic barriers. We found preliminary support for the notion that DNA barcode reference libraries can be used as a tool for inferring biogeographic patterns at regional scales. It is expected that this dataset will find applications in taxonomic, ecological, and applied conservation research.
Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick
2017-01-01
Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652
International Nuclear Information System (INIS)
Tan, Can; Zhang, Li-Yang; Chen, Hong; Xiao, Ling; Liu, Xian-Peng; Zhang, Jian-Xiang
2011-01-01
Highlights: ► Overexpression of human CUL4A (hCUL4A) in PC12 cells. ► The effects of hCUL4A on hypoxia–reoxygenation injury were investigated. ► hCUL4A suppresses apoptosis and DNA damage and thus promotes cell survival. ► hCUL4A regulates apoptosis-related proteins and cell cycle regulators. -- Abstract: The ubiquitin E3 ligase CUL4A plays important roles in diverse cellular processes including carcinogenesis and proliferation. It has been reported that the expression of CUL4A can be induced by hypoxic-ischemic injury. However, the effect of elevated expression of CUL4A on hypoxia–reoxygenation injury is currently unclear. In this study, human CUL4A (hCUL4A) was expressed in rat pheochromocytoma (PC12) cells using adenoviral vector-mediated gene transfer, and the effects of hCUL4A expression on hypoxia–reoxygenation injury were investigated. In PC12 cells subjected to hypoxia and reoxygenation, we found that hCUL4A suppresses apoptosis and DNA damage by regulating apoptosis-related proteins and cell cycle regulators (Bcl-2, caspase-3, p53 and p27); consequently, hCUL4A promotes cell survival. Taken together, our results reveal the beneficial effects of hCUL4A in PC12 cells upon hypoxia–reoxygenation injury.
Low-energy ion beam bombardment effect on the plant-cell-envelope mimetic membrane for DNA transfer
International Nuclear Information System (INIS)
Prakrajang, K.; Sangwijit, K.; Anuntalabhochai, S.; Wanichapichart, P.; Yu, L.D.
2012-01-01
This study is a systematic analysis of the mechanisms involved in ion-beam induced DNA transfer, an important application of ion beam biotechnology. Cellulose membranes were used to mimic the plant cell envelope. Ion beams of argon (Ar) or nitrogen (N) at an energy of 25 keV bombarded the cellulose membranes at fluences ranging from 10 15 to 10 16 ions/cm 2 . The damage to the ion-beam-bombarded membranes was characterized using infrared spectroscopy, a micro tensile test and scanning electron microscopy (SEM). Chain scission was the dominant radiation damage type in the membrane. DNA diffusion across the membrane was significantly increased after ion beam bombardment. The increase in DNA transfer is therefore attributed to chain scission, which increases the permeability by increasing the number of pores in the membrane.
Rao, Feng; Xu, Jing; Khan, A. Basit; Gadalla, Moataz M.; Cha, Jiyoung Y.; Xu, Risheng; Tyagi, Richa; Dang, Yongjun; Chakraborty, Anutosh; Snyder, Solomon H.
2014-01-01
Inositol polyphosphates containing an energetic pyrophosphate bond are formed primarily by a family of three inositol hexakisphosphate (IP6) kinases (IP6K1–3). The Cullin-RING ubiquitin ligases (CRLs) regulate diverse biological processes through substrate ubiquitylation. CRL4, comprising the scaffold Cullin 4A/B, the E2-interacting Roc1/2, and the adaptor protein damage-specific DNA-binding protein 1, is activated by DNA damage. Basal CRL4 activity is inhibited by binding to the COP9 signalosome (CSN). UV radiation and other stressors dissociate the complex, leading to E3 ligase activation, but signaling events that trigger signalosome dissociation from CRL4 have been unclear. In the present study, we show that, under basal conditions, IP6K1 forms a ternary complex with CSN and CRL4 in which IP6K1 and CRL4 are inactive. UV dissociates IP6K1 to generate IP7, which then dissociates CSN–CRL4 to activate CRL4. Thus, IP6K1 is a novel CRL4 subunit that transduces UV signals to mediate disassembly of the CRL4–CSN complex, thereby regulating nucleotide excision repair and cell death. PMID:25349427
In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants
Directory of Open Access Journals (Sweden)
Mokhtar Nosrati
2017-08-01
Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.
Shamim, Uzma; Hanif, Sarmad; Ullah, M F; Azmi, Asfar S; Bhat, Showket H; Hadi, S M
2008-08-01
It was earlier proposed that an important anti-cancer mechanism of plant polyphenols may involve mobilization of endogenous copper ions, possibly chromatin-bound copper and the consequent pro-oxidant action. This paper shows that plant polyphenols are able to mobilize nuclear copper in human lymphocytes, leading to degradation of cellular DNA. A cellular system of lymphocytes isolated from human peripheral blood and comet assay was used for this purpose. Incubation of lymphocytes with neocuproine (a cell membrane permeable copper chelator) inhibited DNA degradation in intact lymphocytes. Bathocuproine, which is unable to permeate through the cell membrane, did not cause such inhibition. This study has further shown that polyphenols are able to degrade DNA in cell nuclei and that such DNA degradation is inhibited by neocuproine as well as bathocuproine (both of which are able to permeate the nuclear pore complex), suggesting that nuclear copper is mobilized in this reaction. Pre-incubation of lymphocyte nuclei with polyphenols indicates that it is capable of traversing the nuclear membrane. This study has also shown that polyphenols generate oxidative stress in lymphocyte nuclei which is inhibited by scavengers of reactive oxygen species (ROS) and neocuproine. These results indicate that the generation of ROS occurs through mobilization of nuclear copper resulting in oxidatively generated DNA breakage.
Directory of Open Access Journals (Sweden)
Choudhury Swarup
2010-07-01
Full Text Available Abstract Background The DNA repair and recombination (DRR proteins protect organisms against genetic damage, caused by environmental agents and other genotoxic agents, by removal of DNA lesions or helping to abide them. Results We identified genes potentially involved in DRR mechanisms in Arabidopsis and rice using similarity searches and conserved domain analysis against proteins known to be involved in DRR in human, yeast and E. coli. As expected, many of DRR genes are very similar to those found in other eukaryotes. Beside these eukaryotes specific genes, several prokaryotes specific genes were also found to be well conserved in plants. In Arabidopsis, several functionally important DRR gene duplications are present, which do not occur in rice. Among DRR proteins, we found that proteins belonging to the nucleotide excision repair pathway were relatively more conserved than proteins needed for the other DRR pathways. Sub-cellular localization studies of DRR gene suggests that these proteins are mostly reside in nucleus while gene drain in between nucleus and cell organelles were also found in some cases. Conclusions The similarities and dissimilarities in between plants and other organisms' DRR pathways are discussed. The observed differences broaden our knowledge about DRR in the plants world, and raises the potential question of whether differentiated functions have evolved in some cases. These results, altogether, provide a useful framework for further experimental studies in these organisms.
Singh, Sanjay K; Roy, Sujit; Choudhury, Swarup Roy; Sengupta, Dibyendu N
2010-07-21
The DNA repair and recombination (DRR) proteins protect organisms against genetic damage, caused by environmental agents and other genotoxic agents, by removal of DNA lesions or helping to abide them. We identified genes potentially involved in DRR mechanisms in Arabidopsis and rice using similarity searches and conserved domain analysis against proteins known to be involved in DRR in human, yeast and E. coli. As expected, many of DRR genes are very similar to those found in other eukaryotes. Beside these eukaryotes specific genes, several prokaryotes specific genes were also found to be well conserved in plants. In Arabidopsis, several functionally important DRR gene duplications are present, which do not occur in rice. Among DRR proteins, we found that proteins belonging to the nucleotide excision repair pathway were relatively more conserved than proteins needed for the other DRR pathways. Sub-cellular localization studies of DRR gene suggests that these proteins are mostly reside in nucleus while gene drain in between nucleus and cell organelles were also found in some cases. The similarities and dissimilarities in between plants and other organisms' DRR pathways are discussed. The observed differences broaden our knowledge about DRR in the plants world, and raises the potential question of whether differentiated functions have evolved in some cases. These results, altogether, provide a useful framework for further experimental studies in these organisms.
AFEAP cloning: a precise and efficient method for large DNA sequence assembly.
Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin
2017-11-14
Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.
Schumacher, Dominik; Lemke, Oliver; Helma, Jonas; Gerszonowicz, Lena; Waller, Verena; Stoschek, Tina; Durkin, Patrick M; Budisa, Nediljko; Leonhardt, Heinrich; Keller, Bettina G; Hackenberger, Christian P R
2017-05-01
The broad substrate tolerance of tubulin tyrosine ligase is the basic rationale behind its wide applicability for chemoenzymatic protein functionalization. In this context, we report that the wild-type enzyme enables ligation of various unnatural amino acids that are substantially bigger than and structurally unrelated to the natural substrate, tyrosine, without the need for extensive protein engineering. This unusual substrate flexibility is due to the fact that the enzyme's catalytic pocket forms an extended cavity during ligation, as confirmed by docking experiments and all-atom molecular dynamics simulations. This feature enabled one-step C-terminal biotinylation and fluorescent coumarin labeling of various functional proteins as demonstrated with ubiquitin, an antigen binding nanobody, and the apoptosis marker Annexin V. Its broad substrate tolerance establishes tubulin tyrosine ligase as a powerful tool for in vitro enzyme-mediated protein modification with single functional amino acids in a specific structural context.
Mycobacterium smegmatis PafBC is involved in regulation of DNA damage response.
Fudrini Olivencia, Begonia; Müller, Andreas U; Roschitzki, Bernd; Burger, Sibylle; Weber-Ban, Eilika; Imkamp, Frank
2017-10-25
Two genes, pafB and pafC, are organized in an operon with the Pup-ligase gene pafA, which is part of the Pup-proteasome system (PPS) present in mycobacteria and other actinobacteria. The PPS is crucial for Mycobacterium tuberculosis resistance towards reactive nitrogen intermediates (RNI). However, pafB and pafC apparently play only a minor role in RNI resistance. To characterize their function, we generated a pafBC deletion in Mycobacterium smegmatis (Msm). Proteome analysis of the mutant strain revealed decreased cellular levels of various proteins involved in DNA damage repair, including recombinase A (RecA). In agreement with this finding, Msm ΔpafBC displayed increased sensitivity to DNA damaging agents. In mycobacteria two pathways regulate DNA repair genes: the LexA/RecA-dependent SOS response and a predominant pathway that controls gene expression via a LexA/RecA-independent promoter, termed P1. PafB and PafC feature winged helix-turn-helix DNA binding motifs and we demonstrate that together they form a stable heterodimer in vitro, implying a function as a heterodimeric transcriptional regulator. Indeed, P1-driven transcription of recA was decreased in Msm ΔpafBC under standard conditions and induction of recA expression upon DNA damage was strongly impaired. Taken together, our data indicate an important regulatory function of PafBC in the mycobacterial DNA damage response.
Plant Nucleolar Stress Response, a New Face in the NAC-Dependent Cellular Stress Responses
Directory of Open Access Journals (Sweden)
Iwai Ohbayashi
2018-01-01
Full Text Available The nucleolus is the most prominent nuclear domain, where the core processes of ribosome biogenesis occur vigorously. All these processes are finely orchestrated by many nucleolar factors to build precisely ribosome particles. In animal cells, perturbations of ribosome biogenesis, mostly accompanied by structural disorders of the nucleolus, cause a kind of cellular stress to induce cell cycle arrest, senescence, or apoptosis, which is called nucleolar stress response. The best-characterized pathway of this stress response involves p53 and MDM2 as key players. p53 is a crucial transcription factor that functions in response to not only nucleolar stress but also other cellular stresses such as DNA damage stress. These cellular stresses release p53 from the inhibition by MDM2, an E3 ubiquitin ligase targeting p53, in various ways, which leads to p53-dependent activation of a set of genes. In plants, genetic impairments of ribosome biogenesis factors or ribosome components have been shown to cause characteristic phenotypes, including a narrow and pointed leaf shape, implying a common signaling pathway connecting ribosomal perturbations and certain aspects of growth and development. Unlike animals, however, plants have neither p53 nor MDM2 family proteins. Then the question arises whether plant cells have a nucleolar stress response pathway. In recent years, it has been reported that several members of the plant-specific transcription factor family NAC play critical roles in the pathways responsive to various cellular stresses. In this mini review, we outline the plant cellular stress response pathways involving NAC transcription factors with reference to the p53-MDM2-dependent pathways of animal cells, and discuss the possible involvement of a plant-unique, NAC-mediated pathway in the nucleolar stress response in plants.
Plant Nucleolar Stress Response, a New Face in the NAC-Dependent Cellular Stress Responses.
Ohbayashi, Iwai; Sugiyama, Munetaka
2017-01-01
The nucleolus is the most prominent nuclear domain, where the core processes of ribosome biogenesis occur vigorously. All these processes are finely orchestrated by many nucleolar factors to build precisely ribosome particles. In animal cells, perturbations of ribosome biogenesis, mostly accompanied by structural disorders of the nucleolus, cause a kind of cellular stress to induce cell cycle arrest, senescence, or apoptosis, which is called nucleolar stress response. The best-characterized pathway of this stress response involves p53 and MDM2 as key players. p53 is a crucial transcription factor that functions in response to not only nucleolar stress but also other cellular stresses such as DNA damage stress. These cellular stresses release p53 from the inhibition by MDM2, an E3 ubiquitin ligase targeting p53, in various ways, which leads to p53-dependent activation of a set of genes. In plants, genetic impairments of ribosome biogenesis factors or ribosome components have been shown to cause characteristic phenotypes, including a narrow and pointed leaf shape, implying a common signaling pathway connecting ribosomal perturbations and certain aspects of growth and development. Unlike animals, however, plants have neither p53 nor MDM2 family proteins. Then the question arises whether plant cells have a nucleolar stress response pathway. In recent years, it has been reported that several members of the plant-specific transcription factor family NAC play critical roles in the pathways responsive to various cellular stresses. In this mini review, we outline the plant cellular stress response pathways involving NAC transcription factors with reference to the p53-MDM2-dependent pathways of animal cells, and discuss the possible involvement of a plant-unique, NAC-mediated pathway in the nucleolar stress response in plants.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Isolation of DNA methyltransferase from plants
International Nuclear Information System (INIS)
Ehrlich, K.; Malbroue, C.
1987-01-01
DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from [ 3 H]AdoMet incorporated into acid precipitable material per h at 30 0 ). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30 0
Directory of Open Access Journals (Sweden)
Jian-Qiang Zhang
Full Text Available DNA barcoding, the identification of species using one or a few short standardized DNA sequences, is an important complement to traditional taxonomy. However, there are particular challenges for barcoding plants, especially for species with complex evolutionary histories. We herein evaluated the utility of five candidate sequences - rbcL, matK, trnH-psbA, trnL-F and the internal transcribed spacer (ITS - for barcoding Rhodiola species, a group of high-altitude plants frequently used as adaptogens, hemostatics and tonics in traditional Tibetan medicine. Rhodiola was suggested to have diversified rapidly recently. The genus is thus a good model for testing DNA barcoding strategies for recently diversified medicinal plants. This study analyzed 189 accessions, representing 47 of the 55 recognized Rhodiola species in the Flora of China treatment. Based on intraspecific and interspecific divergence and degree of monophyly statistics, ITS was the best single-locus barcode, resolving 66% of the Rhodiola species. The core combination rbcL+matK resolved only 40.4% of them. Unsurprisingly, the combined use of all five loci provided the highest discrimination power, resolving 80.9% of the species. However, this is weaker than the discrimination power generally reported in barcoding studies of other plant taxa. The observed complications may be due to the recent diversification, incomplete lineage sorting and reticulate evolution of the genus. These processes are common features of numerous plant groups in the high-altitude regions of the Qinghai-Tibetan Plateau.
A plant gene for photolyase: an enzyme catalyzing the repair of UV-light-induced DNA damage
International Nuclear Information System (INIS)
Batschauer, A.
1993-01-01
Photolyases are thought to be critical components of the defense of plants against damage to DNA by solar ultraviolet light, but nothing is known about their molecular or enzymatic nature. The molecular cloning of a photolyase from mustard (Sinapis alba) described here is intended to increase the knowledge about this important repair mechanism in plant species at a molecular level. The gene encodes a polypeptide of 501 amino acids with a predicted molecular mass of 57 kDa. There is a strong sequence similarity to bacterial and yeast photolyases, with a close relationship to enzymes with a deazaflavin chromophor. The plant photolyase is shown to be functional in Escherichia coli which also indicates conservation of photolyases during evolution. It is demonstrated that photolyase expression in plants is light induced, thus providing good evidence for the adaptation of plants to their environment in order to diminish the harmful effects of sunlight. (author)
Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z
2015-08-01
Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.
Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.
Charbonnel, Cyril; Gallego, Maria E; White, Charles I
2010-10-01
Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.
Multiple pathways of DNA double-strand break processing in a mutant Indian muntjac cell line
International Nuclear Information System (INIS)
Bouffler, S.D.; Jha, B.; Johnson, R.T.
1990-01-01
DNA break processing is compared in the Indian muntjac cell lines, SVM and DM. The initial frequencies and resealing of X-ray generated single- and double-strand breaks are similar in the two cell lines. Inhibiting the repair of UV damage leads to greater double-strand breakage in SVM than in DM, and some of these breaks are not repaired; however, repair-associated single-strand breakage and resealing are normal. Dimethylsulfate also induces excess double-strand breakage in SVM, and these breaks are irreparable. Restricted plasmids are reconstituted correctly in SVM at approximately 30% of the frequency observed in DM. Thus SVM has a reduced capacity to repair certain types of double-strand break. This defect is not due to a DNA ligase deficiency. We conclude that DNA double-strand breaks are repaired by a variety of pathways within mammalian cells and that the structure of the break or its mode of formation determines its subsequent fate
Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
Kobayashi, Takanori; Nagasaka, Seiji; Senoura, Takeshi; Itai, Reiko Nakanishi; Nakanishi, Hiromi; Nishizawa, Naoko K.
2013-01-01
Iron is essential for most living organisms. Plants transcriptionally induce genes involved in iron acquisition under conditions of low iron availability, but the nature of the deficiency signal and its sensors are unknown. Here we report the identification of new iron regulators in rice, designated Oryza sativa Haemerythrin motif-containing Really Interesting New Gene (RING)- and Zinc-finger protein 1 (OsHRZ1) and OsHRZ2. OsHRZ1, OsHRZ2 and their Arabidopsis homologue BRUTUS bind iron and zinc, and possess ubiquitination activity. OsHRZ1 and OsHRZ2 are susceptible to degradation in roots irrespective of iron conditions. OsHRZ-knockdown plants exhibit substantial tolerance to iron deficiency, and accumulate more iron in their shoots and grains irrespective of soil iron conditions. The expression of iron deficiency-inducible genes involved in iron utilization is enhanced in OsHRZ-knockdown plants, mostly under iron-sufficient conditions. These results suggest that OsHRZ1 and OsHRZ2 are iron-binding sensors that negatively regulate iron acquisition under conditions of iron sufficiency. PMID:24253678
Feeney, Laura; Muñoz, Ivan M; Lachaud, Christophe; Toth, Rachel; Appleton, Paul L; Schindler, Detlev; Rouse, John
2017-06-01
Defects in the repair of DNA interstrand crosslinks (ICLs) are associated with the genome instability syndrome Fanconi anemia (FA). Here we report that cells with mutations in RFWD3, an E3 ubiquitin ligase that interacts with and ubiquitylates replication protein A (RPA), show profound defects in ICL repair. An amino acid substitution in the WD40 repeats of RFWD3 (I639K) found in a new FA subtype abolishes interaction of RFWD3 with RPA, thereby preventing RFWD3 recruitment to sites of ICL-induced replication fork stalling. Moreover, single point mutations in the RPA32 subunit of RPA that abolish interaction with RFWD3 also inhibit ICL repair, demonstrating that RPA-mediated RFWD3 recruitment to stalled replication forks is important for ICL repair. We also report that unloading of RPA from sites of ICL induction is perturbed in RFWD3-deficient cells. These data reveal important roles for RFWD3 localization in protecting genome stability and preserving human health. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Li Xin
2012-07-01
Full Text Available Abstract Background DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild relatives, Oryza rufipogon and Oryza nivara. Results The overall methylation level of rice genomes is four times higher than that of Arabidopsis. Consistent with the results reported for Arabidopsis, methylation in promoters represses gene expression while gene-body methylation generally appears to be positively associated with gene expression. Interestingly, we discovered that methylation in gene transcriptional termination regions (TTRs can significantly repress gene expression, and the effect is even stronger than that of promoter methylation. Through integrated analysis of genomic, DNA methylomic and transcriptomic differences between cultivated and wild rice, we found that primary DNA sequence divergence is the major determinant of methylational differences at the whole genome level, but DNA methylational difference alone can only account for limited gene expression variation between the cultivated and wild rice. Furthermore, we identified a number of genes with significant difference in methylation level between the wild and cultivated rice. Conclusions The single-base resolution methylomes of rice obtained in this study have not only broadened our understanding of the mechanism and function of DNA methylation in plant genomes, but also provided valuable data for future studies of rice epigenetics and the epigenetic differentiation between wild and cultivated rice.
Zhang, Wei; Fan, Xiaohong; Zhu, Shuifang; Zhao, Hong; Fu, Lianzhong
2013-01-01
Comprehensive sampling is crucial to DNA barcoding, but it is rarely performed because materials are usually unavailable. In practice, only a few rather than all species of a genus are required to be identified. Thus identification of a given species using a limited sample is of great importance in current application of DNA barcodes. Here, we selected 70 individuals representing 48 species from each major lineage of Solanum, one of the most species-rich genera of seed plants, to explore whether DNA barcodes can provide reliable specific-species discrimination in the context of incomplete sampling. Chloroplast genes ndhF and trnS-trnG and the nuclear gene waxy, the commonly used markers in Solanum phylogeny, were selected as the supplementary barcodes. The tree-building and modified barcode gap methods were employed to assess species resolution. The results showed that four Solanum species of quarantine concern could be successfully identified through the two-step barcoding sampling strategy. In addition, discrepancies between nuclear and cpDNA barcodes in some samples demonstrated the ability to discriminate hybrid species, and highlights the necessity of using barcode regions with different modes of inheritance. We conclude that efficient phylogenetic markers are good candidates as the supplementary barcodes in a given taxonomic group. Critically, we hypothesized that a specific-species could be identified from a phylogenetic framework using incomplete sampling-through this, DNA barcoding will greatly benefit the current fields of its application.
Low-energy ion beam bombardment effect on the plant-cell-envelope mimetic membrane for DNA transfer
Energy Technology Data Exchange (ETDEWEB)
Prakrajang, K., E-mail: k.prakrajang@gmail.com [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Sangwijit, K.; Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Wanichapichart, P. [Membrane Science and Technology Research Center, Department of Physics, Faculty of Science, Prince of Songkla University, Hat Yai, Songkla 90112 (Thailand); Yu, L.D., E-mail: yuld@fnrf.science.cmu.ac.th [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand)
2012-09-01
This study is a systematic analysis of the mechanisms involved in ion-beam induced DNA transfer, an important application of ion beam biotechnology. Cellulose membranes were used to mimic the plant cell envelope. Ion beams of argon (Ar) or nitrogen (N) at an energy of 25 keV bombarded the cellulose membranes at fluences ranging from 10{sup 15} to 10{sup 16} ions/cm{sup 2}. The damage to the ion-beam-bombarded membranes was characterized using infrared spectroscopy, a micro tensile test and scanning electron microscopy (SEM). Chain scission was the dominant radiation damage type in the membrane. DNA diffusion across the membrane was significantly increased after ion beam bombardment. The increase in DNA transfer is therefore attributed to chain scission, which increases the permeability by increasing the number of pores in the membrane.
DEFF Research Database (Denmark)
Akbari, Mansour; Otterlei, Marit; Pena Diaz, Javier
2004-01-01
Nuclear uracil-DNA glycosylase UNG2 has an established role in repair of U/A pairs resulting from misincorporation of dUMP during replication. In antigen-stimulated B-lymphocytes UNG2 removes uracil from U/G mispairs as part of somatic hypermutation and class switch recombination processes. Using......, PCNA and DNA ligase, the latter detected as activity. Short-patch repair was the predominant mechanism both in extracts and UNG2-ARC from proliferating and less BER-proficient growth-arrested cells. Repair of U/G mispairs and U/A pairs was completely inhibited by neutralizing UNG...
Pasion, S G; Brown, G W; Brown, L M; Ray, D S
1994-12-01
In trypanosomatids, DNA replication in the nucleus and in the single mitochondrion (or kinetoplast) initiates nearly simultaneously, suggesting that the DNA synthesis (S) phases of the nucleus and the mitochondrion are coordinately regulated. To investigate the basis for the temporal link between nuclear and mitochondrial DNA synthesis phases the expression of the genes encoding DNA ligase I, the 51 and 28 kDa subunits of replication protein A, dihydrofolate reductase and the mitochondrial type II topoisomerase were analyzed during the cell cycle progression of synchronous cultures of Crithidia fasciculata. These DNA replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures. A plasmid clone (pdN-1) in which TOP2, the gene encoding the mitochondrial topoisomerase, was disrupted by the insertion of a NEO drug-resistance cassette was found to express both a truncated TOP2 mRNA and a truncated topoisomerase polypeptide. The truncated mRNA was also expressed periodically coordinate with the expression of the endogenous TOP2 mRNA indicating that cis elements necessary for periodic expression are contained within cloned sequences. The expression of both TOP2 and nuclear DNA replication genes at the G1/S boundary suggests that regulated expression of these genes may play a role in coordinating nuclear and mitochondrial S phases in trypanosomatids.
Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji
2018-05-14
Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.
The cell pole: the site of cross talk between the DNA uptake and genetic recombination machinery.
Kidane, Dawit; Ayora, Silvia; Sweasy, Joann B; Graumann, Peter L; Alonso, Juan C
2012-01-01
Natural transformation is a programmed mechanism characterized by binding of free double-stranded (ds) DNA from the environment to the cell pole in rod-shaped bacteria. In Bacillus subtilis some competence proteins, which process the dsDNA and translocate single-stranded (ss) DNA into the cytosol, recruit a set of recombination proteins mainly to one of the cell poles. A subset of single-stranded binding proteins, working as "guardians", protects ssDNA from degradation and limit the RecA recombinase loading. Then, the "mediators" overcome the inhibitory role of guardians, and recruit RecA onto ssDNA. A RecA·ssDNA filament searches for homology on the chromosome and, in a process that is controlled by "modulators", catalyzes strand invasion with the generation of a displacement loop (D-loop). A D-loop resolvase or "resolver" cleaves this intermediate, limited DNA replication restores missing information and a DNA ligase seals the DNA ends. However, if any step fails, the "rescuers" will repair the broken end to rescue chromosomal transformation. If the ssDNA does not share homology with resident DNA, but it contains information for autonomous replication, guardian and mediator proteins catalyze plasmid establishment after inhibition of RecA. DNA replication and ligation reconstitute the molecule (plasmid transformation). In this review, the interacting network that leads to a cross talk between proteins of the uptake and genetic recombination machinery will be placed into prospective.
Purification and biochemical characterization of Mur ligases from Staphylococcus aureus.
Patin, Delphine; Boniface, Audrey; Kovač, Andreja; Hervé, Mireille; Dementin, Sébastien; Barreteau, Hélène; Mengin-Lecreulx, Dominique; Blanot, Didier
2010-12-01
The Mur ligases (MurC, MurD, MurE and MurF) catalyze the stepwise synthesis of the UDP-N-acetylmuramoyl-pentapeptide precursor of peptidoglycan. The mur