WorldWideScience

Sample records for phytochelatin synthase ljpcs3

  1. Phytochelatin synthase activity as a marker of metal pollution

    Energy Technology Data Exchange (ETDEWEB)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Adam, Vojtech [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic); Zehnalek, Josef; Beklova, Miroslava [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Kizek, Rene, E-mail: kizek@sci.muni.cz [Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1, CZ-613 00 Brno (Czech Republic); Central European Institute of Technology, Brno University of Technology, Technicka 3058/10, CZ-616 00 Brno (Czech Republic)

    2011-08-30

    Highlights: {yields} New tool for determination of phytochelatin synthase activity. {yields} The optimization of experimental condition for determination of the enzyme activity. {yields} First evaluation of K{sub m} for the enzyme. {yields} The effects of cadmium (II) not only on the activity of the enzyme but also on K{sub m}. -- Abstract: The synthesis of phytochelatins is catalyzed by {gamma}-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO{sub 3}){sub 2} for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 {sup o}C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K{sub m} for PCS was estimated as 2.3 mM.

  2. Phytochelatin synthase activity as a marker of metal pollution

    International Nuclear Information System (INIS)

    Zitka, Ondrej; Krystofova, Olga; Sobrova, Pavlina; Adam, Vojtech; Zehnalek, Josef; Beklova, Miroslava; Kizek, Rene

    2011-01-01

    Highlights: → New tool for determination of phytochelatin synthase activity. → The optimization of experimental condition for determination of the enzyme activity. → First evaluation of K m for the enzyme. → The effects of cadmium (II) not only on the activity of the enzyme but also on K m . -- Abstract: The synthesis of phytochelatins is catalyzed by γ-Glu-Cys dipeptidyl transpeptidase called phytochelatin synthase (PCS). Aim of this study was to suggest a new tool for determination of phytochelatin synthase activity in the tobacco BY-2 cells treated with different concentrations of the Cd(II). After the optimization steps, an experiment on BY-2 cells exposed to different concentrations of Cd(NO 3 ) 2 for 3 days was performed. At the end of the experiment, cells were harvested and homogenized. Reduced glutathione and cadmium (II) ions were added to the cell suspension supernatant. These mixtures were incubated at 35 o C for 30 min and analysed using high performance liquid chromatography coupled with electrochemical detector (HPLC-ED). The results revealed that PCS activity rises markedly with increasing concentration of cadmium (II) ions. The lowest concentration of the toxic metal ions caused almost three fold increase in PCS activity as compared to control samples. The activity of PCS (270 fkat) in treated cells was more than seven times higher in comparison to control ones. K m for PCS was estimated as 2.3 mM.

  3. Enhanced Toxic Metal Accumulation in Engineered Bacterial Cells Expressing Arabidopsis thaliana Phytochelatin Synthase

    Science.gov (United States)

    Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles

    2003-01-01

    Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032

  4. Sub-lethal cadmium exposure increases phytochelatin concentrations in the aquatic snail Lymnaea stagnalis

    Energy Technology Data Exchange (ETDEWEB)

    SF, Gonçalves [Department of Biology & CESAM, Centre for Environmental and Marine Studies, University of Aveiro, 3810-193 Aveiro (Portugal); SK, Davies [Department of Surgery and Cancer, Imperial College London, Sir Alexander Fleming Building, London SW7 2AZ (United Kingdom); Bennett, M. [Department of Life Sciences, Imperial College London, Sir Alexander Fleming Building, London SW7 2AZ (United Kingdom); Raab, A.; Feldmann, J. [TESLA, Department of Chemistry, University of Aberdeen, Meston Walk, Aberdeen AB24 3UE, Scotland (United Kingdom); Kille, P. [Cardiff School of Biosciences, Cardiff University, Park Place, Cardiff CF10 3US (United Kingdom); Loureiro, S. [Department of Biology & CESAM, Centre for Environmental and Marine Studies, University of Aveiro, 3810-193 Aveiro (Portugal); DJ, Spurgeon [Centre for Ecology and Hydrology, Maclean Building, Benson Lane, Wallingford OX10 8BB (United Kingdom); JG, Bundy, E-mail: j.bundy@imperial.ac.uk [Department of Surgery and Cancer, Imperial College London, Sir Alexander Fleming Building, London SW7 2AZ (United Kingdom)

    2016-10-15

    Phytochelatins are metal-binding metabolites found in almost all plant species and some animal groups, including nematodes and annelids, where they can play an important role in detoxifying metals such as cadmium. Species from several other taxa contain a phytochelatin synthase (PCS) gene orthologue, including molluscs, indicating they may have the potential to synthesize phytochelatins. However, the presence of a gene alone does not demonstrate that it plays a functional role in metal detoxification. In the present study, we show that the aquatic snail Lymnaea stagnalis produced both penta- and heptapeptide phytochelatins (i.e. phytochelatin-2 and phytochelatin-3), and their levels increased in response to sub-lethal levels of cadmium. - Highlights: • Little is known about the role of phytochelatins in metal detoxification in animals. • We detected phytochelatins (PC{sub 2} and PC{sub 3}) in a mollusc species, Lymnaea stagnalis. • Phytochelatins increased in Lymnaea stagnalis when exposed to cadmium. • Future research on phytochelatin responses in molluscs would be valuable.

  5. Tentative identification of the second substrate binding site in Arabidopsis phytochelatin synthase.

    Directory of Open Access Journals (Sweden)

    Ju-Chen Chia

    Full Text Available Phytochelatin synthase (PCS uses the substrates glutathione (GSH, γGlu-Cys-Gly and a cadmium (Cd-bound GSH (Cd∙GS2 to produce the shortest phytochelatin product (PC2, (γGlu-Cys2-Gly through a ping-pong mechanism. The binding of the 2 substrates to the active site, particularly the second substrate binding site, is not well-understood. In this study, we generated a structural model of the catalytic domain of Arabidopsis AtPCS1 (residues 12-218 by using the crystal structure of the γGlu-Cys acyl-enzyme complex of the PCS of the cyanobacterium Nostoc (NsPCS as a template. The modeled AtPCS1 revealed a cavity in proximity to the first substrate binding site, consisting of 3 loops containing several conserved amino acids including Arg152, Lys185, and Tyr55. Substitutions of these amino acids (R152K, K185R, or double mutation resulted in the abrogation of enzyme activity, indicating that the arrangement of these 2 positive charges is crucial for the binding of the second substrate. Recombinant AtPCS1s with mutations at Tyr55 showed lower catalytic activities because of reduced affinity (3-fold for Y55W for the Cd∙GS2, further suggesting the role of the cation-π interaction in recognition of the second substrate. Our study results indicate the mechanism for second substrate recognition in PCS. The integrated catalytic mechanism of PCS is further discussed.

  6. Zinc affects differently growth, photosynthesis, antioxidant enzyme activities and phytochelatin synthase expression of four marine diatoms.

    Science.gov (United States)

    Nguyen-Deroche, Thi Le Nhung; Caruso, Aurore; Le, Thi Trung; Bui, Trang Viet; Schoefs, Benoît; Tremblin, Gérard; Morant-Manceau, Annick

    2012-01-01

    Zinc-supplementation (20 μM) effects on growth, photosynthesis, antioxidant enzyme activities (superoxide dismutase, ascorbate peroxidase, catalase), and the expression of phytochelatin synthase gene were investigated in four marine diatoms (Amphora acutiuscula, Nitzschia palea, Amphora coffeaeformis and Entomoneis paludosa). Zn-supplementation reduced the maximum cell density. A linear relationship was found between the evolution of gross photosynthesis and total chlorophyll content. The Zn treatment decreased the electron transport rate except in A. coffeaeformis and in E. paludosa at high irradiance. A linear relationship was found between the efficiency of light to evolve oxygen and the size of the light-harvesting antenna. The external carbonic anhydrase activity was stimulated in Zn-supplemented E. paludosa but was not correlated with an increase of photosynthesis. The total activity of the antioxidant enzymes did not display any clear increase except in ascorbate peroxidase activity in N. palea. The phytochelatin synthase gene was identified in the four diatoms, but its expression was only revealed in N. palea, without a clear difference between control and Zn-supplemented cells. Among the four species, A. paludosa was the most sensitive and A. coffeaeformis, the most tolerant. A. acutiuscula seemed to be under metal starvation, whereas, to survive, only N. palea developed several stress responses.

  7. Zinc Affects Differently Growth, Photosynthesis, Antioxidant Enzyme Activities and Phytochelatin Synthase Expression of Four Marine Diatoms

    Directory of Open Access Journals (Sweden)

    Thi Le Nhung Nguyen-Deroche

    2012-01-01

    Full Text Available Zinc-supplementation (20 μM effects on growth, photosynthesis, antioxidant enzyme activities (superoxide dismutase, ascorbate peroxidase, catalase, and the expression of phytochelatin synthase gene were investigated in four marine diatoms (Amphora acutiuscula, Nitzschia palea, Amphora coffeaeformis and Entomoneis paludosa. Zn-supplementation reduced the maximum cell density. A linear relationship was found between the evolution of gross photosynthesis and total chlorophyll content. The Zn treatment decreased the electron transport rate except in A. coffeaeformis and in E. paludosa at high irradiance. A linear relationship was found between the efficiency of light to evolve oxygen and the size of the light-harvesting antenna. The external carbonic anhydrase activity was stimulated in Zn-supplemented E. paludosa but was not correlated with an increase of photosynthesis. The total activity of the antioxidant enzymes did not display any clear increase except in ascorbate peroxidase activity in N. palea. The phytochelatin synthase gene was identified in the four diatoms, but its expression was only revealed in N. palea, without a clear difference between control and Zn-supplemented cells. Among the four species, A. paludosa was the most sensitive and A. coffeaeformis, the most tolerant. A. acutiuscula seemed to be under metal starvation, whereas, to survive, only N. palea developed several stress responses.

  8. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

    2014-01-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  9. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  10. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-01-01

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  11. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  12. Effect of glutathione on phytochelatin synthesis in tomato cells. [Lycopersicon esculentum

    Energy Technology Data Exchange (ETDEWEB)

    Mendum, M.L.; Gupta, S.C.; Goldsbrough, P.B. (Purdue Univ., West Lafayette, IN (USA))

    1990-06-01

    Growth of cell suspension cultures of tomato, Lycopersicon esculentum Mill. cv VFNT-Cherry, in the presence of cadmium is inhibited by buthionine sulfoximine, an inhibitor of glutathione synthesis. Cell growth and phytochelatin synthesis are restored to cells treated with buthionine sulfoximine by the addition of glutathione to the medium. Glutathione stimulates the accumulation of phytochelatins in cadmium treated cells, indicating that availability of glutathione can limit synthesis of these peptides. Exogenous glutathione causes a disproportionate increase in the level of smaller phytochelatins, notably ({gamma}-Glu-Cys){sub 2}-Gly. In the presence of buthionine sulfoximine and glutathione, phytochelatins that are produced upon exposure to cadmium incorporate little ({sup 35}S)cysteine, indicating that these peptides are probably not synthesized by sequential addition of cysteine and glutamate to glutathione.

  13. Arsenate tolerance in Silene paradoxa does not rely on phytochelatin-dependent sequestration

    International Nuclear Information System (INIS)

    Arnetoli, Miluscia; Vooijs, Riet; Bookum, Wilma ten; Galardi, Francesca; Gonnelli, Cristina; Gabbrielli, Roberto; Schat, Henk; Verkleij, Jos A.C.

    2008-01-01

    Arsenate tolerance, As accumulation and As-induced phytochelatin accumulation were compared in populations of Silene paradoxa, one from a mine site enriched in As, Cu and Zn, the other from an uncontaminated site. The mine population was significantly more arsenate-tolerant. Arsenate uptake and root-to-shoot transport were slightly but significantly higher in the non-mine plants. The difference in uptake was quantitatively insufficient to explain the difference in tolerance between the populations. As accumulation in the roots was similar in both populations, but the mine plants accumulated much less phytochelatins than the non-mine plants. The mean phytochelatin chain length, however, was higher in the mine population, possibly due to a constitutively lower cellular glutathione level. It is argued that the mine plants must possess an arsenic detoxification mechanism other than arsenate reduction and subsequent phytochelatin-based sequestration. This alternative mechanism might explain at least some part of the superior tolerance in the mine plants. - Neither decreased uptake nor phytochelatins seem to play a role in the As tolerance in Silene paradoxa

  14. Phytochelatin and cadmium accumulation in wheat.

    NARCIS (Netherlands)

    Stolt, J.P.; Sneller, F.E.C.; Bryngelson, T.; Lundborg, T.; Schat, H.

    2003-01-01

    Cadmium (Cd) is a nonessential heavy metal that can be harmful at low concentrations in organisms. Therefore, it is necessary to decrease Cd accumulation in the grains of wheats aimed for human consumption. In response to Cd, higher plants synthesize sulphur-rich peptides, phytochelatins (PCs).

  15. Phytochelatins play a key role in arsenic accumulation and tolerance in the aquatic macrophyte Wolffia globosa

    International Nuclear Information System (INIS)

    Zhang Xin; Uroic, M. Kalle; Xie Wanying; Zhu Yongguan; Chen Baodong; McGrath, Steve P.; Feldmann, Jörg; Zhao Fangjie

    2012-01-01

    The rootless duckweed Wolffia globosa can accumulate and tolerate relatively large amounts of arsenic (As); however, the underlying mechanisms were unknown. W. globosa was exposed to different concentrations of arsenate with or without L-buthionine sulphoximine (BSO), a specific inhibitor of γ-glutamylcysteine synthetase. Free thiol compounds and As(III)–thiol complexes were identified and quantified using HPLC – high resolution ICP-MS – accurate mass ESI-MS. Without BSO, 74% of the As accumulated in the duckweed was complexed with phytochelatins (PCs), with As(III)–PC 4 and As(III)–PC 3 being the main species. BSO was taken up by the duckweed and partly deaminated. The BSO treatment completely suppressed the synthesis of PCs and the formation of As(III)–PC complexes, and also inhibited the reduction of arsenate to arsenite. BSO markedly decreased both As accumulation and As tolerance in W. globosa. The results demonstrate an important role of PCs in detoxifying As and enabling As accumulation in W. globosa. - Highlights: ► W. globosa can accumulate and tolerate relatively large amounts of arsenic. ► Majority of the As accumulated in W. globosa was complexed with phytochelatins (PCs). ► As(III)–PC 4 and As(III)–PC 3 are the main complex species. ► Complexation of arsenite with phytochelatins plays a key role in As tolerance and accumulation. - Complexation of arsenite with phytochelatins plays a key role in both arsenic tolerance and accumulation in the aquatic macrophyte Wolffia globosa.

  16. Different response of phytochelatins in two aquatic macrophytes ...

    African Journals Online (AJOL)

    Phytochelatins (PCs) have been proposed as potential biomarkers for an evaluation of metal toxicity. However, most studies have been generally limited to high concentrations of metals. In this study, two submerged macrophytes Ceratophyllum demersum L. and Elodea canadensis Michx. were adopted to investigate the ...

  17. Phytochelatin homologs induced in hairy roots of horseradish.

    Science.gov (United States)

    Kubota, H; Sato, K; Yamada, T; Maitani, T

    2000-01-01

    When exposed to excess heavy metals, plants induce phytochelatins and related peptides (all designated as PCAs). Thus, when hairy roots of horseradish (Armoracia rusticana) were exposed for 3 days to cadmium (1 mM) along with reduced glutathione (2 mM), PCA induction occurred. Moreover, a new family of thiol peptides was detected as well as the previously known PCAs, as revealed by postcolumn-derivatization HPLC. Two were isolated and their structures were identified as (gamma-Glu-Cys)n-Gln (n = 3 and 4) by electrospray ionization-mass spectrometer spectra, this being confirmed by chemical synthesis of the peptides. These new analogs constitute the sixth PCA family identified to date.

  18. CELL-SURFACE DISPLAY OF SYNTHETIC PHYTOCHELATINS USING ICE NUCLEATION PROTEIN FOR ENHANCED HEAVY-METAL BIOACCUMULATION. (R827227)

    Science.gov (United States)

    Synthetic phytochelatins (ECs) composed of (Glu–Cys)nGly are protein analogs of phytochelatin that exhibit improved metal-binding capacity over metallothioneins (MTs). Expression of EC20 on the surface of E. coli using the Lpp-OmpA anchor resulted in i...

  19. Role of metal mixtures (Ca, Cu and Pb) on Cd bioaccumulation and phytochelatin production by Chlamydomonas reinhardtii

    International Nuclear Information System (INIS)

    Abboud, Pauline; Wilkinson, Kevin J.

    2013-01-01

    The goal of the study was to determine whether metal uptake and biological effects could be predicted by free ion concentrations when organisms were exposed to Cd and a second metal. Bioaccumulation and algal phytochelatin (PC) concentrations were determined for Chlamydomonas reinhardtii following a 6-h exposure. Bioaccumulation results, after six hours of exposure, showed that Cd uptake decreased in the presence of relatively high concentrations of Ca, Cu and Pb, however, Cd bioaccumulation increased in the presence of ca. equimolar concentrations of Cu. A good correlation was observed between the production of PCs and the amount of metals bioaccumulated for the binary mixtures of Cd–Pb and Cd–Cu, but not the Cd–Ca mixture. Overall, the results suggested that, in the case of mixtures, bioaccumulated metal rather than free ion concentrations would be a better predictor of biological effect. -- Highlights: •Cd bioaccumulation and phytochelatin production were evaluated for metal mixtures. •Bioaccumulated metal rather than free ion was a better predictor of biological effect. •Calcium additions decreased Cd bioaccumulation but increased phytochelatin production. •Copper additions increased Cd bioaccumulation and phytochelatin production. •Lead additions had little effect on either Cd bioaccumulation or phytochelatin production. -- In metal mixtures containing Cd and Ca, Pb or Cu, bioaccumulated metal rather than free ion was a better predictor of biological effect

  20. First report of phytochelatins in a mushroom: induction of phytochelatins by metal exposure in Boletus edulis.

    Science.gov (United States)

    Collin-Hansen, Christian; Pedersen, Sindre A; Andersen, Rolf A; Steinnes, Eiliv

    2007-01-01

    Some species of macromycetes (mushrooms) consistently are found to contain high concentrations of toxic metals such as cadmium (Cd) and mercury (Hg), and consumption of wild-growing mushrooms is acknowledged as a significant source for Cd and Hg in humans. Yet little is known about the speciation of Cd and Hg in mushroom tissues. Here we present the first evidence of peptides of the phytochelatin family being responsible for binding a large fraction of Cd in caps of the macromycete Boletus edulis exposed to excess metals. Concentrations of Cd, Zn, Cu and Hg, as well as cytosolic Cd-binding capacity (CCBC), glutathione (GSH) and free proline (Pro) were quantified in fruiting bodies of B. edulis differentially exposed to a wide range of metals. Metal distribution among cytosolic compounds were investigated by size exclusion chromatography (SEC), followed by metal determinations with atomic absorption chromatography (AAS) and HR-ICP-MS. Cd-binding compounds in SEC elutates were investigated further by high performance liquid chromatography-mass spectrometry (HPLC-MS). CCBC was >90 times higher in the exposed group relative to the reference group (Mann-Whitney's P < 0.001), whereas concentrations of free Pro were almost identical for the two groups. For the whole study selection, CCBC correlated positively with metal exposure (Spearman's P < 0.001 for all four metals), suggesting dose-dependent induction of Cd-binding compounds by exposure to these metals, possibly as a defense mechanism. The presence of phytochelatins (PCs), a family of cystein-rich oligopeptides, was confirmed in Cd-containing SEC fractions by HPLC-MS. The appearance of more complex PCs was coupled to declining concentrations of GSH. To our knowledge this is the first report demonstrating the presence of PCs in a macromycete.

  1. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Science.gov (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  2. Cadmium induces a novel metallothionein and phytochelatin 2 in an aquatic fungus

    International Nuclear Information System (INIS)

    Jaeckel, Petra; Krauss, Gudrun; Menge, Sieglinde; Schierhorn, Angelika; Ruecknagel, Peter; Krauss, Gerd-Joachim

    2005-01-01

    Cadmium stress response was measured at the thiol peptide level in an aquatic hyphomycete (Heliscus lugdunensis). In liquid culture, 0.1mM cadmium increased the glutathione (GSH) content and induced the synthesis of additional thiol peptides. HPLC, electrospray ionization mass spectrometry, and Edman degradation confirmed that a novel small metallothionein as well as phytochelatin (PC2) were synthesized. The metallothionein has a high homology to family 8 metallothioneins (http://www.expasy.ch/cgi-bin/lists?metallo.txt). The bonding of at least two cadmium ions to the metallothionein was demonstrated by mass spectrometry (MALDI MS). This is the first time that simultaneous induction of metallothionein and phytochelatin accompanied by an increase in GSH level has been shown in a fungus under cadmium stress, indicating a potential function of these complexing agents for in vivo heavy metal detoxification. The method presented here should be applicable as biomarker tool. ol

  3. [The role of Cd-binding proteins and phytochelatins in the formation of cadmium resistance in Nicotiana plumbaginifolia cell lines].

    Science.gov (United States)

    Fenik, S I; Solodushko, V G; Kaliniak, T B; Blium, Ia B

    2007-01-01

    Nicotiana plumbaginifolia callus lines with the equal resistance to cadmium have been produced under different selective conditions--either without inhibition of the phytochelatin synthesis (line Cd-R) or in the presence of the inhibitor butionine sulfoximine (line Cd-Ri). The level of phytochelatin synthesis in the line Cd-R five-fold exceeded the control value and in the line Cd-Ri it was twice as much as in the control. It was shown that in the control line mainly three cadmium-binding proteins are expressed of the molecular weihgts 41, 34 and 19 kD. The common feature of the both resistant lines is the expression of the cadmium-binding proteins of 40, 37 and 19 kD. The resistant lines differ with respect to the synthesis of relatively low-molecular cadmium-binding proteins. The proteins of the molecular weights 12.5, 11.5 and 9 kD are expressed in the line Cd-R, while the proteins of 13 and 10 kD are expressed in the line Cd-Ri. It was supposed that both the phytochelatins and the Cd-binding proteins contribute to the resisitance of N. plumbaginifolia callus lines to cadmium and the lack of the phytochelatins can be equilibrated by the changes in the low-molecular Cd-binding protein synthesis.

  4. Biomonitoring for metal contamination near two Superfund sites in Woburn, Massachusetts, using phytochelatins

    International Nuclear Information System (INIS)

    Gawel, James E.; Hemond, Harold F.

    2004-01-01

    Characterizing the spatial extent of groundwater metal contamination traditionally requires installing sampling wells, an expensive and time-consuming process in urban areas. Moreover, extrapolating biotic effects from metal concentrations alone is problematic, making ecological risk assessment difficult. Our study is the first to examine the use of phytochelatin measurements in tree leaves for delimiting biological metal stress in shallow, metal-contaminated groundwater systems. Three tree species (Rhamnus frangula, Acer platanoides, and Betula populifolia) growing above the shallow groundwater aquifer of the Aberjona River watershed in Woburn, Massachusetts, display a pattern of phytochelatin production consistent with known sources of metal contamination and groundwater flow direction near the Industri-Plex Superfund site. Results also suggest the existence of a second area of contaminated groundwater and elevated metal stress near the Wells G and H Superfund site downstream, in agreement with a recent EPA ecological risk assessment. Possible contamination pathways at this site are discussed

  5. Carbon nanotubes and graphene modified screen-printed carbon electrodes as sensitive sensors for the determination of phytochelatins in plants using liquid chromatography with amperometric detection.

    Science.gov (United States)

    Dago, Àngela; Navarro, Javier; Ariño, Cristina; Díaz-Cruz, José Manuel; Esteban, Miquel

    2015-08-28

    Nanomaterials are of great interest for the development of electrochemical sensors. Multi-walled carbon nanotubes and graphene were used to modify the working electrode surface of different screen-printed carbon electrodes (SPCE) with the aim of improving the sensitivity of the SPCE and comparing it with the conventional glassy carbon electrode. To assay the usability of these sensors, a HPLC methodology with amperometric detection was developed to analyze several phytochelatins in plants of Hordeum vulgare and Glycine max treated with Hg(II) or Cd(II) giving detection limits in the low μmolL(-1) range. Phytochelatins are low molecular weight peptides with the general structure γ-(Glu-Cys)n-Gly (n=2-5) which are synthesized in plants in the presence of heavy metal ions. These compounds can chelate heavy metal ions by the formation of complexes which, are transported to the vacuoles, where the toxicity is not threatening. For this reason phytochelatins are essential in the detoxification of heavy metal ions in plants. The developed HPLC method uses a mobile phase of 1% of formic acid in water with KNO3 or NaCl (pH=2.00) and 1% of formic acid in acetonitrile. Electrochemical detection at different carbon-based electrodes was used. Among the sensors tested, the conventional glassy carbon electrode offers the best sensitivity although modification improves the sensitivity of the SPCE. Glutathione and several isoforms of phytochelatin two were found in plant extracts of both studied species. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Electrochemical behavior of phytochelatins and related peptides at the hanging mercury drop electrode in the presence of cobalt(II) ions.

    Science.gov (United States)

    Dorcák, Vlastimil; Sestáková, Ivana

    2006-01-01

    Direct current voltammetry and differential pulse voltammetry have been used to investigate the electrochemical behaviour of two phytochelatins: heptapeptide (gamma-Glu-Cys)3-Gly and pentapeptide (gamma-Glu-Cys)2-Gly, tripeptide glutathione gamma-Glu-Cys-Gly and its fragments: dipeptides Cys-Gly and gamma-Glu-Cys at the hanging mercury drop electrode in the presence of cobalt(II) ions. Most interesting results were obtained with direct current voltammetry in the potential region of -0.80 V up to -1.80 V. Differential pulse voltammetry of the same solutions of Co(II) with peptides gives more complicated voltammograms with overlapping peaks, probably in connection with the influence of adsorption at slow scan rates necessarily used in this method. However, in using Brdicka catalytic currents for analytical purposes, differential pulse voltammograms seem to be more helpful. Presented investigations have shown that particularly the prewave of cobalt(II) allows distinguishing among phytochelatins, glutathione, and its fragments.

  7. Detoxification of Arsenic by Phytochelatins in Plants1

    Science.gov (United States)

    Schmöger, Marcus E.V.; Oven, Matjaz; Grill, Erwin

    2000-01-01

    As is a ubiquitous element present in the atmosphere as well as in the aquatic and terrestrial environments. Arsenite and arsenate are the major forms of As intoxication, and these anions are readily taken up by plants. Both anions efficiently induce the biosynthesis of phytochelatins (PCs) ([γ-glutamate-cysteine]n-glycine) in vivo and in vitro. The rapid induction of the metal-binding PCs has been observed in cell suspension cultures of Rauvolfia serpentina, in seedlings of Arabidopsis, and in enzyme preparations of Silene vulgaris upon challenge to arsenicals. The rate of PC formation in enzyme preparations was lower compared with Cd-induced biosynthesis, but was accompanied by a prolonged induction phase that resulted finally in higher peptide levels. An approximately 3:1 ratio of the sulfhydryl groups from PCs to As is compatible with reported As-glutathione complexes. The identity of the As-induced PCs and of reconstituted metal-peptide complexes has unequivocally been demonstrated by electrospray ionization mass spectroscopy. Gel filtration experiments and inhibitor studies also indicate a complexation and detoxification of As by the induced PCs. PMID:10712543

  8. Phytochelatin Modified Electrode Surface as a Sensitive Heavy- Metal Ion Biosensor

    Directory of Open Access Journals (Sweden)

    Rene Kizek

    2005-02-01

    Full Text Available Electrochemical biosensors have superior properties over other existingmeasurement systems because they can provide rapid, simple and low-cost on-fielddetermination of many biological active species and a number of dangerous pollutants. Inour work, we suggested a new heavy metal biosensor based on interaction of heavy metalions (Cd2+ and Zn2+ with phytochelatin, which was adsorbed on the surface of the hangingmercury drop electrode, using adsorptive transfer stripping differential pulse voltammetry.In addition, we applied the suggested technique for the determination of heavy metals in abiological sample – human urine and platinum in a pharmaceutical drug. The detectionlimits (3 S/N of Cd(II, Zn(II and cis-platin were about 1.0, 13.3 and 1.9 pmole in 5 μl,respectively. On the basis of the obtained results, we propose that the suggested techniqueoffers simple, rapid, and low-cost detection of heavy metals in environmental, biologicaland medical samples.

  9. Platelet-derived growth factor (PDGF) stimulates glycogen synthase activity in 3T3 cells

    International Nuclear Information System (INIS)

    Chan, C.P.; Bowen-Pope, D.F.; Ross, R.; Krebs, E.G.

    1986-01-01

    Hormonal regulation of glycogen synthase, an enzyme that can be phosphorylated on multiple sites, is often associated with changes in its phosphorylation state. Enzyme activation is conventionally monitored by determining the synthase activity ratio [(activity in the absence of glucose 6-P)/(activity in the presence of glucose 6-P)]. Insulin causes an activation of glycogen synthase with a concomitant decrease in its phosphate content. In a previous report, the authors showed that epidermal growth factor (EGF) increases the glycogen synthase activity ratio in Swiss 3T3 cells. The time and dose-dependency of this response was similar to that of insulin. Their recent results indicate that PDGF also stimulates glycogen synthase activity. Enzyme activation was maximal after 30 min. of incubation with PDGF; the time course observed was very similar to that with insulin and EGF. At 1 ng/ml (0.03nM), PDGF caused a maximal stimulation of 4-fold in synthase activity ratio. Half-maximal stimulation was observed at 0.2 ng/ml (6 pM). The time course of changes in enzyme activity ratio closely followed that of 125 I-PDGF binding. The authors data suggest that PDGF, as well as EFG and insulin, may be important in regulating glycogen synthesis through phosphorylation/dephosphorylation mechanisms

  10. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    International Nuclear Information System (INIS)

    Dotson, G.D.; Woodard, R.W.

    1994-01-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

  11. Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)

    1994-12-01

    The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

  12. The phytochelatin transporters AtABCC1 and AtABCC2 mediate tolerance to cadmium and mercury.

    Science.gov (United States)

    Park, Jiyoung; Song, Won-Yong; Ko, Donghwi; Eom, Yujin; Hansen, Thomas H; Schiller, Michaela; Lee, Tai Gyu; Martinoia, Enrico; Lee, Youngsook

    2012-01-01

    Heavy metals such as cadmium (Cd) and mercury (Hg) are toxic pollutants that are detrimental to living organisms. Plants employ a two-step mechanism to detoxify toxic ions. First, phytochelatins bind to the toxic ion, and then the metal-phytochelatin complex is sequestered in the vacuole. Two ABCC-type transporters, AtABCC1 and AtABCC2, that play a key role in arsenic detoxification, have recently been identified in Arabidopsis thaliana. However, it is unclear whether these transporters are also implicated in phytochelatin-dependent detoxification of other heavy metals such as Cd(II) and Hg(II). Here, we show that atabcc1 single or atabcc1 atabcc2 double knockout mutants exhibit a hypersensitive phenotype in the presence of Cd(II) and Hg(II). Microscopic analysis using a Cd-sensitive probe revealed that Cd is mostly located in the cytosol of protoplasts of the double mutant, whereas it occurs mainly in the vacuole of wild-type cells. This suggests that the two ABCC transporters are important for vacuolar sequestration of Cd. Heterologous expression of the transporters in Saccharomyces cerevisiae confirmed their role in heavy metal tolerance. Over-expression of AtABCC1 in Arabidopsis resulted in enhanced Cd(II) tolerance and accumulation. Together, these results demonstrate that AtABCC1 and AtABCC2 are important vacuolar transporters that confer tolerance to cadmium and mercury, in addition to their role in arsenic detoxification. These transporters provide useful tools for genetic engineering of plants with enhanced metal tolerance and accumulation, which are desirable characteristics for phytoremediation. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  13. The primary defect in glycogen synthase activity is not based on increased glycogen synthase kinase-3a activity in diabetic myotubes

    DEFF Research Database (Denmark)

    Gaster, Michael; Brusgaard, Klaus; Handberg, Aa.

    2004-01-01

    The mechanism responsible for the diminished activation of glycogen synthase (GS) in diabetic myotubes remains unclear, but may involve increased activity and/or expression of glycogen synthase kinase-3 (GSK-3). In myotubes established from type 2 diabetic and healthy control subjects we determined...

  14. Cadmium-induced production of phytochelatins and speciation of intracellular cadmium in organs of Linum usitatissimum seedlings

    Czech Academy of Sciences Publication Activity Database

    Najmanová, J.; Neumannová, E.; Leonhardt, T.; Zítka, O.; Kižek, R.; Macek, Tomáš; Macková, M.; Kotrba, P.

    2012-01-01

    Roč. 36, č. 1 (2012), s. 536-542 ISSN 0926-6690 R&D Projects: GA MŠk 1M06030 Grant - others:GA ČR(CZ) GA522/07/0692 Institutional research plan: CEZ:AV0Z40550506 Keywords : flax * cadmium * heavy metal tolerance * phytochelatins * phytoremediation Subject RIV: EI - Biotechnology ; Bionics Impact factor: 2.468, year: 2012

  15. Effects of cadmium exposure on phytochelatin and the synthesis of abscisic acid in funalia trogii

    Energy Technology Data Exchange (ETDEWEB)

    Yuerekli, F.; Porgali, Z.B. [Inonu University, Arts and Science Faculty, Department of Biology, 44069 Malatya (Turkey); Uenyayar, A.; Mazmanci, M.A. [Mersin University, Engineering Faculty, Engineering Faculty, 33000 Mersin (Turkey)

    2004-08-01

    Heavy metal toxicity poses major environmental and health problems as heavy metals are more difficult to remediate than chemical contaminants, which can be degraded by microorganisms. Phytochelatins are formed in plants and some fungi upon exposure to a range of different heavy metals. Fungi show sensitivity to many environmental factors, including nutrient limitation, changes in carbon sources and heavy metal exposure. (Abstract Copyright [2004], Wiley Periodicals, Inc.)

  16. Glycogen Synthase Kinase-3β

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Lenskjold, Toke; Jacoby, Anne Sophie

    2016-01-01

    cells were quantitated using enzyme immunometric assays. The activity of GSK-3β (serine-9-phosphorylated GSK-3β/total GSK-3β) was lower at baseline compared with follow-up. No significant mean change over time was observed in levels of total GSK-3β and serine-9-phosphorylated GSK-3β. Exploratory......Evidence indicates a role for glycogen synthase kinase-3β (GSK-3β) in the pathophysiology of mood disorders and in cognitive disturbances; however, the natural variation in GSK-3β activity over time is unknown. We aimed to investigate GSK-3β activity over time and its possible correlation...... with emotional lability, subjective mood fluctuations and cognitive function in healthy individuals. Thirty-seven healthy subjects were evaluated with neuropsychological tests and blood samples at baseline and 12-week follow-up. Total GSK-3β and serine-9-phosphorylated GSK-3β in peripheral blood mononuclear...

  17. Biochemical identification of residues that discriminate between 3,4-dihydroxyphenylalanine decarboxylase and 3,4-dihydroxyphenylacetaldehyde synthase-mediated reactions.

    Science.gov (United States)

    Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong

    2017-12-01

    In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2

  18. Glycogen synthase kinase 3: more than a namesake.

    Science.gov (United States)

    Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit

    2009-03-01

    Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.

  19. Arsenic tolerance in Arabidopsis is mediated by two ABCC-type phytochelatin transporters

    Science.gov (United States)

    Song, Won-Yong; Park, Jiyoung; Mendoza-Cózatl, David G.; Suter-Grotemeyer, Marianne; Shim, Donghwan; Hörtensteiner, Stefan; Geisler, Markus; Weder, Barbara; Rea, Philip A.; Rentsch, Doris; Schroeder, Julian I.; Lee, Youngsook; Martinoia, Enrico

    2010-01-01

    Arsenic is an extremely toxic metalloid causing serious health problems. In Southeast Asia, aquifers providing drinking and agricultural water for tens of millions of people are contaminated with arsenic. To reduce nutritional arsenic intake through the consumption of contaminated plants, identification of the mechanisms for arsenic accumulation and detoxification in plants is a prerequisite. Phytochelatins (PCs) are glutathione-derived peptides that chelate heavy metals and metalloids such as arsenic, thereby functioning as the first step in their detoxification. Plant vacuoles act as final detoxification stores for heavy metals and arsenic. The essential PC–metal(loid) transporters that sequester toxic metal(loid)s in plant vacuoles have long been sought but remain unidentified in plants. Here we show that in the absence of two ABCC-type transporters, AtABCC1 and AtABCC2, Arabidopsis thaliana is extremely sensitive to arsenic and arsenic-based herbicides. Heterologous expression of these ABCC transporters in phytochelatin-producing Saccharomyces cerevisiae enhanced arsenic tolerance and accumulation. Furthermore, membrane vesicles isolated from these yeasts exhibited a pronounced arsenite [As(III)]–PC2 transport activity. Vacuoles isolated from atabcc1 atabcc2 double knockout plants exhibited a very low residual As(III)–PC2 transport activity, and interestingly, less PC was produced in mutant plants when exposed to arsenic. Overexpression of AtPCS1 and AtABCC1 resulted in plants exhibiting increased arsenic tolerance. Our findings demonstrate that AtABCC1 and AtABCC2 are the long-sought and major vacuolar PC transporters. Modulation of vacuolar PC transporters in other plants may allow engineering of plants suited either for phytoremediation or reduced accumulation of arsenic in edible organs. PMID:21078981

  20. Active-site-directed inhibition of 3-hydroxy-3-methylglutaryl coenzyme A synthase by 3-chloropropionyl coenzyme A

    International Nuclear Information System (INIS)

    Miziorko, H.M.; Behnke, C.E.

    1985-01-01

    3-Chloropropionyl coenzyme A (3-chloropropionyl-CoA) irreversibly inhibits avian liver 3-hydroxy-3-methylglutaryl-CoA synthase (HMG-CoA synthase). Enzyme inactivation follows pseudo-first-order kinetics and is retarded in the presence of substrates, suggesting that covalent labeling occurs at the active site. A typical rate saturation effect is observed when inactivation kinetics are measured as a function of 3-chloropropionyl-CoA concentration. These data indicate a Ki = 15 microM for the inhibitor and a limiting kinact = 0.31 min-1. [1- 14 C]-3-Chloropropionyl-CoA binds covalently to the enzyme with a stoichiometry (0.7 per site) similar to that measured for acetylation of the enzyme by acetyl-CoA. While the acetylated enzyme formed upon incubation of HMG-CoA synthase with acetyl-CoA is labile to performic acid oxidation, the adduct formed upon 3-chloropropionyl-CoA inactivation is stable to such treatment. Therefore, such an adduct cannot solely involve a thio ester linkage. Exhaustive Pronase digestion of [ 14 C]-3-chloropropionyl-CoA-labeled enzyme produces a radioactive compound which cochromatographs with authentic carboxyethylcysteine using reverse-phase/ion-pairing high-pressure liquid chromatography and both silica and cellulose thin-layer chromatography systems. This suggests that enzyme inactivation is due to alkylation of an active-site cysteine residue

  1. Pivotal role of glycogen synthase kinase-3: A therapeutic target for Alzheimer's disease.

    Science.gov (United States)

    Maqbool, Mudasir; Mobashir, Mohammad; Hoda, Nasimul

    2016-01-01

    Neurodegenerative diseases are among the most challenging diseases with poorly known mechanism of cause and paucity of complete cure. Out of all the neurodegenerative diseases, Alzheimer's disease is the most devastating and loosening of thinking and judging ability disease that occurs in the old age people. Many hypotheses came forth in order to explain its causes. In this review, we have enlightened Glycogen Synthase Kinase-3 which has been considered as a concrete cause for Alzheimer's disease. Plaques and Tangles (abnormal structures) are the basic suspects in damaging and killing of nerve cells wherein Glycogen Synthase Kinase-3 has a key role in the formation of these fatal accumulations. Various Glycogen Synthase Kinase-3 inhibitors have been reported to reduce the amount of amyloid-beta as well as the tau hyperphosphorylation in both neuronal and nonneuronal cells. Additionally, Glycogen Synthase Kinase-3 inhibitors have been reported to enhance the adult hippocampal neurogenesis in vivo as well as in vitro. Keeping the chemotype of the reported Glycogen Synthase Kinase-3 inhibitors in consideration, they may be grouped into natural inhibitors, inorganic metal ions, organo-synthetic, and peptide like inhibitors. On the basis of their mode of binding to the constituent enzyme, they may also be grouped as ATP, nonATP, and allosteric binding sites competitive inhibitors. ATP competitive inhibitors were known earlier inhibitors but they lack efficient selectivity. This led to find the new ways for the enzyme inhibition. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  2. Changes in phytochelatins and their biosynthetic intermediates in red spruce (Picea rubens Sarg.) cell suspension cultures under cadmium and zinc stress

    Science.gov (United States)

    P. Thangavel; Stephanie Long; Rakesh Minocha

    2007-01-01

    Cell suspension cultures of red spruce (Picea rubens Sarg.) were selected to study the effects of cadmium (Cd) and zinc (Zn) on phytochelatins (PCs) and related metabolites after 24 h exposure. The PC2 and its precursor, γ-glutamylcysteine (γ-EC) increased two to fourfold with Cd concentrations ranging from 12...

  3. Electrochemical behavior of phytochelatins and related peptides at the hanging mercury drop electrode in the presence of cobalt(II) ions

    Czech Academy of Sciences Publication Activity Database

    Dorčák, Vlastimil; Šestáková, Ivana

    2006-01-01

    Roč. 68, 1 (2006), s. 14-21 ISSN 1567-5394 R&D Projects: GA ČR(CZ) GA525/02/0301; GA ČR(CZ) GA204/03/0566 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z40400503 Keywords : phytochelatins * cysteine peptides * voltammetry Subject RIV: BO - Biophysics Impact factor: 1.880, year: 2006

  4. SIRT3 deacetylates ATP synthase F1 complex proteins in response to nutrient- and exercise-induced stress.

    Science.gov (United States)

    Vassilopoulos, Athanassios; Pennington, J Daniel; Andresson, Thorkell; Rees, David M; Bosley, Allen D; Fearnley, Ian M; Ham, Amy; Flynn, Charles Robb; Hill, Salisha; Rose, Kristie Lindsey; Kim, Hyun-Seok; Deng, Chu-Xia; Walker, John E; Gius, David

    2014-08-01

    Adenosine triphosphate (ATP) synthase uses chemiosmotic energy across the inner mitochondrial membrane to convert adenosine diphosphate and orthophosphate into ATP, whereas genetic deletion of Sirt3 decreases mitochondrial ATP levels. Here, we investigate the mechanistic connection between SIRT3 and energy homeostasis. By using both in vitro and in vivo experiments, we demonstrate that ATP synthase F1 proteins alpha, beta, gamma, and Oligomycin sensitivity-conferring protein (OSCP) contain SIRT3-specific reversible acetyl-lysines that are evolutionarily conserved and bind to SIRT3. OSCP was further investigated and lysine 139 is a nutrient-sensitive SIRT3-dependent deacetylation target. Site directed mutants demonstrate that OSCP(K139) directs, at least in part, mitochondrial ATP production and mice lacking Sirt3 exhibit decreased ATP muscle levels, increased ATP synthase protein acetylation, and an exercise-induced stress-deficient phenotype. This work connects the aging and nutrient response, via SIRT3 direction of the mitochondrial acetylome, to the regulation of mitochondrial energy homeostasis under nutrient-stress conditions by deacetylating ATP synthase proteins. Our data suggest that acetylome signaling contributes to mitochondrial energy homeostasis by SIRT3-mediated deacetylation of ATP synthase proteins.

  5. De novo transcriptome analysis of Sinapis alba in revealing the glucosinolate and phytochelatin pathways

    Directory of Open Access Journals (Sweden)

    Xiaohui eZhang

    2016-03-01

    Full Text Available Sinapis alba is an important condiment crop and can also be used as a phytoremediation plant. Though it has important economic and agronomic values, sequence data and the genetic tools are still rare in this plant. In the present study, a de novo transcriptome based on the transcriptions of leaves, stems and roots was assembled for S. alba for the first time. The transcriptome contains 47,972 unigenes with a mean length of 1,185 nt and an N50 of 1,672 nt. Among these unigenes, 46,535 (97% unigenes were annotated by at least one of the following databases: NCBI non-redundant (Nr, Swiss-Prot, Kyoto Encyclopedia of Genes and Genomes (KEGG pathway, Gene Ontology (GO, and Clusters of Orthologous Groups of proteins (COGs. The tissue expression pattern profiles revealed that 3,489, 1,361 and 8,482 unigenes were predominantly expressed in the leaves, stems and roots of S. alba, respectively. Genes predominantly expressed in the leaf were enriched in photosynthesis- and carbon fixation-related pathways. Genes predominantly expressed in the stem were enriched in not only pathways related to sugar, ether lipid and amino acid metabolisms but also plant hormone signal transduction and circadian rhythm pathways, while the root-dominant genes were enriched in pathways related to lignin and cellulose syntheses, involved in plant-pathogen interactions, and potentially responsible for heavy metal chelating and detoxification. Based on this transcriptome, 14,727 simple sequence repeats (SSRs were identified, and 12,830 pairs of primers were developed for 2,522 SSR-containing unigenes. Additionally, the glucosinolate (GSL and phytochelatin metabolic pathways, which give the characteristic flavor and the heavy metal tolerance of this plant, were intensively analyzed. The genes of aliphatic GSLs pathway were predominantly expressed in roots. The absence of aliphatic GSLs in leaf tissues was due to the shutdown of BCAT4, MAM1 and CYP79F1 expressions. Glutathione was

  6. Amaryllidaceae Alkaloids as Potential Glycogen Synthase Kinase-3β Inhibitors

    Directory of Open Access Journals (Sweden)

    Daniela Hulcová

    2018-03-01

    Full Text Available Glycogen synthase kinase-3β (GSK-3β is a multifunctional serine/threonine protein kinase that was originally identified as an enzyme involved in the control of glycogen metabolism. It plays a key role in diverse physiological processes including metabolism, the cell cycle, and gene expression by regulating a wide variety of well-known substances like glycogen synthase, tau-protein, and β-catenin. Recent studies have identified GSK-3β as a potential therapeutic target in Alzheimer´s disease, bipolar disorder, stroke, more than 15 types of cancer, and diabetes. GSK-3β is one of the most attractive targets for medicinal chemists in the discovery, design, and synthesis of new selective potent inhibitors. In the current study, twenty-eight Amaryllidaceae alkaloids of various structural types were studied for their potency to inhibit GSK-3β. Promising results have been demonstrated by alkaloids of the homolycorine-{9-O-demethylhomolycorine (IC50 = 30.00 ± 0.71 µM, masonine (IC50 = 27.81 ± 0.01 μM}, and lycorine-types {caranine (IC50 = 30.75 ± 0.04 μM}.

  7. HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

    Science.gov (United States)

    PORRA, R J; ROSS, B D

    1965-03-01

    1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

  8. Phosphorylation of sites 3 and 2 in rabbit skeletal muscle glycogen synthase by a multifunctional protein kinase (ATP-citrate lyase kinase)

    International Nuclear Information System (INIS)

    Sheorain, V.S.; Ramakrishna, S.; Benjamin, W.B.; Soderling, T.R.

    1985-01-01

    A multifunctional protein kinase, purified from rat liver as ATP-citrate lyase kinase, has been identified as a glycogen synthase kinase. This kinase catalyzed incorporation of up to 1.5 mol of and]2number 2 PO 4 /mol of synthase subunit associated with a decrease in the glycogen synthase activity ratio from 0.85 to a value of 0.15. Approximately 65-70% of the 34 PO 4 was incorporated into site 3 and 30-35% into site 2 as determined by reverse phase high performance liquid chromatography. This multifunctional kinase was distinguished from glycogen synthase kinase-3 on the basis of nucleotide and protein substrate specificities. Since the phosphate contents in glycogen synthase of sites 3 and 2 are altered in diabetes and by insulin administration, the possible involvement of the multifunctional kinase was explored. Glycogen synthase purified from diabetic rabbits was phosphorylated in vitro by this multifunctional kinase at only 10% of the rate compared to synthase purified from control rabbits. Treatment of the diabetics with insulin restored the synthase to a form that was readily phosphorylated in vitro

  9. Role of unsaturated derivatives of spermidine as substrates for spermine synthase and in supporting growth of SV-3T3 cells.

    OpenAIRE

    Pegg, A E; Nagarajan, S; Naficy, S; Ganem, B

    1991-01-01

    Synthetic unsaturated analogues of the natural polyamine were examined as possible substrates for spermine synthase and as replacements for spermidine in supporting the growth of SV-3T3 cells. It was found that N-(3-aminopropyl)-1,4-diamino-cis-but-2-ene [the cis isomer of the alkene analogue of spermidine] was a good substrate for spermine synthase, but that the trans isomer [N-(3-aminopropyl)-1,4-diamino-trans-but-2-ene] and the alkene analogue [N-(3-aminopropyl)-1,4-diaminobut-2-yne] were ...

  10. Analysis of phytochelatin complexes in the lead tolerant vetiver grass [Vetiveria zizanioides (L.)] using liquid chromatography and mass spectrometry

    International Nuclear Information System (INIS)

    Andra, Syam S.; Datta, Rupali; Sarkar, Dibyendu; Saminathan, Sumathi K.M.; Mullens, Conor P.; Bach, Stephan B.H.

    2009-01-01

    Ethylenediamene tetraacetic acid (EDTA) has been used to mobilize soil lead (Pb) and enhance plant uptake for phytoremediation. Chelant bound Pb is considered less toxic compared to free Pb ions and hence might induce less stress on plants. Characterization of possible Pb complexes with phytochelatins (PC n , metal-binding peptides) and EDTA in plant tissues will enhance our understanding of Pb tolerance mechanisms. In a previous study, we showed that vetiver grass (Vetiveria zizanioides L.) can accumulate up to 19,800 and 3350 mg Pb kg -1 dry weight in root and shoot tissues, respectively; in a hydroponics set-up. Following the basic incubation study, a greenhouse experiment was conducted to elucidate the efficiency of vetiver grass (with or without EDTA) in remediating Pb-contaminated soils from actual residential sites where Pb-based paints were used. The levels of total thiols, PC n , and catalase (an antioxidant enzyme) were measured in vetiver root and shoot following chelant-assisted phytostabilization. In the presence of 15 mM kg -1 EDTA, vetiver accumulated 4460 and 480 mg Pb kg -1 dry root and shoot tissue, respectively; that are 15- and 24-fold higher compared to those in untreated controls. Despite higher Pb concentrations in the plant tissues, the amount of total thiols and catalase activity in EDTA treated vetiver tissues was comparable to chelant unamended controls, indicating lowered Pb toxicity by chelation with EDTA. The identification of glutathione (referred as PC 1 ) (m/z 308.2), along with chelated complexes like Pb-EDTA (m/z 498.8) and PC 1 -Pb-EDTA (m/z 805.3) in vetiver root tissue using electrospray tandem mass spectrometry (ES-MS) highlights the possible role of such species towards Pb tolerance in vetiver grass. - Chelated lead in conjunction with phytochelatins synthesis and complexation reduces stress in the lead tolerant vetiver grass.

  11. Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

    International Nuclear Information System (INIS)

    Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra

    2008-01-01

    The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative

  12. Monoterpene synthases from common sage (Salvia officinalis)

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  13. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

    Directory of Open Access Journals (Sweden)

    Linjie Wang

    Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

  14. Glycogen synthase kinase 3α regulates urine concentrating mechanism in mice

    OpenAIRE

    Nørregaard, Rikke; Tao, Shixin; Nilsson, Line; Woodgett, James R.; Kakade, Vijayakumar; Yu, Alan S. L.; Howard, Christiana; Rao, Reena

    2015-01-01

    In mammals, glycogen synthase kinase (GSK)3 comprises GSK3α and GSK3β isoforms. GSK3β has been shown to play a role in the ability of kidneys to concentrate urine by regulating vasopressin-mediated water permeability of collecting ducts, whereas the role of GSK3α has yet to be discerned. To investigate the role of GSK3α in urine concentration, we compared GSK3α knockout (GSK3αKO) mice with wild-type (WT) littermates. Under normal conditions, GSK3αKO mice had higher water intake and urine outp...

  15. Analysis of phytochelatin complexes in the lead tolerant vetiver grass [Vetiveria zizanioides (L.)] using liquid chromatography and mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Andra, Syam S., E-mail: syam.andra@gmail.co [Environmental Geochemistry Laboratory, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX (United States); Datta, Rupali [Biological Sciences, Michigan Technological University, Houghton, MI (United States); Sarkar, Dibyendu [Department of Earth and Environmental Studies, Montclair State University, Montclair, NJ (United States); Saminathan, Sumathi K.M. [Environmental Geochemistry Laboratory, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX (United States); Mullens, Conor P.; Bach, Stephan B.H. [Department of Chemistry, University of Texas at San Antonio, San Antonio, TX (United States)

    2009-07-15

    Ethylenediamene tetraacetic acid (EDTA) has been used to mobilize soil lead (Pb) and enhance plant uptake for phytoremediation. Chelant bound Pb is considered less toxic compared to free Pb ions and hence might induce less stress on plants. Characterization of possible Pb complexes with phytochelatins (PC{sub n}, metal-binding peptides) and EDTA in plant tissues will enhance our understanding of Pb tolerance mechanisms. In a previous study, we showed that vetiver grass (Vetiveria zizanioides L.) can accumulate up to 19,800 and 3350 mg Pb kg{sup -1} dry weight in root and shoot tissues, respectively; in a hydroponics set-up. Following the basic incubation study, a greenhouse experiment was conducted to elucidate the efficiency of vetiver grass (with or without EDTA) in remediating Pb-contaminated soils from actual residential sites where Pb-based paints were used. The levels of total thiols, PC{sub n}, and catalase (an antioxidant enzyme) were measured in vetiver root and shoot following chelant-assisted phytostabilization. In the presence of 15 mM kg {sup -1} EDTA, vetiver accumulated 4460 and 480 mg Pb kg{sup -1} dry root and shoot tissue, respectively; that are 15- and 24-fold higher compared to those in untreated controls. Despite higher Pb concentrations in the plant tissues, the amount of total thiols and catalase activity in EDTA treated vetiver tissues was comparable to chelant unamended controls, indicating lowered Pb toxicity by chelation with EDTA. The identification of glutathione (referred as PC{sub 1}) (m/z 308.2), along with chelated complexes like Pb-EDTA (m/z 498.8) and PC{sub 1}-Pb-EDTA (m/z 805.3) in vetiver root tissue using electrospray tandem mass spectrometry (ES-MS) highlights the possible role of such species towards Pb tolerance in vetiver grass. - Chelated lead in conjunction with phytochelatins synthesis and complexation reduces stress in the lead tolerant vetiver grass.

  16. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  17. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  18. 2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols.

    Science.gov (United States)

    Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak

    2015-01-01

    Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

  19. Involvement of Glycogen Synthase Kinase-3 in the Mechanisms of Conditioned Food Aversion Memory Reconsolidation.

    Science.gov (United States)

    Nikitin, V P; Solntseva, S V; Kozyrev, S A

    2017-02-01

    Experiments were performed on the snails trained in conditioned food aversion for 3 days. Injection of TDZD-8 (glycogen synthase kinase-3 inhibitor, 2 mg/kg) in combination with reminder (presentation of a conditioned food stimulus) led to memory impairment developing 3 days after inhibitor/reminder exposure and followed by spontaneous recovery in 10 days. Injections of TDZD-8 in a dose of 4 or 20 mg/kg before reminder were shown to cause amnesia that persisted for more than 10 days. Memory recovery during repeated training was observed at the earlier period than after initial training. The impairment of memory reconsolidation by TDZD-8 after training of snails for 1 day was less pronounced than under standard training conditions (3 days). The effect of a glycogen synthase kinase-3 inhibitor during memory reconsolidation is probably followed by impairment of memory retrieval and/or partial loss, which can be compensated spontaneously or after repeated training.

  20. Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

    OpenAIRE

    Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

    2017-01-01

    Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

  1. Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer

    International Nuclear Information System (INIS)

    Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju

    2010-01-01

    We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco

  2. A heterodimer of human 3'-phospho-adenosine-5'-phosphosulphate (PAPS) synthases is a new sulphate activating complex

    International Nuclear Information System (INIS)

    Grum, Daniel; Boom, Johannes van den; Neumann, Daniel; Matena, Anja; Link, Nina M.; Mueller, Jonathan W.

    2010-01-01

    3'-Phospho-adenosine-5'-phosphosulphate (PAPS) synthases are fundamental to mammalian sulphate metabolism. These enzymes have recently been linked to a rising number of human diseases. Despite many studies, it is not yet understood how the mammalian PAPS synthases 1 and 2 interact with each other. We provide first evidence for heterodimerisation of these two enzymes by pull-down assays and Foerster resonance energy transfer (FRET) measurements. Kinetics of dimer dissociation/association indicates that these heterodimers form as soon as PAPSS1 and -S2 encounter each other in solution. Affinity of the homo- and heterodimers were found to be in the low nanomolar range using anisotropy measurements employing proteins labelled with the fluorescent dye IAEDANS that - in spite of its low quantum yield - is well suited for anisotropy due to its large Stokes shift. Within its kinase domain, the PAPS synthase heterodimer displays similar substrate inhibition by adenosine-5'-phosphosulphate (APS) as the homodimers. Due to divergent catalytic efficacies of PAPSS1 and -S2, the heterodimer might be a way of regulating PAPS synthase function within mammalian cells.

  3. Synthesis and biological evaluation of several dephosphonated analogues of CMP-Neu5Ac as inhibitors of GM3-synthase.

    Science.gov (United States)

    Rota, Paola; Cirillo, Federica; Piccoli, Marco; Gregorio, Antonio; Tettamanti, Guido; Allevi, Pietro; Anastasia, Luigi

    2015-10-05

    Previous studies demonstrated that reducing the GM3 content in myoblasts increased the cell resistance to hypoxic stress, suggesting that a pharmacological inhibition of the GM3 synthesis could be instrumental for the development of new treatments for ischemic diseases. Herein, the synthesis of several dephosphonated CMP-Neu5Ac congeners and their anti-GM3-synthase activity is reported. Biological activity testes revealed that some inhibitors almost completely blocked the GM3-synthase activity in vitro and reduced the GM3 content in living embryonic kidney 293A cells, eventually activating the epidermal growth factor receptor (EGFR) signaling cascade. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Identification of UDPG-binding polypeptides and purified (1,3)-β-glucan synthase by photoaffinity labelling with 5-azido-UDPG

    International Nuclear Information System (INIS)

    Frost, D.J.; Wu, A.; Read, S.M.; Wasserman, B.P.; Drake, R.R.; Haley, B.E.

    1989-01-01

    The photoaffinity probe 5-azido-uridine 5'-β-[ 32 P]-diphosphate glucose was used to identify the major UDPG-binding polypeptide of red beet (1,3)-β-glucan synthase. Glucan synthase was purified from plasma membranes by sequential solubilization with CHAPS followed by product entrapment. Two major polypeptides at 72 and 54 kD were labelled by probe. Labelling of both was abolished with increasing levels of cold UDPG. However, labelling of the 54 kD polypeptide was dependent upon the presence of divalent cations. These data suggest that the 54 kD polypeptide is a substrate-binding and cation-regulated component of the glucan synthase complex

  5. PhaM is the physiological activator of poly(3-hydroxybutyrate) (PHB) synthase (PhaC1) in Ralstonia eutropha.

    Science.gov (United States)

    Pfeiffer, Daniel; Jendrossek, Dieter

    2014-01-01

    Poly(3-hydroxybutyrate) (PHB) synthase (PhaC1) is the key enzyme of PHB synthesis in Ralstonia eutropha and other PHB-accumulating bacteria and catalyzes the polymerization of 3-hydroxybutyryl-CoA to PHB. Activity assays of R. eutropha PHB synthase are characterized by the presence of lag phases and by low specific activity. It is assumed that the lag phase is caused by the time necessary to convert the inactive PhaC1 monomer into the active dimeric form by an unknown priming process. The lag phase can be reduced by addition of nonionic detergents such as hecameg [6-O-(N-heptyl-carbamoyl)-methyl-α-D-glucopyranoside], which apparently accelerates the formation of PhaC1 dimers. We identified the PHB granule-associated protein (PGAP) PhaM as the natural primer (activator) of PHB synthase activity. PhaM was recently discovered as a novel type of PGAP with multiple functions in PHB metabolism. Addition of PhaM to PHB synthase assays resulted in immediate polymerization of 3HB coenzyme A with high specific activity and without a significant lag phase. The effect of PhaM on (i) PhaC1 activity, (ii) oligomerization of PhaC1, (iii) complex formation with PhaC1, and (iv) PHB granule formation in vitro and in vivo was shown by cross-linking experiments of purified proteins (PhaM, PhaC1) with glutardialdehyde, by size exclusion chromatography, and by fluorescence microscopic detection of de novo-synthesized PHB granules.

  6. Early growth and development impairments in patients with ganglioside GM3 synthase deficiency.

    Science.gov (United States)

    Wang, H; Wang, A; Wang, D; Bright, A; Sency, V; Zhou, A; Xin, B

    2016-05-01

    Ganglioside GM3 synthase is a key enzyme involved in the biosynthesis of gangliosides. GM3 synthase deficiency (GSD) causes a complete absence of GM3 and all downstream biosynthetic derivatives. The individuals affected by this disorder manifest severe irritability, intractable seizures and profound intellectual disability. However, we have found that most newborns seem symptom-free for a period of time after birth. In order to further understand the onset of the disease, we investigated the early growth and development of patients with this condition through this study. We compared 37 affected individuals with their normal siblings and revealed that all children with GSD had relatively normal intrauterine growth and development, as their weight, length and head circumference were similar to their normal siblings at birth. However, the disease progresses quickly after birth and causes significant constitutional impairments of growth and development by 6 months of age. Neither breastfeeding nor gastrostomy tube placement made significant difference on growth and development as all groups of patients showed the similar pattern. We conclude that GSD causes significant postnatal growth and developmental impairments and the amount of gangliosides in breast milk and general nutritional intervention do not seem to alter these outcomes. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Glycogen synthase kinase-3 regulation of urinary concentrating ability.

    Science.gov (United States)

    Rao, Reena

    2012-09-01

    Glycogen synthase kinase-3 (GSK3) is an enzyme that is gaining prominence as a critical signaling molecule in the epithelial cells of renal tubules. This review will focus on recent findings exploring the role of GSK3 in renal collecting ducts, especially its role in urine concentration involving vasopressin signaling. Recent studies using inhibition or tissue-specific gene deletion of GSK3 revealed the mechanism by which GSK3 regulates aquaporin 2 water channels via adenylate cyclase or the prostaglandin-E2 pathway. In other studies, postnatal treatment with lithium, an inhibitor of GSK3, increased cell proliferation and led to microcyst formation in rat kidneys. These studies suggest that loss of GSK3 activity could interfere with renal water transport at two levels. In the short term, it could disrupt vasopressin signaling in collecting duct cells and in the long term it could alter the structure of the collecting ducts, making them less responsive to the hydro-osmotic effects of vasopressin. Ongoing studies reveal the crucial role played by GSK3 in the regulation of vasopressin action in the renal collecting ducts and suggest a possible use of GSK3 inhibitors in disease conditions associated with disrupted vasopressin signaling.

  8. A Comparison of the Effects of Neuronal Nitric Oxide Synthase and Inducible Nitric Oxide Synthase Inhibition on Cartilage Damage

    Directory of Open Access Journals (Sweden)

    Nevzat Selim Gokay

    2016-01-01

    Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.

  9. Glycogen synthase kinase-3 regulates inflammatory tolerance in astrocytes

    Science.gov (United States)

    Beurel, Eléonore; Jope, Richard S.

    2010-01-01

    Inflammatory tolerance is the down-regulation of inflammation upon repeated stimuli, which is well-established to occur in peripheral immune cells. However, less is known about inflammatory tolerance in the brain although it may provide an important protective mechanism from detrimental consequences of prolonged inflammation, which appears to occur in many psychiatric and neurodegenerative conditions. Array analysis of 308 inflammatory molecules produced by mouse primary astrocytes after two sequential stimulations with lipopolysaccharide (LPS) distinguished three classes, tolerant, sensitized and unaltered groups. For many of these inflammatory molecules, inhibition of glycogen synthase kinase-3 (GSK3) increased tolerance and reduced sensitization. Focusing on LPS-tolerance in interleukin-6 (IL-6) production, we found that microglia exhibited a strong tolerance response that matched that of macrophages, whereas astrocytes exhibited only partial tolerance. The astrocyte semi-tolerance was found to be regulated by GSK3. GSK3 inhibitors or knocking down GSK3 levels promoted LPS-tolerance and astrocytes expressing constitutively active GSK3 did not develop LPS-tolerance. These findings identify the critical role of GSK3 in counteracting IL-6 inflammatory tolerance in cells of the CNS, supporting the therapeutic potential of GSK3 inhibitors to reduce neuroinflammation by promoting tolerance. PMID:20553816

  10. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  11. Conditional ablation of glycogen synthase kinase 3β in postnatal mouse kidney.

    Science.gov (United States)

    Ge, Yan; Si, Jin; Tian, Li; Zhuang, Shougang; Dworkin, Lance D; Gong, Rujun

    2011-01-01

    Glycogen synthase kinase (GSK)3 is a ubiquitously expressed serine/threonine kinase existing in two isoforms, namely GSK3α and GSK3β. Aside from the long-recognized role in insulin signal transduction and glycogen biosynthesis, GSK3β has been recently coined as a master control molecule in nuclear factor-κB activation and inflammatory kidney injury. Nevertheless, previous studies are less conclusive because they relied greatly on small molecule inhibitors, which lack selectivity and barely distinguish between the GSK3 isoforms. In addition, early embryonic lethality after global knockout of GSK3β precludes interrogation of the biological role of GSK3β in the adult kidney. To circumvent these issues, the Cre/loxP system was used to generate a conditional knockout mouse model in which the GSK3β gene was specifically deleted in kidney cortical tubules at postnatal mature stage. Kidney-specific ablation of GSK3β resulted in a phenotype no different from control littermates. Knockout mice (KO) were viable and exhibited normal development and normal kidney physiology in terms of kidney function, urine albumin excretion, and urine-concentrating ability. It is noteworthy that apart from normal glomerular and tubulointerstitial morphology, the kidneys from KO demonstrated more glycogen accumulation in the renal cortical tubules as assessed by both periodic acid-Schiff staining for light microscopy and direct biochemical assay, consistent with an elevated glycogen synthetic activity as evidenced by diminished inhibitory phosphorylation of glycogen synthase that occurred subsequent to GSK3β ablation. This finding was further validated by electron microscopic observations of increased deposition of glycogen particles in the renal tubules of KO, suggesting that GSK3α could not fully compensate for the loss of GSK3β in regulating glycogen metabolism in the kidney. Collectively, our study suggests that kidney-specific ablation of GSK3β barely affects kidney function

  12. Interleukin-2-induced survival of natural killer (NK) cells involving phosphatidylinositol-3 kinase-dependent reduction of ceramide through acid sphingomyelinase, sphingomyelin synthase, and glucosylceramide synthase.

    Science.gov (United States)

    Taguchi, Yoshimitsu; Kondo, Tadakazu; Watanabe, Mitsumasa; Miyaji, Michihiko; Umehara, Hisanori; Kozutsumi, Yasunori; Okazaki, Toshiro

    2004-11-15

    Interleukin 2 (IL-2) rescued human natural killer (NK) KHYG-1 cells from apoptosis along with a reduction of ceramide. Conversely, an increase of ceramide inhibited IL-2-rescued survival. IL-2 deprivation-induced activation of acid sphingomyelinase (SMase) and inhibition of glucosylceramide synthase (GCS) and sphingomyelin synthase (SMS) were normalized by IL-2 supplementation. A phosphatidyl inositol-3 (PI-3) kinase inhibitor, LY294002, inhibited IL-2-rescued survival, but a mitogen-activated protein kinase inhibitor, PD98059, and an inhibitor of Janus tyrosine kinase/signal transducer and activator of transcription pathway, AG490, did not. LY294002 inhibited IL-2-induced reduction of ceramide through activation of acid SMase and inhibition of GCS and SMS, suggesting the positive involvement of PI-3 kinase in ceramide reduction through enzymatic regulation. Indeed, a constitutively active PI-3 kinase enhanced growth rate and ceramide reduction through inhibition of acid SMase and activation of GCS and SMS. Further, LY294002 inhibited IL-2-induced changes of transcriptional level as well as mRNA and protein levels in acid SMase and GCS but did not affect the stability of the mRNAs. These results suggest that PI-3 kinase-dependent reduction of ceramide through regulation of acid SMase, GCS, and SMS plays a role in IL-2-rescued survival of NK cells.

  13. Inhibition of Glycogen Synthase Kinase-3ß Enhances Cognitive Recovery after Stroke: The Role of TAK1

    Science.gov (United States)

    Venna, Venugopal Reddy; Benashski, Sharon E.; Chauhan, Anjali; McCullough, Louise D.

    2015-01-01

    Memory deficits are common among stroke survivors. Identifying neuroprotective agents that can prevent memory impairment or improve memory recovery is a vital area of research. Glycogen synthase kinase-3ß (GSK-3ß) is involved in several essential intracellular signaling pathways. Unlike many other kinases, GSK-3ß is active only when…

  14. Glycogen synthase kinase-3β in patients with bipolar I disorder

    DEFF Research Database (Denmark)

    Jacoby, Anne S; Munkholm, Klaus; Vinberg, Maj

    2016-01-01

    OBJECTIVES: The enzyme glycogen synthase kinase-3β (GSK3β) is involved in the mechanisms of action of lithium and may play a role in relation to affective states in bipolar disorder. The objectives of the present study were to compare the activity of GSK-3β (measured as levels of phosphorylated GSK......-3β [p-GSK-3β]) between patients with bipolar disorder in the euthymic state and healthy control subjects, and to investigate whether GSK-3β activity varies with affective states in patients with bipolar I disorder. METHODS: In a prospective 6-12-month follow-up study, we investigated state......-specific, intraindividual alterations in the activity of GSK-3β in 60 patients with bipolar I disorder with an acute severe manic index episode and in subsequent euthymic, depressive and manic states and compared this with repeated measurements in healthy control subjects. Data were analyzed using linear mixed...

  15. Role of metal mixtures (Ca, Cu and Pb) on Cd bioaccumulation and phytochelatin production by Chlamydomonas reinhardtii.

    Science.gov (United States)

    Abboud, Pauline; Wilkinson, Kevin J

    2013-08-01

    The goal of the study was to determine whether metal uptake and biological effects could be predicted by free ion concentrations when organisms were exposed to Cd and a second metal. Bioaccumulation and algal phytochelatin (PC) concentrations were determined for Chlamydomonas reinhardtii following a 6-h exposure. Bioaccumulation results, after six hours of exposure, showed that Cd uptake decreased in the presence of relatively high concentrations of Ca, Cu and Pb, however, Cd bioaccumulation increased in the presence of ca. equimolar concentrations of Cu. A good correlation was observed between the production of PCs and the amount of metals bioaccumulated for the binary mixtures of Cd-Pb and Cd-Cu, but not the Cd-Ca mixture. Overall, the results suggested that, in the case of mixtures, bioaccumulated metal rather than free ion concentrations would be a better predictor of biological effect. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Eckmaxol, a Phlorotannin Extracted from Ecklonia maxima, Produces Anti-β-amyloid Oligomer Neuroprotective Effects Possibly via Directly Acting on Glycogen Synthase Kinase 3β.

    Science.gov (United States)

    Wang, Jialing; Zheng, Jiachen; Huang, Chunhui; Zhao, Jiaying; Lin, Jiajia; Zhou, Xuezhen; Naman, C Benjamin; Wang, Ning; Gerwick, William H; Wang, Qinwen; Yan, Xiaojun; Cui, Wei; He, Shan

    2018-04-10

    Alzheimer's disease is a progressive neurodegenerative disorder that mainly affects the elderly. Soluble β-amyloid oligomer, which can induce neurotoxicity, is generally regarded as the main neurotoxin in Alzheimer's disease. Here we report that eckmaxol, a phlorotannin extracted from the brown alga Ecklonia maxima, could produce neuroprotective effects in SH-SY5Y cells. Eckmaxol effectively prevented but did not rescue β-amyloid oligomer-induced neuronal apoptosis and increase of intracellular reactive oxygen species. Eckmaxol also significantly reversed the decreased expression of phospho-Ser9-glycogen synthase kinase 3β and increased expression of phospho-extracellular signal-regulated kinase, which was induced by Aβ oligomer. Moreover, both glycogen synthase kinase 3β and mitogen activated protein kinase inhibitors produced neuroprotective effects in SH-SY5Y cells. Furthermore, eckmaxol showed favorable interaction in the ATP binding site of glycogen synthase kinase 3β and mitogen activated protein kinase. These results suggested that eckmaxol might produce neuroprotective effects via concurrent inhibition of glycogen synthase kinase 3β and extracellular signal-regulated kinase pathways, possibly via directly acting on glycogen synthase kinase 3β and mitogen activated protein kinase. Based on the central role that β-amyloid oligomers play in the pathogenesis of Alzheimer's disease and the high annual production of Ecklonia maxima for alginate and other nutritional ingredients, this report represents a new candidate for the treatment of Alzheimer's disease, and also expands the potential application of Ecklonia maxima and its constituents in the field of pharmacology.

  17. Purification of 1-aminocyclopropane-1-carboxylate synthase from apple fruits using s-adenosyl [3,414C]-methionine (SAM) as a probe

    International Nuclear Information System (INIS)

    Yip, Wingkip; Dong, Jianguo; Yang, Shang Fa

    1989-01-01

    Tomato ACC synthase is inactivated by its substrate SAM, with the moiety of aminobutyrate being covalently linked to ACC synthase during the catalytic reactions. A partial purified ACC synthase (the catalytic activity 100 μmol/h·mg protein) from pellets of apple extract was incubated with [3,4 14 C] SAM. Only one radioactive peak was revealed in a C-4 reverse phase HPLC and one radioactive band on SDS-PAGE with an M.W. of 48 kDa. Apple ACC synthase in native form is resistant to V8, α-chromtrypsin and carboxylpeptidase A digestion, but effectively inactivated by trypsin and ficin, as demonstrated by both the activity assay and SAM labeling. The radioactive protein cut from the SDS-PAGE was injected to three mice, two of the mice showed responses to the protein in western blot analysis. The antibodies from mice is currently under characterization

  18. The effect of a selective neuronal nitric oxide synthase inhibitor 3-bromo 7-nitroindazole on spatial learning and memory in rats.

    Science.gov (United States)

    Gocmez, Semil Selcen; Yazir, Yusufhan; Sahin, Deniz; Karadenizli, Sabriye; Utkan, Tijen

    2015-04-01

    Since the discovery of nitric oxide (NO) as a neuronal messenger, its way to modulate learning and memory functions is subject of intense research. NO is an intercellular messenger in the central nervous system and is formed on demand through the conversion of L-arginine to L-citrulline via the enzyme nitric oxide synthase (NOS). Neuronal form of nitric oxide synthase may play an important role in a wide range of physiological and pathological conditions. Therefore the aim of this study was to investigate the effects of chronic 3-bromo 7-nitroindazole (3-Br 7-NI), specific neuronal nitric oxide synthase (nNOS) inhibitor, administration on spatial learning and memory performance in rats using the Morris water maze (MWM) paradigm. Male rats received either 3-Br 7-NI (20mg/kg/day) or saline via intraperitoneal injection for 5days. Daily administration of the specific neuronal nitric oxide synthase (nNOS) inhibitor, 3-Br 7-NI impaired the acquisition of the MWM task. 3-Br 7-NI also impaired the probe trial. The MWM training was associated with a significant increase in the brain-derived neurotrophic factor (BDNF) mRNA expression in the hippocampus. BDNF mRNA expression in the hippocampus did not change after 3-Br 7-NI treatment. L-arginine significantly reversed behavioural parameters, and the effect of 3-Br 7-NI was found to be NO-dependent. There were no differences in locomotor activity and blood pressure in 3-Br 7-NI treated rats. Our results may suggest that nNOS plays a key role in spatial memory formation in rats. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B

    2001-01-01

    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...... an unusual low specificity toward diphosphoryl donors by accepting dATP, GTP, CTP, and UTP in addition to ATP. The kinetic mechanism of the enzyme is an ordered steady state Bi Bi mechanism with K(ATP) and K(Rib-5-P) values of 170 and 110 micrometer, respectively, and a V(max) value of 13.1 micromol (min x...... mg of protein)(-1). The enzyme has an absolute requirement for magnesium ions, and maximal activity is obtained at 40 degrees C at pH 7.6....

  20. Hyaluronan synthase 3 (HAS3) overexpression downregulates MV3 melanoma cell proliferation, migration and adhesion

    International Nuclear Information System (INIS)

    Takabe, Piia; Bart, Geneviève; Ropponen, Antti; Rilla, Kirsi; Tammi, Markku; Tammi, Raija; Pasonen-Seppänen, Sanna

    2015-01-01

    Malignant skin melanoma is one of the most deadly human cancers. Extracellular matrix (ECM) influences the growth of malignant tumors by modulating tumor cells adhesion and migration. Hyaluronan is an essential component of the ECM, and its amount is altered in many tumors, suggesting an important role for hyaluronan in tumorigenesis. Nonetheless its role in melanomagenesis is not understood. In this study we produced a MV3 melanoma cell line with inducible expression of the hyaluronan synthase 3 (HAS3) and studied its effect on the behavior of the melanoma cells. HAS3 overexpression expanded the cell surface hyaluronan coat and decreased melanoma cell adhesion, migration and proliferation by cell cycle arrest at G1/G0. Melanoma cell migration was restored by removal of cell surface hyaluronan by Streptomyces hyaluronidase and by receptor blocking with hyaluronan oligosaccharides, while the effect on cell proliferation was receptor independent. Overexpression of HAS3 decreased ERK1/2 phosphorylation suggesting that inhibition of MAP-kinase signaling was responsible for these suppressive effects on the malignant phenotype of MV3 melanoma cells. - Highlights: • Inducible HAS3-MV3 melanoma cell line was generated using Lentiviral transduction. • HAS3 overexpression inhibits MV3 cell migration via hyaluronan–receptor interaction. • HAS3 overexpression decreases MV3 melanoma cell proliferation and adhesion. • ERK1/2 phosphorylation is downregulated by 50% in HAS3 overexpressing cells. • The results suggest that hyaluronan has anti-cancer like effects in melanoma

  1. Hyaluronan synthase 3 (HAS3) overexpression downregulates MV3 melanoma cell proliferation, migration and adhesion

    Energy Technology Data Exchange (ETDEWEB)

    Takabe, Piia, E-mail: piia.takabe@uef.fi [University of Eastern Finland, Institute of Biomedicine, 70211 Kuopio (Finland); Bart, Geneviève [University of Eastern Finland, Institute of Biomedicine, 70211 Kuopio (Finland); Ropponen, Antti [University of Eastern Finland, Institute of Clinical Medicine, 70211 Kuopio (Finland); Rilla, Kirsi; Tammi, Markku; Tammi, Raija; Pasonen-Seppänen, Sanna [University of Eastern Finland, Institute of Biomedicine, 70211 Kuopio (Finland)

    2015-09-10

    Malignant skin melanoma is one of the most deadly human cancers. Extracellular matrix (ECM) influences the growth of malignant tumors by modulating tumor cells adhesion and migration. Hyaluronan is an essential component of the ECM, and its amount is altered in many tumors, suggesting an important role for hyaluronan in tumorigenesis. Nonetheless its role in melanomagenesis is not understood. In this study we produced a MV3 melanoma cell line with inducible expression of the hyaluronan synthase 3 (HAS3) and studied its effect on the behavior of the melanoma cells. HAS3 overexpression expanded the cell surface hyaluronan coat and decreased melanoma cell adhesion, migration and proliferation by cell cycle arrest at G1/G0. Melanoma cell migration was restored by removal of cell surface hyaluronan by Streptomyces hyaluronidase and by receptor blocking with hyaluronan oligosaccharides, while the effect on cell proliferation was receptor independent. Overexpression of HAS3 decreased ERK1/2 phosphorylation suggesting that inhibition of MAP-kinase signaling was responsible for these suppressive effects on the malignant phenotype of MV3 melanoma cells. - Highlights: • Inducible HAS3-MV3 melanoma cell line was generated using Lentiviral transduction. • HAS3 overexpression inhibits MV3 cell migration via hyaluronan–receptor interaction. • HAS3 overexpression decreases MV3 melanoma cell proliferation and adhesion. • ERK1/2 phosphorylation is downregulated by 50% in HAS3 overexpressing cells. • The results suggest that hyaluronan has anti-cancer like effects in melanoma.

  2. Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

    Science.gov (United States)

    Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

    1992-01-01

    The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

  3. Glycogen synthase kinase 3 alpha phosphorylates and regulates the osteogenic activity of Osterix.

    Science.gov (United States)

    Li, Hongyan; Jeong, Hyung Min; Choi, You Hee; Lee, Sung Ho; Jeong, Hye Gwang; Jeong, Tae Cheon; Lee, Kwang Youl

    2013-05-10

    Osteoblast-specific transcription factor Osterix is a zinc-finger transcription factor that required for osteoblast differentiation and new bone formation. The function of Osterix can be modulated by post-translational modification. Glycogen synthase kinase 3 alpha (GSK3α) is a multifunctional serine/threonine protein kinase that plays a role in the Wnt signaling pathways and is implicated in the control of several regulatory proteins and transcription factors. In the present study, we investigated how GSK3α regulates Osterix during osteoblast differentiation. Wide type GSK3α up-regulated the protein level, protein stability and transcriptional activity of Osterix. These results suggest that GSK3α regulates osteogenic activity of Osterix. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. The molecular motor F-ATP synthase is targeted by the tumoricidal protein HAMLET.

    Science.gov (United States)

    Ho, James; Sielaff, Hendrik; Nadeem, Aftab; Svanborg, Catharina; Grüber, Gerhard

    2015-05-22

    HAMLET (human alpha-lactalbumin made lethal to tumor cells) interacts with multiple tumor cell compartments, affecting cell morphology, metabolism, proteasome function, chromatin structure and viability. This study investigated if these diverse effects of HAMLET might be caused, in part, by a direct effect on the ATP synthase and a resulting reduction in cellular ATP levels. A dose-dependent reduction in cellular ATP levels was detected in A549 lung carcinoma cells, and by confocal microscopy, co-localization of HAMLET with the nucleotide-binding subunits α (non-catalytic) and β (catalytic) of the energy converting F1F0 ATP synthase was detected. As shown by fluorescence correlation spectroscopy, HAMLET binds to the F1 domain of the F1F0 ATP synthase with a dissociation constant (KD) of 20.5μM. Increasing concentrations of the tumoricidal protein HAMLET added to the enzymatically active α3β3γ complex of the F-ATP synthase lowered its ATPase activity, demonstrating that HAMLET binding to the F-ATP synthase effects the catalysis of this molecular motor. Single-molecule analysis was applied to study HAMLET-α3β3γ complex interaction. Whereas the α3β3γ complex of the F-ATP synthase rotated in a counterclockwise direction with a mean rotational rate of 3.8±0.7s(-1), no rotation could be observed in the presence of bound HAMLET. Our findings suggest that direct effects of HAMLET on the F-ATP synthase may inhibit ATP-dependent cellular processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Glycogen synthase kinase-3 inhibition by 3-anilino-4-phenylmaleimides: insights from 3D-QSAR and docking

    Science.gov (United States)

    Prasanna, Sivaprakasam; Daga, Pankaj R.; Xie, Aihua; Doerksen, Robert J.

    2009-02-01

    Glycogen synthase kinase-3, a serine/threonine kinase, has been implicated in a wide variety of pathological conditions such as diabetes, Alzheimer's disease, stroke, bipolar disorder, malaria and cancer. Herein we report 3D-QSAR analyses using CoMFA and CoMSIA and molecular docking studies on 3-anilino-4-phenylmaleimides as GSK-3α inhibitors, in order to better understand the mechanism of action and structure-activity relationship of these compounds. Comparison of the active site residues of GSK-3α and GSK-3β isoforms shows that all the key amino acids involved in polar interactions with the maleimides for the β isoform are the same in the α isoform, except that Asp133 in the β isoform is replaced by Glu196 in the α isoform. We prepared a homology model for GSK-3α, and showed that the change from Asp to Glu should not affect maleimide binding significantly. Docking studies revealed the binding poses of three subclasses of these ligands, namely anilino, N-methylanilino and indoline derivatives, within the active site of the β isoform, and helped to explain the difference in their inhibitory activity.

  6. Chrysanthemyl diphosphate synthase operates in planta as a bifunctional enzyme with chrysanthemol synthase activity

    DEFF Research Database (Denmark)

    Yang, Ting; Gao, Liping; Hu, Hao

    2014-01-01

    Chrysanthemyl diphosphate synthase (CDS) is the first path-way-specific enzyme in the biosynthesis of pyrethrins, the most widely used plant-derived pesticide. CDS catalyzes c1′-2-3 cyclopropanation reactions of two molecules of dimethylallyl diphosphate (DMAPP) to yield chrysanthemyl diphosphate...

  7. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  8. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  9. Enantioselective synthesis of the novel chiral sulfoxide derivative as a glycogen synthase kinase 3beta inhibitor.

    Science.gov (United States)

    Saitoh, Morihisa; Kunitomo, Jun; Kimura, Eiji; Yamano, Toru; Itoh, Fumio; Kori, Masakuni

    2010-09-01

    Glycogen synthase kinase 3beta (GSK-3beta) inhibitors are expected to be attractive therapeutic agents for the treatment of Alzheimer's disease (AD). Recently we discovered sulfoxides (S)-1 as a novel GSK-3beta inhibitor having in vivo efficacy. We investigated practical asymmetric preparation methods for the scale-up synthesis of (S)-1. The highly enantioselective synthesis of (S)-1 (94% ee) was achieved by titanium-mediated oxidation with D-(-)-diethyl tartrate on gram scale.

  10. Characterization and partial purification of beta-1,3-D-glucan (callose) synthase from barley (Hordeum vulgare) leaves

    DEFF Research Database (Denmark)

    Pedersen, L.H.; Jacobsen, S.; Hejgaard, J.

    1993-01-01

    The plasma membrane bound beta-1,3-D-glucan (callose) synthase. assumed to be involved in the resistance to the powdery mildew fungus (Erysiphe graminis f.sp. hordei), was partially purified from a microsomal fraction of green barley leaves (Hordeum vulgare L.). Plasma membranes were enriched...

  11. Isolation and functional effects of monoclonal antibodies binding to thymidylate synthase.

    Science.gov (United States)

    Jastreboff, M M; Todd, M B; Malech, H L; Bertino, J R

    1985-01-29

    Monoclonal antibodies against electrophoretically pure thymidylate synthase from HeLa cells have been produced. Antibodies (M-TS-4 and M-TS-9) from hybridoma clones were shown by enzyme-linked immunoassay to recognize thymidylate synthase from a variety of human cell lines, but they did not bind to thymidylate synthase from mouse cell lines. The strongest binding of antibodies was observed to enzyme from HeLa cells. These two monoclonal antibodies bind simultaneously to different antigenic sites on thymidylate synthase purified from HeLa cells, as reflected by a high additivity index and results of cross-linked radioimmunoassay. Both monoclonal antibodies inhibit the activity of thymidylate synthase from human cell lines. The strongest inhibition was observed with thymidylate synthase from HeLa cells. Monoclonal antibody M-TS-9 (IgM subclass) decreased the rate of binding of [3H]FdUMP to thymidylate synthase in the presence of 5,10-methylenetetrahydrofolate while M-TS-4 (IgG1) did not change the rate of ternary complex formation. These data indicate that the antibodies recognize different epitopes on the enzyme molecule.

  12. Lithium chloride ameliorates learning and memory ability and inhibits glycogen synthase kinase-3 beta activity in a mouse model of fragile X syndrome

    Institute of Scientific and Technical Information of China (English)

    Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi

    2011-01-01

    In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.

  13. Light and Fungal Elicitor Induce 3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthase mRNA in Suspension Cultured Cells of Parsley (Petroselinum crispum L.) 1

    Science.gov (United States)

    Henstrand, John M.; McCue, Kent F.; Brink, Kent; Handa, Avtar K.; Herrmann, Klaus M.; Conn, Eric E.

    1992-01-01

    Light and fungal elicitor induce mRNA encoding 3-deoxy-d-arabino-heptulosonate 7-phosphate (DAHP) synthase in suspension cultured cells of parsley (Petroselinum crispum L.). The kinetics and dose response of mRNA accumulation were similar for DAHP synthase and phenylalanine ammonia-lyase (PAL). Six micrograms of elicitor from Phytophthora megasperma f. glycinia gave a detectable induction within 1 hour. Induction of DAHP synthase and PAL mRNAs by light was transient, reaching maximal levels at 4 hours and returning to pretreatment levels after 24 hours. Our data suggest that either light or fungal elicitor transcriptionally activate DAHP synthase. A coordinate regulation for key enzymes in the synthesis of primary and secondary metabolites is indicated. ImagesFigure 1 PMID:16668708

  14. Inhibitors of Fatty Acid Synthase for Prostate Cancer. Revision

    Science.gov (United States)

    2013-05-01

    acetyl- cholinesterase inhibitors have been developed, many with femtomolar binding affinities (7). This body of literature also confirms that the...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...May 2013 2. REPORT TYPE Revised Final 3. DATES COVERED 01 May 2009-30 Apr 2013 4. TITLE AND SUBTITLE Inhibitors of Fatty Acid Synthase for

  15. Insulin Induces an Increase in Cytosolic Glucose Levels in 3T3-L1 Cells with Inhibited Glycogen Synthase Activation

    Directory of Open Access Journals (Sweden)

    Helena H. Chowdhury

    2014-10-01

    Full Text Available Glucose is an important source of energy for mammalian cells and enters the cytosol via glucose transporters. It has been thought for a long time that glucose entering the cytosol is swiftly phosphorylated in most cell types; hence the levels of free glucose are very low, beyond the detection level. However, the introduction of new fluorescence resonance energy transfer-based glucose nanosensors has made it possible to measure intracellular glucose more accurately. Here, we used the fluorescent indicator protein (FLIPglu-600µ to monitor cytosolic glucose dynamics in mouse 3T3-L1 cells in which glucose utilization for glycogen synthesis was inhibited. The results show that cells exhibit a low resting cytosolic glucose concentration. However, in cells with inhibited glycogen synthase activation, insulin induced a robust increase in cytosolic free glucose. The insulin-induced increase in cytosolic glucose in these cells is due to an imbalance between the glucose transported into the cytosol and the use of glucose in the cytosol. In untreated cells with sensitive glycogen synthase activation, insulin stimulation did not result in a change in the cytosolic glucose level. This is the first report of dynamic measurements of cytosolic glucose levels in cells devoid of the glycogen synthesis pathway.

  16. Regulation of glycogen synthase kinase-3{beta} (GSK-3{beta}) after ionizing radiation; Regulation der Glykogen Synthase Kinase-3{beta} (GSK-3{beta}) nach ionisierender Strahlung

    Energy Technology Data Exchange (ETDEWEB)

    Boehme, K.A.

    2006-12-15

    Glycogen Synthase Kinase-3{beta} (GSK-3{beta}) phosphorylates the Mdm2 protein in the central domain. This phosphorylation is absolutely required for p53 degradation. Ionizing radiation inactivates GSK-3{beta} by phosphorylation at serine 9 and in consequence prevents Mdm2 mediated p53 degradation. During the work for my PhD I identified Akt/PKB as the kinase that phosphorylates GSK-3{beta} at serine 9 after ionizing radiation. Ionizing radiation leads to phosphorylation of Akt/PKB at threonine 308 and serine 473. The PI3 Kinase inhibitor LY294002 completely abolished Akt/PKB serine 473 phosphorylation and prevented the induction of GSK-3{beta} serine 9 phosphorylation after ionizing radiation. Interestingly, the most significant activation of Akt/PKB after ionizing radiation occurred in the nucleus while cytoplasmic Akt/PKB was only weakly activated after radiation. By using siRNA, I showed that Akt1/PKBa, but not Akt2/PKB{beta}, is required for phosphorylation of GSK- 3{beta} at serine 9 after ionizing radiation. Phosphorylation and activation of Akt/PKB after ionizing radiation depends on the DNA dependent protein kinase (DNA-PK), a member of the PI3 Kinase family, that is activated by free DNA ends. Both, in cells from SCID mice and after knockdown of the catalytic subunit of DNA-PK by siRNA in osteosarcoma cells, phosphorylation of Akt/PKB at serine 473 and of GSK-3{beta} at serine 9 was completely abolished. Consistent with the principle that phosphorylation of GSK-3 at serine 9 contributes to p53 stabilization after radiation, the accumulation of p53 in response to ionizing radiation was largely prevented by downregulation of DNA-PK. From these results I conclude, that ionizing radiation induces a signaling cascade that leads to Akt1/PKBa activation mediated by DNA-PK dependent phosphorylation of serine 473. After activation Akt1/PKBa phosphorylates and inhibits GSK-3{beta} in the nucleus. The resulting hypophosphorylated form of Mdm2 protein is no longer

  17. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  18. Glycogen synthase kinase 3β promotes liver innate immune activation by restraining AMP-activated protein kinase activation.

    Science.gov (United States)

    Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan

    2018-02-13

    Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection

  19. Nitric oxide synthase-3 promotes embryonic development of atrioventricular valves.

    Directory of Open Access Journals (Sweden)

    Yin Liu

    Full Text Available Nitric oxide synthase-3 (NOS3 has recently been shown to promote endothelial-to-mesenchymal transition (EndMT in the developing atrioventricular (AV canal. The present study was aimed to investigate the role of NOS3 in embryonic development of AV valves. We hypothesized that NOS3 promotes embryonic development of AV valves via EndMT. To test this hypothesis, morphological and functional analysis of AV valves were performed in wild-type (WT and NOS3(-/- mice at postnatal day 0. Our data show that the overall size and length of mitral and tricuspid valves were decreased in NOS3(-/- compared with WT mice. Echocardiographic assessment showed significant regurgitation of mitral and tricuspid valves during systole in NOS3(-/- mice. These phenotypes were all rescued by cardiac specific NOS3 overexpression. To assess EndMT, immunostaining of Snail1 was performed in the embryonic heart. Both total mesenchymal and Snail1(+ cells in the AV cushion were decreased in NOS3(-/- compared with WT mice at E10.5 and E12.5, which was completely restored by cardiac specific NOS3 overexpression. In cultured embryonic hearts, NOS3 promoted transforming growth factor (TGFβ, bone morphogenetic protein (BMP2 and Snail1expression through cGMP. Furthermore, mesenchymal cell formation and migration from cultured AV cushion explants were decreased in the NOS3(-/- compared with WT mice. We conclude that NOS3 promotes AV valve formation during embryonic heart development and deficiency in NOS3 results in AV valve insufficiency.

  20. Glycogen Synthase Kinase 3 Inhibitors in the Next Horizon for Alzheimer's Disease Treatment

    Directory of Open Access Journals (Sweden)

    Ana Martinez

    2011-01-01

    Full Text Available Glycogen synthase kinase 3 (GSK-3, a proline/serine protein kinase ubiquitously expressed and involved in many cellular signaling pathways, plays a key role in the pathogenesis of Alzheimer's disease (AD being probably the link between β-amyloid and tau pathology. A great effort has recently been done in the discovery and development of different new molecules, of synthetic and natural origin, able to inhibit this enzyme, and several kinetics mechanisms of binding have been described. The small molecule called tideglusib belonging to the thiadiazolidindione family is currently on phase IIb clinical trials for AD. The potential risks and benefits of this new kind of disease modifying drugs for the future therapy of AD are discussed in this paper.

  1. Aberrant glycogen synthase kinase 3β in the development of pancreatic cancer

    Directory of Open Access Journals (Sweden)

    Takeo Shimasaki

    2012-01-01

    Full Text Available Development and progression of pancreatic cancer involves general metabolic disorder, local chronic inflammation, and multistep activation of distinct oncogenic molecular pathways. These pathologic processes result in a highly invasive and metastatic tumor phenotype that is a major obstacle to curative surgical intervention, infusional gemcitabine-based chemotherapy, and radiation therapy. Many clinical trials with chemical compounds and therapeutic antibodies targeting growth factors, angiogenic factors, and matrix metalloproteinases have failed to demonstrate definitive therapeutic benefits to refractory pancreatic cancer patients. Glycogen synthase kinase 3β (GSK3β, a serine/threonine protein kinase, has emerged as a therapeutic target in common chronic and progressive diseases, including cancer. Here we review accumulating evidence for a pathologic role of GSK3β in promoting tumor cell survival, proliferation, invasion, and resistance to chemotherapy and radiation in pancreatic cancer. We also discuss the putative involvement of GSK3β in mediating metabolic disorder, local inflammation, and molecular alteration leading to pancreatic cancer development. Taken together, we highlight potential therapeutic as well as preventive effects of GSK3β inhibition in pancreatic cancer.

  2. Evolutionary and mechanistic insights from the reconstruction of α-humulene synthases from a modern (+)-germacrene A synthase.

    Science.gov (United States)

    Gonzalez, Veronica; Touchet, Sabrina; Grundy, Daniel J; Faraldos, Juan A; Allemann, Rudolf K

    2014-10-15

    Germacrene A synthase (GAS) from Solidago canadensis catalyzes the conversion of farnesyl diphosphate (FDP) to the plant sesquiterpene (+)-germacrene A. After diphosphate expulsion, farnesyl cation reacts with the distal 10,11-double bond to afford germacrene A (>96%) and <2% α-humulene, which arises from 1,11-cyclization of FDP. The origin of the 1,11-activity of GAS was investigated by amino acid sequence alignments of 1,10- and 1,11-synthases and comparisons of X-ray crystal structures with the homology model of GAS; a triad [Thr 401-Gly 402-Gly 403] that might be responsible for the predominant 1,10-cyclization activity of GAS was identified. Replacement of Gly 402 with residues of increasing size led to a progressive increase of 1,11-cyclization. The catalytic robustness of these 1,10- /1,11-GAS variants point to Gly 402 as a functional switch of evolutionary significance and suggests that enzymes with strict functionalities have evolved from less specific ancestors through a small number of substitutions. Similar results were obtained with germacrene D synthase (GDS) upon replacement of the homologous active-site residue Gly 404: GDS-G404V generated approximately 20% bicyclogermacrene, a hydrocarbon with a cyclopropane ring that underlines the dual 1,10-/1,11-cyclization activity of this mutant. This suggests that the reaction pathways to germacrenes and humulenes might be connected through a bridged 1,10,11-carbocation intermediate or transition state that resembles bicyclogermacrene. Mechanistic studies using [1-(3)H1]-10-fluorofarnesyl diphosphate and deuterium-labeling experiments with [12,13-(2)H6]-FDP support a germacrene-humulene rearrangement linking 1,10- and 1,11-pathways. These results support the bioinformatics proposal that modern 1,10-synthases could have evolved from promiscuous 1,11-sesquiterpene synthases.

  3. Isolation and functional characterization of a methyl jasmonate-responsive 3-carene synthase from Lavandula x intermedia.

    Science.gov (United States)

    Adal, Ayelign M; Sarker, Lukman S; Lemke, Ashley D; Mahmoud, Soheil S

    2017-04-01

    A methyl jasmonate responsive 3-carene synthase (Li3CARS) gene was isolated from Lavandula x intermedia and functionally characterized in vitro. Lavenders produce essential oils consisting mainly of monoterpenes, including the potent antimicrobial and insecticidal monoterpene 3-carene. In this study we isolated and functionally characterized a leaf-specific, methyl jasmonate (MeJA)-responsive monoterpene synthase (Li3CARS) from Lavandula x intermedia. The ORF excluding transit peptides encoded a 64.9 kDa protein that was expressed in E. coli, and purified with Ni-NTA agarose affinity chromatography. The recombinant Li3CARS converted GPP into 3-carene as the major product, with K m and k cat of 3.69 ± 1.17 µM and 2.01 s -1 respectively. Li3CARS also accepted NPP as a substrate to produce multiple products including a small amount of 3-carene. The catalytic efficiency of Li3CARS to produce 3-carene was over ten fold higher for GPP (k cat /K m = 0.56 µM -1 s -1 ) than NPP (k cat /K m = 0.044 µM -1 s -1 ). Production of distinct end product profiles from different substrates (GPP versus NPP) by Li3CARS indicates that monoterpene metabolism may be controlled in part through substrate availability. Li3CARS transcripts were found to be highly abundant in leaves (16-fold) as compared to flower tissues. The transcriptional activity of Li3CARS correlated with 3-carene production, and was up-regulated (1.18- to 3.8-fold) with MeJA 8-72 h post-treatment. The results suggest that Li3CARS may have a defensive role in Lavandula.

  4. The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

    OpenAIRE

    Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

    2016-01-01

    Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

  5. Regulation of mouse brain glycogen synthase kinase-3 by atypical antipsychotics.

    Science.gov (United States)

    Li, Xiaohua; Rosborough, Kelley M; Friedman, Ari B; Zhu, Wawa; Roth, Kevin A

    2007-02-01

    Glycogen synthase kinase-3 (GSK3) has been recognized as an important enzyme that modulates many aspects of neuronal function. Accumulating evidence implicates abnormal activity of GSK3 in mood disorders and schizophrenia, and GSK3 is a potential protein kinase target for psychotropics used in these disorders. We previously reported that serotonin, a major neurotransmitter involved in mood disorders, regulates GSK3 by acutely increasing its N-terminal serine phosphorylation. The present study was undertaken to further determine if atypical antipsychotics, which have therapeutic effects in both mood disorders and schizophrenia, can regulate phospho-Ser-GSK3 and inhibit its activity. The results showed that acute treatment of mice with risperidone rapidly increased the level of brain phospho-Ser-GSK3 in the cortex, hippocampus, striatum, and cerebellum in a dose-dependent manner. Regulation of phospho-Ser-GSK3 was a shared effect among several atypical antipsychotics, including olanzapine, clozapine, quetiapine, and ziprasidone. In addition, combination treatment of mice with risperidone and a monoamine reuptake inhibitor antidepressant imipramine or fluoxetine elicited larger increases in brain phospho-Ser-GSK3 than each agent alone. Taken together, these results provide new information suggesting that atypical antipsychotics, in addition to mood stabilizers and antidepressants, can inhibit the activity of GSK3. These findings may support the pharmacological mechanisms of atypical antipsychotics in the treatment of mood disorders.

  6. Glycogen synthase kinase 3 phosphorylates kinesin light chains and negatively regulates kinesin-based motility

    Science.gov (United States)

    Morfini, Gerardo; Szebenyi, Gyorgyi; Elluru, Ravindhra; Ratner, Nancy; Brady, Scott T.

    2002-01-01

    Membrane-bounded organelles (MBOs) are delivered to different domains in neurons by fast axonal transport. The importance of kinesin for fast antero grade transport is well established, but mechanisms for regulating kinesin-based motility are largely unknown. In this report, we provide biochemical and in vivo evidence that kinesin light chains (KLCs) interact with and are in vivo substrates for glycogen synthase kinase 3 (GSK3). Active GSK3 inhibited anterograde, but not retrograde, transport in squid axoplasm and reduced the amount of kinesin bound to MBOs. Kinesin microtubule binding and microtubule-stimulated ATPase activities were unaffected by GSK3 phosphorylation of KLCs. Active GSK3 was also localized preferentially to regions known to be sites of membrane delivery. These data suggest that GSK3 can regulate fast anterograde axonal transport and targeting of cargos to specific subcellular domains in neurons.

  7. Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

    Directory of Open Access Journals (Sweden)

    Kawamukai Makoto

    2004-11-01

    Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

  8. Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens.

    Science.gov (United States)

    Cortés-Vieyra, Ricarda; Bravo-Patiño, Alejandro; Valdez-Alarcón, Juan J; Juárez, Marcos Cajero; Finlay, B Brett; Baizabal-Aguirre, Víctor M

    2012-06-12

    Glycogen synthase kinase 3β (GSK3β) plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB) activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.

  9. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  10. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  11. Effects of various nitric oxide synthase inhibitors on AlCl3-induced neuronal injury in rats

    Directory of Open Access Journals (Sweden)

    IVANA STEVANOVIĆ

    2009-05-01

    Full Text Available The present study was aimed at determining the effectiveness of nitric oxide synthase (NOS inhibitors: N-nitro-L-arginine methyl ester, 7-nitroindazole and aminoguanidine in modulating the toxicity of AlCl3 on superoxide production and the malondialdehyde concentration of Wistar rats. The animals were sacrificed 10 min and 3 days after the treatment and the forebrain cortex was removed. The results show that AlCl3 exposure promotes oxidative stress in different neural areas. The biochemical changes observed in the neuronal tissues show that aluminum acts as pro-oxidant, while NOS inhibitors exert an anti-oxidant action in AlCl3-treated animals.

  12. Converting S-limonene synthase to pinene or phellandrene synthases reveals the plasticity of the active site.

    Science.gov (United States)

    Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong

    2017-05-01

    S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Modulation of hyaluronan synthase activity in cellular membrane fractions

    OpenAIRE

    Vigetti, Davide; Genasetti, A; Karousou, Evgenia; Viola, Manuela; Clerici, M; Bartolini, B; Moretto, Paola; DE LUCA, Giancarlo; Hascall, Vc; Passi, Alberto

    2009-01-01

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in euk...

  14. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Science.gov (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  15. Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

    DEFF Research Database (Denmark)

    Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

    2001-01-01

    no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

  16. Substrate specificity of Arabidopsis 3-ketoacyl-CoA synthases

    International Nuclear Information System (INIS)

    Blacklock, Brenda J.; Jaworski, Jan G.

    2006-01-01

    The very long chain fatty acids (VLCFA) incorporated into plant lipids are derived from the iterative addition of C2 units provided by malonyl-CoA to an acyl-CoA by the 3-ketoacyl-CoA synthase (KCS) component of a fatty acid elongase (FAE) complex. Mining of the Arabidopsis genome sequence database revealed 20 genes with homology to seed-specific FAE1 KCS. Eight of the 20 putative KCSs were cloned, expressed in yeast, and isolated as (His) 6 fusion proteins. Five of the eight (At1g71160, At1g19440, At1g07720, At5g04530, and At4g34250) had little or no activity with C16 to C20 substrates while three demonstrated activity with C16, C18, and C20 saturated acyl-CoA substrates. At1g01120 KCS (KCS1) and At2g26640 KCS had broad substrate specificities when assayed with saturated and mono-unsaturated C16 to C24 acyl-CoAs while At4g34510 KCS was specific for saturated fatty acyl-CoA substrates

  17. Regulation of glycogen synthase kinase-3 during bipolar mania treatment.

    Science.gov (United States)

    Li, Xiaohong; Liu, Min; Cai, Zhuoji; Wang, Gang; Li, Xiaohua

    2010-11-01

    Bipolar disorder is a debilitating psychiatric illness presenting with recurrent mania and depression. The pathophysiology of bipolar disorder is poorly understood, and molecular targets in the treatment of bipolar disorder remain to be identified. Preclinical studies have suggested that glycogen synthase kinase-3 (GSK3) is a potential therapeutic target in bipolar disorder, but evidence of abnormal GSK3 in human bipolar disorder and its response to treatment is still lacking. This study was conducted in acutely ill type I bipolar disorder subjects who were hospitalized for a manic episode. The protein level and the inhibitory serine phosphorylation of GSK3 in peripheral blood mononuclear cells of bipolar manic and healthy control subjects were compared, and the response of GSK3 to antimanic treatment was evaluated. The levels of GSK3α and GSK3β in this group of bipolar manic subjects were higher than healthy controls. Symptom improvement during an eight-week antimanic treatment with lithium, valproate, and atypical antipsychotics was accompanied by a significant increase in the inhibitory serine phosphorylation of GSK3, but not the total level of GSK3, whereas concomitant electroconvulsive therapy treatment during a manic episode appeared to dampen the response of GSK3 to pharmacological treatment. Results of this study suggest that GSK3 can be modified during the treatment of bipolar mania. This finding in human bipolar disorder is in agreement with preclinical data suggesting that inhibition of GSK3 by increasing serine phosphorylation is a response of GSK3 to psychotropics used in bipolar disorder, supporting the notion that GSK3 is a promising molecular target in the pharmacological treatment of bipolar disorder. © 2010 John Wiley and Sons A/S.

  18. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  19. Role of glycogen synthase kinase-3 beta in the inflammatory response caused by bacterial pathogens

    Directory of Open Access Journals (Sweden)

    Cortés-Vieyra Ricarda

    2012-06-01

    Full Text Available Abstract Glycogen synthase kinase 3β (GSK3β plays a fundamental role during the inflammatory response induced by bacteria. Depending on the pathogen and its virulence factors, the type of cell and probably the context in which the interaction between host cells and bacteria takes place, GSK3β may promote or inhibit inflammation. The goal of this review is to discuss recent findings on the role of the inhibition or activation of GSK3β and its modulation of the inflammatory signaling in monocytes/macrophages and epithelial cells at the transcriptional level, mainly through the regulation of nuclear factor-kappaB (NF-κB activity. Also included is a brief overview on the importance of GSK3 in non-inflammatory processes during bacterial infection.

  20. Nuclear glycogen synthase kinase-3 {beta} (GSK-3) in Rhipicephalus (Boophilus) microplus tick embryogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Mentzingen, Leticia; Andrade, Josiana G. de; Logullo, Carlos [Universidade Estadual do Norte Fluminense Darcy Ribeiro (UENF), Campos dos Goytacazes, RJ (Brazil). Centro de Biociencias e Biotecnologia. Lab. de Quimica e Funcao de Proteinas e Peptideos (LQFPP); Andrade, Caroline P. de; Vaz Junior, Itabajara [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS (Brazil). Centro de Biotecnologia

    2008-07-01

    Full text: Glycogen synthase kinase-3 (GSK3) is recognized as a key component of a large number of cellular processes and diseases. Several mechanisms play a part in controlling the actions of GSK3, including phosphorylation, protein complex formation, and subcellular distribution. Recent observations point to functions for phosphorylases several transcription factors in the nucleus. Also, GSK3b participate of the canonical W nt signalling pathway, which has been studied intensively in embryonic and cancer cells. Like in many other signaling pathways, most components in W nt signal transduction were highly conserved during the evolution. More than 40 proteins have been reported to be phosphorylated by GSK3, including over a dozen transcription factors. Although the mechanisms regulating GSK3 are not fully understood, precise control appears to be achieved by a combination of phosphorylation, localization, and interactions with GSK3-binding proteins. Although GSK3 is traditionally considered a cytosolic protein, it is also present in nuclei. Nuclear GSK3 is particularly interesting because of the many transcription factors that it regulates enabling GSK3 to influence many signaling pathways that converge on these transcription factors, thereby regulating the expression of many genes. Our group identified that GSK-3 {beta} could be detected in different stage eggs of R. micro plus. In this work we detected the GSK-3 in isolated nuclear fraction from the egg homogenates of R. micro plus by western-blot analysis, using anti-GSK- 3 {beta} antibodies. The enzyme activity was also detected radiochemically throughout embryogenesis in same fraction. The GSK-3 activity was inhibiting by using SB 216763 (selective molecule inhibitors of GSK-3). Taken together our results suggest that GSK-3 {beta} isoform probably is involved in gene transcription factors during R. micro plus embryo development.

  1. Hypothalamic glycogen synthase kinase 3β has a central role in the regulation of food intake and glucose metabolism

    OpenAIRE

    Benzler, Jonas; Ganjam, Goutham K.; Krüger, Manon; Pinkenburg, Olaf; Kutschke, Maria; Stöhr, Sigrid; Steger, Juliane; Koch, Christiane E.; Ölkrug, Rebecca; Schwartz, Michael W.; Shepherd, Peter R.; Grattan, David R.; Tups, Alexander

    2012-01-01

    GSK3β (glycogen synthase kinase 3β) is a ubiquitous kinase that plays a key role in multiple intracellular signalling pathways, and increased GSK3β activity is implicated in disorders ranging from cancer to Alzheimer’s disease. In the present study, we provide the first evidence of increased hypothalamic signalling via GSK3β in leptin-deficient Lepob/ob mice and show that intracerebroventricular injection of a GSK3β inhibitor acutely improves glucose tolerance in these mice. The beneficial ef...

  2. Phosphorylation and 14-3-3 binding of Arabidopsis trehalose-phosphate synthase 5 in response to 2-deoxyglucose

    DEFF Research Database (Denmark)

    Harthill, Jean E; Meek, Sarah E M; Morrice, Nick

    2006-01-01

    Trehalose-6-phosphate is a 'sugar signal' that regulates plant metabolism and development. The Arabidopsis genome encodes trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphatase (TPP) enzymes. It also encodes class II proteins (TPS isoforms 5-11) that contain both TPS-like and TPP...

  3. Imidazopyridine-based inhibitors of glycogen synthase kinase 3: synthesis and evaluation of amide isostere replacements of the carboxamide scaffold.

    Science.gov (United States)

    Yngve, Ulrika; Söderman, Peter; Svensson, Mats; Rosqvist, Susanne; Arvidsson, Per I

    2012-11-01

    In this study, we explored the effect of bioisostere replacement in a series of glycogen synthase kinase 3 (GSK3) inhibitors based on the imidazopyridine core. The synthesis and biological evaluation of a number of novel sulfonamide, 1,2,4-oxadiazole, and thiazole derivates as amide bioisosteres, as well as a computational rationalization of the obtained results are reported. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  4. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    International Nuclear Information System (INIS)

    Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long

    2014-01-01

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus

  5. CTP synthase forms cytoophidia in the cytoplasm and nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)

    2014-04-15

    CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.

  6. Glycogen synthase activation by sugars in isolated hepatocytes.

    Science.gov (United States)

    Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J

    1988-07-01

    We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.

  7. Activation of GABAB receptors inhibits protein kinase B /Glycogen Synthase Kinase 3 signaling

    Directory of Open Access Journals (Sweden)

    Lu Frances Fangjia

    2012-11-01

    Full Text Available Abstract Accumulated evidence has suggested that potentiation of cortical GABAergic inhibitory neurotransmission may be a key mechanism in the treatment of schizophrenia. However, the downstream molecular mechanisms related to GABA potentiation remain unexplored. Recent studies have suggested that dopamine D2 receptor antagonists, which are used in the clinical treatment of schizophrenia, modulate protein kinase B (Akt/glycogen synthase kinase (GSK-3 signaling. Here we report that activation of GABAB receptors significantly inhibits Akt/GSK-3 signaling in a β-arrestin-dependent pathway. Agonist stimulation of GABAB receptors enhances the phosphorylation of Akt (Thr-308 and enhances the phosphorylation of GSK-3α (Ser-21/β (Ser-9 in both HEK-293T cells expressing GABAB receptors and rat hippocampal slices. Furthermore, knocking down the expression of β-arrestin2 using siRNA abolishes the GABAB receptor-mediated modulation of GSK-3 signaling. Our data may help to identify potentially novel targets through which GABAB receptor agents may exert therapeutic effects in the treatment of schizophrenia.

  8. The consequences of long-term glycogen synthase kinase-3 inhibition on normal and insulin resistant rat hearts.

    Science.gov (United States)

    Flepisi, T B; Lochner, Amanda; Huisamen, Barbara

    2013-10-01

    Glycogen synthase kinase-3 (GSK-3) is a serine-threonine protein kinase, discovered as a regulator of glycogen synthase. GSK-3 may regulate the expression of SERCA-2a potentially affecting myocardial contractility. It is known to phosphorylate and inhibit IRS-1, thus disrupting insulin signalling. This study aimed to determine whether myocardial GSK-3 protein and its substrate proteins are dysregulated in obesity and insulin resistance, and whether chronic GSK-3 inhibition can prevent or reverse this. Weight matched male Wistar rats were rendered obese by hyperphagia using a special diet (DIO) for 16 weeks and compared to chow fed controls. Half of each group was treated with the GSK-3 inhibitor CHIR118637 (30 mg/kg/day) from week 12 to16 of the diet period. Biometric and biochemical parameters were measured and protein expression determined by Western blotting and specific antibodies. Ca(2+)ATPase activity was determined spectrophotometrically. Cardiomyocytes were prepared by collagenase perfusion and insulin stimulated 2-deoxy-glucose uptake determined. DIO rats were significantly heavier than controls, associated with increased intra-peritoneal fat and insulin resistance. GSK-3 inhibition did not affect weight but improved insulin resistance, also on cellular level. It had no effect on GSK-3 expression but elevated its phospho/total ratio and elevated IRS-2 expression. Obesity lowered SERCA-2a expression and activity while GSK-3 inhibition alleviated this. The phospho/total ratio of phospholamban underscored inhibition of SERCA-2a in obesity. In addition, signs of myocardial hypertrophy were observed in treated control rats. GSK-3 inhibition could not reverse all the detrimental effects of obesity but may be harmful in normal rat hearts. It regulates IRS-2, SERCA-2a and phospholamban expression but not IRS-1.

  9. Threonine phosphorylation of rat liver glycogen synthase

    International Nuclear Information System (INIS)

    Arino, J.; Arro, M.; Guinovart, J.J.

    1985-01-01

    32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase

  10. Functional Characterization of Sesquiterpene Synthase from Polygonum minus

    Directory of Open Access Journals (Sweden)

    Su-Fang Ee

    2014-01-01

    Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

  11. Glycogen synthase kinase-3β promotes cyst expansion in polycystic kidney disease.

    Science.gov (United States)

    Tao, Shixin; Kakade, Vijayakumar R; Woodgett, James R; Pandey, Pankaj; Suderman, Erin D; Rajagopal, Madhumitha; Rao, Reena

    2015-06-01

    Polycystic kidney diseases (PKDs) are inherited disorders characterized by the formation of fluid filled renal cysts. Elevated cAMP levels in PKDs stimulate progressive cyst enlargement involving cell proliferation and transepithelial fluid secretion often leading to end-stage renal disease. The glycogen synthase kinase-3 (GSK3) family of protein kinases consists of GSK3α and GSK3β isoforms and has a crucial role in multiple cellular signaling pathways. We previously found that GSK3β, a regulator of cell proliferation, is also crucial for cAMP generation and vasopressin-mediated urine concentration by the kidneys. However, the role of GSK3β in the pathogenesis of PKDs is not known. Here we found that GSK3β expression and activity were markedly upregulated and associated with cyst-lining epithelia in the kidneys of mice and humans with PKD. Renal collecting duct-specific gene knockout of GSK3β or pharmacological inhibition of GSK3 effectively slowed down the progression of PKD in mouse models of autosomal recessive or autosomal dominant PKD. GSK3 inactivation inhibited cAMP generation and cell proliferation resulting in reduced cyst expansion, improved renal function, and extended life span. GSK3β inhibition also reduced pERK, c-Myc, and cyclin-D1, known mitogens in proliferation of cystic epithelial cells. Thus, GSK3β has a novel functional role in PKD pathophysiology, and its inhibition may be therapeutically useful to slow down cyst expansion and progression of PKD.

  12. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  13. Evolution of flavone synthase I from parsley flavanone 3beta-hydroxylase by site-directed mutagenesis.

    Science.gov (United States)

    Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan

    2007-07-01

    Flavanone 3beta-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the beta-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction).

  14. Lithium Impairs Kidney Development and Inhibits Glycogen Synthase Kinase-3β in Collecting Duct Principal Cells

    DEFF Research Database (Denmark)

    Kjærsgaard, Gitte; Madsen, Kirsten; Marcussen, Niels

    level significantly whereas total GSK-3β abundance was unaltered. Li+ treatment increased α-Smooth Muscle Actin (α-SMA) protein level significantly whereas E-cadherin expression was unaltered. In summary, Li+ treatment impairs postnatal development of the kidney cortex and outer medulla and increases pGSK......The postnatal rat kidney is highly susceptible to Lithium (Li+), which leads to significant tissue injury. We hypothesized that Li+ impairs development of the kidney through entry into epithelial cells of the distal nephron, inhibition of Glycogen Synthase Kinase-3β (GSK-3β) through phosphorylation...... on serine9 (pGSK-3β)and subsequent epithelial to mesenchymal dedifferentiation (EMT). GSK-3β immunoreactive protein was associated with collecting ducts in developing and adult human and rat kidney. Total GSK-3β protein abundance was stable in medulla while it decreased in cortex in the postnatal period...

  15. Synthesis and biological evaluation of glycogen synthase kinase 3 (GSK-3) inhibitors: an fast and atom efficient access to 1-aryl-3-benzylureas.

    Science.gov (United States)

    Monte, Fabio Lo; Kramer, Thomas; Boländer, Alexander; Plotkin, Batya; Eldar-Finkelman, Hagit; Fuertes, Ana; Dominguez, Juan; Schmidt, Boris

    2011-09-15

    The glycogen synthase kinase 3 (GSK-3) is implicated in multiple cellular processes and has been linked to the pathogenesis of Alzheimer's disease (AD). In the course of our research topic we synthesized a library of potent GSK-3 inhibitors. We utilized the urea scaffold present in the potent and highly selective GSK-3 inhibitor AR-A014418 (AstraZeneca). This moiety suits both (a) a convergent approach utilizing readily accessible building blocks and (b) a divergent approach based on a microwave heating assisted Suzuki coupling. We established a chromatography-free purification method to generate products with sufficient purity for the biological assays. The structure-activity relationship of the library provided the rationale for the synthesis of the benzothiazolylurea 66 (IC(50)=140 nM) and the pyridylurea 62 (IC(50)=98 nM), which displayed two to threefold enhanced activity versus the reference compound 18 (AR-A014418: IC(50)=330 nM) in our assays. Copyright © 2011. Published by Elsevier Ltd.

  16. Regulation of glycogen synthase kinase-3β (GSK-3β) after ionizing radiation

    International Nuclear Information System (INIS)

    Boehme, K.A.

    2006-12-01

    Glycogen Synthase Kinase-3β (GSK-3β) phosphorylates the Mdm2 protein in the central domain. This phosphorylation is absolutely required for p53 degradation. Ionizing radiation inactivates GSK-3β by phosphorylation at serine 9 and in consequence prevents Mdm2 mediated p53 degradation. During the work for my PhD I identified Akt/PKB as the kinase that phosphorylates GSK-3β at serine 9 after ionizing radiation. Ionizing radiation leads to phosphorylation of Akt/PKB at threonine 308 and serine 473. The PI3 Kinase inhibitor LY294002 completely abolished Akt/PKB serine 473 phosphorylation and prevented the induction of GSK-3β serine 9 phosphorylation after ionizing radiation. Interestingly, the most significant activation of Akt/PKB after ionizing radiation occurred in the nucleus while cytoplasmic Akt/PKB was only weakly activated after radiation. By using siRNA, I showed that Akt1/PKBa, but not Akt2/PKBβ, is required for phosphorylation of GSK- 3β at serine 9 after ionizing radiation. Phosphorylation and activation of Akt/PKB after ionizing radiation depends on the DNA dependent protein kinase (DNA-PK), a member of the PI3 Kinase family, that is activated by free DNA ends. Both, in cells from SCID mice and after knockdown of the catalytic subunit of DNA-PK by siRNA in osteosarcoma cells, phosphorylation of Akt/PKB at serine 473 and of GSK-3β at serine 9 was completely abolished. Consistent with the principle that phosphorylation of GSK-3 at serine 9 contributes to p53 stabilization after radiation, the accumulation of p53 in response to ionizing radiation was largely prevented by downregulation of DNA-PK. From these results I conclude, that ionizing radiation induces a signaling cascade that leads to Akt1/PKBa activation mediated by DNA-PK dependent phosphorylation of serine 473. After activation Akt1/PKBa phosphorylates and inhibits GSK-3β in the nucleus. The resulting hypophosphorylated form of Mdm2 protein is no longer able to degrade p53 which in

  17. Live imaging of β-1,3-glucan synthase FKS-1 in Neurospora crassa hyphae.

    Science.gov (United States)

    Sánchez-León, Eddy; Riquelme, Meritxell

    2015-09-01

    The subcellular localization and dynamics of FKS-1, the putative catalytic subunit of the β-1,3-glucan synthase complex, was analyzed in growing hyphae of Neurospora crassa by live confocal microscopy. GFP-tagged FKS-1 accumulated at the outer layer of the Spitzenkörper (Spk), and at the apical plasma membrane (PM). Fluorescence recovery after photobleaching analysis revealed arrival of FKS-1-containing carriers first at the immediate surroundings of the core region of the Spk, and thereafter to the Spk most outer region. The results obtained here and previous data suggest that FKS-1 is transported to the Spk in macrovesicles. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Glycogen Synthase Kinase 3 Inactivation Induces Cell Senescence through Sterol Regulatory Element Binding Protein 1-Mediated Lipogenesis in Chang Cells.

    Science.gov (United States)

    Kim, You-Mie; Song, Insun; Seo, Yong-Hak; Yoon, Gyesoon

    2013-12-01

    Enhanced lipogenesis plays a critical role in cell senescence via induction of expression of the mature form of sterol regulatory element binding protein 1 (SREBP1), which contributes to an increase in organellar mass, one of the indicators of senescence. We investigated the molecular mechanisms by which signaling molecules control SREBP1-mediated lipogenesis and senescence. We developed cellular models for stress-induced senescence, by exposing Chang cells, which are immortalized human liver cells, to subcytotoxic concentrations (200 µM) of deferoxamine (DFO) and H2O2. In this model of stress-induced cell senescence using DFO and H2O2, the phosphorylation profile of glycogen synthase kinase 3α (GSK3α) and β corresponded closely to the expression profile of the mature form of SREBP-1 protein. Inhibition of GSK3 with a subcytotoxic concentration of the selective GSK3 inhibitor SB415286 significantly increased mature SREBP1 expression, as well as lipogenesis and organellar mass. In addition, GSK3 inhibition was sufficient to induce senescence in Chang cells. Suppression of GSK3 expression with siRNAs specific to GSK3α and β also increased mature SREBP1 expression and induced senescence. Finally, blocking lipogenesis with fatty acid synthase inhibitors (cerulenin and C75) and siRNA-mediated silencing of SREBP1 and ATP citrate lyase (ACL) significantly attenuated GSK3 inhibition-induced senescence. GSK3 inactivation is an important upstream event that induces SREBP1-mediated lipogenesis and consequent cell senescence.

  19. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Directory of Open Access Journals (Sweden)

    Hoseok Choi

    2016-04-01

    Full Text Available Assaying the glycogen synthase kinase-3 (GSK3 activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts.

  20. Rapid Detection of Glycogen Synthase Kinase-3 Activity in Mouse Sperm Using Fluorescent Gel Shift Electrophoresis

    Science.gov (United States)

    Choi, Hoseok; Choi, Bomi; Seo, Ju Tae; Lee, Kyung Jin; Gye, Myung Chan; Kim, Young-Pil

    2016-01-01

    Assaying the glycogen synthase kinase-3 (GSK3) activity in sperm is of great importance because it is closely implicated in sperm motility and male infertility. While a number of studies on GSK3 activity have relied on labor-intensive immunoblotting to identify phosphorylated GSK3, here we report the simple and rapid detection of GSK3 activity in mouse sperm using conventional agarose gel electrophoresis and a fluorescent peptide substrate. When a dye-tethered and prephosphorylated (primed) peptide substrate for GSK3 was employed, a distinct mobility shift in the fluorescent bands on the agarose was observed by GSK3-induced phosphorylation of the primed peptides. The GSK3 activity in mouse testes and sperm were quantifiable by gel shift assay with low sample consumption and were significantly correlated with the expression levels of GSK3 and p-GSK3. We suggest that our assay can be used for reliable and rapid detection of GSK3 activity in cells and tissue extracts. PMID:27092510

  1. An Arabidopsis callose synthase

    DEFF Research Database (Denmark)

    Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

    2002-01-01

    in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

  2. Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    International Nuclear Information System (INIS)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

    2005-01-01

    Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

  3. Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

    Science.gov (United States)

    Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

    2013-12-01

    Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Cloning and expression of pineapple sucrosephosphate synthase ...

    African Journals Online (AJOL)

    A 1132-base pairs (bp) polymerase-chain-reaction product of sucrose-phosphate synthase (SPS) (EC 2.3.1.14) from pineapple (Ananas comosus cv. Comte de paris) fruit was cloned and nominated as Ac- SPS1. The sequence encodes a putative 377 amino acids protein containing two serine conserved features that had ...

  5. Glycogen synthase kinase-3β ablation limits pancreatitis-induced acinar-to-ductal metaplasia.

    Science.gov (United States)

    Ding, Li; Liou, Geou-Yarh; Schmitt, Daniel M; Storz, Peter; Zhang, Jin-San; Billadeau, Daniel D

    2017-09-01

    Acinar-to-ductal metaplasia (ADM) is a reversible epithelial transdifferentiation process that occurs in the pancreas in response to acute inflammation. ADM can rapidly progress towards pre-malignant pancreatic intraepithelial neoplasia (PanIN) lesions in the presence of mutant KRas and ultimately pancreatic adenocarcinoma (PDAC). In the present work, we elucidate the role and related mechanism of glycogen synthase kinase-3beta (GSK-3β) in ADM development using in vitro 3D cultures and genetically engineered mouse models. We show that GSK-3β promotes TGF-α-induced ADM in 3D cultured primary acinar cells, whereas deletion of GSK-3β attenuates caerulein-induced ADM formation and PanIN progression in Kras G12D transgenic mice. Furthermore, we demonstrate that GSK-3β ablation influences ADM formation and PanIN progression by suppressing oncogenic KRas-driven cell proliferation. Mechanistically, we show that GSK-3β regulates proliferation by increasing the activation of S6 kinase. Taken together, these results indicate that GSK-3β participates in early pancreatitis-induced ADM and thus could be a target for the treatment of chronic pancreatitis and the prevention of PDAC progression. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  6. Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

    International Nuclear Information System (INIS)

    Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

    2004-01-01

    The first crystallographic study of a sucrose phosphate synthase from H. orenii, an organism that is both thermophilic and halophilic, is reported. The protein crystal diffracts X-rays to 3.01 Å. This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure

  7. Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

    Science.gov (United States)

    Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

    2017-02-01

    Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  8. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  9. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  10. Phytochelatin synthesis in response to Hg uptake in aquatic plants near a chlor-alkali factory.

    Science.gov (United States)

    Turull, Marta; Grmanova, Gabriela; Dago, Àngela; Ariño, Cristina; Díez, Sergi; Díaz-Cruz, José Manuel; Esteban, Miquel

    2017-06-01

    The effects of mercury (Hg) released from a chlor-alkali factory in aquatic plants along the Ebro River basin (NE Spain) were analysed considering the phytochelatins (PC n ) and their isoforms content in these plants. These compounds were analyzed using HPLC with amperometric detection, and the macrophytes species Ceratophyllum demersum and Myriopyllum spicatum were collected in two sampling campaigns, autumn and spring, respectively. To correlate the PC n content in macrophytes with the Hg contamination, analysis of total Hg (THg) content in plants and suspended particulate matter, as well as the dissolved-bioavailable fraction of Hg in water measured by the diffusive gradient in thin film (DGT) technique were done. The results confirm the presence of PC 2 -Ala in extracts of C. demersum and PC 2 -desGly in M. spicatum, and the concentration of these thiol compounds depends clearly on the distance between the hot spot and the downstream sites: the higher the levels are, the closer the hot spot is. Since most of the Hg is hypothesized to be associated with SPM and transported downstream, our results of the DGT suggest that trace amounts of Hg in water can be released as free metal ions yielding a certain accumulation in plants (reaching the ppb level) that are enough for activation of induction of PCs. A few PCs species have been determined, at different seasons, indicating that they can be used as good indicators of the presence of bioavailable Hg in aquatic media throughout the year. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Isolation and functional characterization of a τ-cadinol synthase, a new sesquiterpene synthase from Lavandula angustifolia.

    Science.gov (United States)

    Jullien, Frédéric; Moja, Sandrine; Bony, Aurélie; Legrand, Sylvain; Petit, Cécile; Benabdelkader, Tarek; Poirot, Kévin; Fiorucci, Sébastien; Guitton, Yann; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis

    2014-01-01

    In this paper we characterize three sTPSs: a germacrene D (LaGERDS), a (E)-β-caryophyllene (LaCARS) and a τ-cadinol synthase (LaCADS). τ-cadinol synthase is reported here for the first time and its activity was studied in several biological models including transiently or stably transformed tobacco species. Three dimensional structure models of LaCADS and Ocimum basilicum γ-cadinene synthase were built by homology modeling using the template structure of Gossypium arboreum δ-cadinene synthase. The depiction of their active site organization provides evidence of the global influence of the enzymes on the formation of τ-cadinol: instead of a unique amino-acid, the electrostatic properties and solvent accessibility of the whole active site in LaCADS may explain the stabilization of the cadinyl cation intermediate. Quantitative PCR performed from leaves and inflorescences showed two patterns of expression. LaGERDS and LaCARS were mainly expressed during early stages of flower development and, at these stages, transcript levels paralleled the accumulation of the corresponding terpene products (germacrene D and (E)-β-caryophyllene). By contrast, the expression level of LaCADS was constant in leaves and flowers. Phylogenetic analysis provided informative results on potential duplication process leading to sTPS diversification in lavender.

  12. Glycogen synthase kinase-3: A promising therapeutic target for Fragile X Syndrome

    Directory of Open Access Journals (Sweden)

    Marjelo M. Mines

    2011-11-01

    Full Text Available Recent advances in understanding the pathophysiological mechanisms contributing to Fragile X Syndrome (FXS have increased optimism that drug interventions can provide significant therapeutic benefits. FXS results from inadequate expression of functional fragile X mental retardation protein (FMRP. FMRP may have several functions, but it is most well-established as an RNA-binding protein that regulates translation, and it is by this mechanism that FMRP is capable of affecting numerous cellular processes by selectively regulating protein levels. The multiple cellular functions regulated by FMRP suggest that multiple interventions may be required for reversing the effects of deficient FMRP. Evidence that inhibitors of glycogen synthase kinase-3 (GSK3 may contribute to the therapeutic treatment of FXS is reviewed here. In the mouse model of FXS, which lacks FMRP expression (FX mice, GSK3 is hyperactive in several brain regions. Furthermore, significant improvements in several FX-related phenotypes have been obtained in FX mice following the administration of lithium, and in some case other GSK3 inhibitors. These responses include normalization of heightened audiogenic seizure susceptibility and of hyperactive locomotor behavior, enhancement of passive avoidance learning retention and of sociability behaviors, and corrections of macroorchidism, neuronal spine density, and neural plasticity measured electrophysiologically as long term depression. A pilot clinical trial of lithium in FXS patients also found improvements in several measures of behavior. Taken together, these findings indicate that lithium and other inhibitors of GSK3 are promising candidate therapeutic agents for treating FXS.

  13. Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit.

    Science.gov (United States)

    Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo

    2014-09-01

    Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  15. Elk-3 is a transcriptional repressor of nitric-oxide synthase 2.

    Science.gov (United States)

    Chen, Yen-Hsu; Layne, Matthew D; Chung, Su Wol; Ejima, Kuniaki; Baron, Rebecca M; Yet, Shaw-Fang; Perrella, Mark A

    2003-10-10

    The inducible isoform of nitric-oxide synthase (NOS2), a key enzyme catalyzing the dramatic increase in nitric oxide by lipopolysaccharide (LPS), plays an important role in the pathophysiology of endotoxemia and sepsis. Recent evidence suggests that Ets transcription factors may contribute to NOS2 induction by inflammatory stimuli. In this study, we investigated the role of Ets transcription factors in the regulation of NOS2 by LPS and transforming growth factor (TGF)-beta 1. Transient transfection assays in macrophages showed that Ets-2 produced an increase in NOS2 promoter activity, whereas the induction by Ets-1 was modest and NERF2 had no effect. Elk-3 (Net/Erp/Sap-2a) markedly repressed NOS2 promoter activity in a dose-dependent fashion, and overexpression of Elk-3 blunted the induction of endogenous NOS2 message. Mutation of the Net inhibitory domain of Elk-3, but not the C-terminal-binding protein interaction domain, partially alleviated this repressive effect. We also found that deletion of the Ets domain of Elk-3 completely abolished its repressive effect on the NOS2 promoter. LPS administration to macrophages led to a dose-dependent decrease in endogenous Elk-3 mRNA levels, and this decrease in Elk-3 preceded the induction of NOS2 mRNA. In a mouse model of endotoxemia, the expression of Elk-3 in kidney, lung, and heart was significantly down-regulated after systemic administration of LPS, and this down-regulation also preceded NOS2 induction. Moreover, TGF-beta 1 significantly increased endogenous Elk-3 mRNA levels that had been down-regulated by LPS in macrophages. This increase in Elk-3 correlated with a TGF-beta 1-induced down-regulation of NOS2. Taken together, our data suggest that Elk-3 is a strong repressor of NOS2 promoter activity and mRNA levels and that endogenous expression of Elk-3 inversely correlates with NOS2. Thus, Elk-3 may serve as an important mediator of NOS2 gene expression.

  16. Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua

    Science.gov (United States)

    Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing

    2016-01-01

    Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840

  17. Isolation and characterization of three new monoterpene synthases from Artemisia annua

    Directory of Open Access Journals (Sweden)

    Ju-Xin eRuan

    2016-05-01

    Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.

  18. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  19. Regulation of C. elegans fat uptake and storage by acyl-CoA synthase-3 is dependent on NR5A family nuclear hormone receptor nhr-25

    DEFF Research Database (Denmark)

    Mullaney, Brendan C; Blind, Raymond D; Lemieux, George A

    2010-01-01

    Acyl-CoA synthases are important for lipid synthesis and breakdown, generation of signaling molecules, and lipid modification of proteins, highlighting the challenge of understanding metabolic pathways within intact organisms. From a C. elegans mutagenesis screen, we found that loss of ACS-3...... mutant phenotypes require the nuclear hormone receptor NHR-25, a key regulator of C. elegans molting. Our findings suggest that ACS-3-derived long-chain fatty acyl-CoAs, perhaps incorporated into complex ligands such as phosphoinositides, modulate NHR-25 function, which in turn regulates an endocrine...... program of lipid uptake and synthesis. These results reveal a link between acyl-CoA synthase function and an NR5A family nuclear receptor in C. elegans....

  20. Calcineurin B homologous protein 3 negatively regulates cardiomyocyte hypertrophy via inhibition of glycogen synthase kinase 3 phosphorylation.

    Science.gov (United States)

    Kobayashi, Soushi; Nakamura, Tomoe Y; Wakabayashi, Shigeo

    2015-07-01

    Cardiac hypertrophy is a leading cause of serious heart diseases. Although many signaling molecules are involved in hypertrophy, the functions of some proteins in this process are still unknown. Calcineurin B homologous protein 3 (CHP3)/tescalcin is an EF-hand Ca(2+)-binding protein that is abundantly expressed in the heart; however, the function of CHP3 is unclear. Here, we aimed to identify the cardiac functions of CHP3. CHP3 was expressed in hearts at a wide range of developmental stages and was specifically detected in neonatal rat ventricular myocytes (NRVMs) but not in cardiac fibroblasts in culture. Moreover, knockdown of CHP3 expression using adenoviral-based RNA interference in NRVMs resulted in enlargement of cardiomyocyte size, concomitant with increased expression of a pathological hypertrophy marker ANP. This same treatment elevated glycogen synthase kinase (GSK3α/β) phosphorylation, which is known to inhibit GSK3 function. In contrast, CHP3 overexpression blocked the insulin-induced phosphorylation of GSK3α/β without affecting the phosphorylation of Akt, which is an upstream kinase of GSK3α/β, in HEK293 cells, and it inhibited both IGF-1-induced phosphorylation of GSK3β and cardiomyocyte hypertrophy in NRVMs. Co-immunoprecipitation experiments revealed that GSK3β interacted with CHP3. However, a Ca(2+)-binding-defective mutation of CHP3 (CHP3-D123A) also interacted with GSK3β and had the same inhibitory effect on GSK3α/β phosphorylation, suggesting that the action of CHP3 was independent of Ca(2+). These findings suggest that CHP3 functions as a novel negative regulator of cardiomyocyte hypertrophy via inhibition of GSK3α/β phosphorylation and subsequent enzymatic activation of GSK3α/β. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

    Directory of Open Access Journals (Sweden)

    Berta Alquézar

    2017-08-01

    Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.

  2. Morphological Analysis of CDC2 and Glycogen Synthase Kinase 3β Phosphorylation as Markers of G2 → M Transition in Glioma

    Directory of Open Access Journals (Sweden)

    José Javier Otero

    2011-01-01

    Full Text Available G2 → M transition is a strategic target for glioma chemotherapy. Key players in G2 → M transition include CDC2 and glycogen synthase kinase 3β (GSK3β, which are highly regulated by posttranslational phosphorylation. This report is a morphological analysis of CDC2 and GSK3β phosphorylation using immunohistochemistry in gliomas with different biological properties. GBM showed a 2.8-fold and 5.6-fold increase in number of cells positive for pThr161CDC2 and a 4.2- and 6.9-fold increase in number of cells positive for pTyr15CDC2 relative to oligodendroglioma and ependymoma, respectively. Elevated labeling for inhibited phospho-CDC2 (pTyr15CDC correlates with elevated levels of phosphorylated glycogen synthase kinase 3β (GSK3β. 71% of the GBM cases showed intermediate to high intensity staining for pSer9SGK3β 53% of oligodendroglioma, and 73% of ependymoma showed low intensity staining. CDC2 gene amplification correlates with increased survival in glioblastoma multiforme (GBM and astrocytoma WHO grades II-III, but not in oligodendroglioma WHO grades II-III.

  3. Plant oxidosqualene metabolism: cycloartenol synthase-dependent sterol biosynthesis in Nicotiana benthamiana.

    Science.gov (United States)

    Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert

    2014-01-01

    The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.

  4. Incorporation of phosphate into glycogen by glycogen synthase.

    Science.gov (United States)

    Contreras, Christopher J; Segvich, Dyann M; Mahalingan, Krishna; Chikwana, Vimbai M; Kirley, Terence L; Hurley, Thomas D; DePaoli-Roach, Anna A; Roach, Peter J

    2016-05-01

    The storage polymer glycogen normally contains small amounts of covalently attached phosphate as phosphomonoesters at C2, C3 and C6 atoms of glucose residues. In the absence of the laforin phosphatase, as in the rare childhood epilepsy Lafora disease, the phosphorylation level is elevated and is associated with abnormal glycogen structure that contributes to the pathology. Laforin therefore likely functions in vivo as a glycogen phosphatase. The mechanism of glycogen phosphorylation is less well-understood. We have reported that glycogen synthase incorporates phosphate into glycogen via a rare side reaction in which glucose-phosphate rather than glucose is transferred to a growing polyglucose chain (Tagliabracci et al. (2011) Cell Metab13, 274-282). We proposed a mechanism to account for phosphorylation at C2 and possibly at C3. Our results have since been challenged (Nitschke et al. (2013) Cell Metab17, 756-767). Here we extend the evidence supporting our conclusion, validating the assay used for the detection of glycogen phosphorylation, measurement of the transfer of (32)P from [β-(32)P]UDP-glucose to glycogen by glycogen synthase. The (32)P associated with the glycogen fraction was stable to ethanol precipitation, SDS-PAGE and gel filtration on Sephadex G50. The (32)P-signal was not affected by inclusion of excess unlabeled UDP before analysis or by treatment with a UDPase, arguing against the signal being due to contaminating [β-(32)P]UDP generated in the reaction. Furthermore, [(32)P]UDP did not bind non-covalently to glycogen. The (32)P associated with glycogen was released by laforin treatment, suggesting that it was present as a phosphomonoester. The conclusion is that glycogen synthase can mediate the introduction of phosphate into glycogen, thereby providing a possible mechanism for C2, and perhaps C3, phosphorylation. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Monoterpene synthase from Dracocephalum kotschyi and SPME-GC-MS analysis of its aroma profile

    Directory of Open Access Journals (Sweden)

    S. Saeidnia

    2014-04-01

    Full Text Available Dracocephalum kotschyi (Lamiaceae, as one of the remarkable aromatic plants, widely grows and also is cultivated in various temperate regions of Iran. There are diverse reports about the composition of the oil of this plant representing limonene derivatives as its major compounds. There is no report on cloning of mono- or sesquiterpene synthases from this plant. In the present study, the aroma profile of D. kotschyi has been extracted and analyzed via Headspace Solid-Phase Microextraction technique coupled with Gas Chromatography- Mass Spectroscopy. In order to determine the sequence of the active terpene synthase in this plant, first mRNA was prepared and cloning was performed by 3’ and 5’-RACEs-PCR method, then cDNA was sequenced and finally aligned with other recognized terpene synthases. The results showed that the plant leaves mainly comprised geranial (37.2%, limonene-10-al (28.5%, limonene (20.1% and 1,1-dimethoxy decane (14.5%. Sequencing the cDNA cloned from this plant revealed the presence of a monoterpene synthase absolutely similar to limonene synthase, responsible in formation of limonene, terpinolene, camphene and some other cyclic monoterpenes in its young leaves.

  6. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  7. Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2005-08-01

    Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

  8. Structure and mechanism of the diterpene cyclase ent-copalyl diphosphate synthase

    Energy Technology Data Exchange (ETDEWEB)

    Köksal, Mustafa; Hu, Huayou; Coates, Robert M.; Peters, Reuben J.; Christianson, David W. (UIUC); (Iowa State); (Penn)

    2011-09-20

    The structure of ent-copalyl diphosphate synthase reveals three {alpha}-helical domains ({alpha}, {beta} and {gamma}), as also observed in the related diterpene cyclase taxadiene synthase. However, active sites are located at the interface of the {beta}{gamma} domains in ent-copalyl diphosphate synthase but exclusively in the {alpha} domain of taxadiene synthase. Modular domain architecture in plant diterpene cyclases enables the evolution of alternative active sites and chemical strategies for catalyzing isoprenoid cyclization reactions.

  9. Generation and Functional Evaluation of Designer Monoterpene Synthases.

    Science.gov (United States)

    Srividya, N; Lange, I; Lange, B M

    2016-01-01

    Monoterpene synthases are highly versatile enzymes that catalyze the first committed step in the pathways toward terpenoids, the structurally most diverse class of plant natural products. Recent advancements in our understanding of the reaction mechanism have enabled engineering approaches to develop mutant monoterpene synthases that produce specific monoterpenes. In this chapter, we are describing protocols to introduce targeted mutations, express mutant enzyme catalysts in heterologous hosts, and assess their catalytic properties. Mutant monoterpene synthases have the potential to contribute significantly to synthetic biology efforts aimed at producing larger amounts of commercially attractive monoterpenes. © 2016 Elsevier Inc. All rights reserved.

  10. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    International Nuclear Information System (INIS)

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.

    1986-01-01

    The R and S enantionmers of S-adenosyl-3-[ 2 H]3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with [1,4- 2 H 4 ]-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral [ 2 H 5 ]spermidines were isolated and converted to their N 1 ,N 7 -dibocspermidine-N 4 -(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz 1 H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral [ 2 H 3 ]dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH 3 ) in all cases studied to date

  11. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....

  12. Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

    Directory of Open Access Journals (Sweden)

    Hyun Jo Koo

    Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

  13. Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

    Science.gov (United States)

    Koo, Hyun Jo; Gang, David R.

    2012-01-01

    The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

  14. Molecular cloning and functional characterization of three terpene synthases from unripe fruit of black pepper (Piper nigrum).

    Science.gov (United States)

    Jin, Zhehao; Kwon, Moonhyuk; Lee, Ah-Reum; Ro, Dae-Kyun; Wungsintaweekul, Juraithip; Kim, Soo-Un

    2018-01-15

    To identify terpene synthases (TPS) responsible for the biosynthesis of the sesquiterpenes that contribute to the characteristic flavors of black pepper (Piper nigrum), unripe peppercorn was subjected to the Illumina transcriptome sequencing. The BLAST analysis using amorpha-4,11-diene synthase as a query identified 19 sesquiterpene synthases (sesqui-TPSs), of which three full-length cDNAs (PnTPS1 through 3) were cloned. These sesqui-TPS cDNAs were expressed in E. coli to produce recombinant enzymes for in vitro assays, and also expressed in the engineered yeast strain to assess their catalytic activities in vivo. PnTPS1 produced β-caryophyllene as a main product and humulene as a minor compound, and thus was named caryophyllene synthase (PnCPS). Likewise, PnTPS2 and PnTPS3 were, respectively, named cadinol/cadinene synthase (PnCO/CDS) and germacrene D synthase (PnGDS). PnGDS expression in yeast yielded β-cadinene and α-copaene, the rearrangement products of germacrene D. Their k cat /K m values (20-37.7 s -1  mM -1 ) were comparable to those of other sesqui-TPSs. Among three PnTPSs, the transcript level of PnCPS was the highest, correlating with the predominant β-caryophyllene biosynthesis in the peppercorn. The products and rearranged products of three PnTPSs could account for about a half of the sesquiterpenes in number found in unripe peppercorn. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  17. Tissue injury after lithium treatment in human and rat postnatal kidney involves glycogen synthase kinase 3β-positive epithelium

    DEFF Research Database (Denmark)

    Kjaersgaard, Gitte; Madsen, Kirsten; Marcussen, Niels

    2012-01-01

    plasma lithium concentration of 1.0 mmol/L. Kidneys from lithium-treated rat pups exhibited dilated distal nephron segments with microcysts. Stereological analysis showed reduced cortex and outer medullary volumes. Lithium increased pGSK-3β and the proliferation marker PCNA protein abundances in cortex...... concentration capacity and diminished outer medullary volume. Histological sections of nephrectomy samples and a biopsy from 3 long-term lithium-treated patients showed multiple cortical microcysts that originated from normally appearing tubules. Microcysts were lined by a cuboidal PCNA-, GSK-3β- and pGSK-3β......It was hypothesized that lithium causes accelerated and permanent injury to the postnatally developing kidney through entry into epithelial cells of the distal nephron and inhibition of glycogen synthase kinase-3β (GSK-3β). GSK-3β immunoreactivity was associated with glomeruli, thick ascending limb...

  18. Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Praveen Balabaskaran Nina

    2010-07-01

    Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

  19. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  20. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  1. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  2. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  3. Platelet content of nitric oxide synthase 3 phosphorylated at Serine 1177 is associated with the functional response of platelets to aspirin.

    Directory of Open Access Journals (Sweden)

    Javier Modrego

    Full Text Available OBJECTIVE: To analyse if platelet responsiveness to aspirin (ASA may be associated with a different ability of platelets to generate nitric oxide (NO. PATIENTS/METHODS: Platelets were obtained from 50 patients with stable coronary ischemia and were divided into ASA-sensitive (n = 26 and ASA-resistant (n = 24 using a platelet functionality test (PFA-100. RESULTS: ASA-sensitive platelets tended to release more NO (determined as nitrite + nitrate than ASA-resistant platelets but it did not reach statistical significance. Protein expression of nitric oxide synthase 3 (NOS3 was higher in ASA-sensitive than in ASA-resistant platelets but there were no differences in the platelet expression of nitric oxide synthase 2 (NOS2 isoform. The highest NOS3 expression in ASA-sensitive platelets was independent of the presence of T-to-C mutation at nucleotide position -786 (T(-786 → C in the NOS3-coding gene. However, platelet content of phosphorylated NOS3 at Serine (Ser(1177, an active form of NOS3, was higher in ASA-sensitive than in ASA-resistant platelets. The level of platelet NOS3 Ser(1177 phosphorylation was positively associated with the closure time in the PFA-100 test. In vitro, collagen failed to stimulate the aggregation of ASA-sensitive platelets, determined by lumiaggregometry, and it was associated with a significant increase (p = 0.018 of NOS3 phosphorylation at Ser(1177. On the contrary, collagen stimulated the aggregation of ASA-resistant platelets but did not significantly modify the platelet content of phosphorylated NOS3 Ser(1177. During collagen stimulation the release of NO from ASA-sensitive platelets was significantly enhanced but it was not modified in ASA-resistant platelets. CONCLUSIONS: Functional platelet responsiveness to ASA was associated with the platelet content of phosphorylated NOS3 at Ser(1177.

  4. Evolution of Flavone Synthase I from Parsley Flavanone 3β-Hydroxylase by Site-Directed Mutagenesis1[W][OA

    Science.gov (United States)

    Gebhardt, Yvonne Helen; Witte, Simone; Steuber, Holger; Matern, Ulrich; Martens, Stefan

    2007-01-01

    Flavanone 3β-hydroxylase (FHT) and flavone synthase I (FNS I) are 2-oxoglutarate-dependent dioxygenases with 80% sequence identity, which catalyze distinct reactions in flavonoid biosynthesis. However, FNS I has been reported exclusively from a few Apiaceae species, whereas FHTs are more abundant. Domain-swapping experiments joining the N terminus of parsley (Petroselinum crispum) FHT with the C terminus of parsley FNS I and vice versa revealed that the C-terminal portion is not essential for FNS I activity. Sequence alignments identified 26 amino acid substitutions conserved in FHT versus FNS I genes. Homology modeling, based on the related anthocyanidin synthase structure, assigned seven of these amino acids (FHT/FNS I, M106T, I115T, V116I, I131F, D195E, V200I, L215V, and K216R) to the active site. Accordingly, FHT was modified by site-directed mutagenesis, creating mutants encoding from one to seven substitutions, which were expressed in yeast (Saccharomyces cerevisiae) for FNS I and FHT assays. The exchange I131F in combination with either M106T and D195E or L215V and K216R replacements was sufficient to confer some FNS I side activity. Introduction of all seven FNS I substitutions into the FHT sequence, however, caused a nearly complete change in enzyme activity from FHT to FNS I. Both FHT and FNS I were proposed to initially withdraw the β-face-configured hydrogen from carbon-3 of the naringenin substrate. Our results suggest that the 7-fold substitution affects the orientation of the substrate in the active-site pocket such that this is followed by syn-elimination of hydrogen from carbon-2 (FNS I reaction) rather than the rebound hydroxylation of carbon-3 (FHT reaction). PMID:17535823

  5. Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis).

    Science.gov (United States)

    Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes

    2010-07-01

    Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

  6. Mechanism of Action and Inhibition of dehydrosqualene Synthase

    Energy Technology Data Exchange (ETDEWEB)

    F Lin; C Liu; Y Liu; Y Zhang; K Wang; W Jeng; T Ko; R Cao; A Wang; E Oldfield

    2011-12-31

    'Head-to-head' terpene synthases catalyze the first committed steps in sterol and carotenoid biosynthesis: the condensation of two isoprenoid diphosphates to form cyclopropylcarbinyl diphosphates, followed by ring opening. Here, we report the structures of Staphylococcus aureus dehydrosqualene synthase (CrtM) complexed with its reaction intermediate, presqualene diphosphate (PSPP), the dehydrosqualene (DHS) product, as well as a series of inhibitors. The results indicate that, on initial diphosphate loss, the primary carbocation so formed bends down into the interior of the protein to react with C2,3 double bond in the prenyl acceptor to form PSPP, with the lower two-thirds of both PSPP chains occupying essentially the same positions as found in the two farnesyl chains in the substrates. The second-half reaction is then initiated by the PSPP diphosphate returning back to the Mg{sup 2+} cluster for ionization, with the resultant DHS so formed being trapped in a surface pocket. This mechanism is supported by the observation that cationic inhibitors (of interest as antiinfectives) bind with their positive charge located in the same region as the cyclopropyl carbinyl group; that S-thiolo-diphosphates only inhibit when in the allylic site; activity results on 11 mutants show that both DXXXD conserved domains are essential for PSPP ionization; and the observation that head-to-tail isoprenoid synthases as well as terpene cyclases have ionization and alkene-donor sites which spatially overlap those found in CrtM.

  7. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  8. Diterpene synthases of the biosynthetic system of medicinally active diterpenoids in Marrubium vulgare

    DEFF Research Database (Denmark)

    Zerbe, Philipp; Chiang, Angela; Dullat, Harpreet

    2014-01-01

    Marrubium vulgare (Lamiaceae) is a medicinal plant whose major bioactive compounds, marrubiin and other labdane-related furanoid diterpenoids, have potential applications as anti-diabetics, analgesics or vasorelaxants. Metabolite and transcriptome profiling of M. vulgare leaves identified five...... different candidate diterpene synthases (diTPSs) of the TPS-c and TPS-e/f clades. We describe the in vitro and in vivo functional characterization of the M. vulgare diTPS family. In addition to MvEKS ent-kaurene synthase of general metabolism, we identified three diTPSs of specialized metabolism: MvCPS3...

  9. Localization of nitric oxide synthase in human skeletal muscle

    DEFF Research Database (Denmark)

    Frandsen, Ulrik; Lopez-Figueroa, M.; Hellsten, Ylva

    1996-01-01

    The present study investigated the cellular localization of the neuronal type I and endothelial type III nitric oxide synthase in human skeletal muscle. Type I NO synthase immunoreactivity was found in the sarcolemma and the cytoplasm of all muscle fibres. Stronger immunoreactivity was expressed...

  10. Identification of a novel CoA synthase isoform, which is primarily expressed in Brain

    International Nuclear Information System (INIS)

    Nemazanyy, Ivan; Panasyuk, Ganna; Breus, Oksana; Zhyvoloup, Alexander; Filonenko, Valeriy; Gout, Ivan T.

    2006-01-01

    CoA and its derivatives Acetyl-CoA and Acyl-CoA are important players in cellular metabolism and signal transduction. CoA synthase is a bifunctional enzyme which mediates the final stages of CoA biosynthesis. In previous studies, we have reported molecular cloning, biochemical characterization, and subcellular localization of CoA synthase (CoASy). Here, we describe the existence of a novel CoA synthase isoform, which is the product of alternative splicing and possesses a 29aa extension at the N-terminus. We termed it CoASy β and originally identified CoA synthase, CoASy α. The transcript specific for CoASy β was identified by electronic screening and by RT-PCR analysis of various rat tissues. The existence of this novel isoform was further confirmed by immunoblot analysis with antibodies directed to the N-terminal peptide of CoASy β. In contrast to CoASy α, which shows ubiquitous expression, CoASy β is primarily expressed in Brain. Using confocal microscopy, we demonstrated that both isoforms are localized on mitochondria. The N-terminal extension does not affect the activity of CoA synthase, but possesses a proline-rich sequence which can bring the enzyme into complexes with signalling proteins containing SH3 or WW domains. The role of this novel isoform in CoA biosynthesis, especially in Brain, requires further elucidation

  11. Up-regulation of insulin-like growth factor 2 by ketamine requires glycogen synthase kinase-3 inhibition

    Science.gov (United States)

    Grieco, Steven F.; Cheng, Yuyan; Eldar-Finkelman, Hagit; Jope, Richard S.; Beurel, Eléonore

    2016-01-01

    An antidepressant dose of the rapidly-acting ketamine inhibits glycogen synthase kinase-3 (GSK3) in mouse hippocampus, and this inhibition is required for the antidepressant effect of ketamine in learned helplessness depression-like behavior. Here we report that treatment with an antidepressant dose of ketamine (10 mg/kg) increased expression of insulin-like growth factor 2 (IGF2) in mouse hippocampus, an effect that required ketamine-induced inhibition of GSK3. Ketamine also inhibited hippocampal GSK3 and increased expression of hippocampal IGF2 in mice when administered after the induction of learned helplessness. Treatment with the specific GSK3 inhibitor L803-mts was sufficient to up-regulate hippocampal IGF2 expression. Administration of IGF2 siRNA reduced ketamine's antidepressant effect in the learned helplessness paradigm. Mice subjected to the learned helplessness paradigm were separated into two groups, those that were resilient (non-depressed) and those that were susceptible (depressed). Non-depressed resilient mice displayed higher expression of IGF2 than susceptible mice. These results indicate that IGF2 contributes to ketamine's antidepressant effect and that IGF2 may confer resilience to depression-like behavior. PMID:27542584

  12. Role of Glycogen Synthase Kinase-3β in APP Hyperphosphorylation Induced by NMDA Stimulation in Cortical Neurons

    Directory of Open Access Journals (Sweden)

    Xanthi Antoniou

    2010-01-01

    Full Text Available The phosphorylation of Amyloid Precursor Protein (APP at Thr668 plays a key role in APP metabolism that is highly relevant to AD. The c-Jun-N-terminal kinase (JNK, glycogen synthase kinase-3β (GSK-3β and cyclin-dependent kinase 5 (Cdk5 can all be responsible for this phosphorylation. These kinases are activated by excitotoxic stimuli fundamental hallmarks of AD. The exposure of cortical neurons to a high dose of NMDA (100 μM for 30’-45’ led to an increase of P-APP Thr668. During NMDA stimulation APP hyperphosphorylation has to be assigned to GSK-3β activity, since addition of L803-mts, a substrate competitive inhibitor of GSK-3β reduced APP phosphorylation induced by NMDA. On the contrary, inhibition of JNK and Cdk5 with D-JNKI1 and Roscovitine respectively did not prevent NMDA-induced P-APP increase. These data show a tight connection, in excitotoxic conditions, between APP metabolism and the GSK-3β signaling pathway.

  13. Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G

    2015-04-01

    Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American

  14. Effects and mechanism of acid rain on plant chloroplast ATP synthase.

    Science.gov (United States)

    Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

    2016-09-01

    Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

  15. Inhibitors of Fatty Acid Synthase for Prostate Cancer

    Science.gov (United States)

    2012-05-01

    compounds. For example, numerous classes of acetyl- cholinesterase inhibitors have been developed, m any with fe mtomolar binding affinities (7). This...AD_________________ Award Number: W81XWH-09-1-0204 TITLE: Inhibitors of Fatty Acid Synthase for...CONTRACT NUMBER Inhibitors of Fatty Acid Synthase for Prostate Cancer 5b. GRANT NUMBER W81XWH-09-1-0204 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR

  16. Virtual Screening of Novel Glucosamine-6-Phosphate Synthase Inhibitors.

    Science.gov (United States)

    Lather, Amit; Sharma, Sunil; Khatkar, Anurag

    2018-01-01

    Infections caused by microorganisms are the major cause of death today. The tremendous and improper use of antimicrobial agents leads to antimicrobial resistance. Various currently available antimicrobial drugs are inadequate to control the infections and lead to various adverse drug reactions. Efforts based on computer-aided drug design (CADD) can excavate a large number of databases to generate new, potent hits and minimize the requirement of time as well as money for the discovery of newer antimicrobials. Pharmaceutical sciences also have made development with advances in drug designing concepts. The current research article focuses on the study of various G-6-P synthase inhibitors from literature cited molecular database. Docking analysis was conducted and ADMET data of various molecules was evaluated by Schrodinger Glide and PreADMET software, respectively. Here, the results presented efficacy of various inhibitors towards enzyme G-6-P synthase. Docking scores, binding energy and ADMET data of various molecules showed good inhibitory potential toward G-6-P synthase as compared to standard antibiotics. This novel antimicrobial drug target G-6-P synthase has not so extensively been explored for its application in antimicrobial therapy, so the work done so far proved highly essential. This article has helped the drug researchers and scientists to intensively explore about this wonderful antimicrobial drug target. The Schrodinger, Inc. (New York, USA) software was utilized to carry out the computational calculations and docking studies. The hardware configuration was Intel® core (TM) i5-4210U CPU @ 2.40GHz, RAM memory 4.0 GB under 64-bit window operating system. The ADMET data was calculated by using the PreADMET tool (PreADMET ver. 2.0). All the computational work was completed in the Laboratory for Enzyme Inhibition Studies, Department of Pharmaceutical Sciences, M.D. University, Rohtak, INDIA. Molecular docking studies were carried out to identify the binding

  17. Crystallization, preliminary X-ray diffraction and structure solution of MosA, a dihydrodipicolinate synthase from Sinorhizobium meliloti L5-30

    International Nuclear Information System (INIS)

    Leduc, Yvonne A.; Phenix, Christopher P.; Puttick, Jennifer; Nienaber, Kurt; Palmer, David R. J.; Delbaere, Louis T. J.

    2005-01-01

    MosA from S. meliloti L5-30 has been crystallized in solution with pyruvate and the 2.3 Å resolution structure has been solved by molecular replacement using E. coli dihydrodipicolinate synthase as the model. The structure of MosA, a dihydrodipicolinate synthase and reported methyltransferase from Sinorhizobium meliloti, has been solved using molecular replacement with Escherichia coli dihydrodipicolinate synthase as the model. A crystal grown in the presence of pyruvate diffracted X-rays to 2.3 Å resolution using synchrotron radiation and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 69.14, b = 138.87, c = 124.13 Å

  18. Inhibition of glycogen synthase kinase-3β attenuates glucocorticoid-induced suppression of myogenic differentiation in vitro.

    Directory of Open Access Journals (Sweden)

    Zhenyu Ma

    Full Text Available Glucocorticoids are the only therapy that has been demonstrated to alter the progress of Duchenne muscular dystrophy (DMD, the most common muscular dystrophy in children. However, glucocorticoids disturb skeletal muscle metabolism and hamper myogenesis and muscle regeneration. The mechanisms involved in the glucocorticoid-mediated suppression of myogenic differentiation are not fully understood. Glycogen synthase kinase-3β (GSK-3β is considered to play a central role as a negative regulator in myogenic differentiation. Here, we showed that glucocorticoid treatment during the first 48 h in differentiation medium decreased the level of phosphorylated Ser9-GSK-3β, an inactive form of GSK-3β, suggesting that glucocorticoids affect GSK-3β activity. We then investigated whether GSK-3β inhibition could regulate glucocorticoid-mediated suppression of myogenic differentiation in vitro. Two methods were employed to inhibit GSK-3β: pharmacological inhibition with LiCl and GSK-3β gene knockdown. We found that both methods resulted in enhanced myotube formation and increased levels of muscle regulatory factors and muscle-specific protein expression. Importantly, GSK-3β inhibition attenuated glucocorticoid-induced suppression of myogenic differentiation. Collectively, these data suggest the involvement of GSK-3β in the glucocorticoid-mediated impairment of myogenic differentiation. Therefore, the inhibition of GSK-3β may be a strategy for preventing glucocorticoid-induced muscle degeneration.

  19. Discovery of novel 2-(4-aryl-2-methylpiperazin-1-yl)-pyrimidin-4-ones as glycogen synthase kinase-3β inhibitors.

    Science.gov (United States)

    Kohara, Toshiyuki; Nakayama, Kazuki; Watanabe, Kazutoshi; Kusaka, Shin-Ichi; Sakai, Daiki; Tanaka, Hiroshi; Fukunaga, Kenji; Sunada, Shinji; Nabeno, Mika; Saito, Ken-Ichi; Eguchi, Jun-Ichi; Mori, Akiko; Tanaka, Shinji; Bessho, Tomoko; Takiguchi-Hayashi, Keiko; Horikawa, Takashi

    2017-08-15

    We herein describe the results of further evolution of glycogen synthase kinase (GSK)-3β inhibitors from our promising compounds containing a 3-methylmorpholine moiety. Transformation of the morpholine moiety into a piperazine moiety resulted in potent GSK-3β inhibitors. SAR studies focused on the nitrogen atom of the piperazine moiety revealed that a phenyl group afforded potent inhibitory activity toward GSK-3β. Docking studies indicated that the phenyl group on the piperazine nitrogen atom and the methyl group on the piperazine make cation-π and CH-π interactions with GSK-3β respectively. 4-Methoxyphenyl analogue 29 showed most potent inhibitory activity toward GSK-3β with good in vitro and in vivo pharmacokinetic profiles, and 29 demonstrated a significant decrease in tau phosphorylation after oral administration in mice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. In-silico docking based design and synthesis of [1H,3H] imidazo[4,5-b] pyridines as lumazine synthase inhibitors for their effective antimicrobial activity.

    Science.gov (United States)

    Harer, Sunil L; Bhatia, Manish S

    2014-10-01

    The imidazopyridine moiety is important pharmacophore that has proven to be useful for a number of biologically relevant targets, also reported to display antibacterial, antifungal, antiviral properties. Riboflavin biosynthesis involving catalytic step of Lumazine synthase is absent in animals and human, but present in microorganism, one of marked advantage of this study. Still, this path is not exploited as antiinfective target. Here, we proposed different interactions between [1H,3H] imidazo[4,5-b] pyridine test ligands and target protein Lumazine synthase (protein Data Bank 2C92), one-step synthesis of title compounds and further evaluation of them for in vitro antimicrobial activity. Active pocket of the target protein involved in the interaction with the test ligands molecules was found using Biopredicta tools in VLifeMDS 4.3 Suite. In-silico docking suggests H-bonding, hydrophobic interaction, charge interaction, aromatic interaction, and Vanderwaal forces responsible for stabilizing enzyme-inhibitor complex. Disc diffusion assay method was used for in vitro antimicrobial screening. Investigation of possible interaction between test ligands and target lumazine synthase of Mycobacterium tuberculosis suggested 1i and 2f as best fit candidates showing hydrogen bonding, hydrophobic, aromatic and Vanderwaal's forces. Among all derivatives 1g, 1j, 1k, 1l, 2a, 2c, 2d, 2e, 2h, and 2j exhibited potent activities against bacteria and fungi compared to the standard Ciprofloxacin and Fluconazole, respectively. The superiority of 1H imidazo [4,5-b] pyridine compounds having R' = Cl >No2 > NH2 at the phenyl/aliphatic moiety resident on the imidazopyridine, whereas leading 3H imidazo[4,5-b] pyridine compounds containing R/Ar = Cl > No2 > NH2> OCH3 substituents on the 2(nd) position of imidazole.

  1. In-silico docking based design and synthesis of [1H,3H] imidazo[4,5-b] pyridines as lumazine synthase inhibitors for their effective antimicrobial activity

    Directory of Open Access Journals (Sweden)

    Sunil L Harer

    2014-01-01

    Full Text Available Purpose: The imidazopyridine moiety is important pharmacophore that has proven to be useful for a number of biologically relevant targets, also reported to display antibacterial, antifungal, antiviral properties. Riboflavin biosynthesis involving catalytic step of Lumazine synthase is absent in animals and human, but present in microorganism, one of marked advantage of this study. Still, this path is not exploited as antiinfective target. Here, we proposed different interactions between [1H,3H] imidazo[4,5-b] pyridine test ligands and target protein Lumazine synthase (protein Data Bank 2C92, one-step synthesis of title compounds and further evaluation of them for in vitro antimicrobial activity. Materials and Methods: Active pocket of the target protein involved in the interaction with the test ligands molecules was found using Biopredicta tools in VLifeMDS 4.3 Suite. In-silico docking suggests H-bonding, hydrophobic interaction, charge interaction, aromatic interaction, and Vanderwaal forces responsible for stabilizing enzyme-inhibitor complex. Disc diffusion assay method was used for in vitro antimicrobial screening. Results and Discussion: Investigation of possible interaction between test ligands and target lumazine synthase of Mycobacterium tuberculosis suggested 1i and 2f as best fit candidates showing hydrogen bonding, hydrophobic, aromatic and Vanderwaal′s forces. Among all derivatives 1g, 1j, 1k, 1l, 2a, 2c, 2d, 2e, 2h, and 2j exhibited potent activities against bacteria and fungi compared to the standard Ciprofloxacin and Fluconazole, respectively. The superiority of 1H imidazo [4,5-b] pyridine compounds having R′ = Cl >No 2 > NH 2 at the phenyl/aliphatic moiety resident on the imidazopyridine, whereas leading 3H imidazo[4,5-b] pyridine compounds containing R/Ar = Cl > No 2 > NH 2> OCH 3 substituents on the 2 nd position of imidazole.

  2. Crystallization of the c[subscript 14]-rotor of the chloroplast ATP synthase reveals that it contains pigments

    Energy Technology Data Exchange (ETDEWEB)

    Varco-Merth, Benjamin; Fromme, Raimund; Wang, Meitian; Fromme, Petra (AZU)

    2008-08-27

    The ATP synthase is one of the most important enzymes on earth as it couples the transmembrane electrochemical potential of protons to the synthesis of ATP from ADP and inorganic phosphage, providing the main ATP source of almost all higher life on earth. During ATP synthesis, stepwise protonation of a conserved carboxylate on each protein subunit of an oligomeric ring of 10--15 c-subunits is commonly thought to drive rotation of the rotor moiety (c{sub 10-14}{gamma}{sup {epsilon}}) relative to stator moiety ({alpha}{sub 3}{beta}{sub 3}{delta}ab{sub 2}). Here we report the isolation and crystallization of the c{sub 14}-ring of subunit c from the spinach chloroplast enzyme diffracting as far as 2.8 {angstrom}. Though ATP synthase was not previously know to contain any pigments, the crystals of the c-subunit possessed a strong yellow color. The pigment analysis revaled that they contain 1 chlorophyll and 2 carotenoids, thereby showing for the first time that the chloroplast ATP synthase contains cofactors, leading to the question of the possible roles of the functions of the pigments in the chloroplast ATP synthase.

  3. Platelet-derived growth factor-DD targeting arrests pathological angiogenesis by modulating glycogen synthase kinase-3beta phosphorylation.

    Science.gov (United States)

    Kumar, Anil; Hou, Xu; Lee, Chunsik; Li, Yang; Maminishkis, Arvydas; Tang, Zhongshu; Zhang, Fan; Langer, Harald F; Arjunan, Pachiappan; Dong, Lijin; Wu, Zhijian; Zhu, Linda Y; Wang, Lianchun; Min, Wang; Colosi, Peter; Chavakis, Triantafyllos; Li, Xuri

    2010-05-14

    Platelet-derived growth factor-DD (PDGF-DD) is a recently discovered member of the PDGF family. The role of PDGF-DD in pathological angiogenesis and the underlying cellular and molecular mechanisms remain largely unexplored. In this study, using different animal models, we showed that PDGF-DD expression was up-regulated during pathological angiogenesis, and inhibition of PDGF-DD suppressed both choroidal and retinal neovascularization. We also demonstrated a novel mechanism mediating the function of PDGF-DD. PDGF-DD induced glycogen synthase kinase-3beta (GSK3beta) Ser(9) phosphorylation and Tyr(216) dephosphorylation in vitro and in vivo, leading to increased cell survival. Consistently, GSK3beta activity was required for the antiangiogenic effect of PDGF-DD targeting. Moreover, PDGF-DD regulated the expression of GSK3beta and many other genes important for angiogenesis and apoptosis. Thus, we identified PDGF-DD as an important target gene for antiangiogenic therapy due to its pleiotropic effects on vascular and non-vascular cells. PDGF-DD inhibition may offer new therapeutic options to treat neovascular diseases.

  4. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  5. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  6. Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

    International Nuclear Information System (INIS)

    Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

    2010-01-01

    The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

  7. Glycogen Synthase Kinase 3β Inhibition as a Therapeutic Approach in the Treatment of Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Liang Ma

    2013-08-01

    Full Text Available Alternative strategies beyond current chemotherapy and radiation therapy regimens are needed in the treatment of advanced stage and recurrent endometrial cancers. There is considerable promise for biologic agents targeting the extracellular signal-regulated kinase (ERK pathway for treatment of these cancers. Many downstream substrates of the ERK signaling pathway, such as glycogen synthase kinase 3β (GSK3β, and their roles in endometrial carcinogenesis have not yet been investigated. In this study, we tested the importance of GSK3β inhibition in endometrial cancer cell lines and in vivo models. Inhibition of GSK3β by either lithium chloride (LiCl or specific GSK3β inhibitor VIII showed cytostatic and cytotoxic effects on multiple endometrial cancer cell lines, with little effect on the immortalized normal endometrial cell line. Flow cytometry and immunofluorescence revealed a G2/M cell cycle arrest in both type I (AN3CA, KLE, and RL952 and type II (ARK1 endometrial cancer cell lines. In addition, LiCl pre-treatment sensitized AN3CA cells to the chemotherapy agent paclitaxel. Administration of LiCl to AN3CA tumor-bearing mice resulted in partial or complete regression of some tumors. Thus, GSK3β activity is associated with endometrial cancer tumorigenesis and its pharmacologic inhibition reduces cell proliferation and tumor growth.

  8. Glycogen synthase kinase-3beta (GSK3beta) negatively regulates PTTG1/human securin protein stability, and GSK3beta inactivation correlates with securin accumulation in breast tumors.

    Science.gov (United States)

    Mora-Santos, Mar; Limón-Mortés, M Cristina; Giráldez, Servando; Herrero-Ruiz, Joaquín; Sáez, Carmen; Japón, Miguel Á; Tortolero, Maria; Romero, Francisco

    2011-08-26

    PTTG1, also known as securin, is an inactivating partner of separase, the major effector for chromosome segregation during mitosis. At the metaphase-to-anaphase transition, securin is targeted for proteasomal destruction by the anaphase-promoting complex or cyclosome, allowing activation of separase. In addition, securin is overexpressed in metastatic or genomically instable tumors, suggesting a relevant role for securin in tumor progression. Stability of securin is regulated by phosphorylation; some phosphorylated forms are degraded out of mitosis, by the action of the SKP1-CUL1-F-box protein (SCF) complex. The kinases targeting securin for proteolysis have not been identified, and mechanistic insight into the cause of securin accumulation in human cancers is lacking. Here, we demonstrate that glycogen synthase kinase-3β (GSK3β) phosphorylates securin to promote its proteolysis via SCF(βTrCP) E3 ubiquitin ligase. Importantly, a strong correlation between securin accumulation and GSK3β inactivation was observed in breast cancer tissues, indicating that GSK3β inactivation may account for securin accumulation in breast cancers.

  9. Glycogen Synthase Kinase-3 is involved in glycogen metabolism control and embryogenesis of Rhodnius prolixus.

    Science.gov (United States)

    Mury, Flávia B; Lugon, Magda D; DA Fonseca, Rodrigo Nunes; Silva, Jose R; Berni, Mateus; Araujo, Helena M; Fontenele, Marcio Ribeiro; Abreu, Leonardo Araujo DE; Dansa, Marílvia; Braz, Glória; Masuda, Hatisaburo; Logullo, Carlos

    2016-10-01

    Rhodnius prolixus is a blood-feeding insect that transmits Trypanosoma cruzi and Trypanosoma rangeli to vertebrate hosts. Rhodnius prolixus is also a classical model in insect physiology, and the recent availability of R. prolixus genome has opened new avenues on triatomine research. Glycogen synthase kinase 3 (GSK-3) is classically described as a key enzyme involved in glycogen metabolism, also acting as a downstream component of the Wnt pathway during embryogenesis. GSK-3 has been shown to be highly conserved among several organisms, mainly in the catalytic domain region. Meanwhile, the role of GSK-3 during R. prolixus embryogenesis or glycogen metabolism has not been investigated. Here we show that chemical inhibition of GSK-3 by alsterpaullone, an ATP-competitive inhibitor of GSK3, does not affect adult survival rate, though it alters oviposition and egg hatching. Specific GSK-3 gene silencing by dsRNA injection in adult females showed a similar phenotype. Furthermore, bright field and 4'-6-diamidino-2-phenylindole (DAPI) staining analysis revealed that ovaries and eggs from dsGSK-3 injected females exhibited specific morphological defects. We also demonstrate that glycogen content was inversely related to activity and transcription levels of GSK-3 during embryogenesis. Lastly, after GSK-3 knockdown, we observed changes in the expression of the Wingless (Wnt) downstream target β-catenin as well as in members of other pathways such as the receptor Notch. Taken together, our results show that GSK-3 regulation is essential for R. prolixus oogenesis and embryogenesis.

  10. Mutations in the Atp1p and Atp3p subunits of yeast ATP synthase differentially affect respiration and fermentation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Francis, Brian R; White, Karen H; Thorsness, Peter E

    2007-04-01

    ATP1-111, a suppressor of the slow-growth phenotype of yme1Delta lacking mitochondrial DNA is due to the substitution of phenylalanine for valine at position 111 of the alpha-subunit of mitochondrial ATP synthase (Atp1p in yeast). The suppressing activity of ATP1-111 requires intact beta (Atp2p) and gamma (Atp3p) subunits of mitochondrial ATP synthase, but not the stator stalk subunits b (Atp4p) and OSCP (Atp5p). ATP1-111 and other similarly suppressing mutations in ATP1 and ATP3 increase the growth rate of wild-type strains lacking mitochondrial DNA. These suppressing mutations decrease the growth rate of yeast containing an intact mitochondrial chromosome on media requiring oxidative phosphorylation, but not when grown on fermentable media. Measurement of chronological aging of yeast in culture reveals that ATP1 and ATP3 suppressor alleles in strains that contain mitochondrial DNA are longer lived than the isogenic wild-type strain. In contrast, the chronological life span of yeast cells lacking mitochondrial DNA and containing these mutations is shorter than that of the isogenic wild-type strain. Spore viability of strains bearing ATP1-111 is reduced compared to wild type, although ATP1-111 enhances the survival of spores that lacked mitochondrial DNA.

  11. Up-Regulation of Excitatory Amino Acid Transporters EAAT3 and EAAT4 by Lithium Sensitive Glycogen Synthase Kinase GSK3ß

    Directory of Open Access Journals (Sweden)

    Abeer Abousaab

    2016-12-01

    Full Text Available Background: Cellular uptake of glutamate by the excitatory amino-acid transporters (EAATs decreases excitation and thus participates in the regulation of neuroexcitability. Kinases impacting on neuronal function include Lithium-sensitive glycogen synthase kinase GSK3ß. The present study thus explored whether the activities of EAAT3 and/or EAAT4 isoforms are sensitive to GSK3ß. Methods: cRNA encoding wild type EAAT3 (SLC1A1 or EAAT4 (SLC1A6 was injected into Xenopus oocytes without or with additional injection of cRNA encoding wild type GSK3ß or the inactive mutant K85AGSK3ß. Dual electrode voltage clamp was performed in order to determine glutamate-induced current (IEAAT. Results: Appreciable IEAAT was observed in EAAT3 or EAAT4 expressing but not in water injected oocytes. IEAAT was significantly increased by coexpression of GSK3ß but not by coexpression of K85AGSK3ß. Coexpression of GSK3ß increased significantly the maximal IEAAT in EAAT3 or EAAT4 expressing oocytes, without significantly modifying apparent affinity of the carriers. Lithium (1 mM exposure for 24 hours decreased IEAAT in EAAT3 and GSK3ß expressing oocytes to values similar to IEAAT in oocytes expressing EAAT3 alone. Lithium did not significantly modify IEAAT in oocytes expressing EAAT3 without GSK3ß. Conclusions: Lithium-sensitive GSK3ß is a powerful regulator of excitatory amino acid transporters EAAT3 and EAAT4.

  12. Natural Variation in Monoterpene Synthesis in Kiwifruit: Transcriptional Regulation of Terpene Synthases by NAC and ETHYLENE-INSENSITIVE3-Like Transcription Factors1

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.

    2015-01-01

    Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633

  13. Regulation of basal gastric acid secretion by the glycogen synthase kinase GSK3.

    Science.gov (United States)

    Rotte, Anand; Pasham, Venkanna; Eichenmüller, Melanie; Yang, Wenting; Qadri, Syed M; Bhandaru, Madhuri; Lang, Florian

    2010-10-01

    According to previous observations, basal gastric acid secretion is downregulated by phosphoinositol-3-(PI3)-kinase, phosphoinositide-dependent kinase (PDK1), and protein kinase B (PKBβ/Akt2) signaling. PKB/Akt phosphorylates glycogen synthase kinase GSK3. The present study explored whether PKB/Akt-dependent GSK3-phosphorylation modifies gastric acid secretion. Utilizing 2',7'-bis-(carboxyethyl)-5(6')-carboxyfluorescein (BCECF)-fluorescence, basal gastric acid secretion was determined from Na(+)-independent pH recovery (∆pH/min) following an ammonium pulse, which reflects H(+)/K(+)-ATPase activity. Experiments were performed in gastric glands from gene-targeted mice (gsk3 ( KI )) with PKB/serum and glucocorticoid-inducible kinase (SGK)-insensitive GSKα,β, in which the serines within the PKB/SGK phosphorylation site were replaced by alanine (GSK3α(21A/21A), GSK3β(9A/9A)). The cytosolic pH in isolated gastric glands was similar in gsk3 ( KI ) and their wild-type littermates (gsk3 ( WT )). However, ∆pH/min was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ) mice and ∆pH/min was virtually abolished by the H(+)/K(+)-ATPase inhibitor omeprazole (100 μM) in gastric glands from both gsk3 ( KI ) and gsk3 ( WT ). Plasma gastrin levels were lower in gsk3 ( KI ) than in gsk3 ( WT ). Both, an increase of extracellular K(+) concentration to 35 mM [replacing Na(+)/N-methyl-D: -glucamine (NMDG)] and treatment with forskolin (5 μM), significantly increased ∆pH/min to virtually the same value in both genotypes. The protein kinase A (PKA) inhibitor H89 (150 nM) and the H(2)-receptor antagonist ranitidine (100 μM) decreased ∆pH/min in gsk3 ( KI ) but not gsk3 ( WT ) and again abrogated the differences between the genotypes. The protein abundance of phosphorylated but not of total PKA was significantly larger in gsk3 ( KI ) than in gsk3 ( WT ). Basal gastric acid secretion is enhanced by the disruption of PKB/SGK-dependent phosphorylation and the

  14. Structure determination of glycogen synthase kinase-3 from Leishmania major and comparative inhibitor structure-activity relationships with Trypanosoma brucei GSK-3

    Energy Technology Data Exchange (ETDEWEB)

    Ojo, Kayode K; Arakaki, Tracy L; Napuli, Alberto J; Inampudi, Krishna K; Keyloun, Katelyn R; Zhang, Li; Hol, Wim G.J.; Verlind, Christophe L.M.J.; Merritt, Ethan A; Van Voorhis, Wesley C [UWASH

    2012-04-24

    Glycogen synthase kinase-3 (GSK-3) is a drug target under intense investigation in pharmaceutical companies and constitutes an attractive piggyback target for eukaryotic pathogens. Two different GSKs are found in trypanosomatids, one about 150 residues shorter than the other. GSK-3 short (GeneDB: Tb927.10.13780) has previously been validated genetically as a drug target in Trypanosoma brucei by RNAi induced growth retardation; and chemically by correlation between enzyme and in vitro growth inhibition. Here, we report investigation of the equivalent GSK-3 short enzymes of L. major (LmjF18.0270) and L. infantum (LinJ18_V3.0270, identical in amino acid sequences to LdonGSK-3 short) and a crystal structure of LmajGSK-3 short at 2 Å resolution. The inhibitor structure-activity relationships (SARs) of L. major and L. infantum are virtually identical, suggesting that inhibitors could be useful for both cutaneous and visceral leishmaniasis. Leishmania spp. GSK-3 short has different inhibitor SARs than TbruGSK-3 short, which can be explained mostly by two variant residues in the ATP-binding pocket. Indeed, mutating these residues in the ATP-binding site of LmajGSK-3 short to the TbruGSK-3 short equivalents results in a mutant LmajGSK-3 short enzyme with SAR more similar to that of TbruGSK-3 short. The differences between human GSK-3β (HsGSK-3β) and LmajGSK-3 short SAR suggest that compounds which selectively inhibit LmajGSK-3 short may be found.

  15. Non-bilayer structures in mitochondrial membranes regulate ATP synthase activity.

    Science.gov (United States)

    Gasanov, Sardar E; Kim, Aleksandr A; Yaguzhinsky, Lev S; Dagda, Ruben K

    2018-02-01

    Cardiolipin (CL) is an anionic phospholipid at the inner mitochondrial membrane (IMM) that facilitates the formation of transient non-bilayer (non-lamellar) structures to maintain mitochondrial integrity. CL modulates mitochondrial functions including ATP synthesis. However, the biophysical mechanisms by which CL generates non-lamellar structures and the extent to which these structures contribute to ATP synthesis remain unknown. We hypothesized that CL and ATP synthase facilitate the formation of non-bilayer structures at the IMM to stimulate ATP synthesis. By using 1 H NMR and 31 P NMR techniques, we observed that increasing the temperature (8°C to 37°C), lowering the pH (3.0), or incubating intact mitochondria with CTII - an IMM-targeted toxin that increases the formation of immobilized non-bilayer structures - elevated the formation of non-bilayer structures to stimulate ATP synthesis. The F 0 sector of the ATP synthase complex can facilitate the formation of non-bilayer structures as incubating model membranes enriched with IMM-specific phospholipids with exogenous DCCD-binding protein of the F 0 sector (DCCD-BPF) elevated the formation of immobilized non-bilayer structures to a similar manner as CTII. Native PAGE assays revealed that CL, but not other anionic phospholipids, specifically binds to DCCD-BPF to promote the formation of stable lipid-protein complexes. Mechanistically, molecular docking studies identified two lipid binding sites for CL in DCCD-BPF. We propose a new model of ATP synthase regulation in which CL mediates the formation of non-bilayer structures that serve to cluster protons and ATP synthase complexes as a mechanism to enhance proton translocation to the F 0 sector, and thereby increase ATP synthesis. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Hypothalamic glycogen synthase kinase 3β has a central role in the regulation of food intake and glucose metabolism.

    Science.gov (United States)

    Benzler, Jonas; Ganjam, Goutham K; Krüger, Manon; Pinkenburg, Olaf; Kutschke, Maria; Stöhr, Sigrid; Steger, Juliane; Koch, Christiane E; Ölkrug, Rebecca; Schwartz, Michael W; Shepherd, Peter R; Grattan, David R; Tups, Alexander

    2012-10-01

    GSK3β (glycogen synthase kinase 3β) is a ubiquitous kinase that plays a key role in multiple intracellular signalling pathways, and increased GSK3β activity is implicated in disorders ranging from cancer to Alzheimer's disease. In the present study, we provide the first evidence of increased hypothalamic signalling via GSK3β in leptin-deficient Lep(ob/ob) mice and show that intracerebroventricular injection of a GSK3β inhibitor acutely improves glucose tolerance in these mice. The beneficial effect of the GSK3β inhibitor was dependent on hypothalamic signalling via PI3K (phosphoinositide 3-kinase), a key intracellular mediator of both leptin and insulin action. Conversely, neuron-specific overexpression of GSK3β in the mediobasal hypothalamus exacerbated the hyperphagia, obesity and impairment of glucose tolerance induced by a high-fat diet, while having little effect in controls fed standard chow. These results demonstrate that increased hypothalamic GSK3β signalling contributes to deleterious effects of leptin deficiency and exacerbates high-fat diet-induced weight gain and glucose intolerance.

  17. Suppression of allene oxide synthase 3 in potato increases degree of arbuscular mycorrhizal fungal colonization.

    Science.gov (United States)

    Morcillo, Rafael Jorge León; Navarrete, María Isabel Tamayo; Bote, Juan Antonio Ocampo; Monguio, Salomé Prat; García-Garrido, José Manuel

    2016-01-15

    Arbuscular mycorrhizal (AM) is a mutually beneficial interaction among higher plants and soil fungi of the phylum Glomeromycota. Numerous studies have pointed that jasmonic acid plays an important role in the development of the intraradical fungus. This compound belongs to a group of biologically active compounds known as oxylipins which are derived from the oxidative metabolism of polyunsaturated fatty acids. Studies of the regulatory role played by oxylipins in AM colonization have generally focused on jasmonates, while few studies exist on the 9-LOX pathway of oxylipins during AM formation. Here, the cDNA of Allene oxide synthase 3 (AOS3), a key enzyme in the 9-LOX pathway, was used in the RNA interference (RNAi) system to transform potato plants in order to suppress its expression. Results show increases in AOS3 gene expression and 9-LOX products in roots of wild type potato mycorrhizal plants. The suppression of AOS3 gene expression increases the percentage of root with mycorrhizal colonization at early stages of AM formation. AOS3 RNA interference lead to an induction of LOXA and 13-LOX genes, a reduction in AOS3 derived 9-LOX oxylipin compounds and an increase in jasmonic acid content, suggesting compensation between 9 and 13-LOX pathways. The results in a whole support the hypothesis of a regulatory role for the 9-LOX oxylipin pathway during mycorrhization. Copyright © 2015 Elsevier GmbH. All rights reserved.

  18. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey

    2016-05-10

    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  19. Prostaglandin H synthase immunoreactivity in human gut. An immunohistochemical study

    DEFF Research Database (Denmark)

    Mikkelsen, H B; Rumessen, J J; Qvortrup, Klaus

    1991-01-01

    Prostaglandins exhibit a variety of actions on intestinal smooth muscle depending upon the type, dose and muscle layer studied. As the cellular origin of prostaglandin H (PGH) synthase has not been established with certainty in the human gut wall, we studied the localization of PGH synthase...

  20. Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases

    Directory of Open Access Journals (Sweden)

    Saito Koji

    2005-08-01

    Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1

  1. Functional identification of a Lippia dulcis bornyl diphosphate synthase that contains a duplicated, inhibitory arginine-rich motif.

    Science.gov (United States)

    Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun

    2017-08-26

    Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Structural study and thermodynamic characterization of inhibitor binding to lumazine synthase from Bacillus anthracis

    Energy Technology Data Exchange (ETDEWEB)

    Morgunova, Ekaterina [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden); Illarionov, Boris; Saller, Sabine [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Popov, Aleksander [European Synchrotron Radiation Facility, BP 220, F-38043 Grenoble CEDEX 09 (France); Sambaiah, Thota [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Bacher, Adelbert [Chemistry Department, Technical University of Munich, 85747 Garching (Germany); Cushman, Mark [Department of Medicinal Chemistry and Molecular Pharmacology, Purdue University (United States); Fischer, Markus [Institut für Lebensmittelchemie, Universität Hamburg, Grindelallee 117, 20146 Hamburg (Germany); Ladenstein, Rudolf, E-mail: rudolf.ladenstein@ki.se [Karolinska Institutet NOVUM, Center of Structural Biochemistry, Hälsovägen 7-9, 141 57 Huddinge (Sweden)

    2010-09-01

    Crystallographic studies of lumazine synthase, the penultimate enzyme of the riboflavin-biosynthetic pathway in B. anthracis, provide a structural framework for the design of antibiotic inhibitors, together with calorimetric and kinetic investigations of inhibitor binding. The crystal structure of lumazine synthase from Bacillus anthracis was solved by molecular replacement and refined to R{sub cryst} = 23.7% (R{sub free} = 28.4%) at a resolution of 3.5 Å. The structure reveals the icosahedral symmetry of the enzyme and specific features of the active site that are unique in comparison with previously determined orthologues. The application of isothermal titration calorimetry in combination with enzyme kinetics showed that three designed pyrimidine derivatives bind to lumazine synthase with micromolar dissociation constants and competitively inhibit the catalytic reaction. Structure-based modelling suggested the binding modes of the inhibitors in the active site and allowed an estimation of the possible contacts formed upon binding. The results provide a structural framework for the design of antibiotics active against B. anthracis.

  3. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

    2007-01-01

    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  4. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  5. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    International Nuclear Information System (INIS)

    Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi

    2008-01-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1

  6. Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

    Energy Technology Data Exchange (ETDEWEB)

    Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)

    2008-03-01

    Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.

  7. Glycogen synthase kinase-3 levels and phosphorylation undergo large fluctuations in mouse brain during development

    Science.gov (United States)

    Beurel, Eléonore; Mines, Marjelo A; Song, Ling; Jope, Richard S

    2012-01-01

    Objectives Dysregulated glycogen synthase kinase-3 (GSK3) may contribute to the pathophysiology of mood disorders and other diseases, and appears to be a target of certain therapeutic drugs. The growing recognition of heightened vulnerability during development to many psychiatric diseases, including mood disorders, led us to test if there are developmental changes in mouse brain GSK3 and its regulation by phosphorylation and by therapeutic drugs. Methods GSK3 levels and phosphorylation were measured at seven ages of development in mouse cerebral cortex and hippocampus. Results Two periods of rapid transitions in GSK3 levels were identified, a large rise between postnatal day 1 and two to three weeks of age, where GSK3 levels were as high as four-fold adult mouse brain levels, and a rapid decline between two to four and eight weeks of age, when adult levels were reached. Inhibitory serine-phosphorylation of GSK3, particularly GSK3β, was extremely high in one-day postnatal mouse brain, and rapidly declined thereafter. These developmental changes in GSK3 were equivalent in male and female cerebral cortex, and differed from other signaling kinases, including Akt, ERK1/2, JNK, and p38 levels and phosphorylation. In contrast to adult mouse brain, where administration of lithium or fluoxetine rapidly and robustly increased serine-phosphorylation of GSK3, in young mice these responses were blunted or absent. Conclusions High brain levels of GSK3 and large fluctuations in its levels and phosphorylation in juvenile and adolescent mouse brain raise the possibility that they may contribute to destabilized mood regulation induced by environmental and genetic factors. PMID:23167932

  8. Systematic analysis of rat 12/15-lipoxygenase enzymes reveals critical role for spinal eLOX3 hepoxilin synthase activity in inflammatory hyperalgesia

    OpenAIRE

    Gregus, Ann M.; Dumlao, Darren S.; Wei, Spencer C.; Norris, Paul C.; Catella, Laura C.; Meyerstein, Flore G.; Buczynski, Matthew W.; Steinauer, Joanne J.; Fitzsimmons, Bethany L.; Yaksh, Tony L.; Dennis, Edward A.

    2013-01-01

    Previously, we observed significant increases in spinal 12-lipoxygenase (LOX) metabolites, in particular, hepoxilins, which contribute to peripheral inflammation-induced tactile allodynia. However, the enzymatic sources of hepoxilin synthase (HXS) activity in rats remain elusive. Therefore, we overexpressed each of the 6 rat 12/15-LOX enzymes in HEK-293T cells and measured by LC-MS/MS the formation of HXB3, 12-HETE, 8-HETE, and 15-HETE from arachidonic acid (AA) at baseline and in the presenc...

  9. Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

    International Nuclear Information System (INIS)

    Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

    1991-01-01

    Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

  10. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  11. Brain derived neurotrophic factor is involved in the regulation of glycogen synthase kinase 3β (GSK3β) signalling

    International Nuclear Information System (INIS)

    Gupta, Vivek; Chitranshi, Nitin; You, Yuyi; Gupta, Veer; Klistorner, Alexander; Graham, Stuart

    2014-01-01

    Highlights: • BDNF knockdown leads to activation of GSK3β in the neuronal cells. • BDNF knockdown can induce GSK3β activation beyond TrkB mediated effects. • BDNF impairment in vivo leads to age dependent activation of GSK3β in the retina. • Systemic treatment with TrkB agonist induces inhibition of retinal GSK3β. - Abstract: Glycogen synthase kinase 3β (GSK3β) is involved in several biochemical processes in neurons regulating cellular survival, gene expression, cell fate determination, metabolism and proliferation. GSK3β activity is inhibited through the phosphorylation of its Ser-9 residue. In this study we sought to investigate the role of BDNF/TrkB signalling in the modulation of GSK3β activity. BDNF/TrkB signalling regulates the GSK3β activity both in vivo in the retinal tissue as well as in the neuronal cells under culture conditions. We report here for the first time that BDNF can also regulate GSK3β activity independent of its effects through the TrkB receptor signalling. Knockdown of BDNF lead to a decline in GSK3β phosphorylation without having a detectable effect on the TrkB activity or its downstream effectors Akt and Erk1/2. Treatment with TrkB receptor agonist had a stimulating effect on the GSK3β phosphorylation, but the effect was significantly less pronounced in the cells in which BDNF was knocked down. The use of TrkB receptor antagonist similarly, manifested itself in the form of downregulation of GSK3β phosphorylation, but a combined TrkB inhibition and BDNF knockdown exhibited a much stronger negative effect. In vivo, we observed reduced levels of GSK3β phosphorylation in the retinal tissues of the BDNF +/− animals implicating critical role of BDNF in the regulation of the GSK3β activity. Concluding, BDNF/TrkB axis strongly regulates the GSK3β activity and BDNF also exhibits GSK3β regulatory effect independent of its actions through the TrkB receptor signalling

  12. Brain derived neurotrophic factor is involved in the regulation of glycogen synthase kinase 3β (GSK3β) signalling

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Vivek, E-mail: vivek.gupta@mq.edu.au [Australian School of Advanced Medicine, Macquarie University (Australia); Chitranshi, Nitin; You, Yuyi [Australian School of Advanced Medicine, Macquarie University (Australia); Gupta, Veer [School of Medical Sciences, Edith Cowan University, Perth (Australia); Klistorner, Alexander; Graham, Stuart [Australian School of Advanced Medicine, Macquarie University (Australia); Save Sight Institute, Sydney University, Sydney (Australia)

    2014-11-21

    Highlights: • BDNF knockdown leads to activation of GSK3β in the neuronal cells. • BDNF knockdown can induce GSK3β activation beyond TrkB mediated effects. • BDNF impairment in vivo leads to age dependent activation of GSK3β in the retina. • Systemic treatment with TrkB agonist induces inhibition of retinal GSK3β. - Abstract: Glycogen synthase kinase 3β (GSK3β) is involved in several biochemical processes in neurons regulating cellular survival, gene expression, cell fate determination, metabolism and proliferation. GSK3β activity is inhibited through the phosphorylation of its Ser-9 residue. In this study we sought to investigate the role of BDNF/TrkB signalling in the modulation of GSK3β activity. BDNF/TrkB signalling regulates the GSK3β activity both in vivo in the retinal tissue as well as in the neuronal cells under culture conditions. We report here for the first time that BDNF can also regulate GSK3β activity independent of its effects through the TrkB receptor signalling. Knockdown of BDNF lead to a decline in GSK3β phosphorylation without having a detectable effect on the TrkB activity or its downstream effectors Akt and Erk1/2. Treatment with TrkB receptor agonist had a stimulating effect on the GSK3β phosphorylation, but the effect was significantly less pronounced in the cells in which BDNF was knocked down. The use of TrkB receptor antagonist similarly, manifested itself in the form of downregulation of GSK3β phosphorylation, but a combined TrkB inhibition and BDNF knockdown exhibited a much stronger negative effect. In vivo, we observed reduced levels of GSK3β phosphorylation in the retinal tissues of the BDNF{sup +/−} animals implicating critical role of BDNF in the regulation of the GSK3β activity. Concluding, BDNF/TrkB axis strongly regulates the GSK3β activity and BDNF also exhibits GSK3β regulatory effect independent of its actions through the TrkB receptor signalling.

  13. First and second line mechanisms of cadmium detoxification in the lichen photobiont Trebouxia impressa (Chlorophyta)

    International Nuclear Information System (INIS)

    Sanita di Toppi, L.; Pawlik-Skowronska, B.; Vurro, E.; Vattuone, Z.; Kalinowska, R.; Restivo, F.M.; Musetti, R.; Skowronski, T.

    2008-01-01

    'First line' defence mechanisms, such as phytochelatin biosynthesis, and 'second line' mechanisms, such as stress protein induction, were investigated in cadmium-exposed cells of Trebouxia impressa Ahmadjian, a green microalgal species that is a common photobiont of the lichen Physcia adscendens (Fr.) H. Olivier. When T. impressa cells were exposed to 0, 9 and 18 μM Cd for 6, 18 and 48 h, glutathione and phytochelatins efficiently protected the cells against Cd damage. By contrast, the highest Cd concentration (36 μM) at the longest exposure-time (48 h) caused marked drops in glutathione and phytochelatin content, several types of ultrastructural damage, and decreases in cell density and total chlorophyll concentration. In this case, induction of stress proteins was observed, but only long after the induction of phytochelatins. Thus, stress proteins could represent a 'second line' mechanism to counteract Cd stress, activated when there is a decline in the 'first line' mechanism of Cd detoxification given by phytochelatins. - Trebouxia impressa photobionts protect themselves against cadmium stress by means of phytochelatins and stress proteins

  14. First and second line mechanisms of cadmium detoxification in the lichen photobiont Trebouxia impressa (Chlorophyta)

    Energy Technology Data Exchange (ETDEWEB)

    Sanita di Toppi, L. [Dipartimento di Biologia Evolutiva e Funzionale, viale G.P. Usberti 11/A, Universita di Parma, 43100 Parma (Italy)], E-mail: luigi.sanitaditoppi@unipr.it; Pawlik-Skowronska, B. [Centre for Ecological Research, Polish Academy of Sciences, Experimental Station, Niecala 18/3, 20080 Lublin (Poland); Vurro, E. [Dipartimento di Biologia Evolutiva e Funzionale, viale G.P. Usberti 11/A, Universita di Parma, 43100 Parma (Italy); Vattuone, Z. [Dipartimento di Biologia Evolutiva e Funzionale, viale G.P. Usberti 11/A, Universita di Parma, 43100 Parma (Italy); Centre for Ecological Research, Polish Academy of Sciences, Experimental Station, Niecala 18/3, 20080 Lublin (Poland); Kalinowska, R. [Centre for Ecological Research, Polish Academy of Sciences, Experimental Station, Niecala 18/3, 20080 Lublin (Poland); Restivo, F.M. [Dipartimento di Genetica, Biologia dei Microrganismi, Antropologia, Evoluzione, viale G.P. Usberti 11/A, Universita di Parma, 43100 Parma (Italy); Musetti, R. [Dipartimento di Biologia Applicata alla Difesa delle Piante, via delle Scienze 208, Universita di Udine, 33100 Udine (Italy); Skowronski, T. [Centre for Ecological Research, Polish Academy of Sciences, Experimental Station, Niecala 18/3, 20080 Lublin (Poland)

    2008-01-15

    'First line' defence mechanisms, such as phytochelatin biosynthesis, and 'second line' mechanisms, such as stress protein induction, were investigated in cadmium-exposed cells of Trebouxia impressa Ahmadjian, a green microalgal species that is a common photobiont of the lichen Physcia adscendens (Fr.) H. Olivier. When T. impressa cells were exposed to 0, 9 and 18 {mu}M Cd for 6, 18 and 48 h, glutathione and phytochelatins efficiently protected the cells against Cd damage. By contrast, the highest Cd concentration (36 {mu}M) at the longest exposure-time (48 h) caused marked drops in glutathione and phytochelatin content, several types of ultrastructural damage, and decreases in cell density and total chlorophyll concentration. In this case, induction of stress proteins was observed, but only long after the induction of phytochelatins. Thus, stress proteins could represent a 'second line' mechanism to counteract Cd stress, activated when there is a decline in the 'first line' mechanism of Cd detoxification given by phytochelatins. - Trebouxia impressa photobionts protect themselves against cadmium stress by means of phytochelatins and stress proteins.

  15. Structure of the dimeric form of CTP synthase from Sulfolobus solfataricus

    DEFF Research Database (Denmark)

    Lauritsen, Iben; Willemoës, Martin; Jensen, Kaj Frank

    2011-01-01

    CTP synthase catalyzes the last committed step in de novo pyrimidine-nucleotide biosynthesis. Active CTP synthase is a tetrameric enzyme composed of a dimer of dimers. The tetramer is favoured in the presence of the substrate nucleotides ATP and UTP; when saturated with nucleotide, the tetramer...... completely dominates the oligomeric state of the enzyme. Furthermore, phosphorylation has been shown to regulate the oligomeric states of the enzymes from yeast and human. The crystal structure of a dimeric form of CTP synthase from Sulfolobus solfataricus has been determined at 2.5 Å resolution...

  16. Methamphetamine- and 1-methyl-4-phenyl- 1,2,3, 6-tetrahydropyridine-induced dopaminergic neurotoxicity in inducible nitric oxide synthase-deficient mice.

    Science.gov (United States)

    Itzhak, Y; Martin, J L; Ali, S F

    1999-12-15

    Previous studies have suggested a role for the retrograde messenger, nitric oxide (NO), in methamphetamine (METH)- and 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)- induced dopaminergic neurotoxicity. Since evidence supported the involvement of the neuronal nitric oxide synthase (nNOS) isoform in the dopaminergic neurotoxicity, the present study was undertaken to investigate whether the inducible nitric oxide synthase (iNOS) isoform is also associated with METH- and MPTP-induced neurotoxicity. The administration of METH (5mg/kg x 3) to iNOS deficient mice [homozygote iNOS(-/-)] and wild type mice (C57BL/6) resulted in significantly smaller depletion of striatal dopaminergic markers in the iNOS(-/-) mice compared with the wild-type mice. METH-induced hyperthermia was also significantly lower in the iNOS(-/-) mice than in wild-type mice. In contrast to the outcome of METH administration, MPTP injections (20 mg/kg x 3) resulted in a similar decrease in striatal dopaminergic markers in iNOS(-/-) and wild-type mice. In the set of behavioral experiments, METH-induced locomotor sensitization was investigated. The acute administration of METH (1.0 mg/kg) resulted in the same intensity of locomotor activity in iNOS(-/-) and wild-type mice. Moreover, 68 to 72 h after the exposure to the high-dose METH regimen (5 mg/kg x 3), a marked sensitized response to a challenge injection of METH (1.0 mg/kg) was observed in both the iNOS(-/-) and wild-type mice. The finding that iNOS(-/-) mice were unprotected from MPTP-induced neurotoxicity suggests that the partial protection against METH-induced neurotoxicity observed was primarily associated with the diminished hyperthermic effect of METH seen in the iNOS(-/-) mice. Moreover, in contrast to nNOS deficiency, iNOS deficiency did not affect METH-induced behavioral sensitization. Copyright 1999 Wiley-Liss, Inc.

  17. Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants.

    Science.gov (United States)

    Degenhardt, Jörg; Köllner, Tobias G; Gershenzon, Jonathan

    2009-01-01

    The multitude of terpene carbon skeletons in plants is formed by enzymes known as terpene synthases. This review covers the monoterpene and sesquiterpene synthases presenting an up-to-date list of enzymes reported and evidence for their ability to form multiple products. The reaction mechanisms of these enzyme classes are described, and information on how terpene synthase proteins mediate catalysis is summarized. Correlations between specific amino acid motifs and terpene synthase function are described, including an analysis of the relationships between active site sequence and cyclization type and a discussion of whether specific protein features might facilitate multiple product formation.

  18. Lithium chloride increases the production of amyloid-beta peptide independently from its inhibition of glycogen synthase kinase 3.

    Science.gov (United States)

    Feyt, Christine; Kienlen-Campard, Pascal; Leroy, Karelle; N'Kuli, Francisca; Courtoy, Pierre J; Brion, Jean-Pierre; Octave, Jean-Noël

    2005-09-30

    Glycogen synthase kinase 3 (GSK3) is able to phosphorylate tau at many sites that are found to be phosphorylated in paired helical filaments in Alzheimer disease. Lithium chloride (LiCl) efficiently inhibits GSK3 and was recently reported to also decrease the production of amyloid-beta peptide (Abeta) from its precursor, the amyloid precursor protein. Therefore, lithium has been proposed as a combined therapeutic agent, inhibiting both the hyperphosphorylation of tau and the production of Abeta. Here, we demonstrate that the inhibition of GSK3 by LiCl induced the nuclear translocation of beta-catenin in Chinese hamster ovary cells and rat cultured neurons, in which a decrease in tau phosphorylation was observed. In both cellular models, a nontoxic concentration of LiCl increased the production of Abeta by increasing the beta-cleavage of amyloid precursor protein, generating more substrate for an unmodified gamma-secretase activity. SB415286, another GSK3 inhibitor, induced the nuclear translocation of beta-catenin and slightly decreased Abeta production. It is concluded that the LiCl-mediated increase in Abeta production is not related to GSK3 inhibition.

  19. Modulation of Escherichia coli serine acetyltransferase catalytic activity in the cysteine synthase complex

    Czech Academy of Sciences Publication Activity Database

    Benoni, Roberto; De Bei, O.; Paredi, G.; Hayes, C. S.; Franko, N.; Mozzarelli, A.; Bettati, S.; Campanini, B.

    2017-01-01

    Roč. 591, č. 9 (2017), s. 1212-1224 ISSN 0014-5793 Institutional support: RVO:61388963 Keywords : cysteine synthase * protein - protein interaction * serine acetyltransferase Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.623, year: 2016

  20. Phosphorylation of inhibitor-2 and activation of MgATP-dependent protein phosphatase by rat skeletal muscle glycogen synthase kinase

    International Nuclear Information System (INIS)

    Hegazy, M.G.; Reimann, E.M.; Thysseril, T.J.; Schlender, K.K.

    1986-01-01

    Rat skeletal muscle contains a glycogen synthase kinase (GSK-M) which is not stimulated by Ca 2+ or cAMP. This kinase has an apparent Mr of 62,000 and uses ATP but not GTP as a phosphoryl donor. GSK-M phosphorylated glycogen synthase at sites 2 and 3. It phosphorylated ATP-citrate lyase and activated MgATP-dependent phosphatase in the presence of ATP but not GTP. As expected, the kinase also phosphorylated phosphatase inhibitor 2 (I-2). Phosphatase incorporation reached approximately 0.3 mol/mol of I-2. Phosphopeptide maps were obtained by digesting 32 P-labeled I-2 with trypsin and separating the peptides by reversed phase HPLC. Two partially separated 32 P-labeled peaks were obtained when I-2 was phosphorylated with either GSK-M or glycogen synthase kinase 3 (GSK-3) and these peptides were different from those obtained when I-2 was phosphorylated with the catalytic subunit of cAMP-dependent protein kinase (CSU) or casein kinase II (CK-II). When I-2 was phosphorylated with GSK-M or GSK-3 and cleaved by CNBr, a single radioactive peak was obtained. Phosphoamino acid analysis showed that I-2 was phosphorylated by GSK-M or GSK-3 predominately in Thr whereas CSU and CK-II phosphorylated I-2 exclusively in Ser. These results indicate that GSK-M is similar to GSK-3 and to ATP-citrate lyase kinase. However, it appears to differ in Mr from ATP-citrate lyase kinase and it differs from GSK-3 in that it phosphorylates glycogen synthase at site 2 and it does not use GTP as a phosphoryl donor

  1. Regulation of Th1 cells and experimental autoimmune encephalomyelitis (EAE) by glycogen synthase kinase-3

    Science.gov (United States)

    Beurel, Eléonore; Kaidanovich-Beilin, Oksana; Yeh, Wen-I; Song, Ling; Palomo, Valle; Michalek, Suzanne M.; Woodgett, James R.; Harrington, Laurie E.; Eldar-Finkelman, Hagit; Martinez, Ana; Jope, Richard S.

    2013-01-01

    Experimental autoimmune encephalomyelitis (EAE) is a rodent model of multiple sclerosis (MS), a debilitating autoimmune disease of the central nervous system, for which only limited therapeutic interventions are available. Since MS is mediated in part by autoreactive T cells, particularly Th17 and Th1 cells, in the present study, we tested if inhibitors of glycogen synthase kinase-3 (GSK3), previously reported to reduce Th17 cell generation, also alter Th1 cell production or ameliorate EAE. GSK3 inhibitors were found to impede the production of Th1 cells by reducing STAT1 activation. Molecularly reducing the expression of either of the two GSK3 isoforms demonstrated that Th17 cell production was sensitive to reduced levels of GSK3β, and Th1 cell production was inhibited in GSK3α-deficient cells. Administration of the selective GSK3 inhibitors TDZD-8, VP2.51, VP0.7, or L803-mts, significantly reduced the clinical symptoms of MOG35-55-induced EAE in mice, nearly eliminating the chronic progressive phase, and reduced the number of Th17 and Th1 cells in the spinal cord. Administration of TDZD-8 or L803-mts after the initial disease episode ameliorated clinical symptoms in a relapsing/remitting model of PLP139-151-induced EAE. Furthermore, deletion of GSK3β specifically in T cells was sufficient to ameliorate MOG35-55-induced EAE. These results demonstrate isoform-selective effects of GSK3 on T cell generation, therapeutic effects of GSK3 inhibitors in EAE, and that GSK3 inhibition in T cells is sufficient to reduce the severity of EAE, suggesting that GSK3 may be a feasible target for developing new therapeutic interventions for MS. PMID:23606540

  2. Possible Role of the Glycogen Synthase Kinase-3 Signaling Pathway in Trimethyltin-Induced Hippocampal Neurodegeneration in Mice

    Science.gov (United States)

    Kim, Sung-Ho; Kim, Jong-Choon; Wang, Hongbing; Shin, Taekyun; Moon, Changjong

    2013-01-01

    Trimethyltin (TMT) is an organotin compound with potent neurotoxic effects characterized by neuronal destruction in selective regions, including the hippocampus. Glycogen synthase kinase-3 (GSK-3) regulates many cellular processes, and is implicated in several neurodegenerative disorders. In this study, we evaluated the therapeutic effect of lithium, a selective GSK-3 inhibitor, on the hippocampus of adult C57BL/6 mice with TMT treatment (2.6 mg/kg, intraperitoneal [i.p.]) and on cultured hippocampal neurons (12 days in vitro) with TMT treatment (5 µM). Lithium (50 mg/kg, i.p., 0 and 24 h after TMT injection) significantly attenuated TMT-induced hippocampal cell degeneration, seizure, and memory deficits in mice. In cultured hippocampal neurons, lithium treatment (0–10 mM; 1 h before TMT application) significantly reduced TMT-induced cytotoxicity in a dose-dependent manner. Additionally, the dynamic changes in GSK-3/β-catenin signaling were observed in the mouse hippocampus and cultured hippocampal neurons after TMT treatment with or without lithium. Therefore, lithium inhibited the detrimental effects of TMT on the hippocampal neurons in vivo and in vitro, suggesting involvement of the GSK-3/β-catenin signaling pathway in TMT-induced hippocampal cell degeneration and dysfunction. PMID:23940567

  3. Phytoremediation of soils contaminated with radionuclides

    International Nuclear Information System (INIS)

    Yamaguchi, Isamu

    2004-01-01

    Aiming at efficient phytoremediation of soils contaminated with radionuclides, we examined the effect of soil microbes on the uptake ability of plants using the multitracer technique to find that tomato rhizofungi in Fusarium spp. can stimulate the uptake of 85 Sr and 137 Cs by the plants. The synergic effect of a nonpathogenic strain of F. oxysporum on the uptake of radionuclides by plants proved to be enhanced by introducing a phytochelatin synthase gene into the fungus. Since soil contamination by radionuclides is still an unsolved problem in many parts of the world. Studies on phytoremediation of polluted soil environment will be important for developing effective strategies and devising adequate techniques to reduce human risks caused by food contamination of radionuclides. (author)

  4. Molecular size estimation of plasma membrane β-glucan synthase from red beet root

    International Nuclear Information System (INIS)

    Sloan, M.E.; Eiberger, L.L.; Wasserman, B.P.

    1986-01-01

    Cellulose and cell wall β-D-glucans in higher plants are thought to be synthesized by the plasma membrane enzyme, β-glucan synthase. This enzyme has never been purified to homogeneity, hence its subunit composition is unknown. Partial purification of red beet root glucan synthase by glycerol density gradient centrifugation followed by SDS-PAGE yielded a highly enriched subunit of 68 kDa. Radiation inactivation of plasma membranes gave a molecular size the 450 kDa for the holoenzyme complex. This suggests that glucan synthase consists of 6 to 7 subunits and confirms electron microscope studies showing that glucan synthases exist as multi-subunit complexes embedded within the membrane

  5. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  6. Ursolic acid and luteolin-7-glucoside improve lipid profiles and increase liver glycogen content through glycogen synthase kinase-3.

    Science.gov (United States)

    Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina

    2010-06-01

    In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.

  7. SCREENING OF 6-PYRUVOYL-TETRAHYDROPTERIN SYNTHASE ACTIVITY DEFICIENCY AMONG HYPERP HENYLALANINEMIC PATIENTS

    Directory of Open Access Journals (Sweden)

    DURDI QUJEQ

    1999-10-01

    Full Text Available A deficiency of the phenylalanine hydroxylase activity or its cofactor tetrahydrobiopterin may"nlead to hyperphenylalamnemia and as a result, loss of IQ, poor school performance, and"nbehavior problems occurs. Deficiency in 6-pyruvoyl-tetrahydropterin synthase activity is the"nmajor cause of tetrahydrobiopterin deficient phenylketonuria. In this study, blood specimens"nfrom 165 healthy volunteers and 127 children with phenylketonuria were used to determine"nthe 6-pyruvoyl-tetrahydropterin synthase activity. It was found that the activity of 6-"npyruvoyl- tetrahydropterin synthase was decreased in comparison with control [23.46 +/-"n2.94, (mean +/- SD, mmol/ ml/h, n=I27 vs. 127.63 +/- 4.52, n=165, p<0.05]. Results of"nthis study indicate that examination of 6-pyruvoyl-tetrahydropterin synthase activity is helpful"nand may lead to the diagnosis cause of hyperphenylalaninemia.

  8. Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase

    International Nuclear Information System (INIS)

    Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.

    1990-01-01

    The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6

  9. Glycogen synthase kinase-3β facilitates cell apoptosis induced by high fluence low-power laser irradiation through acceleration of Bax translocation

    Science.gov (United States)

    Huang, Lei; Wu, Shengnan; Xing, Da

    2011-03-01

    Glycogen synthase kinase-3β (GSK-3β) is a critical activator of cell apoptosis induced by a diverse array of insults. However, the effects of GSK-3β on the human lung adenocarcinoma cell (ASTC-a-1) apoptosis induced by high fluence low-power laser irradiation (HF-LPLI) are not clear. Here, we showed that GSK-3β was constantly translocated from cytoplasm to nucleus and activated during HF-LPLI-induced cell apoptosis. In addition, we found that co-overexpression of YFP-GSK-3β and CFP-Bax in ASTC-a-1 cells accelerated both Bax translocations to mitochondria and cell apoptosis, compared to the cells expressed CFP-Bax only under HF-LPLI treatment, indicating that GSK-3β facilitated ASTC-a-1 cells apoptosis through acceleration mitochondrial translocation of Bax. Our results demonstrate that GSK-3β exerts some of its pro-apoptotic effects in ASTC-a-1 cells by regulating the mitochondrial localization of Bax, a key component of the intrinsic apoptotic cascade.

  10. Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

    DEFF Research Database (Denmark)

    Højlund, Kurt; Beck-Nielsen, Henning

    2006-01-01

    Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

  11. A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

    Directory of Open Access Journals (Sweden)

    Maiko Furubayashi

    Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

  12. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  13. Cloning and functional characterization of three terpene synthases from lavender (Lavandula angustifolia).

    Science.gov (United States)

    Landmann, Christian; Fink, Barbara; Festner, Maria; Dregus, Márta; Engel, Karl-Heinz; Schwab, Wilfried

    2007-09-15

    The essential oil of lavender (Lavandula angustifolia) is mainly composed of mono- and sesquiterpenes. Using a homology-based PCR strategy, two monoterpene synthases (LaLIMS and LaLINS) and one sesquiterpene synthase (LaBERS) were cloned from lavender leaves and flowers. LaLIMS catalyzed the formation of (R)-(+)-limonene, terpinolene, (1R,5S)-(+)-camphene, (1R,5R)-(+)-alpha-pinene, beta-myrcene and traces of alpha-phellandrene. The proportions of these products changed significantly when Mn(2+) was supplied as the cofactor instead of Mg(2+). The second enzyme LaLINS produced exclusively (R)-(-)-linalool, the main component of lavender essential oil. LaBERS transformed farnesyl diphosphate and represents the first reported trans-alpha-bergamotene synthase. It accepted geranyl diphosphate with higher affinity than farnesyl diphosphate and also produced monoterpenes, albeit at low rates. LaBERS is probably derived from a parental monoterpene synthase by the loss of the plastidial signal peptide and by broadening its substrate acceptance spectrum. The identification and description of the first terpene synthases from L. angustifolia forms the basis for the biotechnological modification of essential oil composition in lavender.

  14. Crystallization and preliminary X-ray crystallographic analysis of strictosidine synthase from Rauvolfia: the first member of a novel enzyme family.

    Science.gov (United States)

    Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim

    2004-10-01

    Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.

  15. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of AMPA receptor signaling

    Science.gov (United States)

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-01-01

    Objectives Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. Methods In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Results Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. Conclusions These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. PMID:27687706

  17. Phospholipids chiral at phosphorus. Steric course of the reactions catalyzed by phosphatidylserine synthase from Escherichia coli and yeast

    International Nuclear Information System (INIS)

    Raetz, C.R.H.; Carman, G.M.; Dowhan, W.; Jiang, R.T.; Waszkuc, W.; Loffredo, W.; Tsai, M.D.

    1987-01-01

    The steric courses of the reactions catalyzed by phosphatidylserine (PS) synthase from Escherichia coli and yeast were elucidated by the following procedure. R/sub P/ and S/sub P/ isomers of 1,2-dipalmitoyl-sn-glycero-3-[ 17 O, 18 O]phosphoethanolamine ([ 17 O, 18 O]DPPE) were synthesized and converted to (R/sub P/)- and (S/sub P/)-1,2-dipalmitoyl-sn-glycero-3-[ 16 O, 17 O, 18 O]DPPA), respectively, by incubating with phospholipase D. Condensation of [ 16 O, 17 O, 18 O]DPPA with cytidine 5'-monophosphomorpholidate in pyridine gave the desired substrate for PS synthase, [ 17 O, 18 O]cytidine 5'-diphospho-1,2-dipalmitoyl-sn-glycerol ([ 17 O, 18 O]CDP-DPG), as a mixture of several isotopic and configurational isomers. Incubation of [ 17 O, 18 O]CDP-DPG), as a mixture of several isotopic and configurational isomers. Incubation of [ 17 O, 18 O] CDP-DPG with a mixture of L-serine, PS synthase and PS decarboxylase gave [ 17 O, 18 O]DPPE. The configuration and isotopic enrichments of the starting [ 17 O, 18 O]DPPE and the product were analyzed by 31 P NMR following trimethylsilylation of the DPPE. The results indicate that the reaction of E. coli PS synthase proceeds with retention of configuration at phosphorus, which suggests a two-step mechanism involving a phosphatidyl-enzyme intermediate, while the yeast PS synthase catalyzes the reaction with inversion of configuration, which suggests a single-displacement mechanism. Such results lend strong support to the ping-pong mechanism proposed for the E. coli enzyme and the sequential Bi-Bi mechanism proposed for the yeast enzyme, both based on previous isotopic exchange experiments

  18. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  19. Crystal structure of 3,4-dihydroxy-2-butanone 4-phosphate synthase of riboflavin biosynthesis

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Calabrese, J.C.; Wawrzak, Z.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    3,4-Dihydroxy-2-butanone-4-phosphate synthase catalyzes a commitment step in the biosynthesis of riboflavin. On the enzyme, ribulose 5-phosphate is converted to 3,4-dihydroxy-2-butanone 4-phosphate and formate in steps involving enolization, ketonization, dehydration, skeleton rearrangement, and formate elimination. The enzyme is absent in humans and an attractive target for the discovery of antimicrobials for pathogens incapable of acquiring sufficient riboflavin from their hosts. The homodimer of 23 kDa subunits requires Mg{sup 2+} for activity. The first three-dimensional structure of the enzyme was determined at 1.4 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on Escherichia coli protein crystals containing gold. The protein consists of an {alpha} + {beta} fold having a complex linkage of {beta} strands. Intersubunit contacts are mediated by numerous hydrophobic interactions and three hydrogen bond networks. A proposed active site was identified on the basis of amino acid residues that are conserved among the enzyme from 19 species. There are two well-separated active sites per dimer, each of which comprise residues from both subunits. In addition to three arginines and two threonines, which may be used for recognizing the phosphate group of the substrate, the active site consists of three glutamates, two aspartates, two histidines, and a cysteine which may provide the means for general acid and base catalysis and for coordinating the Mg{sup 2+} cofactor within the active site.

  20. Maintaining glycogen synthase kinase-3 activity is critical for mTOR kinase inhibitors to inhibit cancer cell growth.

    Science.gov (United States)

    Koo, Junghui; Yue, Ping; Gal, Anthony A; Khuri, Fadlo R; Sun, Shi-Yong

    2014-05-01

    mTOR kinase inhibitors that target both mTORC1 and mTORC2 are being evaluated in cancer clinical trials. Here, we report that glycogen synthase kinase-3 (GSK3) is a critical determinant for the therapeutic response to this class of experimental drugs. Pharmacologic inhibition of GSK3 antagonized their suppressive effects on the growth of cancer cells similarly to genetic attenuation of GSK3. Conversely, expression of a constitutively activated form of GSK3β sensitized cancer cells to mTOR inhibition. Consistent with these findings, higher basal levels of GSK3 activity in a panel of human lung cancer cell lines correlated with more efficacious responses. Mechanistic investigations showed that mTOR kinase inhibitors reduced cyclin D1 levels in a GSK3β-dependent manner, independent of their effects on suppressing mTORC1 signaling and cap binding. Notably, selective inhibition of mTORC2 triggered proteasome-mediated cyclin D1 degradation, suggesting that mTORC2 blockade is responsible for GSK3-dependent reduction of cyclin D1. Silencing expression of the ubiquitin E3 ligase FBX4 rescued this reduction, implicating FBX4 in mediating this effect of mTOR inhibition. Together, our findings define a novel mechanism by which mTORC2 promotes cell growth, with potential implications for understanding the clinical action of mTOR kinase inhibitors. ©2014 AACR.

  1. Optimization of ATP synthase function in mitochondria and chloroplasts via the adenylate kinase equilibrium

    Directory of Open Access Journals (Sweden)

    Abir U Igamberdiev

    2015-01-01

    Full Text Available The bulk of ATP synthesis in plants is performed by ATP synthase, the main bioenergetics engine of cells, operating both in mitochondria and in chloroplasts. The reaction mechanism of ATP synthase has been studied in detail for over half a century; however, its optimal performance depends also on the steady delivery of ATP synthase substrates and the removal of its products. For mitochondrial ATP synthase, we analyze here the provision of stable conditions for (i the supply of ADP and Mg2+, supported by adenylate kinase (AK equilibrium in the intermembrane space, (ii the supply of phosphate via membrane transporter in symport with H+, and (iii the conditions of outflow of ATP by adenylate transporter carrying out the exchange of free adenylates. We also show that, in chloroplasts, AK equilibrates adenylates and governs Mg2+ contents in the stroma, optimizing ATP synthase and Calvin cycle operation, and affecting the import of inorganic phosphate in exchange with triose phosphates. It is argued that chemiosmosis is not the sole component of ATP synthase performance, which also depends on AK-mediated equilibrium of adenylates and Mg2+, adenylate transport and phosphate release and supply.

  2. The crystal structure of human GDP-L-fucose synthase.

    Science.gov (United States)

    Zhou, Huan; Sun, Lihua; Li, Jian; Xu, Chunyan; Yu, Feng; Liu, Yahui; Ji, Chaoneng; He, Jianhua

    2013-09-01

    Human GDP-l-fucose synthase, also known as FX protein, synthesizes GDP-l-fucose from its substrate GDP-4-keto-6-deoxy-d-mannose. The reaction involves epimerization at both C-3 and C-5 followed by an NADPH-dependent reduction of the carbonyl at C-4. In this paper, the first crystal structure of human FX protein was determined at 2.37 Å resolution. The asymmetric unit of the crystal structure contains four molecules which form two homodimers. Each molecule consists of two domains, a Rossmann-fold NADPH-binding motif and a carboxyl terminal domain. Compared with the Escherichia coli GDP-l-fucose synthase, the overall structures of these two enzymes have four major differences. There are four loops in the structure of human FX protein corresponding to two α-helices and two β-sheets in that of the E. coli enzyme. Besides, there are seven different amino acid residues binding with NAPDH comparing human FX protein with that from E. coli. The structure of human FX reveals the key catalytic residues and could be useful for the design of drugs for the treatment of inflammation, auto-immune diseases, and possibly certain types of cancer.

  3. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

  4. Hyperglycemia adversely modulates endothelial nitric oxide synthase during anesthetic preconditioning through tetrahydrobiopterin- and heat shock protein 90-mediated mechanisms.

    Science.gov (United States)

    Amour, Julien; Brzezinska, Anna K; Jager, Zachary; Sullivan, Corbin; Weihrauch, Dorothee; Du, Jianhai; Vladic, Nikolina; Shi, Yang; Warltier, David C; Pratt, Phillip F; Kersten, Judy R

    2010-03-01

    Endothelial nitric oxide synthase activity is regulated by (6R-)5,6,7,8-tetrahydrobiopterin (BH4) and heat shock protein 90. The authors tested the hypothesis that hyperglycemia abolishes anesthetic preconditioning (APC) through BH4- and heat shock protein 90-dependent pathways. Myocardial infarct size was measured in rabbits in the absence or presence of APC (30 min of isoflurane), with or without hyperglycemia, and in the presence or absence of the BH4 precursor sepiapterin. Isoflurane-dependent nitric oxide production was measured (ozone chemiluminescence) in human coronary artery endothelial cells cultured in normal (5.5 mm) or high (20 mm) glucose conditions, with or without sepiapterin (10 or 100 microm). APC decreased myocardial infarct size compared with control experiments (26 +/- 6% vs. 46 +/- 3%, respectively; P < 0.05), and this action was blocked by hyperglycemia (43 +/- 4%). Sepiapterin alone had no effect on infarct size (46 +/- 3%) but restored APC during hyperglycemia (21 +/- 3%). The beneficial actions of sepiapterin to restore APC were blocked by the nitric oxide synthase inhibitor N (G)-nitro-L-arginine methyl ester (47 +/- 2%) and the BH4 synthesis inhibitor N-acetylserotonin (46 +/- 3%). Isoflurane increased nitric oxide production to 177 +/- 13% of baseline, and this action was attenuated by high glucose concentrations (125 +/- 6%). Isoflurane increased, whereas high glucose attenuated intracellular BH4/7,8-dihydrobiopterin (BH2) (high performance liquid chromatography), heat shock protein 90-endothelial nitric oxide synthase colocalization (confocal microscopy) and endothelial nitric oxide synthase activation (immunoblotting). Sepiapterin increased BH4/BH2 and dose-dependently restored nitric oxide production during hyperglycemic conditions (149 +/- 12% and 175 +/- 9%; 10 and 100 microm, respectively). The results indicate that tetrahydrobiopterin and heat shock protein 90-regulated endothelial nitric oxide synthase activity play a central

  5. Post-irradiation inactivation, protection, and repair of the sulfhydryl enzyme malate synthase

    International Nuclear Information System (INIS)

    Durchschlag, H.; Zipper, P.

    1985-01-01

    Malate synthase from baker's yeast, a trimeric sulfhydryl enzyme with one essential sulfhydryl group per subunit, was inactivated by 2 kGy X-irradiation in air-saturated aqueous solution (enzyme concentration: 0.5 mg/ml). The radiation induced changes of enzymic activity were registered at about 0,30,60 h after irradiation. To elucidate the role of OH - , O 2 , and H 2 O 2 in the X-ray inactivation of the enzyme, experiments were performed in the absence of presence of different concentrations of specific additives (formate, superoxide dismutase, catalase). These additives were added to malate synthase solutions before or after X-irradiation. Moreover, repairs of inactivated malate synthase were initiated at about 0 or 30 h after irradiation by means of the sulfhydryl agent dithiothreitol. Experiments yielded the following results: 1. Irradiation of malate synthase in the absence of additives inactivated the enzyme immediately to a residual activity Asub(r)=3% (corresponding to a D 37 =0.6 kGy), and led to further slow inactivation in the post-irradiation phase. Repairs, initiated at different times after irradiation, restored enzymic activity considerably. The repair initiated at t=0 led to Asub(r)=21%; repairs started later on resulted in somewhat lower activities. The decay of reparability, however, was found to progress more slowly than post-irradiation inactivation itself. After completion of repair the activities of repaired samples did not decrease significantly. 2. The presence of specific additives during irradiation caused significant protective effects against primary inactivation. The protection by formate was very pronounced (e.g., Asub(r)=72% and D 37 =6 kGy for 100 mM formate). The presence of catalytic amounts of superoxide dismutase and/or catalase exhibited only minor effects, depending on the presence and concentration of formate. (orig.)

  6. Purification and characterization of CDP-diacylglycerol synthase from Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Kelley, M.J.; Carman, G.M.

    1987-01-01

    The membrane-associated phospholipid biosynthetic enzyme CDP-diacylglycerol synthase (CTP:phosphatidate cytidylyltransferase was purified 2300-fold from Saccharomyces cerevisiae. The purification procedure included Triton X-100 solubilization of mitochondrial membranes, CDP-diacylglycerol-Sepharose affinity chromatography, and hydroxylapatite chromatography. The procedure resulted in a nearly homogeneous enzyme preparation as determined by native and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Radiation inactivation of mitochondrial associated and purified CDP-diacylglycerol synthase suggested that the molecular weight of the native enzyme was 114,000. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the purified enzyme preparation yielded two subunits with molecular weights of 56,000 and 54,000. Antibodies prepared against the purified enzyme immunoprecipitated CDP-diacylglycerol synthase activity and subunits. CDP-diacylglycerol synthase activity was dependent on magnesium ions and Triton X-100 at pH 6.5. Thio-reactive agents inhibited activity. The activation energy for the reaction was 9 kcal/mol, and the enzyme was thermally labile above 30 degrees C. The Km values for CTP and phosphatidate were 1 and 0.5 mM, respectively, and the Vmax was 4700 nmol/min/mg. Results of kinetic and isotopic exchange reactions suggested that the enzyme catalyzes a sequential Bi Bi reaction mechanism

  7. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  8. Evaluation of synthase and hemisynthase activities of glucosamine-6-phosphate synthase by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    Science.gov (United States)

    Gaucher-Wieczorek, Florence; Guérineau, Vincent; Touboul, David; Thétiot-Laurent, Sophie; Pelissier, Franck; Badet-Denisot, Marie-Ange; Badet, Bernard; Durand, Philippe

    2014-08-01

    Glucosamine-6-phosphate synthase (GlmS, EC 2.6.1.16) catalyzes the first and rate-limiting step in the hexosamine biosynthetic pathway, leading to the synthesis of uridine-5'-diphospho-N-acetyl-D-glucosamine, the major building block for the edification of peptidoglycan in bacteria, chitin in fungi, and glycoproteins in mammals. This bisubstrate enzyme converts D-fructose-6-phosphate (Fru-6P) and L-glutamine (Gln) into D-glucosamine-6-phosphate (GlcN-6P) and L-glutamate (Glu), respectively. We previously demonstrated that matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) allows determination of the kinetic parameters of the synthase activity. We propose here to refine the experimental protocol to quantify Glu and GlcN-6P, allowing determination of both hemisynthase and synthase parameters from a single assay kinetic experiment, while avoiding interferences encountered in other assays. It is the first time that MALDI-MS is used to survey the activity of a bisubstrate enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Expression of inducible nitric oxide synthase, caspase-3 and production of reactive oxygen intermediate on endothelial cells culture (HUVECs treated with P. falciparum infected erythrocytes and tumour necrosis factor-α

    Directory of Open Access Journals (Sweden)

    Loeki E. Fitri

    2006-09-01

    Full Text Available Cytoadherence of P. falciparum infected erythrocytes on endothelial cells is a key factor in development of severe malaria. This process may associated with the activation of local immune that was enhanced by tumour necrosis factor-α (TNF-α. This study was conducted to see the influence of P.falciparum infected erythrocytes cytoadherence and TNF-α treatment in inducing endothelial cells activation in vitro. inducible nitric oxide synthase (iNOS and caspase-3 expression, also reactive oxygen intermediate (ROI production were used as parameters. An Experimental laboratory study had been done to observe endothelial cells activation (HUVECs after treatment with TNF-α for 20 hours or P. falciparum infected erythrocytes for 1 hour or both of them. Normal endothelial cells culture had been used as a control. Using immunocytochemistry local immune activation of endothelial cells was determined by iNOS and caspase-3 expression. Nitro Blue Tetrazolium reduction-assay was conducted to see the ROI production semi quantitatively. inducible nitric oxide synthase expression only found on endothelial cells culture treated with P. falciparum infected erythrocytes or both P. falciparum infected erythrocytes and TNF-α. Caspase-3 expression found slightly on normal endothelial cells culture. This expression increased significantly on endothelial cells culture treated with both P.falciparum infected erythrocytes and TNF-α (p=0.000. The normal endothelial cells release low level of ROI in the presence of non-specific trigger, PMA. In the presence of P. falciparum infected erythrocytes or TNF-α or both of them, some cells showed medium to high levels of ROI. Cytoadherence of P. falciparum infected erythrocytes and TNF α treatment on endothelial cells can induce activation of local immune marked by increase inducible nitric oxide synthase and release of free radicals that cause cell damage. (Med J Indones 2006; 15:151-6 Keywords: P.falciparum ,HUVECs, TNF-α, i

  10. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  11. Identification of a Glycogen Synthase Kinase-3[beta] Inhibitor that Attenuates Hyperactivity in CLOCK Mutant Mice

    Energy Technology Data Exchange (ETDEWEB)

    Kozikowski, Alan P.; Gunosewoyo, Hendra; Guo, Songpo; Gaisina, Irina N.; Walter, Richard L.; Ketcherside, Ariel; McClung, Colleen A.; Mesecar, Andrew D.; Caldarone, Barbara (Psychogenics); (Purdue); (UIC); (UTSMC)

    2012-05-02

    Bipolar disorder is characterized by a cycle of mania and depression, which affects approximately 5 million people in the United States. Current treatment regimes include the so-called 'mood-stabilizing drugs', such as lithium and valproate that are relatively dated drugs with various known side effects. Glycogen synthase kinase-3{beta} (GSK-3{beta}) plays a central role in regulating circadian rhythms, and lithium is known to be a direct inhibitor of GSK-3{beta}. We designed a series of second generation benzofuran-3-yl-(indol-3-yl)maleimides containing a piperidine ring that possess IC{sub 50} values in the range of 4 to 680 nM against human GSK-3{beta}. One of these compounds exhibits reasonable kinase selectivity and promising preliminary absorption, distribution, metabolism, and excretion (ADME) data. The administration of this compound at doses of 10 to 25 mg kg{sup -1} resulted in the attenuation of hyperactivity in amphetamine/chlordiazepoxide-induced manic-like mice together with enhancement of prepulse inhibition, similar to the effects found for valproate (400 mg kg{sup -1}) and the antipsychotic haloperidol (1 mg kg{sup -1}). We also tested this compound in mice carrying a mutation in the central transcriptional activator of molecular rhythms, the CLOCK gene, and found that the same compound attenuates locomotor hyperactivity in response to novelty. This study further demonstrates the use of inhibitors of GSK-3{beta} in the treatment of manic episodes of bipolar/mood disorders, thus further validating GSK-3{beta} as a relevant therapeutic target in the identification of new therapies for bipolar patients.

  12. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  13. Increased killing of SCCVII squamous cell carcinoma cells after the combination of Pc 4 photodynamic therapy and dasatinib is associated with enhanced caspase-3 activity and ceramide synthase 1 upregulation

    Science.gov (United States)

    SEPAROVIC, DUSKA; BREEN, PAUL; BOPPANA, NITHIN B.; VAN BUREN, ERIC; JOSEPH, NICHOLAS; KRAVEKA, JACQUELINE M.; RAHMANIYAN, MEHRDAD; LI, LI; GUDZ, TATYANA I.; BIELAWSKA, ALICJA; BAI, AIPING; BIELAWSKI, JACEK; PIERCE, JASON S.; KORBELIK, MLADEN

    2013-01-01

    Photodynamic therapy (PDT) is not always effective as an anticancer treatment, therefore, PDT is combined with other anticancer agents for improved efficacy. The combination of dasatinib and PDT with the silicone phthalocyanine photosensitizer Pc 4 was assessed for increased killing of SCCVII mouse squamous cell carcinoma cells, a preclinical model of head and neck squamous cell carcinoma, using apoptotic markers and colony formation as experimental end-points. Because each of these treatments regulates the metabolism of the sphingolipid ceramide, their effects on mRNA levels of ceramide synthase, a ceramide-producing enzyme, and the sphingolipid profile were determined. PDT + dasatinib induced an additive loss of clonogenicity. Unlike PDT alone or PDT + dasatinib, dasatinib induced zVAD-fmk-dependent cell killing. PDT or dasatinib-induced caspase-3 activation was potentiated after the combination. PDT alone induced mitochondrial depolarization, and the effect was inhibited after the combination. Annexin V+ and propidium iodide+ cells remained at control levels after treatments. In contrast to PDT alone, dasatinib induced upregulation of ceramide synthase 1 mRNA, and the effect was enhanced after the combination. Dasatinib induced a modest increase in C20:1-and C22-ceramide but had no effect on total ceramide levels. PDT increased the levels of 12 individual ceramides and total ceramides, and the addition of dasatinib did not affect these increases. PDT alone decreased substantially sphingosine levels and inhibited the activity of acid ceramidase, an enzyme that converts ceramide to sphingosine. The data suggest that PDT-induced increases in ceramide levels do not correlate with ceramide synthase mRNA levels but rather with inhibition of ceramidase. Cell killing was zVAD-fmk-sensitive after dasatinib but not after either PDT or the combination and enhanced cell killing after the combination correlated with potentiated caspase-3 activation and upregulation of

  14. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  15. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    International Nuclear Information System (INIS)

    Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano; Macone, Alberto; Boffi, Alberto; Ilari, Andrea

    2008-01-01

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to the trigonal space group P3 1 21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction

  16. Constitutive nitric oxide synthase (cNOS activity in Langerhans islets from streptozotocin diabetic rats

    Directory of Open Access Journals (Sweden)

    Fonovich de Schroeder T.M.

    1998-01-01

    Full Text Available Nitric oxide synthase activity was measured in Langerhans islets isolated from control and streptozotocin diabetic rats. The activity of the enzyme was linear up to 150 µg of protein from control rats and was optimal at 0.1 µM calcium, when it was measured after 45 min of incubation at 37oC in the presence of 200 µM arginine. Specific activity of the enzyme was 25 x 10-4 nmol [3H]citrulline 45 min-1 mg protein-1. Streptozotocin diabetic rats exhibited less enzyme activity both in total pancreas homogenate and in isolated Langerhans islets when compared to control animals. Nitric oxide synthase activity measured in control and diabetic rats 15 days after the last streptozotocin injection in the second group of animals corresponded only to a constitutive enzyme since it was not inhibited by aminoguanidine in any of the mentioned groups. Hyperglycemia in diabetic rats may be the consequence of impaired insulin release caused at least in part by reduced positive modulation mediated by constitutive nitric oxide synthase activity, which was dramatically reduced in islets severely damaged after streptozotocin treatment.

  17. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  18. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  19. Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro [School of Pharmaceutical Sciences, University of Shizuoka and the COE21 Program, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-07-01

    An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  20. Impairments in cognition and neural precursor cell proliferation in mice expressing constitutively active glycogen synthase kinase-3

    Directory of Open Access Journals (Sweden)

    Marta ePardo

    2015-03-01

    Full Text Available ABSTRACTBrain glycogen synthase kinase-3 (GSK3 is hyperactive in several neurological conditions that involve impairments in both cognition and neurogenesis. This raises the hypotheses that hyperactive GSK3 may directly contribute to impaired cognition, and that this may be related to deficiencies in neural precursor cells (NPC. To study the effects of hyperactive GSK3 in the absence of disease influences, we compared adult hippocampal NPC proliferation and performance in three cognitive tasks in male and female wild-type mice and GSK3 knockin mice, which express constitutively active GSK3. NPC proliferation was ~40% deficient in both male and female GSK3 knockin mice compared with wild-type mice. Environmental enrichment (EE increased NPC proliferation in male, but not female, GSK3 knockin mice and wild-type mice. Male and female GSK3 knockin mice exhibited impairments in novel object recognition, temporal order memory, and coordinate spatial processing compared with gender-matched wild-type mice. EE restored impaired novel object recognition and temporal ordering in both sexes of GSK3 knockin mice, indicating that this repair was not dependent on NPC proliferation, which was not increased by EE in female GSK3 knockin mice. Acute 1 hr pretreatment with the GSK3 inhibitor TDZD-8 also improved novel object recognition and temporal ordering in male and female GSK3 knockin mice. These findings demonstrate that hyperactive GSK3 is sufficient to impair adult hippocampal NPC proliferation and to impair performance in three cognitive tasks in both male and female mice, but these changes in NPC proliferation do not directly regulate novel object recognition and temporal ordering tasks.

  1. Trapping of intermediates with substrate analog HBOCoA in the polymerizations catalyzed by class III polyhydroxybutyrate (PHB) synthase from Allochromatium vinosum.

    Science.gov (United States)

    Chen, Chao; Cao, Ruikai; Shrestha, Ruben; Ward, Christina; Katz, Benjamin B; Fischer, Christopher J; Tomich, John M; Li, Ping

    2015-05-15

    Polyhydroxybutyrate (PHB) synthases (PhaCs) catalyze the formation of biodegradable PHB polymers that are considered as an ideal alternative to petroleum-based plastics. To provide strong evidence for the preferred mechanistic model involving covalent and noncovalent intermediates, a substrate analog HBOCoA was synthesized chemoenzymatically. Substitution of sulfur in the native substrate HBCoA with an oxygen in HBOCoA enabled detection of (HB)nOCoA (n = 2-6) intermediates when the polymerization was catalyzed by wild-type (wt-)PhaECAv at 5.84 h(-1). This extremely slow rate is due to thermodynamically unfavorable steps that involve the formation of enzyme-bound PHB species (thioesters) from corresponding CoA oxoesters. Synthesized standards (HB)nOCoA (n = 2-3) were found to undergo both reacylation and hydrolysis catalyzed by the synthase. Distribution of the hydrolysis products highlights the importance of the penultimate ester group as previously suggested. Importantly, the reaction between primed synthase [(3)H]-sT-PhaECAv and HBOCoA yielded [(3)H]-sTet-O-CoA at a rate constant faster than 17.4 s(-1), which represents the first example that a substrate analog undergoes PHB chain elongation at a rate close to that of the native substrate (65.0 s(-1)). Therefore, for the first time with a wt-synthase, strong evidence was obtained to support our favored PHB chain elongation model.

  2. Glycogen synthase kinase-3 (GSK3) regulates TNF production and haemocyte phagocytosis in the immune response of Chinese mitten crab Eriocheir sinensis.

    Science.gov (United States)

    Li, Xiaowei; Jia, Zhihao; Wang, Weilin; Wang, Lingling; Liu, Zhaoqun; Yang, Bin; Jia, Yunke; Song, Xiaorui; Yi, Qilin; Qiu, Limei; Song, Linsheng

    2017-08-01

    Glycogen synthase kinase-3 (GSK3) is a serine/threonine protein kinase firstly identified as a regulator of glycogen synthesis. Recently, it has been proved to be a key regulator of the immune reaction. In the present study, a GSK3 homolog gene (designated as EsGSK3) was cloned from Chinese mitten crab, Eriocheir sinensis. The open reading frame (ORF) was 1824 bp, which encoded a predicted polypeptide of 607 amino acids. There was a conserved Serine/Threonine Kinase domain and a DNA binding domain found in EsGSK3. Phylogenetic analysis showed that EsGSK3 was firstly clustered with GSK3-β from oriental river prawn Macrobrachium nipponense in the invertebrate branch, while GSK3s from vertebrates formed the other distinct branch. EsGSK3 mRNA transcripts could be detected in all tested tissues of the crab including haepatopancreas, eyestalk, muscle, gonad, haemocytes and haematopoietic tissue with the highest expression level in haepatopancreas. And EsGSK3 protein was mostly detected in the cytoplasm of haemocyte by immunofluorescence analysis. The expression levels of EsGSK3 mRNA increased significantly at 6 h after Aeromonas hydrophila challenge (p level at 48 h (p > 0.05). The mRNA expression of lipopolysaccharide-induced tumor necrosis factor (TNF)-α factor (EsLITAF) was also induced by A. hydrophila challenge. However, the mRNA expression of EsLITAF and TNF-α production was significantly suppressed after EsGSK3 was blocked in vivo with specific inhibitor lithium, while the phagocytosis of crab haemocytes was significantly promoted. These results collectively demonstrated that EsGSK3 could regulate the innate immune responses of E. sinensis by promoting TNF-α production and inhibiting haemocyte phagocytosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Assembly factors of F1FO-ATP synthase across genomes

    Czech Academy of Sciences Publication Activity Database

    Pícková, Andrea; Potocký, Martin; Houštěk, Josef

    2005-01-01

    Roč. 59, č. 3 (2005), s. 393-402 ISSN 0887-3585 R&D Projects: GA MŠk(CZ) 1M0520; GA MZd(CZ) NR7790 Grant - others:GA UK(CZ) 12/2002; GA UK(CZ) 11/2004; EC Framework Programme(XE) LSHM-CT-2004-503116 Institutional research plan: CEZ:AV0Z50110509 Keywords : assembly * ATP synthase * phylogenetic and sequence analysis Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 4.684, year: 2005

  4. ATP Synthase, a Target for Dementia and Aging?

    Science.gov (United States)

    Larrick, James W; Larrick, Jasmine W; Mendelsohn, Andrew R

    2018-02-01

    Advancing age is the biggest risk factor for development for the major life-threatening diseases in industrialized nations accounting for >90% of deaths. Alzheimer's dementia (AD) is among the most devastating. Currently approved therapies fail to slow progression of the disease, providing only modest improvements in memory. Recently reported work describes mechanistic studies of J147, a promising therapeutic molecule previously shown to rescue the severe cognitive deficits exhibited by aged, transgenic AD mice. Apparently, J147 targets the mitochondrial alpha-F1-ATP synthase (ATP5A). Modest inhibition of the ATP synthase modulates intracellular calcium to activate AMP-activated protein kinase to inhibit mammalian target of rapamycin, a known mechanism of lifespan extension from worms to mammals.

  5. Phosphoproteomics reveals that glycogen synthase kinase-3 phosphorylates multiple splicing factors and is associated with alternative splicing

    Science.gov (United States)

    Shinde, Mansi Y.; Sidoli, Simone; Kulej, Katarzyna; Mallory, Michael J.; Radens, Caleb M.; Reicherter, Amanda L.; Myers, Rebecca L.; Barash, Yoseph; Lynch, Kristen W.; Garcia, Benjamin A.; Klein, Peter S.

    2017-01-01

    Glycogen synthase kinase-3 (GSK-3) is a constitutively active, ubiquitously expressed protein kinase that regulates multiple signaling pathways. In vitro kinase assays and genetic and pharmacological manipulations of GSK-3 have identified more than 100 putative GSK-3 substrates in diverse cell types. Many more have been predicted on the basis of a recurrent GSK-3 consensus motif ((pS/pT)XXX(S/T)), but this prediction has not been tested by analyzing the GSK-3 phosphoproteome. Using stable isotope labeling of amino acids in culture (SILAC) and MS techniques to analyze the repertoire of GSK-3–dependent phosphorylation in mouse embryonic stem cells (ESCs), we found that ∼2.4% of (pS/pT)XXX(S/T) sites are phosphorylated in a GSK-3–dependent manner. A comparison of WT and Gsk3a;Gsk3b knock-out (Gsk3 DKO) ESCs revealed prominent GSK-3–dependent phosphorylation of multiple splicing factors and regulators of RNA biosynthesis as well as proteins that regulate transcription, translation, and cell division. Gsk3 DKO reduced phosphorylation of the splicing factors RBM8A, SRSF9, and PSF as well as the nucleolar proteins NPM1 and PHF6, and recombinant GSK-3β phosphorylated these proteins in vitro. RNA-Seq of WT and Gsk3 DKO ESCs identified ∼190 genes that are alternatively spliced in a GSK-3–dependent manner, supporting a broad role for GSK-3 in regulating alternative splicing. The MS data also identified posttranscriptional regulation of protein abundance by GSK-3, with ∼47 proteins (1.4%) whose levels increased and ∼78 (2.4%) whose levels decreased in the absence of GSK-3. This study provides the first unbiased analysis of the GSK-3 phosphoproteome and strong evidence that GSK-3 broadly regulates alternative splicing. PMID:28916722

  6. Selectivity of the surface binding site (SBS) on barley starch synthase I

    DEFF Research Database (Denmark)

    Wilkens, Casper; Cuesta-Seijo, Jose A.; Palcic, Monica

    2014-01-01

    Starch synthase I (SSI) from various sources has been shown to preferentially elongate branch chains of degree of polymerisation (DP) from 6–7 to produce chains of DP 8–12. In the recently determined crystal structure of barley starch synthase I (HvSSI) a so-called surface binding site (SBS) was ...

  7. The Antimalarial Effect of Curcumin Is Mediated by the Inhibition of Glycogen Synthase Kinase-3β.

    Science.gov (United States)

    Ali, Amatul Hamizah; Sudi, Suhaini; Basir, Rusliza; Embi, Noor; Sidek, Hasidah Mohd

    2017-02-01

    Curcumin, a bioactive compound in Curcuma longa, exhibits various pharmacological activities, including antimalarial effects. In silico docking simulation studies suggest that curcumin possesses glycogen synthase kinase-3β (GSK3β)-inhibitory properties. The involvement of GSK3 in the antimalarial effects in vivo is yet to be demonstrated. In this study, we aimed to evaluate whether the antimalarial effects of curcumin involve phosphorylation of host GSK3β. Intraperitoneal administration of curcumin into Plasmodium berghei NK65-infected mice resulted in dose-dependent chemosuppression of parasitemia development. At the highest dose tested (30 mg/kg body weight), both therapeutic and prophylactic administrations of curcumin resulted in suppression exceeding 50% and improved median survival time of infected mice compared to control. Western analysis revealed a 5.5-fold (therapeutic group) and 1.8-fold (prophylactic group) increase in phosphorylation of Ser 9 GSK3β and 1.6-fold (therapeutic group) and 1.7-fold (prophylactic group) increase in Ser 473 Akt in liver of curcumin-treated infected animals. Following P. berghei infection, levels of pro- and anti-inflammatory cytokines, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, interleukin (IL)-10, and IL-4 were elevated by 7.5-, 35.0-, 33.0-, and 2.2-fold, respectively. Curcumin treatment (therapeutic) caused a significant decrease (by 6.0- and 2.0-fold, respectively) in serum TNF-α and IFN-γ level, while IL-10 and IL-4 were elevated (by 1.4- and 1.8-fold). Findings from the present study demonstrate for the first time that the antimalarial action of curcumin involved inhibition of GSK3β.

  8. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  9. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  10. Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

    Science.gov (United States)

    Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

    2015-01-01

    Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

  11. Glycogen synthase kinase 3 (GSK3) in the heart: a point of integration in hypertrophic signalling and a therapeutic target? A critical analysis.

    Science.gov (United States)

    Sugden, P H; Fuller, S J; Weiss, S C; Clerk, A

    2008-03-01

    Glycogen synthase kinase 3 (GSK3, of which there are two isoforms, GSK3alpha and GSK3beta) was originally characterized in the context of regulation of glycogen metabolism, though it is now known to regulate many other cellular processes. Phosphorylation of GSK3alpha(Ser21) and GSK3beta(Ser9) inhibits their activity. In the heart, emphasis has been placed particularly on GSK3beta, rather than GSK3alpha. Importantly, catalytically-active GSK3 generally restrains gene expression and, in the heart, catalytically-active GSK3 has been implicated in anti-hypertrophic signalling. Inhibition of GSK3 results in changes in the activities of transcription and translation factors in the heart and promotes hypertrophic responses, and it is generally assumed that signal transduction from hypertrophic stimuli to GSK3 passes primarily through protein kinase B/Akt (PKB/Akt). However, recent data suggest that the situation is far more complex. We review evidence pertaining to the role of GSK3 in the myocardium and discuss effects of genetic manipulation of GSK3 activity in vivo. We also discuss the signalling pathways potentially regulating GSK3 activity and propose that, depending on the stimulus, phosphorylation of GSK3 is independent of PKB/Akt. Potential GSK3 substrates studied in relation to myocardial hypertrophy include nuclear factors of activated T cells, beta-catenin, GATA4, myocardin, CREB, and eukaryotic initiation factor 2Bvarepsilon. These and other transcription factor substrates putatively important in the heart are considered. We discuss whether cardiac pathologies could be treated by therapeutic intervention at the GSK3 level but conclude that any intervention would be premature without greater understanding of the precise role of GSK3 in cardiac processes.

  12. Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer

    Science.gov (United States)

    Abu-Soud, Husam M.; Stuehr, Dennis J.

    1993-11-01

    Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.

  13. Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

    Science.gov (United States)

    Gauba, Esha; Guo, Lan; Du, Heng

    2017-01-01

    Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

  14. Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

    Directory of Open Access Journals (Sweden)

    Ro Dae-Kyun

    2009-07-01

    Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

  15. Cytidine triphosphate synthase activity and mRNA expression in normal human blood cells

    NARCIS (Netherlands)

    Verschuur, A. C.; van Gennip, A. H.; Muller, E. J.; Voûte, P. A.; Vreken, P.; van Kuilenburg, A. B.

    1999-01-01

    Cytidine triphosphate (CTP) synthase is one of the key enzymes in pyrimidine nucleotide anabolic pathways. The activity of this enzyme is elevated in various malignancies including acute lymphocytic leukemia (ALL). In this study we investigated the activity of CTP synthase in various human blood

  16. Isolation, characterization, and mechanistic studies of (-)-alpha-gurjunene synthase from Solidago canadensis.

    Science.gov (United States)

    Schmidt, C O; Bouwmeester, H J; Bülow, N; König, W A

    1999-04-15

    The leaves of the composite Solidago canadensis (goldenrod) were shown to contain (-)-alpha-gurjunene synthase activity. This sesquiterpene is likely to be the precursor for cyclocolorenone, a sesquiterpene ketone present in high amounts in S. canadensis leaves. (-)-alpha-Gurjunene synthase was purified to apparent homogeneity (741-fold) by anion-exchange chromatography (on several matrices), dye ligand chromatography, hydroxylapatite chromatography, and gel filtration. Chromatography on a gel filtration matrix indicated a native molecular mass of 48 kDa, and SDS-PAGE showed the enzyme to be composed of one subunit with a denatured mass of 60 kDa. Its maximum activity was observed at pH 7.8 in the presence of 10 mM Mg2+ and the KM value for the substrate farnesyl diphosphate was 5.5 microM. Over a range of purification steps (-)-alpha-gurjunene and (+)-gamma-gurjunene synthase activities copurified. In addition, the product ratio of the enzyme activity under several different assay conditions was always 91% (-)-alpha-gurjunene and 9% (+)-gamma-gurjunene. This suggests that the formation of these two structurally related products is catalyzed by one enzyme. For further confirmation, we carried out a number of mechanistic studies with (-)-alpha-gurjunene synthase, in which an enzyme preparation was incubated with deuterated substrate analogues. Based on mass spectrometry analysis of the products formed, a cyclization mechanism was postulated which makes it plausible that the synthase catalyzes the formation of both sesquiterpenes. Copyright 1999 Academic Press.

  17. Functional and Structural Characterization of a (+)-Limonene Synthase from Citrus sinensis.

    Science.gov (United States)

    Morehouse, Benjamin R; Kumar, Ramasamy P; Matos, Jason O; Olsen, Sarah Naomi; Entova, Sonya; Oprian, Daniel D

    2017-03-28

    Terpenes make up the largest and most diverse class of natural compounds and have important commercial and medical applications. Limonene is a cyclic monoterpene (C 10 ) present in nature as two enantiomers, (+) and (-), which are produced by different enzymes. The mechanism of production of the (-)-enantiomer has been studied in great detail, but to understand how enantiomeric selectivity is achieved in this class of enzymes, it is important to develop a thorough biochemical description of enzymes that generate (+)-limonene, as well. Here we report the first cloning and biochemical characterization of a (+)-limonene synthase from navel orange (Citrus sinensis). The enzyme obeys classical Michaelis-Menten kinetics and produces exclusively the (+)-enantiomer. We have determined the crystal structure of the apoprotein in an "open" conformation at 2.3 Å resolution. Comparison with the structure of (-)-limonene synthase (Mentha spicata), which is representative of a fully closed conformation (Protein Data Bank entry 2ONG ), reveals that the short H-α1 helix moves nearly 5 Å inward upon substrate binding, and a conserved Tyr flips to point its hydroxyl group into the active site.

  18. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  19. Glycogen synthase kinase-3: a key kinase in retinal neuron apoptosis in early diabetic retinopathy

    Institute of Scientific and Technical Information of China (English)

    Li Zhaohui; Ma Ling; Chen Xiaodong; Li Yonghao; Li Shiyi; Zhang Jinglin; Lu Lin

    2014-01-01

    Background Diabetes-related pathogenic factors can cause retinal ganglion cell (RGC) apoptosis,but the specific mechanism is not very clear.The aim of this study is to investigate the correlation between glycogen synthase kinase-3 (GSK-3) activation and retinal neuron apoptosis.Methods In an in vitro experiment,the number of apoptotic RGC-5 cells differentiated by staurosporine was evaluated via flow cytometry and nuclei staining using Hoechst 33258.GSK-3 phosphorylation and caspase-3 activation in RGC-5 cells after serum deprivation were determined using Western blotting.Mitochondrial membrane potential was detected using the dye 5,5',6,6'-tetrachloro-1,1',3,3'-tetrethyl benzimidalyl carbocyanine iodide,and reactive oxygen species (ROS) levels were measured with dihydroethidium.In an in vivo experiment,the number of apoptotic retinal neurons was evaluated via terminal transferase dUTP nick-end labeling (TUNEL),and GSK-3 phosphorylation was determined using Western blotting,in the retinal nerve epithelial tissue of rats in which diabetes was induced by intravenous tail-vein injection of streptozotocin for 4 weeks.Results The levels of phosphorylated Ser21/9 in GSK-3α/β and p-T308/S473-AKT were lower and the cleaved caspase-3 levels were higher in the serum-deprived model (P <0.05).Lithium chloride treatment was associated with a slower rate of apoptosis,increased mitochondrial membrane potential,and decreased ROS levels in differentiated RGC-5 cells (P <0.05).The level of blood glucose and the number of TUNEL-positive cells in the whole-mounted retinas were higher (P <0.01),and the levels of phosphorylated Ser21/9 in GSK-3α/β and body weight were lower (P <0.05).However,the thickness of the retinal nerve epithelial layer was not significantly less in diabetic rats compared with control group.Lithium chloride intravitreal injection increased the levels of phosphorylated Ser21/9 in GSK-3α/β and decreased TUNEL-positive cells in the whole-mounted retinas

  20. Cloning and expression of pineapple sucrose- phosphate synthase ...

    African Journals Online (AJOL)

    hope&shola

    2010-12-06

    Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

  1. Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

    Science.gov (United States)

    Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

    2016-04-01

    Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Cyclic [G(2′,5′)pA(3′,5′)p] Is the Metazoan Second Messenger Produced by DNA-Activated Cyclic GMP-AMP Synthase

    OpenAIRE

    Gao, Pu; Ascano, Manuel; Wu, Yang; Barchet, Winfried; Gaffney, Barbara L.; Zillinger, Thomas; Serganov, Artem A.; Liu, Yizhou; Jones, Roger A.; Hartmann, Gunther; Tuschl, Thomas; Patel, Dinshaw J.

    2013-01-01

    Recent studies identified cyclic GMP-AMP (cGAMP) as a metazoan second messenger triggering an interferon response. cGAMP is generated from GTP and ATP by cytoplasmic dsDNA sensor cGAMP synthase (cGAS). We combined structural, chemical, biochemical, and cellular assays to demonstrate that this second messenger contains G(2′,5′)pA and A(3′,5′)pG phosphodiester linkages, designated c[G(2′,5′) pA(3′,5′)p]. We show that, upon dsDNA binding, cGAS is activated through conformational transitions, res...

  3. Multi-substrate terpene synthases: their occurrence and physiological significance

    Directory of Open Access Journals (Sweden)

    Leila Pazouki

    2016-07-01

    Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.

  4. Longevity in vivo of primary cell wall cellulose synthases.

    Science.gov (United States)

    Hill, Joseph Lee; Josephs, Cooper; Barnes, William J; Anderson, Charles T; Tien, Ming

    2018-02-01

    Our work focuses on understanding the lifetime and thus stability of the three main cellulose synthase (CESA) proteins involved in primary cell wall synthesis of Arabidopsis. It had long been thought that a major means of CESA regulation was via their rapid degradation. However, our studies here have uncovered that AtCESA proteins are not rapidly degraded. Rather, they persist for an extended time in the plant cell. Plant cellulose is synthesized by membrane-embedded cellulose synthase complexes (CSCs). The CSC is composed of cellulose synthases (CESAs), of which three distinct isozymes form the primary cell wall CSC and another set of three isozymes form the secondary cell wall CSC. We determined the stability over time of primary cell wall (PCW) CESAs in Arabidopsis thaliana seedlings, using immunoblotting after inhibiting protein synthesis with cycloheximide treatment. Our work reveals very slow turnover for the Arabidopsis PCW CESAs in vivo. Additionally, we show that the stability of all three CESAs within the PCW CSC is altered by mutations in individual CESAs, elevated temperature, and light conditions. Together, these results suggest that CESA proteins are very stable in vivo, but that their lifetimes can be modulated by intrinsic and environmental cues.

  5. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2017-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  6. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  7. ATP Synthase Deficiency due to TMEM70 Mutation Leads to Ultrastructural Mitochondrial Degeneration and Is Amenable to Treatment

    Directory of Open Access Journals (Sweden)

    Anne K. Braczynski

    2015-01-01

    Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.

  8. Isolation and characterization of beta-glucan synthase: A potential biochemical regulator of gravistimulated differential cell wall loosening

    Science.gov (United States)

    Kuzmanoff, K. M.

    1984-01-01

    In plants, gravity stimulates differential growth in the upper and lower halves of horizontally oriented organs. Auxin regulation of cell wall loosening and elongation is the basis for most models of this phenomenon. Auxin treatment of pea stem tissue rapidly increases the activity of Golgi-localized Beta-1,4-glucan synthase, an enzyme involved in biosynthesis of wall xyloglucan which apparently constitutes the substrate for the wall loosening process. The primary objective is to determine if auxin induces de novo formation of Golgi glucan synthase and increases the level of this glucan synthase mRNA. This shall be accomplished by (a) preparation of a monoclonal antibody to the synthase, (b) isolation, and characterization of the glucan synthase, and (c) examination for cross reactivity between the antibody and translation products of auxin induced mRNAs in pea tissue. The antibody will also be used to localize the glucan synthase in upper and lower halves of pea stem tissue before, during and after the response to gravity.

  9. A novel 5-enolpyruvylshikimate-3-phosphate synthase from Rahnella aquatilis with significantly reduced glyphosate sensitivity.

    Directory of Open Access Journals (Sweden)

    Ri-He Peng

    Full Text Available The 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19 is a key enzyme in the shikimate pathway for the production of aromatic amino acids and chorismate-derived secondary metabolites in plants, fungi, and microorganisms. It is also the target of the broad-spectrum herbicide glyphosate. Natural glyphosate resistance is generally thought to occur within microorganisms in a strong selective pressure condition. Rahnella aquatilis strain GR20, an antagonist against pathogenic agrobacterial strains of grape crown gall, was isolated from the rhizosphere of grape in glyphosate-contaminated vineyards. A novel gene encoding EPSPS was identified from the isolated bacterium by complementation of an Escherichia coli auxotrophic aroA mutant. The EPSPS, named AroA(R. aquatilis, was expressed and purified from E. coli, and key kinetic values were determined. The full-length enzyme exhibited higher tolerance to glyphosate than the E. coli EPSPS (AroA(E. coli, while retaining high affinity for the substrate phosphoenolpyruvate. Transgenic plants of AroA(R. aquatilis were also observed to be more resistant to glyphosate at a concentration of 5 mM than that of AroA(E. coli. To probe the sites contributing to increased tolerance to glyphosate, mutant R. aquatilis EPSPS enzymes were produced with the c-strand of subdomain 3 and the f-strand of subdomain 5 (Thr38Lys, Arg40Val, Arg222Gln, Ser224Val, Ile225Val, and Gln226Lys substituted by the corresponding region of the E. coli EPSPS. The mutant enzyme exhibited greater sensitivity to glyphosate than the wild type R. aquatilis EPSPS with little change of affinity for its first substrate, shikimate-3-phosphate (S3P and phosphoenolpyruvate (PEP. The effect of the residues on subdomain 5 on glyphosate resistance was more obvious.

  10. Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

    Science.gov (United States)

    Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

    2017-07-01

    Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  11. Improved crystallization of Escherichia coli ATP synthase catalytic complex (F1) by introducing a phosphomimetic mutation in subunit ∊

    International Nuclear Information System (INIS)

    Roy, Ankoor; Hutcheon, Marcus L.; Duncan, Thomas M.; Cingolani, Gino

    2012-01-01

    A phosphomimetic mutation in subunit ∊ dramatically increases reproducibility for crystallization of Escherichia coli ATP synthase catalytic complex (F 1 ) (subunit composition α 3 β 3 γ∊). Diffraction data were collected to ∼3.15 Å resolution using synchrotron radiation. The bacterial ATP synthase (F O F 1 ) of Escherichia coli has been the prominent model system for genetics, biochemical and more recently single-molecule studies on F-type ATP synthases. With 22 total polypeptide chains (total mass of ∼529 kDa), E. coli F O F 1 represents nature’s smallest rotary motor, composed of a membrane-embedded proton transporter (F O ) and a peripheral catalytic complex (F 1 ). The ATPase activity of isolated F 1 is fully expressed by the α 3 β 3 γ ‘core’, whereas single δ and ∊ subunits are required for structural and functional coupling of E. coli F 1 to F O . In contrast to mitochondrial F 1 -ATPases that have been determined to atomic resolution, the bacterial homologues have proven very difficult to crystallize. In this paper, we describe a biochemical strategy that led us to improve the crystallogenesis of the E. coli F 1 -ATPase catalytic core. Destabilizing the compact conformation of ∊’s C-terminal domain with a phosphomimetic mutation (∊S65D) dramatically increased crystallization success and reproducibility, yielding crystals of E. coli F 1 that diffract to ∼3.15 Å resolution

  12. Broad Substrate Specificity of the Loading Didomain of the Lipomycin Polyketide Synthase

    Energy Technology Data Exchange (ETDEWEB)

    Yuzawa, S; Eng, CH; Katz, L; Keasling, JD

    2013-06-04

    LipPks1, a polyketide synthase subunit of the lipomycin synthase, is believed to catalyze the polyketide chain initiation reaction using isobutyryl-CoA as a substrate, followed by an elongation reaction with methylmalonyl-CoA to start the biosynthesis of antibiotic alpha-lipomycin in Streptomyces aureofaciens Tu117. Recombinant LipPks1, containing the thioesterase domain from the 6-deoxyerythronolide B synthase, was produced in Escherichia coli, and its substrate specificity was investigated in vitro. Surprisingly, several different acyl-CoAs, including isobutyryl-CoA, were accepted as the starter substrates, while no product was observed with acetyl-CoA. These results demonstrate the broad substrate specificity of LipPks1 and may be applied to producing new antibiotics.

  13. The canonical wnt signal restricts the glycogen synthase kinase 3/fbw7-dependent ubiquitination and degradation of eya1 phosphatase.

    Science.gov (United States)

    Sun, Ye; Li, Xue

    2014-07-01

    Haploinsufficiency of Eya1 causes the branchio-oto-renal (BOR) syndrome, and abnormally high levels of Eya1 are linked to breast cancer progression and poor prognosis. Therefore, regulation of Eya1 activity is key to its tissue-specific functions and oncogenic activities. Here, we show that Eya1 is posttranslationally modified by ubiquitin and that its ubiquitination level is self-limited to prevent premature degradation. Eya1 has an evolutionarily conserved CDC4 phosphodegron (CPD) signal, a target site of glycogen synthase kinase 3 (GSK3) kinase and Fbw7 ubiquitin ligase, which is required for Eya1 ubiquitination. Genetic deletion of Fbw7 and pharmacological inhibition of GSK3 significantly decrease Eya1 ubiquitination. Conversely, activation of the phosphatidylinositol 3-kinase (PI3K)/Akt and the canonical Wnt signal suppresses Eya1 ubiquitination. Compound Eya1(+/-); Wnt9b(+/-) mutants exhibit an increased penetrance of renal defect, indicating that they function in the same genetic pathway in vivo. Together, these findings reveal that the canonical Wnt and PI3K/Akt signal pathways restrain the GSK3/Fbw7-dependent Eya1 ubiquitination, and they further suggest that dysregulation of this novel axis contributes to tumorigenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Expression, crystallization and preliminary crystallographic study of octaprenyl pyrophosphate synthase from Helicobacter pylori

    International Nuclear Information System (INIS)

    Zhang, Jinyong; Zhang, Xiaoli; Mao, Xuhu; Zou, Quanming; Li, Defeng

    2011-01-01

    Octaprenyl pyrophosphate synthase from H. pylori has been expressed, purified and crystallized, and a diffraction data set was collected to 2.00 Å resolution. Octaprenyl pyrophosphate synthase (OPPs) is involved in the synthesis of the side chains of ubiquinone and menaquinone and catalyzes consecutive condensation reactions of farnesyl pyrophosphate with isopentenyl pyrophosphate to generate polyprenyl pyrophosphate and pyrophosphate. In order to investigate the roles played by OPPs in the metabolism of ubiquinone and menaquinone and the enzymatic mechanisms of these enzymes, analysis of the structure–function relationship of OPPs from Helicobacter pylori was initiated. The gene for OPPs was cloned, the protein was expressed, purified and crystallized and a diffraction data set was collected to 2.00 Å resolution. The crystals belonged to space group P4 1 2 1 2 or P4 3 2 1 2, with unit-cell parameters a = b = 109.33, c = 103.41 Å

  15. The Dictyostelium discoideum cellulose synthase: Structure/function analysis and identification of interacting proteins

    Energy Technology Data Exchange (ETDEWEB)

    Richard L. Blanton

    2004-02-19

    OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.

  16. Aberrant glycogen synthase kinase 3β is involved in pancreatic cancer cell invasion and resistance to therapy.

    Directory of Open Access Journals (Sweden)

    Ayako Kitano

    Full Text Available BACKGROUND AND PURPOSE: The major obstacles to treatment of pancreatic cancer are the highly invasive capacity and resistance to chemo- and radiotherapy. Glycogen synthase kinase 3β (GSK3β regulates multiple cellular pathways and is implicated in various diseases including cancer. Here we investigate a pathological role for GSK3β in the invasive and treatment resistant phenotype of pancreatic cancer. METHODS: Pancreatic cancer cells were examined for GSK3β expression, phosphorylation and activity using Western blotting and in vitro kinase assay. The effects of GSK3β inhibition on cancer cell survival, proliferation, invasive ability and susceptibility to gemcitabine and radiation were examined following treatment with a pharmacological inhibitor or by RNA interference. Effects of GSK3β inhibition on cancer cell xenografts were also examined. RESULTS: Pancreatic cancer cells showed higher expression and activity of GSK3β than non-neoplastic cells, which were associated with changes in its differential phosphorylation. Inhibition of GSK3β significantly reduced the proliferation and survival of cancer cells, sensitized them to gemcitabine and ionizing radiation, and attenuated their migration and invasion. These effects were associated with decreases in cyclin D1 expression and Rb phosphorylation. Inhibition of GSK3β also altered the subcellular localization of Rac1 and F-actin and the cellular microarchitecture, including lamellipodia. Coincident with these changes were the reduced secretion of matrix metalloproteinase-2 (MMP-2 and decreased phosphorylation of focal adhesion kinase (FAK. The effects of GSK3β inhibition on tumor invasion, susceptibility to gemcitabine, MMP-2 expression and FAK phosphorylation were observed in tumor xenografts. CONCLUSION: The targeting of GSK3β represents an effective strategy to overcome the dual challenges of invasiveness and treatment resistance in pancreatic cancer.

  17. Glycogen synthase kinase-3 inhibition attenuates fibroblast activation and development of fibrosis following renal ischemia-reperfusion in mice

    Directory of Open Access Journals (Sweden)

    Shailendra P. Singh

    2015-08-01

    Full Text Available Glycogen synthase kinase-3β (GSK3β is a serine/threonine protein kinase that plays an important role in renal tubular injury and regeneration in acute kidney injury. However, its role in the development of renal fibrosis, often a long-term consequence of acute kidney injury, is unknown. Using a mouse model of renal fibrosis induced by ischemia-reperfusion injury, we demonstrate increased GSK3β expression and activity in fibrotic kidneys, and its presence in myofibroblasts in addition to tubular epithelial cells. Pharmacological inhibition of GSK3 using TDZD-8 starting before or after ischemia-reperfusion significantly suppressed renal fibrosis by reducing the myofibroblast population, collagen-1 and fibronectin deposition, inflammatory cytokines, and macrophage infiltration. GSK3 inhibition in vivo reduced TGF-β1, SMAD3 activation and plasminogen activator inhibitor-1 levels. Consistently in vitro, TGF-β1 treatment increased GSK3β expression and GSK3 inhibition abolished TGF-β1-induced SMAD3 activation and α-smooth muscle actin (α-SMA expression in cultured renal fibroblasts. Importantly, overexpression of constitutively active GSK3β stimulated α-SMA expression even in the absence of TGF-β1 treatment. These results suggest that TGF-β regulates GSK3β, which in turn is important for TGF-β–SMAD3 signaling and fibroblast-to-myofibroblast differentiation. Overall, these studies demonstrate that GSK3 could promote renal fibrosis by activation of TGF-β signaling and the use of GSK3 inhibitors might represent a novel therapeutic approach for progressive renal fibrosis that develops as a consequence of acute kidney injury.

  18. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  19. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  20. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

    Science.gov (United States)

    Cheng, Jiujun; Charles, Trevor C

    2016-09-01

    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  1. Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.

    Science.gov (United States)

    Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2017-06-01

    The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  2. Angiotensin II-induced hypertension blunts thick ascending limb NO production by reducing NO synthase 3 expression and enhancing threonine 495 phosphorylation.

    Science.gov (United States)

    Ramseyer, Vanesa D; Gonzalez-Vicente, Agustin; Carretero, Oscar A; Garvin, Jeffrey L

    2015-01-15

    Thick ascending limbs reabsorb 30% of the filtered NaCl load. Nitric oxide (NO) produced by NO synthase 3 (NOS3) inhibits NaCl transport by this segment. In contrast, chronic angiotensin II (ANG II) infusion increases net thick ascending limb transport. NOS3 activity is regulated by changes in expression and phosphorylation at threonine 495 (T495) and serine 1177 (S1177), inhibitory and stimulatory sites, respectively. We hypothesized that NO production by thick ascending limbs is impaired by chronic ANG II infusion, due to reduced NOS3 expression, increased phosphorylation of T495, and decreased phosphorylation of S1177. Rats were infused with 200 ng·kg(-1)·min(-1) ANG II or vehicle for 1 and 5 days. ANG II infusion for 5 days decreased NOS3 expression by 40 ± 12% (P thick ascending limbs from ANG II-infused animals [ANG II -0.01 ± 0.06 arbitrary fluorescence units (AFU)/min vs. 0.17 ± 0.02 AFU/min in controls; P thick ascending limbs is impaired due to decreased NOS3 expression and altered phosphorylation. Copyright © 2015 the American Physiological Society.

  3. Site-directed Mutagenesis Switching a Dimethylallyl Tryptophan Synthase to a Specific Tyrosine C3-Prenylating Enzyme*

    Science.gov (United States)

    Fan, Aili; Zocher, Georg; Stec, Edyta; Stehle, Thilo; Li, Shu-Ming

    2015-01-01

    The tryptophan prenyltransferases FgaPT2 and 7-DMATS (7-dimethylallyl tryptophan synthase) from Aspergillus fumigatus catalyze C4- and C7-prenylation of the indole ring, respectively. 7-DMATS was found to accept l-tyrosine as substrate as well and converted it to an O-prenylated derivative. An acceptance of l-tyrosine by FgaPT2 was also observed in this study. Interestingly, isolation and structure elucidation revealed the identification of a C3-prenylated l-tyrosine as enzyme product. Molecular modeling and site-directed mutagenesis led to creation of a mutant FgaPT2_K174F, which showed much higher specificity toward l-tyrosine than l-tryptophan. Its catalytic efficiency toward l-tyrosine was found to be 4.9-fold in comparison with that of non-mutated FgaPT2, whereas the activity toward l-tryptophan was less than 0.4% of that of the wild-type. To the best of our knowledge, this is the first report on an enzymatic C-prenylation of l-tyrosine as free amino acid and altering the substrate preference of a prenyltransferase by mutagenesis. PMID:25477507

  4. Crystallization and preliminary X-ray analysis of beta-alanine synthase from the yeast Saccharomyces kluyveri

    DEFF Research Database (Denmark)

    Dobritzsch, D.; Gojkovic, Zoran; Andersen, Birgit

    2003-01-01

    In eukaryotes and some bacteria, the third step of reductive pyrimidine catabolism is catalyzed by beta-alanine synthase (EC 3.5.1.6). Crystals of the recombinant enzyme from the yeast Saccharomyces kluyveri were obtained using sodium citrate as a precipitant. The crystals belong to space group P2...

  5. Alteration of structure and function of ATP synthase and cytochrome c oxidase by lack of F-o-a and Cox3 subunits caused by mitochondrial DNA 9205delTA mutation

    Czech Academy of Sciences Publication Activity Database

    Hejzlarová, Kateřina; Kaplanová, Vilma; Nůsková, Hana; Kovářová, Nikola; Ješina, Pavel; Drahota, Zdeněk; Mráček, Tomáš; Seneca, S.; Houštěk, Josef

    2015-01-01

    Roč. 466, č. 3 (2015), s. 601-611 ISSN 0264-6021 R&D Projects: GA ČR(CZ) GAP303/11/0970; GA ČR(CZ) GB14-36804G; GA MŠk(CZ) LL1204; GA ČR(CZ) GAP303/12/1363 Institutional support: RVO:67985823 Keywords : ATP synthase * cytochrome c oxidase * mitochondrial diseases * mtDNA MT-ATP6 mutation * oxidative phosphorylation * threshold effect Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.562, year: 2015

  6. Role of cadmium and ultraviolet-B radiation in plants. Influence on photosynthesis and element content in two species of Brassicaceae

    Energy Technology Data Exchange (ETDEWEB)

    Larsson Joensson, Helene

    2001-02-01

    Plants are exposed to many different stress factors during their lifetime. often more than one factor at a time. which highlights the importance of research regarding interaction among stress factors. Cadmium and ultraviolet-B radiation (MB, 280-315 mm) are two potential stress factors in the environment, which have gained increased interest due to atmospheric pollution. In this work the interaction between Cd and UV-B radiation was investigated in two species of Brassicaceae; Brassica napus and Arabidopsis thaliana, the latter including the wild type and phytochelatin-deficient cad1-3. In both species photosynthetic parameters and element content were studied after the plants were exposed to Cd and supplemental UV-B radiation for 14 days. A separate Cd uptake study was carried out on Arabidopsis thaliana to investigate the effect of different Cd pretreatments on Cd uptake. The experiments showed that Cd was the dominant factor, but in Brassica napus, Cd+UV-B showed some interaction effects on energy dissipation and chlorophyll ratios. Generally, Cd decreased the chlorophyll content and influenced photosynthesis by altering oxygen evolution, non-photochemical quenching and the quantum yield. Cadmium had large effects on the content of essential elements, particularly in roots, that may be due to competition during uptake. The Cd uptake study showed that the wild type contained much higher amounts of Cd than the phytochelatin-deficient cad1-3, although Cd uptake is expected to be independent of phytochelatin content. Phytochelatins chelate and transport Cd to the vacuole, thus removing Cd from the cytosol. This compartmentation may disrupt a possible feedback mechanism in the cytosol.

  7. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    International Nuclear Information System (INIS)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S.

    2015-01-01

    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L −1 were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni 2+ -IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg 2+ containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K M  = 1.111 μM (±0.113), v max  = 0.3245 μM min −1 (±0.0035), k cat  = 2.95 min −1 , as well as a catalytic efficiency k cat /K M  = 4.43 × 10 4  M −1 s −1 were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned and expressed. • Fusion to SUMO and cold-shock induction

  8. SUMO-fusion, purification, and characterization of a (+)-zizaene synthase from Chrysopogon zizanioides

    Energy Technology Data Exchange (ETDEWEB)

    Hartwig, S.; Frister, T.; Alemdar, S.; Li, Z.; Scheper, T.; Beutel, S., E-mail: beutel@iftc.uni-hannover.de

    2015-03-20

    An uncharacterized plant cDNA coding for a polypeptide presumably having sesquiterpene synthase activity, was expressed in soluble and active form. Two expression strategies were evaluated in Escherichia coli. The enzyme was fused to a highly soluble SUMO domain, in addition to being produced in an unfused form by a cold-shock expression system. Yields up to ∼325 mg/L{sup −1} were achieved in batch cultivations. The 6x-His-tagged enzyme was purified employing an Ni{sup 2+}-IMAC-based procedure. Identity of the protein was established by Western Blot analysis as well as peptide mass fingerprinting. A molecular mass of 64 kDa and an isoelectric point of pI 4.95 were determined by 2D gel electrophoresis. Cleavage of the fusion domain was possible by digestion with specific SUMO protease. The synthase was active in Mg{sup 2+} containing buffer and catalyzed the production of (+)-zizaene (syn. khusimene), a precursor of khusimol, from farnesyl diphosphate. Product identity was confirmed by GC–MS and comparison of retention indices. Enzyme kinetics were determined by measuring initial reaction rates for the product, using varying substrate concentrations. By assuming a Michaelis–Menten model, kinetic parameters of K{sub M} = 1.111 μM (±0.113), v{sub max} = 0.3245 μM min{sup −1} (±0.0035), k{sub cat} = 2.95 min{sup −1}, as well as a catalytic efficiency k{sub cat}/K{sub M} = 4.43 × 10{sup 4} M{sup −1} s{sup −1} were calculated. Fusion to a SUMO moiety can substantially increase soluble expression levels of certain hard to express terpene synthases in E. coli. The kinetic data determined for the recombinant synthase are comparable to other described plant sesquiterpene synthases and in the typical range of enzymes belonging to the secondary metabolism. This leaves potential for optimizing catalytic parameters through methods like directed evolution. - Highlights: • Uncharacterized (+)-zizaene synthase from C. zizanoides was cloned

  9. Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Roman eGangl

    2015-09-01

    Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

  10. Isolation of developing secondary xylem specific cellulose synthase ...

    Indian Academy of Sciences (India)

    The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

  11. Chronic inhibition of glycogen synthase kinase-3 protects against rotenone-induced cell death in human neuron-like cells by increasing BDNF secretion.

    Science.gov (United States)

    Giménez-Cassina, Alfredo; Lim, Filip; Díaz-Nido, Javier

    2012-12-07

    Mitochondrial dysfunction is a common feature of many neurodegenerative disorders. Likewise, activation of glycogen synthase kinase-3 (GSK-3) has been proposed to play an important role in neurodegeneration. This multifunctional protein kinase is involved in a number of cellular functions and we previously showed that chronic inhibition of GSK-3 protects neuronal cells against mitochondrial dysfunction-elicited cell death, through a mechanism involving increased glucose metabolism and the translocation of hexokinase II (HKII) to mitochondria. Here, we sought to gain deeper insight into the molecular basis of this neuroprotection. We found that chronic inhibition of GSK-3, either genetically or pharmacologically, elicited a marked increase in brain-derived neurotrophic factor (BDNF) secretion, which in turn conferred resistance to mitochondrial dysfunction through subcellular re-distribution of HKII. These results define a molecular pathway through which chronic inhibition of GSK-3 may protect neuronal cells from death. Moreover, they highlight the potential benefits of enhanced neurotrophic factor secretion as a therapeutic approach to treat neurodegenerative diseases. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  12. Isolation and characterization of three new monoterpene synthases from Artemisia annua

    OpenAIRE

    Ju-Xin eRuan; Jian-Xu eLi; Xin eFang; Ling-Jian eWang; Wen-Li eHu; Xiao-Ya eChen; Changqing eYang

    2016-01-01

    Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with...

  13. Cyclic GMP-AMP Synthase is Activated by Double-stranded DNA-Induced Oligomerization

    OpenAIRE

    Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T.; Shelton, Catherine L.; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B.; Li, Pingwei

    2013-01-01

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide 2′,5′ cGAMP that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and ...

  14. Endothelium-dependent relaxation of rat aorta to a histamine H3 agonist is reduced by inhibitors of nitric oxide synthase, guanylate cyclase and Na+,K+-ATPase

    Directory of Open Access Journals (Sweden)

    D. M. Djuric

    1996-01-01

    Full Text Available The possible involvement of different effector systems (nitric oxide synthase, guanylate cyclase, β-adrenergic and muscarinic cholinergic receptors, cyclooxygenase and lipoxygenase, and Na+,K+-ATPase was evaluated in a histamine H3 receptor agonist-induced ((Rα-methylhistamine, (Rα-MeHA endothelium-dependent rat aorta relaxation assay. (Rα-MeHA (0.1 nM – 0.01 mM relaxed endothelium-dependent rat aorta, with a pD2 value of 8.22 ± 0.06, compared with a pD2 value of 7.98 ± 0.02 caused by histamine (50% and 70% relaxation, respectively. The effect of (Rα-MeHA (0.1 nM – 0.01 mM was competitively antagonized by thioperamide (1, 10 and 30 nM (pA2 = 9.21 ± 0.40; slope = 1.03 ± 0.35 but it was unaffected by pyrilamine (100 nM, cimetidine (1 μM, atropine (10 μM, propranolol (1 μM, indomethacin (10 μM or nordthydroguaiaretic acid (0.1 mM. Inhibitors of nitric oxide synthase, L-NG-monomethylarginine (L-NMMA, 10 μM and NG-nitro-L-arginine methylester (L-NOARG, 10 μM inhibited the relaxation effect of (Rα-MeHA, by approximately 52% and 70%, respectively. This inhibitory effect of L-NMMA was partially reversed by L-arginine (10 μM. Methylene blue (10 μM and ouabain (10 μM inhibited relaxation (Rα-MeHA-induced by approximately 50% and 90%, respectively. The products of cyclooxygenase and lipoxygenase are not involved in (Rα-MeHA-induced endothelium-dependent rat aorta relaxation nor are the muscarinic cholinergic and β-adrenergic receptors. The results also suggest the involvement of NO synthase, guanylate cyclase and Na+,K+-ATPase in (Rα-MeHA-induced endothelium-dependent rat aorta relaxation.

  15. Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

    Directory of Open Access Journals (Sweden)

    Reshma Davidson

    Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

  16. Glycogen synthase kinase-3 inhibition sensitizes human induced pluripotent stem cells to thiol-containing antioxidants induced apoptosis.

    Science.gov (United States)

    Tu, Chengyi; Xu, Robert; Koleti, Meghana; Zoldan, Janet

    2017-08-01

    Inhibition of glycogen synthase kinase 3 (GSK3) is an extensively used strategy to activate Wnt pathway for pluripotent stem cell (PSC) differentiation. However, the effects of such inhibition on PSCs, besides upregulating the Wnt pathway, have rarely been investigated despite that GSK3 is broadly involved in other cellular activities such as insulin signaling and cell growth/survival regulation. Here we describe a previously unknown synergistic effect between GSK3 inhibition (e.g., Chir99021 and LY2090314) and various normally non-toxic thiol-containing antioxidants (e.g., N-acetylcysteine, NAC) on the induction of apoptosis in human induced pluripotent stem cells (iPSCs). Neither Chir99021 nor the antioxidants individually induced significant apoptosis, whereas their combined treatment resulted in rapid and extensive apoptosis, with substantial caspase 3 activity observed within 3h and over 90% decrease in cell viability after 24h. We confirmed the generality of this phenomenon with multiple independent iPSCs lines, various thiol-based antioxidants and distinct GSK3 inhibitors. Mechanistically, we demonstrated that rapamycin treatment could substantially reduce cell death, suggesting the critical role of mammalian target of rapamycin (mTOR). Akt dysregulation was also found to partially contribute to cell apoptosis but was not the primary cause. Further, this coordinated proapoptotic effect was not detected in mouse ESCs but was present in another human cells line: a breast cancer cell line (MDA-MB-231). Given the wide use of GSK3 inhibition in biomedical research: from iPSC differentiation to cancer intervention and the treatment of neuronal diseases, researchers can potentially take advantage of or avoid this synergistic effect for improved experimental or clinical outcome. Copyright © 2017. Published by Elsevier B.V.

  17. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

    2011-01-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  18. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  19. Inhibition of the ATP Synthase Eliminates the Intrinsic Resistance of Staphylococcus aureus towards Polymyxins

    DEFF Research Database (Denmark)

    Vestergaard, Martin; Nøhr-Meldgaard, Katrine; Bojer, Martin Saxtorph

    2017-01-01

    , linezolid, daptomycin, and oxacillin were unchanged. ATP synthase activity is known to be inhibited by oligomycin A, and the presence of this compound increased polymyxin B-mediated killing of S. aureus Our results demonstrate that the ATP synthase contributes to intrinsic resistance of S. aureus towards...

  20. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A. [Instituto Leloir, Buenos Aires (Argentina); Braden, B.C. [Bowie State Univ., Maryland (United States)

    2004-07-01

    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  1. High order quaternary arrangement confers increased structural stability to Brucella Spp. lumazine synthase

    International Nuclear Information System (INIS)

    Zylberman, V.; Craig, P.O.; Klinke, S.; Cauerhff, A.; Goldbaum, F.A.; Braden, B.C.

    2004-01-01

    The penultimate step in the pathway of riboflavin biosynthesis is catalyzed by the enzyme lumazine synthase (LS). One of the most distinctive characteristics of this enzyme is the structural quaternary divergence found in different species. The protein exists as pentameric and icosahedral forms, built from practically the same structural monomeric unit. The pentameric structure is formed by five 18 kDa monomers, each extensively contacting neighboring monomers. The icosahedral structure consists of 60 LS monomers arranged as twelve pentamers giving rise to a capsid exhibiting icosahedral 532 symmetry. In all lumazine synthases studied, the topologically equivalent active sites are located at the interfaces between adjacent subunits in the pentameric modules. The Brucella spp. lumazine synthase (BLS) sequence clearly diverges from pentameric and icosahedral enzymes. This unusual divergence prompted to further investigate on its quaternary arrangement. In the present work, we demonstrate by means of solution Light Scattering and X-ray structural analyses that BLS assembles as a very stable dimer of pentamers representing a third category of quaternary assembly for lumazine synthases. We also describe by spectroscopic studies the thermodynamic stability of this oligomeric protein, and postulate a mechanism for dissociation/unfolding of this macromolecular assembly. The higher molecular order of BLS increases its stability 20 deg C compared to pentameric lumazine synthases. The decameric arrangement described in this work highlights the importance of quaternary interactions in the stabilization of proteins. (author)

  2. In vivo inhibition of the mitochondrial H+-ATP synthase in neurons promotes metabolic preconditioning.

    Science.gov (United States)

    Formentini, Laura; Pereira, Marta P; Sánchez-Cenizo, Laura; Santacatterina, Fulvio; Lucas, José J; Navarro, Carmen; Martínez-Serrano, Alberto; Cuezva, José M

    2014-04-01

    A key transducer in energy conservation and signaling cell death is the mitochondrial H(+)-ATP synthase. The expression of the ATPase inhibitory factor 1 (IF1) is a strategy used by cancer cells to inhibit the activity of the H(+)-ATP synthase to generate a ROS signal that switches on cellular programs of survival. We have generated a mouse model expressing a mutant of human IF1 in brain neurons to assess the role of the H(+)-ATP synthase in cell death in vivo. The expression of hIF1 inhibits the activity of oxidative phosphorylation and mediates the shift of neurons to an enhanced aerobic glycolysis. Metabolic reprogramming induces brain preconditioning affording protection against quinolinic acid-induced excitotoxicity. Mechanistically, preconditioning involves the activation of the Akt/p70S6K and PARP repair pathways and Bcl-xL protection from cell death. Overall, our findings provide the first in vivo evidence highlighting the H(+)-ATP synthase as a target to prevent neuronal cell death.

  3. Increased phosphorylation of skeletal muscle glycogen synthase at NH2-terminal sites during physiological hyperinsulinemia in type 2 diabetes

    DEFF Research Database (Denmark)

    Højlund, Kurt; Staehr, Peter; Hansen, Bo Falck

    2003-01-01

    In type 2 diabetes, insulin activation of muscle glycogen synthase (GS) is impaired. This defect plays a major role for the development of insulin resistance and hyperglycemia. In animal muscle, insulin activates GS by reducing phosphorylation at both NH(2)- and COOH-terminal sites......, but the mechanism involved in human muscle and the defect in type 2 diabetes remain unclear. We studied the effect of insulin at physiological concentrations on glucose metabolism, insulin signaling and phosphorylation of GS in skeletal muscle from type 2 diabetic and well-matched control subjects during euglycemic......-hyperinsulinemic clamps. Analysis using phospho-specific antibodies revealed that insulin decreases phosphorylation of sites 3a + 3b in human muscle, and this was accompanied by activation of Akt and inhibition of glycogen synthase kinase-3alpha. In type 2 diabetic subjects these effects of insulin were fully intact...

  4. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  5. Indole-3-butyric acid promotes adventitious rooting in Arabidopsis thaliana thin cell layers by conversion into indole-3-acetic acid and stimulation of anthranilate synthase activity.

    Science.gov (United States)

    Fattorini, L; Veloccia, A; Della Rovere, F; D'Angeli, S; Falasca, G; Altamura, M M

    2017-07-11

    Indole-3-acetic acid (IAA), and its precursor indole-3-butyric acid (IBA), control adventitious root (AR) formation in planta. Adventitious roots are also crucial for propagation via cuttings. However, IBA role(s) is/are still far to be elucidated. In Arabidopsis thaliana stem cuttings, 10 μM IBA is more AR-inductive than 10 μM IAA, and, in thin cell layers (TCLs), IBA induces ARs when combined with 0.1 μM kinetin (Kin). It is unknown whether arabidopsis TCLs produce ARs under IBA alone (10 μM) or IAA alone (10 μM), and whether they contain endogenous IAA/IBA at culture onset, possibly interfering with the exogenous IBA/IAA input. Moreover, it is unknown whether an IBA-to-IAA conversion is active in TCLs, and positively affects AR formation, possibly through the activity of the nitric oxide (NO) deriving from the conversion process. Revealed undetectable levels of both auxins at culture onset, showing that arabidopsis TCLs were optimal for investigating AR-formation under the total control of exogenous auxins. The AR-response of TCLs from various ecotypes, transgenic lines and knockout mutants was analyzed under different treatments. It was shown that ARs are better induced by IBA than IAA and IBA + Kin. IBA induced IAA-efflux (PIN1) and IAA-influx (AUX1/LAX3) genes, IAA-influx carriers activities, and expression of ANTHRANILATE SYNTHASE -alpha1 (ASA1), a gene involved in IAA-biosynthesis. ASA1 and ANTHRANILATE SYNTHASE -beta1 (ASB1), the other subunit of the same enzyme, positively affected AR-formation in the presence of exogenous IBA, because the AR-response in the TCLs of their mutant wei2wei7 was highly reduced. The AR-response of IBA-treated TCLs from ech2ibr10 mutant, blocked into IBA-to-IAA-conversion, was also strongly reduced. Nitric oxide, an IAA downstream signal and a by-product of IBA-to-IAA conversion, was early detected in IAA- and IBA-treated TCLs, but at higher levels in the latter explants. Altogether, results showed that IBA induced

  6. Tumor Necrosis Factor (TNF -308G>A, Nitric Oxide Synthase 3 (NOS3 +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Conflicting data have been reported on the association between tumor necrosis factor (TNF -308G>A and nitric oxide synthase 3 (NOS3 +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF -308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine.We performed an updated meta-analysis for TNF -308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR and 95% confidence intervals (95% CI assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates.Eleven studies in 6682 migraineurs and 22591 controls for TNF -308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the "A" allele of the TNF -308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 - 2.87. The risk of migraine with aura (MA was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the "T" allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 - 3.88.Our findings appear to support the hypothesis that the TNF -308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians.

  7. Inhibition of glycogen synthase kinase 3beta ameliorates triptolide-induced acute cardiac injury by desensitizing mitochondrial permeability transition

    International Nuclear Information System (INIS)

    Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin; Fu, Xinlu; Shen, Feihai; Huang, Zhiying

    2016-01-01

    Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.

  8. Inhibition of glycogen synthase kinase 3beta ameliorates triptolide-induced acute cardiac injury by desensitizing mitochondrial permeability transition

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Wenwen; Yang, Yanqin; Xiong, Zhewen; Kong, Jiamin [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Fu, Xinlu [Laboratory Animals Center, Sun Yat-sen University, Guangzhou 510006 (China); Shen, Feihai, E-mail: shenfh3@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China); Huang, Zhiying, E-mail: hzhiying@mail.sysu.edu.cn [School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006 (China)

    2016-12-15

    Triptolide (TP), a diterpene triepoxide, is a major active component of Tripterygium wilfordii extracts, which are prepared as tablets and has been used clinically for the treatment of inflammation and autoimmune disorders. However, TP's therapeutic potential is limited by severe adverse effects. In a previous study, we reported that TP induced mitochondria dependent apoptosis in cardiomyocytes. Glycogen synthase kinase-3β (GSK-3β) is a multifunctional serine/threonine kinase that plays important roles in the necrosis and apoptosis of cardiomyocytes. Our study aimed to investigate the role of GSK-3β in TP-induced cardiotoxicity. Inhibition of GSK-3β activity by SB 216763, a potent and selective GSK-3 inhibitor, prominently ameliorated the detrimental effects in C57BL/6J mice with TP administration, which was associated with a correction of GSK-3β overactivity. Consistently, in TP-treated H9c2 cells, SB 216763 treatment counteracted GSK-3β overactivity, improved cell viability, and prevented apoptosis by modulating the expression of Bcl-2 family proteins. Mechanistically, GSK-3β interacted with and phosphorylated cyclophilin F (Cyp-F), a key regulator of mitochondrial permeability transition pore (mPTP). GSK-3β inhibition prevented the phosphorylation and activation of Cyp-F, and desensitized mPTP. Our findings suggest that pharmacological targeting of GSK-3β could represent a promising therapeutic strategy for protecting against cardiotoxicity induced by TP. - Highlights: • GSK-3β inhibition ameliorates TP-induced cardiotoxicity in vitro and in vivo. • GSK-3β controls Cyp-F activation, and regulates mPTP and apoptosis in H9c2 cells. • The protective effect is attributed to GSK-3β activity rather than to protein level. • GSK-3β may be a promising target against TP-induced cardiotoxicity.

  9. Glycogen synthase kinase 3β in the basolateral amygdala is critical for the reconsolidation of cocaine reward memory.

    Science.gov (United States)

    Wu, Ping; Xue, Yan-Xue; Ding, Zeng-Bo; Xue, Li-Fen; Xu, Chun-Mei; Lu, Lin

    2011-07-01

    Exposure to cocaine-associated conditioned stimuli elicits craving and increases the probability of cocaine relapse in cocaine users even after extended periods of abstinence. Recent evidence indicates that cocaine seeking can be inhibited by disrupting the reconsolidation of the cocaine cue memories and that basolateral amygdala (BLA) neuronal activity plays a role in this effect. Previous studies demonstrated that glycogen synthase kinase 3β (GSK-3β) plays a role in the reconsolidation of fear memory. Here, we used a conditioned place preference procedure to examine the role of GSK-3β in the BLA in the reconsolidation of cocaine cue memories. GSK-3β activity in the BLA, but not central amygdala (CeA), in rats that acquired cocaine (10 mg/kg)-induced conditioned place preference increased after re-exposure to a previously cocaine-paired chamber (i.e., a memory reactivation procedure). Systemic injections of the GSK-3β inhibitor lithium chloride after memory reactivation impaired the reconsolidation of cocaine cue memories and inhibited subsequent cue-induced GSK-3β activity in the BLA. Basolateral amygdala, but not central amygdala, injections of SB216763, a selective inhibitor of GSK-3β, immediately after the reactivation of cocaine cue memories also disrupted cocaine cue memory reconsolidation and prevented cue-induced increases in GSK-3β activity in the BLA. The effect of SB216763 on the reconsolidation of cocaine cue memories lasted at least 2 weeks and was not recovered by a cocaine priming injection. These results indicate that GSK-3β activity in the BLA mediates the reconsolidation of cocaine cue memories. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

  10. The C-terminal peptide of Aquifex aeolicus riboflavin synthase directs encapsulation of native and foreign guests by a cage-forming lumazine synthase.

    Science.gov (United States)

    Azuma, Yusuke; Zschoche, Reinhard; Hilvert, Donald

    2017-06-23

    Encapsulation of specific enzymes in self-assembling protein cages is a hallmark of bacterial compartments that function as counterparts to eukaryotic organelles. The cage-forming enzyme lumazine synthase (LS) from Bacillus subtilis (BsLS), for example, encapsulates riboflavin synthase (BsRS), enabling channeling of lumazine from the site of its generation to the site of its conversion to vitamin B 2 Elucidating the molecular mechanisms underlying the assembly of these supramolecular complexes could help inform new approaches for metabolic engineering, nanotechnology, and drug delivery. To that end, we investigated a thermostable LS from Aquifex aeolicus (AaLS) and found that it also forms cage complexes with the cognate riboflavin synthase (AaRS) when both proteins are co-produced in the cytosol of Escherichia coli A 12-amino acid-long peptide at the C terminus of AaRS serves as a specific localization sequence responsible for targeting the guest to the protein compartment. Sequence comparisons suggested that analogous peptide segments likely direct RS complexation by LS cages in other bacterial species. Covalent fusion of this peptide tag to heterologous guest molecules led to their internalization into AaLS assemblies both in vivo and in vitro , providing a firm foundation for creating tailored biomimetic nanocompartments for medical and biotechnological applications. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  12. Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

    Science.gov (United States)

    Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

    2014-02-01

    Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  14. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Lamas, Maria J.; Duran, Goretti; Gomez, Antonio; Balboa, Emilia; Anido, Urbano; Bernardez, Beatriz; Rana-Diez, Pablo; Lopez, Rafael; Carracedo, Angel; Barros, Francisco

    2012-01-01

    Purpose: 5-Fluorouracil–based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m 2 /d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62–10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10–6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR C 677 and MTHFR A 1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  15. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Lamas, Maria J., E-mail: mlamasd@yahoo.es [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Duran, Goretti [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Gomez, Antonio [Department of Oncology Radiotherapy, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Balboa, Emilia [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Anido, Urbano [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Bernardez, Beatriz [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Rana-Diez, Pablo [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Lopez, Rafael [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Carracedo, Angel; Barros, Francisco [Fundacion Publica Galega de Medicina Xenomica and Genomic Medicine Group-CIBERER, University of Santiago de Compostela, Calle San Fransisco S/N, Santiago de Compostela (Spain)

    2012-01-01

    Purpose: 5-Fluorouracil-based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m{sup 2}/d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62-10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10-6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR{sub C}677 and MTHFR{sub A}1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  16. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  17. Homocysteine threshold value based on cystathionine beta synthase and paraoxonase 1 activities in mice.

    Science.gov (United States)

    Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N

    2007-12-01

    Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.

  18. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  19. A recruiting protein of geranylgeranyl diphosphate synthase controls metabolic flux toward chlorophyll biosynthesis in rice.

    Science.gov (United States)

    Zhou, Fei; Wang, Cheng-Yuan; Gutensohn, Michael; Jiang, Ling; Zhang, Peng; Zhang, Dabing; Dudareva, Natalia; Lu, Shan

    2017-06-27

    In plants, geranylgeranyl diphosphate (GGPP) is produced by plastidic GGPP synthase (GGPPS) and serves as a precursor for vital metabolic branches, including chlorophyll, carotenoid, and gibberellin biosynthesis. However, molecular mechanisms regulating GGPP allocation among these biosynthetic pathways localized in the same subcellular compartment are largely unknown. We found that rice contains only one functionally active GGPPS, OsGGPPS1, in chloroplasts. A functionally active homodimeric enzyme composed of two OsGGPPS1 subunits is located in the stroma. In thylakoid membranes, however, the GGPPS activity resides in a heterodimeric enzyme composed of one OsGGPPS1 subunit and GGPPS recruiting protein (OsGRP). OsGRP is structurally most similar to members of the geranyl diphosphate synthase small subunit type II subfamily. In contrast to members of this subfamily, OsGRP enhances OsGGPPS1 catalytic efficiency and specificity of GGPP production on interaction with OsGGPPS1. Structural biology and protein interaction analyses demonstrate that affinity between OsGRP and OsGGPPS1 is stronger than between two OsGGPPS1 molecules in homodimers. OsGRP determines OsGGPPS1 suborganellar localization and directs it to a large protein complex in thylakoid membranes, consisting of geranylgeranyl reductase (OsGGR), light-harvesting-like protein 3 (OsLIL3), protochlorophyllide oxidoreductase (OsPORB), and chlorophyll synthase (OsCHLG). Taken together, genetic and biochemical analyses suggest OsGRP functions in recruiting OsGGPPS1 from the stroma toward thylakoid membranes, thus providing a mechanism to control GGPP flux toward chlorophyll biosynthesis.

  20. Glyphosate-resistant goosegrass. Identification of a mutation in the target enzyme 5-enolpyruvylshikimate-3-phosphate synthase.

    Science.gov (United States)

    Baerson, Scott R; Rodriguez, Damian J; Tran, Minhtien; Feng, Yongmei; Biest, Nancy A; Dill, Gerald M

    2002-07-01

    The spontaneous occurrence of resistance to the herbicide glyphosate in weed species has been an extremely infrequent event, despite over 20 years of extensive use. Recently, a glyphosate-resistant biotype of goosegrass (Eleusine indica) was identified in Malaysia exhibiting an LD(50) value approximately 2- to 4-fold greater than the sensitive biotype collected from the same region. A comparison of the inhibition of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) activity by glyphosate in extracts prepared from the resistant (R) and sensitive (S) biotypes revealed an approximately 5-fold higher IC(50)(glyphosate) for the (R) biotype. Sequence comparisons of the predicted EPSPS mature protein coding regions from both biotypes revealed four single-nucleotide differences, two of which result in amino acid changes. One of these changes, a proline to serine substitution at position 106 in the (R) biotype, corresponds to a substitution previously identified in a glyphosate-insensitive EPSPS enzyme from Salmonella typhimurium. Kinetic data generated for the recombinant enzymes suggests that the second substitution identified in the (R) EPSPS does not contribute significantly to its reduced glyphosate sensitivity. Escherichia coli aroA- (EPSPS deficient) strains expressing the mature EPSPS enzyme from the (R) biotype exhibited an approximately 3-fold increase in glyphosate tolerance relative to strains expressing the mature EPSPS from the (S) biotype. These results provide the first evidence for an altered EPSPS enzyme as an underlying component of evolved glyphosate resistance in any plant species.

  1. Impact of drought stress on specialised metabolism: Biosynthesis and the expression of monoterpene synthases in sage (Salvia officinalis).

    Science.gov (United States)

    Radwan, Alzahraa; Kleinwächter, Maik; Selmar, Dirk

    2017-09-01

    In previous experiments, we demonstrated that the amount of monoterpenes in sage is increased massively by drought stress. Our current study is aimed to elucidate whether this increase is due, at least in part, to elevated activity of the monoterpene synthases responsible for the biosynthesis of essential oils in sage. Accordingly, the transcription rates of the monoterpene synthases were analyzed. Salvia officinalis plants were cultivated under moderate drought stress. The concentrations of monoterpenes as well as the expression of the monoterpene synthases were analyzed. The amount of monoterpenes massively increased in response to drought stress; it doubled after just two days of drought stress. The observed changes in monoterpene content mostly match with the patterns of monoterpene synthase expressions. The expression of bornyl diphosphate synthase was strongly up-regulated; its maximum level was reached after two days. Sabinene synthase increased gradually and reached a maximum after two weeks. In contrast, the transcript level of cineole synthase continuously declined. This study revealed that the stress related increase of biosynthesis is not only due to a "passive" shift caused by the stress related over-reduced status, but also is due - at least in part-to an "active" up-regulation of the enzymes involved. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Creation of a high-amylose durum wheat through mutagenesis of starch synthase II (SSIIa)

    Science.gov (United States)

    In cereal seeds mutations in one or more starch synthases lead to decreased amylopectin and increased amylose content. Here, the impact of starch synthase IIa (SSIIa or SGP-1) mutations upon durum starch was investigated. A screen of durum accessions identified two lines lacking SGP-A1, the A geno...

  3. Cyanide detoxification in an insect herbivore: Molecular identification of β-cyanoalanine synthases from Pieris rapae.

    Science.gov (United States)

    van Ohlen, Maike; Herfurth, Anna-Maria; Kerbstadt, Henrike; Wittstock, Ute

    2016-03-01

    Cyanogenic compounds occur widely in the plant kingdom. Therefore, many herbivores are adapted to the presence of these compounds in their diet by either avoiding cyanide release or by efficient cyanide detoxification mechanisms. The mechanisms of adaptation are not fully understood. Larvae of Pieris rapae (Lepidoptera: Pieridae) are specialist herbivores on glucosinolate-containing plants. They are exposed to cyanide during metabolism of phenylacetonitrile, a product of benzylglucosinolate breakdown catalyzed by plant myrosinases and larval nitrile-specifier protein (NSP) in the gut. Cyanide is metabolized to β-cyanoalanine and thiocyanate in the larvae. Here, we demonstrate that larvae of P. rapae possess β-cyanoalanine activity in their gut. We have identified three gut-expressed cDNAs designated PrBSAS1-PrBSAS3 which encode proteins with similarity to β-substituted alanine synthases (BSAS). Characterization of recombinant PrBSAS1-PrBSAS3 shows that they possess β-cyanoalanine activity. In phylogenetic trees, PrBSAS1-PrBSAS3, the first characterized insect BSAS, group together with a characterized mite β-cyanoalanine synthase and bacterial enzymes indicating a similar evolutionary history. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Fatty acid synthase inhibitors isolated from Punica granatum L

    International Nuclear Information System (INIS)

    Jiang, He-Zhong; Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing; Fan, Hui-Jin; Ma, Xiao-Feng

    2012-01-01

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC 50 value of 10.3 μmol L -1 . (author)

  5. Fatty acid synthase inhibitors isolated from Punica granatum L

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, He-Zhong [School of Life Science and Engineering, Southwest Jiaotong University, Chengdu, (China); Ma, Qing-Yun; Liang, Wen-Juan; Huang, Sheng-Zhuo; Dai, Hao-Fu; Wang, Peng-Cheng; Zhao, You-Xing, E-mail: zhaoyx1011@163.com [Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou (China); Fan, Hui-Jin; Ma, Xiao-Feng, E-mail: maxiaofeng@gucas.ac.cn [College of Life Sciences, Graduate University of Chinese Academy of Sciences, Beijing (China)

    2012-05-15

    The aim of this work is the isolation of fatty acid synthase (FAS) inhibitors from the ethyl acetate extracts of fruit peels of Punica granatum L. Bioassay-guided chemical investigation of the fruit peels resulted in the isolation of seventeen compounds mainly including triterpenoids and phenolic compounds, from which one new oleanane-type triterpene (punicaone) along with fourteen known compounds were isolated for the first time from this plant. Seven isolates were evaluated for inhibitory activities of FAS and two compounds showed to be active. Particularly, flavogallonic acid exhibited strong FAS inhibitory activity with IC{sub 50} value of 10.3 {mu}mol L{sup -1}. (author)

  6. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  7. Subunit–subunit interactions are weakened in mutant forms of acetohydroxy acid synthase insensitive to valine inhibition

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Janata, Jiří; Ságová-Marečková, M.; Kopecký, J.

    2010-01-01

    Roč. 192, č. 3 (2010), s. 195-200 ISSN 0302-8933 R&D Projects: GA MŠk 2B08064 Institutional research plan: CEZ:AV0Z50200510 Keywords : Streptomyces cinnamonensis * Acetohydroxy acid synthase * Subunit-subunit interaction Subject RIV: EE - Microbiology, Virology Impact factor: 1.754, year: 2010

  8. Ketamine-induced inhibition of glycogen synthase kinase-3 contributes to the augmentation of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor signaling.

    Science.gov (United States)

    Beurel, Eléonore; Grieco, Steven F; Amadei, Celeste; Downey, Kimberlee; Jope, Richard S

    2016-09-01

    Sub-anesthetic doses of ketamine have been found to provide rapid antidepressant actions, indicating that the cellular signaling systems targeted by ketamine are potential sites for therapeutic intervention. Ketamine acts as an antagonist of N-methyl-D-aspartate (NMDA) receptors, and animal studies indicate that subsequent augmentation of signaling by α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors is critical for the antidepressant outcome. In this study, we tested if the inhibitory effect of ketamine on glycogen synthase kinase-3 (GSK3) affected hippocampal cell-surface AMPA receptors using immunoblotting of membrane and synaptosomal extracts from wild-type and GSK3 knockin mice. Treatment with an antidepressant dose of ketamine increased the hippocampal membrane level of the AMPA glutamate receptor (GluA)1 subunit, but did not alter the localization of GluA2, GluA3, or GluA4. This effect of ketamine was abrogated in GSK3 knockin mice expressing mutant GSK3 that cannot be inhibited by ketamine, demonstrating that ketamine-induced inhibition of GSK3 is necessary for up-regulation of cell surface AMPA GluA1 subunits. AMPA receptor trafficking is regulated by post-synaptic density-95 (PSD-95), a substrate for GSK3. Ketamine treatment decreased the hippocampal membrane level of phosphorylated PSD-95 on Thr-19, the target of GSK3 that promotes AMPA receptor internalization. These results demonstrate that ketamine-induced inhibition of GSK3 causes reduced phosphorylation of PSD-95, diminishing the internalization of AMPA GluA1 subunits to allow for augmented signaling through AMPA receptors following ketamine treatment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Glycogen synthase kinase 3 has a limited role in cell cycle regulation of cyclin D1 levels.

    Science.gov (United States)

    Yang, Ke; Guo, Yang; Stacey, William C; Harwalkar, Jyoti; Fretthold, Jonathan; Hitomi, Masahiro; Stacey, Dennis W

    2006-08-30

    The expression level of cyclin D1 plays a vital role in the control of proliferation. This protein is reported to be degraded following phosphorylation by glycogen synthase kinase 3 (GSK3) on Thr-286. We recently showed that phosphorylation of Thr-286 is responsible for a decline in cyclin D1 levels during S phase, an event required for efficient DNA synthesis. These studies were undertaken to test the possibility that phosphorylation by GSK3 is responsible for the S phase specific decline in cyclin D1 levels, and that this event is regulated by the phosphatidylinositol 3-kinase (PI3K)/AKT signaling pathway which controls GSK3. We found, however, that neither PI3K, AKT, GSK3, nor proliferative signaling activity in general is responsible for the S phase decline in cyclin D1 levels. In fact, the activity of these signaling kinases does not vary through the cell cycle of proliferating cells. Moreover, we found that GSK3 activity has little influence over cyclin D1 expression levels during any cell cycle phase. Inhibition of GSK3 activity by siRNA, LiCl, or other chemical inhibitors failed to influence cyclin D1 phosphorylation on Thr-286, even though LiCl efficiently blocked phosphorylation of beta-catenin, a known substrate of GSK3. Likewise, the expression of a constitutively active GSK3 mutant protein failed to influence cyclin D1 phosphorylation or total protein expression level. Because we were unable to identify any proliferative signaling molecule or pathway which is regulated through the cell cycle, or which is able to influence cyclin D1 levels, we conclude that the suppression of cyclin D1 levels during S phase is regulated by cell cycle position rather than signaling activity. We propose that this mechanism guarantees the decline in cyclin D1 levels during each S phase; and that in so doing it reduces the likelihood that simple over expression of cyclin D1 can lead to uncontrolled cell growth.

  10. Silencing onion lachrymatory factor synthase causes a significant change in the sulfur secondary metabolite profile.

    Science.gov (United States)

    Eady, Colin C; Kamoi, Takahiro; Kato, Masahiro; Porter, Noel G; Davis, Sheree; Shaw, Martin; Kamoi, Akiko; Imai, Shinsuke

    2008-08-01

    Through a single genetic transformation in onion (Allium cepa), a crop recalcitrant to genetic transformation, we suppressed the lachrymatory factor synthase gene using RNA interference silencing in six plants. This reduced lachrymatory synthase activity by up to 1,544-fold, so that when wounded the onions produced significantly reduced levels of tear-inducing lachrymatory factor. We then confirmed, through a novel colorimetric assay, that this silencing had shifted the trans-S-1-propenyl-l-cysteine sulfoxide breakdown pathway so that more 1-propenyl sulfenic acid was converted into di-1-propenyl thiosulfinate. A consequence of this raised thiosulfinate level was a marked increase in the downstream production of a nonenzymatically produced zwiebelane isomer and other volatile sulfur compounds, di-1-propenyl disulfide and 2-mercapto-3,4-dimethyl-2,3-dihydrothiophene, which had previously been reported in trace amounts or had not been detected in onion. The consequences of this dramatic simultaneous down- and up-regulation of secondary sulfur products on the health and flavor attributes of the onion are discussed.

  11. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    OpenAIRE

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  12. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Maintained activity of glycogen synthase kinase-3β despite of its phosphorylation at serine-9 in okadaic acid-induced neurodegenerative model

    International Nuclear Information System (INIS)

    Lim, Yong-Whan; Yoon, Seung-Yong; Choi, Jung-Eun; Kim, Sang-Min; Lee, Hui-Sun; Choe, Han; Lee, Seung-Chul; Kim, Dong-Hou

    2010-01-01

    Glycogen synthase kinase-3β (GSK3β) is recognized as one of major kinases to phosphorylate tau in Alzheimer's disease (AD), thus lots of AD drug discoveries target GSK3β. However, the inactive form of GSK3β which is phosphorylated at serine-9 is increased in AD brains. This is also inconsistent with phosphorylation status of other GSK3β substrates, such as β-catenin and collapsin response mediator protein-2 (CRMP2) since their phosphorylation is all increased in AD brains. Thus, we addressed this paradoxical condition of AD in rat neurons treated with okadaic acid (OA) which inhibits protein phosphatase-2A (PP2A) and induces tau hyperphosphorylation and cell death. Interestingly, OA also induces phosphorylation of GSK3β at serine-9 and other substrates including tau, β-catenin and CRMP2 like in AD brains. In this context, we observed that GSK3β inhibitors such as lithium chloride and 6-bromoindirubin-3'-monoxime (6-BIO) reversed those phosphorylation events and protected neurons. These data suggest that GSK3β may still have its kinase activity despite increase of its phosphorylation at serine-9 in AD brains at least in PP2A-compromised conditions and that GSK3β inhibitors could be a valuable drug candidate in AD.

  14. From bacterial to human dihydrouridine synthase: automated structure determination

    Energy Technology Data Exchange (ETDEWEB)

    Whelan, Fiona, E-mail: fiona.whelan@york.ac.uk; Jenkins, Huw T., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom); Griffiths, Samuel C. [University of Oxford, Headington, Oxford OX3 7BN (United Kingdom); Byrne, Robert T. [Ludwig-Maximilians-University Munich, Feodor-Lynen-Strasse 25, 81377 Munich (Germany); Dodson, Eleanor J.; Antson, Alfred A., E-mail: fiona.whelan@york.ac.uk [The University of York, Heslington, York YO10 5DD (United Kingdom)

    2015-06-30

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer.

  15. From bacterial to human dihydrouridine synthase: automated structure determination

    International Nuclear Information System (INIS)

    Whelan, Fiona; Jenkins, Huw T.; Griffiths, Samuel C.; Byrne, Robert T.; Dodson, Eleanor J.; Antson, Alfred A.

    2015-01-01

    The crystal structure of a human dihydrouridine synthase, an enzyme associated with lung cancer, with 18% sequence identity to a T. maritima enzyme, has been determined at 1.9 Å resolution by molecular replacement after extensive molecular remodelling of the template. The reduction of uridine to dihydrouridine at specific positions in tRNA is catalysed by dihydrouridine synthase (Dus) enzymes. Increased expression of human dihydrouridine synthase 2 (hDus2) has been linked to pulmonary carcinogenesis, while its knockdown decreased cancer cell line viability, suggesting that it may serve as a valuable target for therapeutic intervention. Here, the X-ray crystal structure of a construct of hDus2 encompassing the catalytic and tRNA-recognition domains (residues 1–340) determined at 1.9 Å resolution is presented. It is shown that the structure can be determined automatically by phenix.mr-rosetta starting from a bacterial Dus enzyme with only 18% sequence identity and a significantly divergent structure. The overall fold of the human Dus2 is similar to that of bacterial enzymes, but has a larger recognition domain and a unique three-stranded antiparallel β-sheet insertion into the catalytic domain that packs next to the recognition domain, contributing to domain–domain interactions. The structure may inform the development of novel therapeutic approaches in the fight against lung cancer

  16. Glutamylation of the DNA sensor cGAS regulates its binding and synthase activity in antiviral immunity.

    Science.gov (United States)

    Xia, Pengyan; Ye, Buqing; Wang, Shuo; Zhu, Xiaoxiao; Du, Ying; Xiong, Zhen; Tian, Yong; Fan, Zusen

    2016-04-01

    Cyclic GMP-AMP synthase (cGAS) senses cytosolic DNA during viral infection and catalyzes synthesis of the dinucleotide cGAMP, which activates the adaptor STING to initiate antiviral responses. Here we found that deficiency in the carboxypeptidase CCP5 or CCP6 led to susceptibility to DNA viruses. CCP5 and CCP6 were required for activation of the transcription factor IRF3 and interferons. Polyglutamylation of cGAS by the enzyme TTLL6 impeded its DNA-binding ability, whereas TTLL4-mediated monoglutamylation of cGAS blocked its synthase activity. Conversely, CCP6 removed the polyglutamylation of cGAS, whereas CCP5 hydrolyzed the monoglutamylation of cGAS, which together led to the activation of cGAS. Therefore, glutamylation and deglutamylation of cGAS tightly modulate immune responses to infection with DNA viruses.

  17. Cordycepin (3'-deoxyadenosine) inhibits the growth of B16-BL6 mouse melanoma cells through the stimulation of adenosine A3 receptor followed by glycogen synthase kinase-3beta activation and cyclin D1 suppression.

    Science.gov (United States)

    Yoshikawa, Noriko; Yamada, Shizuo; Takeuchi, Chihiro; Kagota, Satomi; Shinozuka, Kazumasa; Kunitomo, Masaru; Nakamura, Kazuki

    2008-06-01

    Cordyceps sinensis, a parasitic fungus on the larvae of Lepidoptera, has been used as a traditional Chinese medicine. We previously reported that the growth of B16-BL6 mouse melanoma (B16-BL6) cells was inhibited by cordycepin (3'-deoxyadenosine), an active ingredient of C. sinensis, and its effect was antagonized by MRS1191, a selective adenosine A3 receptor antagonist. In this study, the radioligand binding assay using [125I]-AB-MECA (a selective adenosine A3 receptor agonist) has shown that B16-BL6 cells express adenosine A3 receptors and that cordycepin binds to these receptors. We also confirmed the involvement of adenosine A3 receptors in the action of cordycepin using MRS1523 and MRS1220, specific adenosine A3 receptor antagonists. Next, indirubin, a glycogen synthase kinase-3beta (GSK-3beta) inhibitor, antagonized the growth suppression induced by cordycepin. Furthermore, the level of cyclin D1 protein in B16-BL6 cells was decreased by cordycepin using Western blot analysis. In conclusion, this study demonstrated that cordycepin inhibits the proliferation of B16-BL6 cells by stimulating adenosine A3 receptors followed by the Wnt signaling pathway, including GSK-3beta activation and cyclin D1 inhibition.

  18. Lead tolerance in plants: strategies for phytoremediation.

    Science.gov (United States)

    Gupta, D K; Huang, H G; Corpas, F J

    2013-04-01

    Lead (Pb) is naturally occurring element whose distribution in the environment occurs because of its extensive use in paints, petrol, explosives, sludge, and industrial wastes. In plants, Pb uptake and translocation occurs, causing toxic effects resulting in decrease of biomass production. Commonly plants may prevent the toxic effect of heavy metals by induction of various celular mechanisms such as adsorption to the cell wall, compartmentation in vacuoles, enhancement of the active efflux, or induction of higher levels of metal chelates like a protein complex (metallothioneins and phytochelatins), organic (citrates), and inorganic (sulphides) complexes. Phyotochelains (PC) are synthesized from glutathione (GSH) and such synthesis is due to transpeptidation of γ-glutamyl cysteinyl dipeptides from GSH by the action of a constitutively present enzyme, PC synthase. Phytochelatin binds to Pb ions leading to sequestration of Pb ions in plants and thus serves as an important component of the detoxification mechanism in plants. At cellular level, Pb induces accumulation of reactive oxygen species (ROS), as a result of imbalanced ROS production and ROS scavenging processes by imposing oxidative stress. ROS include superoxide radical (O2(.-)), hydrogen peroxide (H2O2) and hydroxyl radical ((·)OH), which are necessary for the correct functioning of plants; however, in excess they caused damage to biomolecules, such as membrane lipids, proteins, and nucleic acids among others. To limit the detrimental impact of Pb, efficient strategies like phytoremediation are required. In this review, it will discuss recent advancement and potential application of plants for lead removal from the environment.

  19. Biosynthesis of the oxygenated diterpene nezukol in the medicinal plant Isodon rubescens is catalyzed by a pair of diterpene synthases.

    Directory of Open Access Journals (Sweden)

    Kyle A Pelot

    Full Text Available Plants produce an immense diversity of natural products (i.e. secondary or specialized metabolites that offer a rich source of known and potentially new pharmaceuticals and other desirable bioproducts. The Traditional Chinese Medicinal plant Isodon rubescens (Lamiaceae contains an array of bioactive labdane-related diterpenoid natural products. Of these, the ent-kauranoid oridonin is the most prominent specialized metabolite that has been extensively studied for its potent antimicrobial and anticancer efficacy. Mining of a previously established transcriptome of I. rubescens leaf tissue identified seven diterpene synthase (diTPSs candidates. Here we report the functional characterization of four I. rubescens diTPSs. IrTPS5 and IrTPS3 were identified as an ent-copalyl diphosphate (CPP synthase and a (+-CPP synthase, respectively. Distinct transcript abundance of IrTPS5 and the predicted ent-CPP synthase IrTPS1 suggested a role of IrTPS5 in specialized ent-kaurene metabolism possibly en route to oridonin. Nicotiana benthamiana co-expression assays demonstrated that IrTPS4 functions sequentially with IrTPS3 to form miltiradiene. In addition, IrTPS2 converted the IrTPS3 product (+-CPP into the hydroxylated tricyclic diterpene nezukol not previously identified in I. rubescens. Metabolite profiling verified the presence of nezukol in I. rubescens leaf tissue. The proposed IrTPS2-catalyzed reaction mechanism proceeds via the common ionization of the diphosphate group of (+-CPP, followed by formation of an intermediary pimar-15-en-8-yl+ carbocation and neutralization of the carbocation by water capture at C-8 to yield nezukol, as confirmed by nuclear magnetic resonance (NMR analysis. Oxygenation activity is rare for the family of class I diTPSs and offers new catalysts for developing metabolic engineering platforms to produce a broader spectrum of bioactive diterpenoid natural products.

  20. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  1. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  2. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3beta is implicated in the treatment of cervical carcinoma.

    Science.gov (United States)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3beta (GSK-3beta) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3beta(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3beta after transfection with GSK-3beta by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3beta (s9). Furthermore, we demonstrated GSK-3beta transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3beta was important to improve chemosensitization, indicating the significance of GSK-3beta-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  3. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Yuan [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Shu, Yi Min [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Wang, Shu Fang [Department of Pathology, Baylor College of Medicine, Houston, TX 77030 (United States); Da, Bang Hong; Wang, Ze Hua [Department of Obstetrics and Gynecology, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Li, Hua Bin [Allergy and Cancer Center, The First Affiliated Hospital of Sun Yat-sen University, Guangzhou 510080 (China); Department of Medicine, Feinberg Medical School, Northwestern University, Chicago, IL 60611 (United States)

    2010-02-23

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  4. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    International Nuclear Information System (INIS)

    Zhang, Yuan; Shu, Yi Min; Wang, Shu Fang; Da, Bang Hong; Wang, Ze Hua; Li, Hua Bin

    2010-01-01

    PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy

  5. Crystallization and preliminary crystallographic analysis of an octaketide-producing plant type III polyketide synthase

    Energy Technology Data Exchange (ETDEWEB)

    Morita, Hiroyuki [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan); Kondo, Shin; Kato, Ryohei [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Wanibuchi, Kiyofumi; Noguchi, Hiroshi [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); Sugio, Shigetoshi, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Innovation Center Yokohama, Mitsubishi Chemical Corporation, 1000 Kamoshida, Aoba, Yokohama, Kanagawa 227-8502 (Japan); Abe, Ikuro, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka 422-8526 (Japan); PRESTO, Japan Science and Technology Agency, Kawaguchi, Saitama 332-0012 (Japan); Kohno, Toshiyuki, E-mail: sugio.shigetoshi@mw.m-kagaku.co.jp [Mitsubishi Kagaku Institute of Life Sciences (MITILS), 11 Minamiooya, Machida, Tokyo 194-8511 (Japan)

    2007-11-01

    Octaketide synthase from A. arborescens has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.6 Å. Octaketide synthase (OKS) from Aloe arborescens is a plant-specific type III polyketide synthase that produces SEK4 and SEK4b from eight molecules of malonyl-CoA. Recombinant OKS expressed in Escherichia coli was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to space group I422, with unit-cell parameters a = b = 110.2, c = 281.4 Å, α = β = γ = 90.0°. Diffraction data were collected to 2.6 Å resolution using synchrotron radiation at BL24XU of SPring-8.

  6. A novel 5-enolpyruvylshikimate-3-phosphate synthase shows high glyphosate tolerance in Escherichia coli and tobacco plants.

    Directory of Open Access Journals (Sweden)

    Gaoyi Cao

    Full Text Available A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops.

  7. Friedelin Synthase from Maytenus ilicifolia: Leucine 482 Plays an Essential Role in the Production of the Most Rearranged Pentacyclic Triterpene

    Science.gov (United States)

    Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.

    2016-11-01

    Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.

  8. Inhibition of glycogen synthase kinase-3 enhances the differentiation and reduces the proliferation of adult human olfactory epithelium neural precursors

    International Nuclear Information System (INIS)

    Manceur, Aziza P.; Tseng, Michael; Holowacz, Tamara; Witterick, Ian; Weksberg, Rosanna; McCurdy, Richard D.; Warsh, Jerry J.; Audet, Julie

    2011-01-01

    The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.

  9. Structure of the ent-Copalyl Diphosphate Synthase PtmT2 from Streptomyces platensis CB00739, a Bacterial Type II Diterpene Synthase.

    Science.gov (United States)

    Rudolf, Jeffrey D; Dong, Liao-Bin; Cao, Hongnan; Hatzos-Skintges, Catherine; Osipiuk, Jerzy; Endres, Michael; Chang, Chin-Yuan; Ma, Ming; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben

    2016-08-31

    Terpenoids are the largest and most structurally diverse family of natural products found in nature, yet their presence in bacteria is underappreciated. The carbon skeletons of terpenoids are generated through carbocation-dependent cyclization cascades catalyzed by terpene synthases (TSs). Type I and type II TSs initiate cyclization via diphosphate ionization and protonation, respectively, and protein structures of both types are known. Most plant diterpene synthases (DTSs) possess three α-helical domains (αβγ), which are thought to have arisen from the fusion of discrete, ancestral bacterial type I TSs (α) and type II TSs (βγ). Type II DTSs of bacterial origin, of which there are no structurally characterized members, are a missing piece in the structural evolution of TSs. Here, we report the first crystal structure of a type II DTS from bacteria. PtmT2 from Streptomyces platensis CB00739 was verified as an ent-copalyl diphosphate synthase involved in the biosynthesis of platensimycin and platencin. The crystal structure of PtmT2 was solved at a resolution of 1.80 Å, and docking studies suggest the catalytically active conformation of geranylgeranyl diphosphate (GGPP). Site-directed mutagenesis confirmed residues involved in binding the diphosphate moiety of GGPP and identified DxxxxE as a potential Mg(2+)-binding motif for type II DTSs of bacterial origin. Finally, both the shape and physicochemical properties of the active sites are responsible for determining specific catalytic outcomes of TSs. The structure of PtmT2 fundamentally advances the knowledge of bacterial TSs, their mechanisms, and their role in the evolution of TSs.

  10. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  11. Modulation of hyaluronan synthase activity in cellular membrane fractions.

    Science.gov (United States)

    Vigetti, Davide; Genasetti, Anna; Karousou, Evgenia; Viola, Manuela; Clerici, Moira; Bartolini, Barbara; Moretto, Paola; De Luca, Giancarlo; Hascall, Vincent C; Passi, Alberto

    2009-10-30

    Hyaluronan (HA), the only non-sulfated glycosaminoglycan, is involved in morphogenesis, wound healing, inflammation, angiogenesis, and cancer. In mammals, HA is synthesized by three homologous HA synthases, HAS1, HAS2, and HAS3, that polymerize the HA chain using UDP-glucuronic acid and UDP-N-acetylglucosamine as precursors. Since the amount of HA is critical in several pathophysiological conditions, we developed a non-radioactive assay for measuring the activity of HA synthases (HASs) in eukaryotic cells and addressed the question of HAS activity during intracellular protein trafficking. We prepared three cellular fractions: plasma membrane, cytosol (containing membrane proteins mainly from the endoplasmic reticulum and Golgi), and nuclei. After incubation with UDP-sugar precursors, newly synthesized HA was quantified by polyacrylamide gel electrophoresis of fluorophore-labeled saccharides and high performance liquid chromatography. This new method measured HAS activity not only in the plasma membrane fraction but also in the cytosolic membranes. This new technique was used to evaluate the effects of 4-methylumbeliferone, phorbol 12-myristate 13-acetate, interleukin 1beta, platelet-derived growth factor BB, and tunicamycin on HAS activities. We found that HAS activity can be modulated by post-translational modification, such as phosphorylation and N-glycosylation. Interestingly, we detected a significant increase in HAS activity in the cytosolic membrane fraction after tunicamycin treatment. Since this compound is known to induce HA cable structures, this result links HAS activity alteration with the capability of the cell to promote HA cable formation.

  12. Glycogen synthase kinase-3beta and the p25 activator of cyclin dependent kinase 5 increase pausing of mitochondria in neurons.

    Science.gov (United States)

    Morel, M; Authelet, M; Dedecker, R; Brion, J P

    2010-06-02

    The complex bi-directional axoplasmic transport of mitochondria is essential for proper metabolic functioning of neurons and is controlled by phosphorylation. We have investigated by time-lapse imaging the effects of increased expression of glycogen synthase kinase-3beta (GSK-3beta) and of the p25 activator of cyclin dependent kinase 5 on mitochondria movements in mammalian cortical neurons and in PC12 cells. Both GSK-3beta and p25 increased the stationary behaviour of mitochondria in PC12 and in neurons, decreased their anterograde transport but did not affect the intrinsic velocities of mitochondria. The microtubule-associated tau proteins were more phosphorylated in GSK-3beta and p25 transfected neurons, but ultrastructural observation showed that these cells still contained microtubules and nocodazole treatment further reduced residual mitochondria movements in GSK-3beta or p25 transfected neurons, indicating that microtubule disruption was not the primary cause of increased mitochondrial stationary behaviour in GSK-3beta or p25 transfected neurons. Our results suggest that increased expression of GSK-3beta and p25 acted rather by decreasing the frequency of mitochondrial movements driven by molecular motors and that GSK-3beta and p25 might regulate these transports by controlling the time that mitochondria spend pausing, rather than their velocities. Copyright 2010 IBRO. Published by Elsevier Ltd. All rights reserved.

  13. Clinicopathological and biological significance of aberrant activation of glycogen synthase kinase-3 in ovarian cancer

    Directory of Open Access Journals (Sweden)

    Fu Y

    2014-06-01

    Full Text Available Yunfeng Fu,1 Xinyu Wang,1 Xiaodong Cheng,1 Feng Ye,2 Xing Xie,1,2 Weiguo Lu1,2 1Department of Gynecologic Oncology, Women's Hospital, School of Medicine, Zhejiang University, 2Women's Reproduction and Health Laboratory of Zhejiang Province, Hangzhou, People's Republic of China Background: Glycogen synthase kinase-3 (GSK-3 plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/βTyr279/216 in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition can influence cell viability and tumor growth of ovarian cancer. Methods: Immunohistochemistry was used to examine expression of GSK-3α/β and pGSK-3α/βTyr279/216 in 71 human epithelial ovarian cancer tissues and correlations between protein expression, and clinicopathological factors were analyzed. Cell viability was determined by 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay following exposure of ovarian carcinoma cells to pharmacological inhibitors of GSK-3 or GSK-3 small interfering RNA. In vivo validation of tumor growth inhibition was performed with xenograft mice. Results: The expression levels of GSK-3α/β and pGSK-3α/βTyr279/216 in ovarian cancers were significantly higher than those in benign tumors. High expression of GSK-3α/β was more likely to be found in patients with advanced International Federation of Gynecology and Obstetrics (FIGO stages and high serum cancer antigen 125. Higher expression of pGSK-3α/βTyr279/216 was associated with advanced FIGO stages, residual tumor mass, high serum cancer antigen 125, and poor chemoresponse. Worse overall survival was revealed by Kaplan–Meier survival curves in patients with high expression of GSK-3α/β or pGSK-3α/βTyr279/216. Multivariate analysis indicated that FIGO stage, GSK-3α/β expression, and pGSK-3α/βTyr279/216 expression were independent prognostic factors for overall

  14. Producing biofuels using polyketide synthases

    Science.gov (United States)

    Katz, Leonard; Fortman, Jeffrey L; Keasling, Jay D

    2013-04-16

    The present invention provides for a non-naturally occurring polyketide synthase (PKS) capable of synthesizing a carboxylic acid or a lactone, and a composition such that a carboxylic acid or lactone is included. The carboxylic acid or lactone, or derivative thereof, is useful as a biofuel. The present invention also provides for a recombinant nucleic acid or vector that encodes such a PKS, and host cells which also have such a recombinant nucleic acid or vector. The present invention also provides for a method of producing such carboxylic acids or lactones using such a PKS.

  15. Tumor Necrosis Factor (TNF) –308G>A, Nitric Oxide Synthase 3 (NOS3) +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis

    Science.gov (United States)

    Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan

    2015-01-01

    Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763

  16. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  17. Hypoxic inactivation of glycogen synthase kinase-3β promotes gastric tumor growth and angiogenesis by facilitating hypoxia-inducible factor-1 signaling.

    Science.gov (United States)

    Ko, Young San; Cho, Sung Jin; Park, Jinju; Choi, Yiseul; Lee, Jae-Seon; Youn, Hong-Duk; Kim, Woo Ho; Kim, Min A; Park, Jong-Wan; Lee, Byung Lan

    2016-09-01

    Since the molecular mechanism of hypoxic adaptation in cancer cells is cell-type specific, we investigated whether glycogen synthase kinase-3β (GSK-3β) activation is involved in hypoxia-induced gastric tumor promotion. Stable gastric cancer cell lines (SNU-638, SNU-484, MKN1, and MKN45) were cultured under hypoxic conditions. Cells overexpressing wild-type GSK-3β (WT-GSK-3β) or kinase-dead mutant of GSK-3β (KD-GSK-3β) were generated and used for cell culture and animal studies. In cell culture experiments, hypoxia decreased GSK-3β activation in gastric cancer cells. Cell viability and the expressions of HIF-1α protein and VEGF mRNA in gastric cancer cells were higher in KD-GSK-3β transfectants than in WT-GSK-3β transfectants under hypoxic conditions, but not under normoxic conditions. Gastric cancer xenografts showed that tumor growth, microvessel area, HIF-1α activation, and VEGF expression were higher in KD-GSK-3β tumors than in WT-GSK-3β tumors in vivo. In addition, the expression of hypoxia-induced HIF-1α protein was regulated by GSK-3β at the translational level. Our data suggest that GSK-3β is involved in hypoxic adaptation of gastric cancer cells as an inhibitory upstream regulator of the HIF-1α/VEGF signaling pathway. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  18. Carbon Monoxide Protects against Hepatic Ischemia/Reperfusion Injury via ROS-Dependent Akt Signaling and Inhibition of Glycogen Synthase Kinase 3β

    Directory of Open Access Journals (Sweden)

    Hyo Jeong Kim

    2013-01-01

    Full Text Available Carbon monoxide (CO may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3 and phosphatidylinositol 3-kinase (PI3K-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.

  19. Carbon monoxide protects against hepatic ischemia/reperfusion injury via ROS-dependent Akt signaling and inhibition of glycogen synthase kinase 3β.

    Science.gov (United States)

    Kim, Hyo Jeong; Joe, Yeonsoo; Kong, Jin Sun; Jeong, Sun-Oh; Cho, Gyeong Jae; Ryter, Stefan W; Chung, Hun Taeg

    2013-01-01

    Carbon monoxide (CO) may exert important roles in physiological and pathophysiological states through the regulation of cellular signaling pathways. CO can protect organ tissues from ischemia/reperfusion (I/R) injury by modulating intracellular redox status and by inhibiting inflammatory, apoptotic, and proliferative responses. However, the cellular mechanisms underlying the protective effects of CO in organ I/R injury remain incompletely understood. In this study, a murine model of hepatic warm I/R injury was employed to assess the role of glycogen synthase kinase-3 (GSK3) and phosphatidylinositol 3-kinase (PI3K)-dependent signaling pathways in the protective effects of CO against inflammation and injury. Inhibition of GSK3 through the PI3K/Akt pathway played a crucial role in CO-mediated protection. CO treatment increased the phosphorylation of Akt and GSK3-beta (GSK3β) in the liver after I/R injury. Furthermore, administration of LY294002, an inhibitor of PI3K, compromised the protective effect of CO and decreased the level of phospho-GSK3β after I/R injury. These results suggest that CO protects against liver damage by maintaining GSK3β phosphorylation, which may be mediated by the PI3K/Akt signaling pathway. Our study provides additional support for the therapeutic potential of CO in organ injury and identifies GSK3β as a therapeutic target for CO in the amelioration of hepatic injury.

  20. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  1. Cloning, expression, purification and crystallization of dihydrodipicolinate synthase from the grapevine Vitis vinifera

    International Nuclear Information System (INIS)

    Atkinson, Sarah C.; Dogovski, Con; Newman, Janet; Dobson, Renwick C. J.; Perugini, Matthew A.

    2011-01-01

    Dihydrodipicolinate synthase from the common grapevine V. vinifera has been cloned, expressed, purified and crystallized in the presence of the substrate pyruvate by in-drop hexahistidine-tag cleavage. A diffraction data set has been collected to a resolution of 2.2 Å. Dihydrodipicolinate synthase (DHDPS) catalyses the first committed step of the lysine-biosynthesis pathway in bacteria, plants and some fungi. This study describes the cloning, expression, purification and crystallization of DHDPS from the grapevine Vitis vinifera (Vv-DHDPS). Following in-drop cleavage of the hexahistidine tag, cocrystals of Vv-DHDPS with the substrate pyruvate were grown in 0.1 M Bis-Tris propane pH 8.2, 0.2 M sodium bromide, 20%(w/v) PEG 3350. X-ray diffraction data in space group P1 at a resolution of 2.2 Å are presented. Preliminary diffraction data analysis indicated the presence of eight molecules per asymmetric unit (V M = 2.55 Å 3 Da −1 , 52% solvent content). The pending crystal structure of Vv-DHDPS will provide insight into the molecular evolution in quaternary structure of DHDPS enzymes

  2. Premotor nitric oxide synthase immunoreactive pathway connecting lumbar segments with the ventral motor nucleus of the cervical enlargement in the dog.

    Science.gov (United States)

    Marsala, Jozef; Lukácová, Nadezda; Cízková, Dása; Lukác, Imrich; Kuchárová, Karolína; Marsala, Martin

    2004-03-01

    In this study we investigate the occurrence and origin of punctate nitric oxide synthase immunoreactivity in the neuropil of the ventral motor nucleus in C7-Th1 segments of the dog spine, which are supposed to be the terminal field of an ascending premotor propriospinal nitric oxide synthase-immunoreactive pathway. As the first step, nitric oxide synthase immunohistochemistry was used to distinguish nitric oxide synthase-immunoreactive staining of the ventral motor nucleus. Dense, punctate nitric oxide synthase immunoreactivity was found on control sections in the neuropil of the ventral motor nucleus. After hemisection at Th10-11, axotomy-induced retrograde changes consisting in a strong upregulation of nitric oxide synthase-containing neurons were found mostly unilaterally in lamina VIII, the medial part of lamina VII and in the pericentral region in all segments of the lumbosacral enlargement. Concurrently, a strong depletion of the punctate nitric oxide synthase immunopositivity in the neuropil of the ventral motor nucleus ipsilaterally with the hemisection was detected, thus revealing that an uncrossed ascending premotor propriospinal pathway containing a fairly high number of nitric oxide synthase-immunoreactive fibers terminates in the ventral motor nucleus. Application of the retrograde fluorescent tracer Fluorogold injected into the ventral motor nucleus and analysis of alternate sections processed for nitric oxide synthase immunocytochemistry revealed the presence of Fluorogold-labeled and nitric oxide synthase-immunoreactive axons in the ventrolateral funiculus and in the lateral and medial portions of the ventral column throughout the thoracic and upper lumbar segments. A noticeable number of Fluorogold-labeled and nitric oxide synthase-immunoreactive somata detected on consecutive sections were found in the lumbosacral enlargement, mainly in laminae VIII-IX, the medial part of lamina VII and in the pericentral region (lamina X), ipsilaterally with the

  3. Fish Oil Supplementation and Fatty Acid Synthase Expression in the Prostate: A Randomized Controlled Trial. Addendum

    Science.gov (United States)

    2011-07-01

    controls, Menendez et al demonstrated that addition of omega-3 fatty acids (-3 FA), docosahexanoic acid ( DHA ), alpha- linolenic acid , and -6 FA, γ...AD_________________ Award Number: W81XWH-04-1-0296 TITLE: Fish Oil Supplementation and Fatty Acid ...COVERED 1 March 2010 – 30 June 2011 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fish Oil Supplementation and Fatty Acid Synthase Expression in the

  4. Glycogen Synthase Kinase-3 Modulates Hyperosmotic-Induced Urea Transporter A1 Relocation in the Inner Medullary Collecting Duct Cells.

    Science.gov (United States)

    Li, Yong-Xia; Huang, Yun; Liu, Song; Mao, Yan; Yuan, Cheng-Yan; Yang, Xiao; Yao, Li-Jun

    2016-01-01

    Glycogen synthase kinase 3 (GSK3) regulates urine concentration by mediating the vasopressin-induced aquaporin 2 expression and water permeability, although it is unknown whether GSK3 also mediates the accumulation of the urea transporter A1 (UT-A1). The aim of this study is to investigate the effect of GSK3 on UT-A1 distribution. Mouse inner medullary collecting duct 3 cells were transfected with UT-A1-GFP construct. The stable transfected cells were cultured under hypertonic conditions, treated with GSK3 inhibitor lithium chloride, GSK3 activator, lysosome or proteasome inhibitor. The expression levels of UT-A1, GSK3, and phospho-GSK3 were analyzed using western blot. The interaction between UT-A1 and the Golgi apparatus was examined using confocal immunofluorescence microscope. The UT-A1 trafficking was examined using the biotinylation of surface membranes. UT-A1 dissociated away from the Golgi apparatus and translocated to the plasma membrane under hypertonic-NaCl and NaCl plus urea stimulation. This movement was accompanied by the increased phosphorylation of GSK3 and its localization on the cellular membrane. Moreover, these results were duplicated by treating the cells with the GSK3 inhibitor, and by contrast, were partially reversed by the GSK3 activator. Treating cells with a lysosome or proteasome inhibitor failed to attenuate the effects of hypertonic stimulus, indicating that the loss of UT-A1 from the Golgi was not due to degradation. Our results suggest that GSK3 may in part modulate the hypertonic-induced intracellular UT-A1 redistribution and its accumulation on the plasma membrane, which may constitute another mechanism by which GSK3 modulates urine concentration. © 2016 S. Karger AG, Basel.

  5. Crystallization and preliminary X-ray crystallographic analysis of Aquifex aeolicus SelA, a bacterial selenocysteine synthase

    International Nuclear Information System (INIS)

    Itoh, Yuzuru; Sekine, Shun-ichi; Yokoyama, Shigeyuki

    2012-01-01

    The bacterial selenocysteine synthase SelA from Aquifex aeolicus was crystallized and the diffraction resolution was improved by lysine-residue methylation, truncation of N-terminal region (ΔN), and Lys-to-Ala point mutations. Phases were determined by using a selenomethionine-substituted crystal of the ΔN mutant. Selenocysteine (Sec), the 21st amino acid, is synthesized on its specific tRNA (tRNA Sec ) via a multi-step process. In bacteria, tRNA Sec is ligated first with serine by seryl-tRNA synthetase, which is followed by Ser-to-Sec conversion by Sec synthase (SelA). To elucidate its structure and catalytic mechanism, Aquifex aeolicus SelA was crystallized. Although wild-type SelA crystals diffracted X-rays poorly (to up to 8 Å resolution), the resolution was improved by introducing a quadruple point mutation targeting the loop regions and by methylating the lysine residues, which yielded 3.9 Å resolution diffraction data from a full-length SelA crystal. Truncation of the N-terminal region (ΔN) also improved the resolution. A 3.3 Å resolution data set for phase determination was obtained from a crystal of selenomethionine-substituted Lys-methylated SelA-ΔN

  6. The joint effect of the endothelin receptor B gene (EDNRB polymorphism rs10507875 and nitric oxide synthase 3 gene (NOS3 polymorphism rs869109213 in Slovenian patients with type 2 diabetes mellitus and diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Dejan Bregar

    2018-02-01

    Full Text Available Increasing evidence suggests that endothelin and nitric oxide synthase genes and their products exert biological effects on the vasculature via the nitric oxide or endothelin pathway. The aim of the study was to evaluate the association of rs10507875 and rs869109213 (alone or in interaction with diabetic retinopathy (DR in subjects with type 2 diabetes mellitus (T2DM. We genotyped the single nucleotide polymorphism rs10507875 of the endothelin receptor B gene (EDNRB and variable number tandem repeats rs869109213 of the nitric oxide synthase 3 gene (NOS3 in 270 Slovenian patients with DR and T2DM and 256 controls with T2DM without clinical signs of DR. The genotyping was performed using either real-time polymerase chain reaction (PCR or standard PCR. We found a significant association between the genotypes of NOS3 rs869109213 polymorphism and the risk of DR in the co-dominant model (4a4b genotype; 1.99-fold increased risk [1.09-3.65]; 95% confidence interval [CI]; p = 0.02, co-dominant model (4a4a genotype; 4.16-fold increased risk [1.03-16.74]; 95% CI; p = 0.04, and dominant model (4a4a and 4a4b genotypes; 2.22-fold increased risk [1.26-3.92]; 95% CI; p = 0.01 compared to the 4b4b genotype. Moreover, the joint effect of the two polymorphisms on DR risk was greater than the individual effect of each polymorphism in the analyzed genetic models. Additionally, adjusted odds ratio showed an increased risk in dominant × dominant (4.15-fold [1.40-12.26]; 95% CI; p = 0.01 and recessive × dominant (2.24-fold [1.25-4.01]; 95% CI; p = 0.02 genotype combinations of the two polymorphisms. In conclusion, our results indicate that NOS3 rs869109213 polymorphism alone or in a combination with EDNRB rs10507875 polymorphism may be associated with DR in Slovenian patients with T2DM.

  7. Overexpression of Farnesyl Diphosphate Synthase in Arabidopsis Mitochondria Triggers Light-dependent Lesion Formation and Alters Cytokinin Homeostasis

    Czech Academy of Sciences Publication Activity Database

    Manzano, D.; Busquets, A.; Closa, M.; Hoyerová, Klára; Schaller, H.; Kamínek, Miroslav; Arró, M.; Ferrer, A.

    2006-01-01

    Roč. 61, 1-2 (2006), s. 195-213 ISSN 0167-4412 R&D Projects: GA AV ČR(CZ) IAA600380507 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * cytokinin * farnesyl diphosphate synthase * isoprenoid Subject RIV: EF - Botanics Impact factor: 3.577, year: 2006

  8. Inhibition of fatty acid synthase prevents preadipocyte differentiation

    International Nuclear Information System (INIS)

    Schmid, Bernhard; Rippmann, Joerg F.; Tadayyon, Moh; Hamilton, Bradford S.

    2005-01-01

    Inhibition of fatty acid synthase (FAS) reduces food intake in rodents. As adipose tissue expresses FAS, we sought to investigate the effect of reduced FAS activity on adipocyte differentiation. FAS activity was suppressed either pharmacologically or by siRNA during differentiation of 3T3-L1 cells. Cerulenin (10 μM), triclosan (50 μM), and C75 (50 μM) reduced dramatically visible lipid droplet accumulation, while incorporation of [1- 14 C]acetate into lipids was reduced by 75%, 70%, and 90%, respectively. Additionally, the substances reduced FAS, CEBPα, and PPARγ mRNA by up to 85% compared to that of control differentiated cells. Transient transfection with FAS siRNA suppressed FAS mRNA and FAS activity, and this was accompanied by reduction of CEBPα and PPARγ mRNA levels, and complete prevention of lipid accumulation. CD36, a late marker of differentiation, was also reduced. Together, these results suggest that FAS generated signals may be essential to support preadipocyte differentiation

  9. Identification and characterization of multiple curcumin synthases from the herb Curcuma longa.

    Science.gov (United States)

    Katsuyama, Yohei; Kita, Tomoko; Horinouchi, Sueharu

    2009-09-03

    Curcuminoids are pharmaceutically important compounds isolated from the herb Curcuma longa. Two additional type III polyketide synthases, named CURS2 and CURS3, that are capable of curcuminoid synthesis were identified and characterized. In vitro analysis revealed that CURS2 preferred feruloyl-CoA as a starter substrate and CURS3 preferred both feruloyl-CoA and p-coumaroyl-CoA. These results suggested that CURS2 synthesizes curcumin or demethoxycurcumin and CURS3 synthesizes curcumin, bisdemethoxycurcumin and demethoxycurcumin. The availability of the substrates and the expression levels of the three different enzymes capable of curcuminoid synthesis with different substrate specificities might influence the composition of curcuminoids in the turmeric and in different cultivars.

  10. Characterising the cellulose synthase complexes of cell walls

    NARCIS (Netherlands)

    Mansoori Zangir, N.

    2012-01-01

    One of the characteristics of the plant kingdom is the presence of a structural cell wall. Cellulose is a major component in both the primary and secondary cell walls of plants. In higher plants cellulose is synthesized by so called rosette protein complexes with cellulose synthases (CESAs) as

  11. Inhibition of glycogen synthase kinase-3 reduces extension of the axonal leading process by destabilizing microtubules in cerebellar granule neurons.

    Science.gov (United States)

    Inami, Yoshihiro; Omura, Mitsuru; Kubota, Kenta; Konishi, Yoshiyuki

    2018-07-01

    Recent studies have uncovered various molecules that play key roles in neuronal morphogenesis. Nevertheless, the mechanisms underlying the neuron-type-dependent regulation of morphogenesis remain unknown. We have previously reported that inhibition of glycogen synthase kinase-3 (GSK3) markedly reduced axonal length of cerebellar granule neurons (CGNs) in a neuron-type-dependent manner. In the present study, we investigated the mechanisms by which the growth of CGN axons was severely suppressed upon GSK3 inhibition. Using time-lapse imaging of cultured CGNs at early morphogenesis, we found that extension of the leading process was severely inhibited by the pharmacological inhibition of GSK3. The rate of somal migration was also reduced with a GSK3 inhibitor in dissociated culture as well as in microexplant culture. In addition, CGNs ectopically expressed with a catalytically inactive mutant of GSK3 exhibited a migration defect in vivo. In axonal leading processes of CGNs, detyrosination and acetylation of α-tubulin, which are known to correlate with microtubule stability, were decreased by GSK3 inhibition. A photoconversion analysis found that inhibition of GSK3 increases the turnover of microtubules. Furthermore, in the presence of paclitaxel, a microtubule-stabilizing reagent, inhibition of GSK3 recovered the axonal leading process extension that was reduced by paclitaxel. Our results suggest that GSK3 supports the extension of axonal processes by stabilizing microtubules, contrary to its function in other neuron-types, lending mechanical insight into neuron-type-dependent morphological regulation. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Effect of glycogen synthase overexpression on insulin-stimulated muscle glucose uptake and storage.

    Science.gov (United States)

    Fogt, Donovan L; Pan, Shujia; Lee, Sukho; Ding, Zhenping; Scrimgeour, Angus; Lawrence, John C; Ivy, John L

    2004-03-01

    Insulin-stimulated muscle glucose uptake is inversely associated with the muscle glycogen concentration. To investigate whether this association is a cause and effect relationship, we compared insulin-stimulated muscle glucose uptake in noncontracted and postcontracted muscle of GSL3-transgenic and wild-type mice. GSL3-transgenic mice overexpress a constitutively active form of glycogen synthase, which results in an abundant storage of muscle glycogen. Muscle contraction was elicited by in situ electrical stimulation of the sciatic nerve. Right gastrocnemii from GSL3-transgenic and wild-type mice were subjected to 30 min of electrical stimulation followed by hindlimb perfusion of both hindlimbs. Thirty minutes of contraction significantly reduced muscle glycogen concentration in wild-type (49%) and transgenic (27%) mice, although transgenic mice retained 168.8 +/- 20.5 micromol/g glycogen compared with 17.7 +/- 2.6 micromol/g glycogen for wild-type mice. Muscle of transgenic and wild-type mice demonstrated similar pre- (3.6 +/- 0.3 and 3.9 +/- 0.6 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) and postcontraction (7.9 +/- 0.4 and 7.0 +/- 0.4 micromol.g(-1).h(-1) for transgenic and wild-type, respectively) insulin-stimulated glucose uptakes. However, the [14C]glucose incorporated into glycogen was greater in noncontracted (151%) and postcontracted (157%) transgenic muscle vs. muscle of corresponding wild-type mice. These results indicate that glycogen synthase activity is not rate limiting for insulin-stimulated glucose uptake in skeletal muscle and that the inverse relationship between muscle glycogen and insulin-stimulated glucose uptake is an association, not a cause and effect relationship.

  13. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    International Nuclear Information System (INIS)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He; Su, Xiao-Dong

    2006-01-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni 2+ -chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2 1 , with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°

  14. Effects of small interfering RNA targeting thymidylate synthase on survival of ACC3 cells from salivary adenoid cystic carcinoma

    International Nuclear Information System (INIS)

    Shirasaki, Takashi; Maruya, Shin-ichiro; Mizukami, Hiroki; Kakehata, Seiji; Kurotaki, Hidekachi; Yagihashi, Soroku; Shinkawa, Hideichi

    2008-01-01

    Thymidylate synthase (TS) is an important target for chemotherapeutic treatment of cancer and high expression of TS has been associated with poor prognosis or refractory disease in several cancers including colorectal and head and neck cancer. Although TS is known to regulate cell cycles and transcription factors, its potency as a therapeutic target has not been fully explored in adenoid cystic carcinoma (ACC). An ACC cell line (ACC3) was transfected with siRNA targeting the TS gene and inhibition of cell growth and induction of apoptosis-associated molecules were evaluated in vitro. In addition, the in vivo effect of TS siRNA on tumor progression was assessed using a xenograft model. Our results demonstrated that ACC3 cells showed significantly higher TS expression than non-cancer cell lines and the induction of TS siRNA led to inhibition of cell proliferation. The effect was associated with an increase in p53, p21, and active caspase-3 and S-phase accumulation. We also found up-regulation of spermidine/spermine N1-acetyltransferase (SSAT), a polyamine metabolic enzyme. Furthermore, treatment with TS siRNA delivered by atelocollagen showed a significant cytostatic effect through the induction of apoptosis in a xenograft model. TS may be an important therapeutic target and siRNA targeting TS may be of potential therapeutic value in ACC

  15. Nitric Oxide Synthase and Cyclooxygenase Pathways: A Complex Interplay in Cellular Signaling.

    Science.gov (United States)

    Sorokin, Andrey

    2016-01-01

    The cellular reaction to external challenges is a tightly regulated process consisting of integrated processes mediated by a variety of signaling molecules, generated as a result of modulation of corresponding biosynthetic systems. Both, nitric oxide synthase (NOS) and cyclooxygenase (COX) systems, consist of constitutive forms (NOS1, NOS3 and COX-1), which are mostly involved in housekeeping tasks, and inducible forms (NOS2 and COX-2), which shape the cellular response to stress and variety of bioactive agents. The complex interplay between NOS and COX pathways can be observed at least at three levels. Firstly, products of NOS and Cox systems can mediate the regulation and the expression of inducible forms (NOS2 and COX-2) in response of similar and dissimilar stimulus. Secondly, the reciprocal modulation of cyclooxygenase activity by nitric oxide and NOS activity by prostaglandins at the posttranslational level has been shown to occur. Mechanisms by which nitric oxide can modulate prostaglandin synthesis include direct S-nitrosylation of COX and inactivation of prostaglandin I synthase by peroxynitrite, product of superoxide reaction with nitric oxide. Prostaglandins, conversely, can promote an increased association of dynein light chain (DLC) (also known as protein inhibitor of neuronal nitric oxide synthase) with NOS1, thereby reducing its activity. The third level of interplay is provided by intracellular crosstalk of signaling pathways stimulated by products of NOS and COX which contributes significantly to the complexity of cellular signaling. Since modulation of COX and NOS pathways was shown to be principally involved in a variety of pathological conditions, the dissection of their complex relationship is needed for better understanding of possible therapeutic strategies. This review focuses on implications of interplay between NOS and COX for cellular function and signal integration.

  16. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of SAICAR synthase from Streptococcus suis serotype 2

    International Nuclear Information System (INIS)

    Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua

    2010-01-01

    Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°

  17. Molecular cloning and characterization of strictosidine synthase, a ...

    African Journals Online (AJOL)

    Mitragynine is one of the most dominant indole alkaloids present in the leaves of Mitragyna speciosa, a species of Rubiaceae. This alkaloid is believed to be synthesized via condensation of the amino acid derivative, tryptamine and secologanine by the action of strictosidine synthase (STR). The cDNA clone encoding STR ...

  18. Cyclic [G(2',5')pA(3',5')p] is the metazoan second messenger produced by DNA-activated cyclic GMP-AMP synthase.

    Science.gov (United States)

    Gao, Pu; Ascano, Manuel; Wu, Yang; Barchet, Winfried; Gaffney, Barbara L; Zillinger, Thomas; Serganov, Artem A; Liu, Yizhou; Jones, Roger A; Hartmann, Gunther; Tuschl, Thomas; Patel, Dinshaw J

    2013-05-23

    Recent studies identified cyclic GMP-AMP (cGAMP) as a metazoan second messenger triggering an interferon response. cGAMP is generated from GTP and ATP by cytoplasmic dsDNA sensor cGAMP synthase (cGAS). We combined structural, chemical, biochemical, and cellular assays to demonstrate that this second messenger contains G(2',5')pA and A(3',5')pG phosphodiester linkages, designated c[G(2',5')pA(3',5')p]. We show that, upon dsDNA binding, cGAS is activated through conformational transitions, resulting in formation of a catalytically competent and accessible nucleotide-binding pocket for generation of c[G(2',5')pA(3',5')p]. We demonstrate that cyclization occurs in a stepwise manner through initial generation of 5'-pppG(2',5')pA prior to cyclization to c[G(2',5')pA(3',5')p], with the latter positioned precisely in the catalytic pocket. Mutants of cGAS dsDNA-binding or catalytic pocket residues exhibit reduced or abrogated activity. Our studies have identified c[G(2',5')pA(3',5')p] as a founding member of a family of metazoan 2',5'-containing cyclic heterodinucleotide second messengers distinct from bacterial 3',5' cyclic dinucleotides. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. The stress-related, rhizobial small RNA RcsR1 destabilizes the autoinducer synthase encoding mRNA sinI in Sinorhizobium meliloti

    Czech Academy of Sciences Publication Activity Database

    Baumgardt, K.; Šmídová, Klára; Rahn, H.; Lochnit, G.; Robledo, M.; Evguenieva-Hackenberg, E.

    2016-01-01

    Roč. 13, č. 5 (2016), s. 486-499 ISSN 1547-6286 Institutional support: RVO:61388971 Keywords : Agrobacterium * autoinducer synthase * degradosome Subject RIV: EE - Microbiology, Virology Impact factor: 3.900, year: 2016

  20. Evolution of conifer diterpene synthases: diterpene resin acid biosynthesis in lodgepole pine and jack pine involves monofunctional and bifunctional diterpene synthases.

    Science.gov (United States)

    Hall, Dawn E; Zerbe, Philipp; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet; Madilao, Lina L; Yuen, Macaire; Bohlmann, Jörg

    2013-02-01

    Diterpene resin acids (DRAs) are major components of pine (Pinus spp.) oleoresin. They play critical roles in conifer defense against insects and pathogens and as a renewable resource for industrial bioproducts. The core structures of DRAs are formed in secondary (i.e. specialized) metabolism via cycloisomerization of geranylgeranyl diphosphate (GGPP) by diterpene synthases (diTPSs). Previously described gymnosperm diTPSs of DRA biosynthesis are bifunctional enzymes that catalyze the initial bicyclization of GGPP followed by rearrangement of a (+)-copalyl diphosphate intermediate at two discrete class II and class I active sites. In contrast, similar diterpenes of gibberellin primary (i.e. general) metabolism are produced by the consecutive activity of two monofunctional class II and class I diTPSs. Using high-throughput transcriptome sequencing, we discovered 11 diTPS from jack pine (Pinus banksiana) and lodgepole pine (Pinus contorta). Three of these were orthologous to known conifer bifunctional levopimaradiene/abietadiene synthases. Surprisingly, two sets of orthologous PbdiTPSs and PcdiTPSs were monofunctional class I enzymes that lacked functional class II active sites and converted (+)-copalyl diphosphate, but not GGPP, into isopimaradiene and pimaradiene as major products. Diterpene profiles and transcriptome sequences of lodgepole pine and jack pine are consistent with roles for these diTPSs in DRA biosynthesis. The monofunctional class I diTPSs of DRA biosynthesis form a new clade within the gymnosperm-specific TPS-d3 subfamily that evolved from bifunctional diTPS rather than monofunctional enzymes (TPS-c and TPS-e) of gibberellin metabolism. Homology modeling suggested alterations in the class I active site that may have contributed to their functional specialization relative to other conifer diTPSs.

  1. Studies on the Active Site of Deacetoxycephalosporin C Synthase

    NARCIS (Netherlands)

    Lloyd, Matthew D.; Lee, Hwei-Jen; Harlos, Karl; Zhang, Zhi-Hong; Baldwin, Jack E.; Schofield, Christopher J.; Charnock, John M.; Garner, C. David; Hara, Takane; Terwisscha van Scheltinga, Anke C.; Valegård, Karin; Viklund, Jenny A.C.; Hajdu, Janos; Andersson, Inger; Danielsson, Åke; Bhikhabhai, Rama

    1999-01-01

    The Fe(II) and 2-oxoglutarate-dependent dioxygenase deacetoxycephalosporin C synthase (DAOCS) from Streptomyces clavuligerus was expressed at ca 25% of total soluble protein in Escherichia coli and purified by an efficient large-scale procedure. Purified protein catalysed the conversions of

  2. A plant genetically modified that accumulates Pb is especially promising for phytoremediation

    International Nuclear Information System (INIS)

    Gisbert, Carmina; Ros, Roc; Haro, Antonio de; Walker, David J.; Pilar Bernal, M.; Serrano, Ramon; Navarro-Avino, Juan

    2003-01-01

    From a number of wild plant species growing on soils highly contaminated by heavy metals in Eastern Spain, Nicotiana glauca R. Graham (shrub tobacco) was selected for biotechnological modification, because it showed the most appropriate properties for phytoremediation. This plant has a wide geographic distribution, is fast-growing with a high biomass, and is repulsive to herbivores. Following Agrobacterium mediated transformation, the induction and overexpression of a wheat gene encoding phytochelatin synthase (TaPCS1) in this particular plant greatly increased its tolerance to metals such as Pb and Cd, developing seedling roots 160% longer than wild type plants. In addition, seedlings of transformed plants grown in mining soils containing high levels of Pb (1572 ppm) accumulated double concentration of this heavy metal than wild type. These results indicate that the transformed N. glauca represents a highly promising new tool for use in phytoremediation efforts

  3. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Directory of Open Access Journals (Sweden)

    Wang Ze

    2010-02-01

    Full Text Available Abstract Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9 expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA, co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9. Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy.

  4. Stabilization of mismatch repair gene PMS2 by glycogen synthase kinase 3β is implicated in the treatment of cervical carcinoma

    Science.gov (United States)

    2010-01-01

    Background PMS2 expression loss was reported in a variety of human. However, its importance has not been fully understood in cervical carcinoma. The aim of this study was to determine the expression of PMS2 in cervical carcinoma and evaluate the significance of mismatch repair gene PMS2 regulated by glycogen synthase kinase 3β (GSK-3β) in chemosensitivity. Methods We examined PMS2 and phosphorylated GSK-3β(s9) expression in cervical carcinoma tissues using immunohistochemical staining. Furthermore, we detected PMS2 expression in HeLa cells and evaluate the interaction with GSK-3β after transfection with GSK-3β by small interference RNA (siRNA), co-immunoprecipitation and immunoblotting. We also evaluated the effect of PMS2 transfection on HeLa cells' chemosensitivity to cisplatin treatment. Results We found significant downregulation of PMS2 in cervical carcinoma, which was negatively associated with phosphorylated GSK-3β (s9). Furthermore, we demonstrated GSK-3β transfection was able to interact with PMS2 and enhance PMS2 production in HeLa cells, and increased PMS2 production was responsible for enhanced chemosensitivity. Conclusions Our results provide the evidence that stabilization of PMS2 production by GSK-3β was important to improve chemosensitization, indicating the significance of GSK-3β-related PMS2 downregulation in the development of cervical carcinoma and in developing a potential strategy for chemotherapy. PMID:20178594

  5. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Inhibition of glycogen synthase kinase-3 enhances the differentiation and reduces the proliferation of adult human olfactory epithelium neural precursors

    Energy Technology Data Exchange (ETDEWEB)

    Manceur, Aziza P. [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Tseng, Michael [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Holowacz, Tamara [Donnelly Centre, University of Toronto, Toronto, Ontario (Canada); Witterick, Ian [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Department of Otolaryngology, Head and Neck Surgery, University of Toronto, ON (Canada); Weksberg, Rosanna [Institute of Medical Science, University of Toronto, Toronto, ON (Canada); The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); McCurdy, Richard D. [The Hospital for Sick Children, Research Institute, Program in Genetics and Genomic Biology, Toronto, Ontario Canada (Canada); Warsh, Jerry J. [Laboratory of Cellular and Molecular Pathophysiology, Centre for Addiction and Mental Health (CAMH), University of Toronto, Toronto, Ontario (Canada); Department of Psychiatry, University of Toronto, Toronto, ON (Canada); Institute of Medical Science, University of Toronto, Toronto, ON (Canada); Audet, Julie, E-mail: julie.audet@utoronto.ca [Institute of Biomaterials and Biomedical Engineering (IBBME), University of Toronto, Toronto, Ontario (Canada); Donnelly Centre, University of Toronto, Toronto, Ontario (Canada)

    2011-09-10

    The olfactory epithelium (OE) contains neural precursor cells which can be easily harvested from a minimally invasive nasal biopsy, making them a valuable cell source to study human neural cell lineages in health and disease. Glycogen synthase kinase-3 (GSK-3) has been implicated in the etiology and treatment of neuropsychiatric disorders and also in the regulation of murine neural precursor cell fate in vitro and in vivo. In this study, we examined the impact of decreased GSK-3 activity on the fate of adult human OE neural precursors in vitro. GSK-3 inhibition was achieved using ATP-competitive (6-bromoindirubin-3'-oxime and CHIR99021) or substrate-competitive (TAT-eIF2B) inhibitors to eliminate potential confounding effects on cell fate due to off-target kinase inhibition. GSK-3 inhibitors decreased the number of neural precursor cells in OE cell cultures through a reduction in proliferation. Decreased proliferation was not associated with a reduction in cell survival but was accompanied by a reduction in nestin expression and a substantial increase in the expression of the neuronal differentiation markers MAP1B and neurofilament (NF-M) after 10 days in culture. Taken together, these results suggest that GSK-3 inhibition promotes the early stages of neuronal differentiation in cultures of adult human neural precursors and provide insights into the mechanisms by which alterations in GSK-3 signaling affect adult human neurogenesis, a cellular process strongly suspected to play a role in the etiology of neuropsychiatric disorders.

  7. New procedures to measure synthase and phosphatase activities of bis-phosphoglycerate mutase. Interest for development of therapeutic drugs

    International Nuclear Information System (INIS)

    Ravel, P.; Garel, M.C.; Toullec, D.

    1997-01-01

    In red blood cells, a modulation of the level of the allosteric effector of hemoglobin, 2,3-diphosphoglycerate (2,3-DPG) would have implications in the treatment of ischemia and sickle cell anemia. Its concentrations is determined by the relative activities of the synthase and phosphatase reactions of the multifunctional bis-phosphoglycerate mutase (BPGM). In this report we develop first a more direct synthase assay which uses glyceraldehyde phosphate to suppress the aldolase and triose phosphate isomerase reactions. Secondly we propose a radioactive phosphatase assay coupled to chromatographic separation and identification of the reaction products by paper electrophoresis. Such identification of these products allows us to show that the multifunctional BPGM expresses its mutase instead of its phosphatase activity in conditions of competition between the 3-phosphoglycerate and the 2-phospho-glycolate activator in the phosphatase reaction. These two more precise procedures could be used to study the effects of substrate and cofactor analogues regarding potential therapeutic approaches and could be used for clinical analyses to detect deficiency of BPGM. (author)

  8. Functional specificity of cardiolipin synthase revealed by the identification of a cardiolipin synthase CrCLS1 in Chlamydomonas reinhardtii

    Directory of Open Access Journals (Sweden)

    Chun-Hsien eHung

    2016-01-01

    Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.

  9. Heme A synthase in bacteria depends on one pair of cysteinyls for activity.

    Science.gov (United States)

    Lewin, Anna; Hederstedt, Lars

    2016-02-01

    Heme A is a prosthetic group unique for cytochrome a-type respiratory oxidases in mammals, plants and many microorganisms. The poorly understood integral membrane protein heme A synthase catalyzes the synthesis of heme A from heme O. In bacteria, but not in mitochondria, this enzyme contains one or two pairs of cysteine residues that are present in predicted hydrophilic polypeptide loops on the extracytoplasmic side of the membrane. We used heme A synthase from the eubacterium Bacillus subtilis and the hyperthermophilic archeon Aeropyrum pernix to investigate the functional role of these cysteine residues. Results with B. subtilis amino acid substituted proteins indicated the pair of cysteine residues in the loop connecting transmembrane segments I and II as being essential for catalysis but not required for binding of the enzyme substrate, heme O. Experiments with isolated A. pernix and B. subtilis heme A synthase demonstrated that a disulfide bond can form between the cysteine residues in the same loop and also between loops showing close proximity of the two loops in the folded enzyme protein. Based on the findings, we propose a classification scheme for the four discrete types of heme A synthase found so far in different organisms and propose that essential cysteinyls mediate transfer of reducing equivalents required for the oxygen-dependent catalysis of heme A synthesis from heme O. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Predicting the functions and specificity of triterpenoid synthases: a mechanism-based multi-intermediate docking approach.

    Directory of Open Access Journals (Sweden)

    Bo-Xue Tian

    2014-10-01

    Full Text Available Terpenoid synthases construct the carbon skeletons of tens of thousands of natural products. To predict functions and specificity of triterpenoid synthases, a mechanism-based, multi-intermediate docking approach is proposed. In addition to enzyme function prediction, other potential applications of the current approach, such as enzyme mechanistic studies and enzyme redesign by mutagenesis, are discussed.

  11. Riboflavin accumulation and characterization of cDNAs encoding lumazine synthase and riboflavin synthase in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un

    2012-12-05

    Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.

  12. Optimization of the expression of phaC2 encoding poly (3-hydroxyalkanoate synthase from Pseudomonas aeruginosa PTCC1310 in Fad B deleted Escherichia coli

    Directory of Open Access Journals (Sweden)

    Daryoush Abedi

    2016-01-01

    Conclusion: We obtained functional expression of the phaC2 gene and investigated various conditions that could influence the expression of protein to optimize production of PHA synthase enzymes. This would allow us to study PHA production in large quantities.

  13. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    African Journals Online (AJOL)

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  14. Dynamics of meso and thermo citrate synthases with implicit solvation

    Science.gov (United States)

    Cordeiro, J. M. M.

    The dynamics of hydration of meso and thermo citrate synthases has been investigated using the EEF1 methodology implemented with the CHARMM program. The native enzymes are composed of two identical subunits, each divided into a small and large domain. The dynamics behavior of both enzymes at 30°C and 60°C has been compared. The results of simulations show that during the hydration process, each subunit follows a different pathway of hydration, in spite of the identical sequence. The hydrated structures were compared with the crystalline structure, and the root mean square deviation (RMSD) of each residue along the trajectory was calculated. The regions with larger and smaller mobility were identified. In particular, helices belonging to the small domain are more mobile than those of the large domain. In contrast, the residues that constitute the active site show a much lower displacement compared with the crystalline structure. Hydration free energy calculations point out that Thermoplasma acidophilum citrate synthase (TCS) is more stable than chicken citrate synthase (CCS), at high temperatures. Such result has been ascribed to the higher number of superficial charges in the thermophilic homologue, which stabilizes the enzyme, while the mesophilic homologue denatures. These results are in accord with the experimental found that TCS keeps activity at temperatures farther apart from the catalysis regular temperature than the CCS.

  15. Role of Polymorphisms of Inducible Nitric Oxide Synthase and Endothelial Nitric Oxide Synthase in Idiopathic Environmental Intolerances

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2015-01-01

    Full Text Available Oxidative stress and inflammation play a pathogenetic role in idiopathic environmental intolerances (IEI, namely, multiple chemical sensitivity (MCS, fibromyalgia (FM, and chronic fatigue syndrome (CFS. Given the reported association of nitric oxide synthase (NOS gene polymorphisms with inflammatory disorders, we aimed to investigate the distribution of NOS2A −2.5 kb (CCTTTn as well as Ser608Leu and NOS3 −786T>C variants and their correlation with nitrite/nitrate levels, in a study cohort including 170 MCS, 108 suspected MCS (SMCS, 89 FM/CFS, and 196 healthy subjects. Patients and controls had similar distributions of NOS2A Ser608Leu and NOS3 −786T>C polymorphisms. Interestingly, the NOS3 −786TT genotype was associated with increased nitrite/nitrate levels only in IEI patients. We also found that the NOS2A −2.5 kb (CCTTT11 allele represents a genetic determinant for FM/CFS, and the (CCTTT16 allele discriminates MCS from SMCS patients. Instead, the (CCTTT8 allele reduces by three-, six-, and tenfold, respectively, the risk for MCS, SMCS, and FM/CFS. Moreover, a short number of (CCTTT repeats is associated with higher concentrations of nitrites/nitrates. Here, we first demonstrate that NOS3 −786T>C variant affects nitrite/nitrate levels in IEI patients and that screening for NOS2A −2.5 kb (CCTTTn polymorphism may be useful for differential diagnosis of various IEI.

  16. Inhibition of glycogen synthase kinase-3β counteracts ligand-independent activity of the androgen receptor in castration resistant prostate cancer.

    Directory of Open Access Journals (Sweden)

    Stefanie V Schütz

    Full Text Available In order to generate genomic signals, the androgen receptor (AR has to be transported into the nucleus upon androgenic stimuli. However, there is evidence from in vitro experiments that in castration-resistant prostate cancer (CRPC cells the AR is able to translocate into the nucleus in a ligand-independent manner. The recent finding that inhibition of the glycogen-synthase-kinase 3β (GSK-3β induces a rapid nuclear export of the AR in androgen-stimulated prostate cancer cells prompted us to analyze the effects of a GSK-3β inhibition in the castration-resistant LNCaP sublines C4-2 and LNCaP-SSR. Both cell lines exhibit high levels of nuclear AR in the absence of androgenic stimuli. Exposure of these cells to the maleimide SB216763, a potent GSK-3β inhibitor, resulted in a rapid nuclear export of the AR even under androgen-deprived conditions. Moreover, the ability of C4-2 and LNCaP-SSR cells to grow in the absence of androgens was diminished after pharmacological inhibition of GSK-3β in vitro. The ability of SB216763 to modulate AR signalling and function in CRPC in vivo was additionally demonstrated in a modified chick chorioallantoic membrane xenograft assay after systemic delivery of SB216763. Our data suggest that inhibition of GSK-3β helps target the AR for export from the nucleus thereby diminishing the effects of mislocated AR in CRPC cells. Therefore, inhibition of GSK-3β could be an interesting new strategy for the treatment of CRPC.

  17. Focal adhesion kinase-mediated activation of glycogen synthase kinase 3β regulates IL-33 receptor internalization and IL-33 signaling.

    Science.gov (United States)

    Zhao, Jing; Wei, Jianxin; Bowser, Rachel K; Traister, Russell S; Fan, Ming-Hui; Zhao, Yutong

    2015-01-15

    IL-33, a relatively new member of the IL-1 cytokine family, plays a crucial role in allergic inflammation and acute lung injury. Long form ST2 (ST2L), the receptor for IL-33, is expressed on immune effector cells and lung epithelia and plays a critical role in triggering inflammation. We have previously shown that ST2L stability is regulated by the ubiquitin-proteasome system; however, its upstream internalization has not been studied. In this study, we demonstrate that glycogen synthase kinase 3β (GSK3β) regulates ST2L internalization and IL-33 signaling. IL-33 treatment induced ST2L internalization, and an effect was attenuated by inhibition or downregulation of GSK3β. GSK3β was found to interact with ST2L on serine residue 446 in response to IL-33 treatment. GSK3β binding site mutant (ST2L(S446A)) and phosphorylation site mutant (ST2L(S442A)) are resistant to IL-33-induced ST2L internalization. We also found that IL-33 activated focal adhesion kinase (FAK). Inhibition of FAK impaired IL-33-induced GSK3β activation and ST2L internalization. Furthermore, inhibition of ST2L internalization enhanced IL-33-induced cytokine release in lung epithelial cells. These results suggest that modulation of the ST2L internalization by FAK/GSK3β might serve as a unique strategy to lessen pulmonary inflammation. Copyright © 2015 by The American Association of Immunologists, Inc.

  18. Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He, E-mail: liangyh@pku.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, Peking University, Beijing 100871 (China); Department of Biochemistry and Molecular Biology, College of Life Sciences, Peking University, Beijing 100871 (China)

    2006-10-01

    Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.

  19. The LINKS motif zippers trans-acyltransferase polyketide synthase assembly lines into a biosynthetic megacomplex.

    Science.gov (United States)

    Gay, Darren C; Wagner, Drew T; Meinke, Jessica L; Zogzas, Charles E; Gay, Glen R; Keatinge-Clay, Adrian T

    2016-03-01

    Polyketides such as the clinically-valuable antibacterial agent mupirocin are constructed by architecturally-sophisticated assembly lines known as trans-acyltransferase polyketide synthases. Organelle-sized megacomplexes composed of several copies of trans-acyltransferase polyketide synthase assembly lines have been observed by others through transmission electron microscopy to be located at the Bacillus subtilis plasma membrane, where the synthesis and export of the antibacterial polyketide bacillaene takes place. In this work we analyze ten crystal structures of trans-acyltransferase polyketide synthases ketosynthase domains, seven of which are reported here for the first time, to characterize a motif capable of zippering assembly lines into a megacomplex. While each of the three-helix LINKS (Laterally-INteracting Ketosynthase Sequence) motifs is observed to similarly dock with a spatially-reversed copy of itself through hydrophobic and ionic interactions, the amino acid sequences of this motif are not conserved. Such a code is appropriate for mediating homotypic contacts between assembly lines to ensure the ordered self-assembly of a noncovalent, yet tightly-knit, enzymatic network. LINKS-mediated lateral interactions would also have the effect of bolstering the vertical association of the polypeptides that comprise a polyketide synthase assembly line. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants

    Directory of Open Access Journals (Sweden)

    Jia Fang

    2018-02-01

    Full Text Available Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T2 and T3Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium (CP4. For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid content in transgene-present, transgene-absent, empty vector (EV, and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  1. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants.

    Science.gov (United States)

    Fang, Jia; Nan, Peng; Gu, Zongying; Ge, Xiaochun; Feng, Yu-Qi; Lu, Bao-Rong

    2018-01-01

    Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T 2 and T 3 Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium ( CP4 ). For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid) content in transgene-present, transgene-absent, empty vector (EV), and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T 2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T 3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  2. Bifunctional cis-Abienol Synthase from Abies balsamea Discovered by Transcriptome Sequencing and Its Implications for Diterpenoid Fragrance Production*

    Science.gov (United States)

    Zerbe, Philipp; Chiang, Angela; Yuen, Macaire; Hamberger, Björn; Hamberger, Britta; Draper, Jason A.; Britton, Robert; Bohlmann, Jörg

    2012-01-01

    The labdanoid diterpene alcohol cis-abienol is a major component of the aromatic oleoresin of balsam fir (Abies balsamea) and serves as a valuable bioproduct material for the fragrance industry. Using high-throughput 454 transcriptome sequencing and metabolite profiling of balsam fir bark tissue, we identified candidate diterpene synthase sequences for full-length cDNA cloning and functional characterization. We discovered a bifunctional class I/II cis-abienol synthase (AbCAS), along with the paralogous levopimaradiene/abietadiene synthase and isopimaradiene synthase, all of which are members of the gymnosperm-specific TPS-d subfamily. The AbCAS-catalyzed formation of cis-abienol proceeds via cyclization and hydroxylation at carbon C-8 of a postulated carbocation intermediate in the class II active site, followed by cleavage of the diphosphate group and termination of the reaction sequence without further cyclization in the class I active site. This reaction mechanism is distinct from that of synthases of the isopimaradiene- or levopimaradiene/abietadiene synthase type, which employ deprotonation reactions in the class II active site and secondary cyclizations in the class I active site, leading to tricyclic diterpenes. Comparative homology modeling suggested the active site residues Asp-348, Leu-617, Phe-696, and Gly-723 as potentially important for the specificity of AbCAS. As a class I/II bifunctional enzyme, AbCAS is a promising target for metabolic engineering of cis-abienol production. PMID:22337889

  3. Isolation of Persicaria minor sesquiterpene synthase promoter and its deletions for transgenic Arabidopsis thaliana

    Science.gov (United States)

    Omar, Aimi Farehah; Ismail, Ismanizan

    2016-11-01

    Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.

  4. Expression of mismatch repair gene PMS2 in nasopharyngeal carcinoma and regulation by glycogen synthase kinase-3β in vivo and in vitro.

    Science.gov (United States)

    Fang, Jugao; Lei, Wenbin; Huang, Xiaoming; Li, Pingdong; Chen, Xiaohong; Zhu, Xiaolin; Wen, Weiping; Li, Huabin

    2012-02-01

    To evaluate the expression of mismatch repair gene PMS2 in human nasopharyngeal carcinoma (NPC) tissues and evaluate the effect of glycogen synthase kinase (GSK)-3β on PMS2 production in vivo and in vitro. The expression of PMS2 and inactivated phosphorylated GSK-3β(s9) was examined by immunohistochemical staining in 25 NPC tissues and the relation was determined by correlation analysis. The effect of GSK-3β transfection in CNE-2 cells on PMS2 production as well as cell apoptosis and chemosensitization were evaluated using small interference RNA (siRNA), immunoblotting and flow cytometric analysis in vitro. The expression of inactivated phosphorylated GSK-3β(s9) was found to negative correlated with PMS2 in vivo. And transfected GSK-3β was found to be able to enhance PMS2 production, and increase cell apoptosis in CNE-2 cells in combination with cisplatin administration in vitro. Inactivation of GSK-3β might be important for NPC tumorgenesis through negatively regulating PMS2 production, and enhanced PMS2 production by GSK-3β is beneficial for understanding the NPC tumorgenesis and developing potential strategy for future therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  5. NOpiates: Novel Dual Action Neuronal Nitric Oxide Synthase Inhibitors with μ-Opioid Agonist Activity.

    Science.gov (United States)

    Renton, Paul; Green, Brenda; Maddaford, Shawn; Rakhit, Suman; Andrews, John S

    2012-03-08

    A novel series of benzimidazole designed multiple ligands (DMLs) with activity at the neuronal nitric oxide synthase (nNOS) enzyme and the μ-opioid receptor was developed. Targeting of the structurally dissimilar heme-containing enzyme and the μ-opioid GPCR was predicated on the modulatory role of nitric oxide on μ-opioid receptor function. Structure-activity relationship studies yielded lead compound 24 with excellent nNOS inhibitory activity (IC50 = 0.44 μM), selectivity over both endothelial nitric oxide synthase (10-fold) and inducible nitric oxide synthase (125-fold), and potent μ-opioid binding affinity, K i = 5.4 nM. The functional activity as measured in the cyclic adenosine monosphospate secondary messenger assay resulted in full agonist activity (EC50 = 0.34 μM). This work represents a novel approach in the development of new analgesics for the treatment of pain.

  6. Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

    Science.gov (United States)

    Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

    2017-03-01

    This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

  7. Improvement in the quality of hematopoietic prostaglandin D synthase crystals in a microgravity environment

    International Nuclear Information System (INIS)

    Tanaka, Hiroaki; Tsurumura, Toshiharu; Aritake, Kosuke; Furubayashi, Naoki; Takahashi, Sachiko; Yamanaka, Mari; Hirota, Erika; Sano, Satoshi; Sato, Masaru; Kobayashi, Tomoyuki; Tanaka, Tetsuo; Inaka, Koji; Urade, Yoshihiro

    2011-01-01

    Crystals of hematopoietic prostaglandin D synthase grown in microgravity show improved quality. Human hematopoietic prostaglandin synthase, one of the better therapeutic target enzymes for allergy and inflammation, was crystallized with 22 inhibitors and in three inhibitor-free conditions in microgravity. Most of the space-grown crystals showed better X-ray diffraction patterns than the terrestrially grown ones, indicating the advantage of a microgravity environment on protein crystallization, especially in the case of this protein

  8. Cellulose synthases: new insights from crystallography and modeling.

    Science.gov (United States)

    Slabaugh, Erin; Davis, Jonathan K; Haigler, Candace H; Yingling, Yaroslava G; Zimmer, Jochen

    2014-02-01

    Detailed information about the structure and biochemical mechanisms of cellulose synthase (CelS) proteins remained elusive until a complex containing the catalytic subunit (BcsA) of CelS from Rhodobacter sphaeroides was crystalized. Additionally, a 3D structure of most of the cytosolic domain of a plant CelS (GhCESA1 from cotton, Gossypium hirsutum) was produced by computational modeling. This predicted structure contributes to our understanding of how plant CelS proteins may be similar and different as compared with BcsA. In this review, we highlight how these structures impact our understanding of the synthesis of cellulose and other extracellular polysaccharides. We show how the structures can be used to generate hypotheses for experiments testing mechanisms of glucan synthesis and translocation in plant CelS. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Crystal structure of riboflavin synthase

    Energy Technology Data Exchange (ETDEWEB)

    Liao, D.-I.; Wawrzak, Z.; Calabrese, J.C.; Viitanen, P.V.; Jordan, D.B. (DuPont); (NWU)

    2010-03-05

    Riboflavin synthase catalyzes the dismutation of two molecules of 6,7-dimethyl-8-(1'-D-ribityl)-lumazine to yield riboflavin and 4-ribitylamino-5-amino-2,6-dihydroxypyrimidine. The homotrimer of 23 kDa subunits has no cofactor requirements for catalysis. The enzyme is nonexistent in humans and is an attractive target for antimicrobial agents of organisms whose pathogenicity depends on their ability to biosynthesize riboflavin. The first three-dimensional structure of the enzyme was determined at 2.0 {angstrom} resolution using the multiwavelength anomalous diffraction (MAD) method on the Escherichia coli protein containing selenomethionine residues. The homotrimer consists of an asymmetric assembly of monomers, each of which comprises two similar {beta} barrels and a C-terminal {alpha} helix. The similar {beta} barrels within the monomer confirm a prediction of pseudo two-fold symmetry that is inferred from the sequence similarity between the two halves of the protein. The {beta} barrels closely resemble folds found in phthalate dioxygenase reductase and other flavoproteins. The three active sites of the trimer are proposed to lie between pairs of monomers in which residues conserved among species reside, including two Asp-His-Ser triads and dyads of Cys-Ser and His-Thr. The proposed active sites are located where FMN (an analog of riboflavin) is modeled from an overlay of the {beta} barrels of phthalate dioxygenase reductase and riboflavin synthase. In the trimer, one active site is formed, and the other two active sites are wide open and exposed to solvent. The nature of the trimer configuration suggests that only one active site can be formed and be catalytically competent at a time.

  10. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    International Nuclear Information System (INIS)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao; Yu, Xiyan; Wang, Xiufeng

    2010-01-01

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  11. Antisense repression of sucrose phosphate synthase in transgenic muskmelon alters plant growth and fruit development

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Hongmei; Ma, Leyuan; Zhao, Cong; Hao, Hui; Gong, Biao [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Yu, Xiyan, E-mail: yuxiyan@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China); Wang, Xiufeng, E-mail: xfwang@sdau.edu.cn [College of Horticulture Science and Engineering, State Key Laboratory of Crop Biology, Shandong Agricultural University, Tai' an, Shandong 271018 (China)

    2010-03-12

    To unravel the roles of sucrose phosphate synthase (SPS) in muskmelon (Cucumis melo L.), we reduced its activity in transgenic muskmelon plants by an antisense approach. For this purpose, an 830 bp cDNA fragment of muskmelon sucrose phosphate synthase was expressed in antisense orientation behind the 35S promoter of the cauliflower mosaic virus. The phenotype of the antisense plants clearly differed from that of control plants. The transgenic plant leaves were markedly smaller, and the plant height and stem diameter were obviously shorter and thinner. Transmission electron microscope observation revealed that the membrane degradation of chloroplast happened in transgenic leaves and the numbers of grana and grana lamella in the chloroplast were significantly less, suggesting that the slow growth and weaker phenotype of transgenic plants may be due to the damage of the chloroplast ultrastructure, which in turn results in the decrease of the net photosynthetic rate. The sucrose concentration and levels of sucrose phosphate synthase decreased in transgenic mature fruit, and the fruit size was smaller than the control fruit. Together, our results suggest that sucrose phosphate synthase may play an important role in regulating the muskmelon plant growth and fruit development.

  12. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Science.gov (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  13. Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

    Science.gov (United States)

    Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

    2018-07-01

    The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

  14. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  15. Attenuation of ischemia-reperfusion injury by sevoflurane postconditioning involves protein kinase B and glycogen synthase kinase 3 beta activation in isolated rat hearts.

    Science.gov (United States)

    Fang, Neng-Xin; Yao, Yun-Tai; Shi, Chun-Xia; Li, Li-Huan

    2010-12-01

    Volatile anesthetic ischemic postconditioning reduces infarct size following ischemia/reperfusion. Whether phosphorylation of protein kinase B (PKB/Akt) and glycogen synthase kinase 3 beta (GSK3β) is causal for cardioprotection by postconditioning is controversial. We therefore investigated the impact of PKB/Akt and GSK3β in isolated perfused rat hearts subjected to 40 min of ischemia followed by 1 h of reperfusion. 2.0% sevoflurane (1.0 minimum alveolar concentration) was administered at the onset of reperfusion in 15 min as postconditioning. Western blot analysis was used to determine phosphorylation of PKB/Akt and its downstream target GSK3β after 1 h of reperfusion. Mitochondrial and cytosolic content of cytochrome C checked by western blot served as a marker for mitochondrial permeability transition pore opening. Sevoflurane postconditioning significantly improved functional cardiac recovery and decreased infarct size in isolated rat hearts. Compared with unprotected hearts, sevoflurane postconditioning-induced phosphorylation of PKB/Akt and GSK3β were significantly increased. Increase of cytochrome C in mitochondria and decrease of it in cytosol is significant when compared with unprotected ones which have reversal effects on cytochrome C. The current study presents evidence that sevoflurane-induced cardioprotection at the onset of reperfusion are partly through activation of PKB/Akt and GSK3β.

  16. Nitric Oxide Synthase Enzymes in the Airways of Mice Exposed to Ovalbumin: NOS2 Expression Is NOS3 Dependent

    Directory of Open Access Journals (Sweden)

    Jennifer M. Bratt

    2010-01-01

    Full Text Available Objectives and Design. The function of the airway nitric oxide synthase (NOS isoforms and the lung cell types responsible for its production are not fully understood. We hypothesized that NO homeostasis in the airway is important to control inflammation, which requires upregulation, of NOS2 protein expression by an NOS3-dependent mechanism. Materials or Subjects. Mice from a C57BL/6 wild-type, NOS1−/−, NOS2−/−, and NOS3−/− genotypes were used. All mice strains were systemically sensitized and exposed to filtered air or ovalbumin (OVA aerosol for two weeks to create a subchronic model of allergen-induced airway inflammation. Methods. We measured lung function, lung lavage inflammatory and airway epithelial goblet cell count, exhaled NO, nitrate and nitrite concentration, and airway NOS1, NOS2, and NOS3 protein content. Results. Deletion of NOS1 or NOS3 increases NOS2 protein present in the airway epithelium and smooth muscle of air-exposed animals. Exposure to allergen significantly reduced the expression of NOS2 protein in the airway epithelium and smooth muscle of the NOS3−/− strain only. This reduction in NOS2 expression was not due to the replacement of epithelial cells with goblet cells as remaining epithelial cells did not express NOS2. NOS1−/− animals had significantly reduced goblet cell metaplasia compared to C57Bl/6 wt, NOS2−/−, and NOS3−/− allergen-exposed mice. Conclusion. The airway epithelial and smooth muscle cells maintain a stable airway NO concentration under noninflammatory conditions. This “homeostatic” mechanism is unable to distinguish between NOS derived from the different constitutive NOS isoforms. NOS3 is essential for the expression of NOS2 under inflammatory conditions, while NOS1 expression contributes to allergen-induced goblet cell metaplasia.

  17. Nitric Oxide Synthase Enzymes in the Airways of Mice Exposed to Ovalbumin: NOS2 Expression Is NOS3 Dependent

    Science.gov (United States)

    Bratt, Jennifer M.; Williams, Keisha; Rabowsky, Michelle F.; Last, Michael S.; Franzi, Lisa M.; Last, Jerold A.; Kenyon, Nicholas J.

    2010-01-01

    Objectives and Design. The function of the airway nitric oxide synthase (NOS) isoforms and the lung cell types responsible for its production are not fully understood. We hypothesized that NO homeostasis in the airway is important to control inflammation, which requires upregulation, of NOS2 protein expression by an NOS3-dependent mechanism. Materials or Subjects. Mice from a C57BL/6 wild-type, NOS1−/−, NOS2−/−, and NOS3−/− genotypes were used. All mice strains were systemically sensitized and exposed to filtered air or ovalbumin (OVA) aerosol for two weeks to create a subchronic model of allergen-induced airway inflammation. Methods. We measured lung function, lung lavage inflammatory and airway epithelial goblet cell count, exhaled NO, nitrate and nitrite concentration, and airway NOS1, NOS2, and NOS3 protein content. Results. Deletion of NOS1 or NOS3 increases NOS2 protein present in the airway epithelium and smooth muscle of air-exposed animals. Exposure to allergen significantly reduced the expression of NOS2 protein in the airway epithelium and smooth muscle of the NOS3−/− strain only. This reduction in NOS2 expression was not due to the replacement of epithelial cells with goblet cells as remaining epithelial cells did not express NOS2. NOS1−/− animals had significantly reduced goblet cell metaplasia compared to C57Bl/6 wt, NOS2−/−, and NOS3−/− allergen-exposed mice. Conclusion. The airway epithelial and smooth muscle cells maintain a stable airway NO concentration under noninflammatory conditions. This “homeostatic” mechanism is unable to distinguish between NOS derived from the different constitutive NOS isoforms. NOS3 is essential for the expression of NOS2 under inflammatory conditions, while NOS1 expression contributes to allergen-induced goblet cell metaplasia. PMID:20953358

  18. Two structurally distinct inhibitors of glycogen synthase kinase 3 induced centromere positive micronuclei in human lymphoblastoid TK6 cells.

    Science.gov (United States)

    Mishima, Masayuki; Tanaka, Kenji; Takeiri, Akira; Harada, Asako; Kubo, Chiyomi; Sone, Sachiko; Nishimura, Yoshikazu; Tachibana, Yukako; Okazaki, Makoto

    2008-08-25

    Glycogen synthase kinase 3 (GSK3) is an attractive novel pharmacological target. Inhibition of GSK3 is recently regarded as one of the viable approaches to therapy for Alzheimer's disease, cancer, diabetes mellitus, osteoporosis, and bipolar mood disorder. Here, we have investigated the aneugenic potential of two potent and highly specific inhibitors of GSK3 by using an in vitro micronucleus test with human lymphoblastoid TK6 cells. One inhibitor was a newly synthesized maleimide derivative and the other was a previously known aminopyrimidine derivative. Both compounds elicited statistically significant and concentration-dependent increases in micronucleated cells. One hundred micronuclei (MN) of each were analyzed using centromeric DNA staining with fluorescence in situ hybridization. Both the two structurally distinct compounds induced centromere-positive micronuclei (CMN). Calculated from the frequency of MN cells and the percentage of CMN, CMN cell incidence after treatment with the maleimide compound at 1.2 microM, 2.4 microM, and 4.8 microM was 11.6, 27.7, and 56.3 per 1000 cells, respectively; the negative control was 4.5. CMN cell incidence after the treatment with the aminopyrimidine compound at 1.8 microM, 3.6 microM, and 5.4 microM was 6.7, 9.8 and 17.2 per 1000 cells, respectively. Both compounds exhibited concentration-dependent increase in the number of mitotic cells. The frequency of CMN cells correlated well with mitotic cell incidence after treatment with either compound. Furthermore, both inhibitors induced abnormal mitotic cells with asymmetric mitotic spindles and lagging anaphase chromosomes. These results lend further support to the hypothesis that the inhibition of GSK3 activity affects microtubule function and exhibits an aneugenic mode of action.

  19. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    International Nuclear Information System (INIS)

    Kultti, Anne; Pasonen-Seppaenen, Sanna; Jauhiainen, Marjo; Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I.

    2009-01-01

    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  20. 4-Methylumbelliferone inhibits hyaluronan synthesis by depletion of cellular UDP-glucuronic acid and downregulation of hyaluronan synthase 2 and 3

    Energy Technology Data Exchange (ETDEWEB)

    Kultti, Anne, E-mail: anne.kultti@uku.fi [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Pasonen-Seppaenen, Sanna [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland); Jauhiainen, Marjo [Department of Pharmaceutical Chemistry, University of Kuopio, FIN-70211 Kuopio (Finland); Rilla, Kirsi J.; Kaernae, Riikka; Pyoeriae, Emma; Tammi, Raija H.; Tammi, Markku I. [Institute of Biomedicine, Anatomy, University of Kuopio, P.O.B. 1627, FIN-70211 Kuopio (Finland)

    2009-07-01

    Hyaluronan accumulation on cancer cells and their surrounding stroma predicts an unfavourable disease outcome, suggesting that hyaluronan enhances tumor growth and spreading. 4-Methylumbelliferone (4-MU) inhibits hyaluronan synthesis and retards cancer spreading in experimental animals through mechanisms not fully understood. These mechanisms were studied in A2058 melanoma cells, MCF-7 and MDA-MB-361 breast, SKOV-3 ovarian and UT-SCC118 squamous carcinoma cells by analysing hyaluronan synthesis, UDP-glucuronic acid (UDP-GlcUA) content, and hyaluronan synthase (HAS) mRNA levels. The maximal inhibition in hyaluronan synthesis ranged 22-80% in the cell lines tested. Active glucuronidation of 4-MU produced large quantities of 4-MU-glucuronide, depleting the cellular UDP-GlcUA pool. The maximal reduction varied between 38 and 95%. 4-MU also downregulated HAS mRNA levels: HAS3 was 84-60% lower in MDA-MB-361, A2058 and SKOV-3 cells. HAS2 was the major isoenzyme in MCF-7 cells and lowered by 81%, similar to 88% in A2058 cells. These data indicate that both HAS substrate and HAS2 and/or HAS3 mRNA are targeted by 4-MU. Despite different target point sensitivities, the reduction of hyaluronan caused by 4-MU was associated with a significant inhibition of cell migration, proliferation and invasion, supporting the importance of hyaluronan synthesis in cancer, and the therapeutic potential of hyaluronan synthesis inhibition.

  1. Bornyl-diphosphate synthase from Lavandula angustifolia: A major monoterpene synthase involved in essential oil quality.

    Science.gov (United States)

    Despinasse, Yolande; Fiorucci, Sébastien; Antonczak, Serge; Moja, Sandrine; Bony, Aurélie; Nicolè, Florence; Baudino, Sylvie; Magnard, Jean-Louis; Jullien, Frédéric

    2017-05-01

    Lavender essential oils (EOs) of higher quality are produced by a few Lavandula angustifolia cultivars and mainly used in the perfume industry. Undesirable compounds such as camphor and borneol are also synthesized by lavender leading to a depreciated EO. Here, we report the cloning of bornyl diphosphate synthase of lavender (LaBPPS), an enzyme that catalyzes the production of bornyl diphosphate (BPP) and then by-products such as borneol or camphor, from an EST library. Compared to the BPPS of Salvia officinalis, the functional characterization of LaBPPS showed several differences in amino acid sequence, and the distribution of catalyzed products. Molecular modeling of the enzyme's active site suggests that the carbocation intermediates are more stable in LaBPPS than in SoBPPS leading probably to a lower efficiency of LaBPPS to convert GPP into BPP. Quantitative RT-PCR performed from leaves and flowers at different development stages of L. angustifolia samples show a clear correlation between transcript level of LaBPPS and accumulation of borneol/camphor, suggesting that LaBPPS is mainly responsible of in vivo biosynthesis of borneol/camphor in fine lavender. A phylogenetic analysis of terpene synthases (TPS) pointed out the basal position of LaBPPS in the TPSb clade, suggesting that LaBPPS could be an ancestor of others lavender TPSb. Finally, borneol could be one of the first monoterpenes to be synthesized in the Lavandula subgenus. Knowledge gained from these experiments will facilitate future studies to improve the lavender oils through metabolic engineering or plant breeding. Accession numbers: LaBPPS: KM015221. Copyright © 2017. Published by Elsevier Ltd.

  2. Enhancement of vascular targeting by inhibitors of nitric oxide synthase

    International Nuclear Information System (INIS)

    Davis, Peter D.; Tozer, Gillian M.; Naylor, Matthew A.; Thomson, Peter; Lewis, Gemma; Hill, Sally A.

    2002-01-01

    Purpose: This study investigates the enhancement of the vascular targeting activity of the tubulin-binding agent combretastatin A4 phosphate (CA4P) by various inhibitors of nitric oxide synthases. Methods and Materials: The syngeneic tumors CaNT and SaS growing in CBA mice were used for this study. Reduction in perfused vascular volume was measured by injection of Hoechst 33342 24 h after drug administration. Necrosis (hematoxylin and eosin stain) was assessed also at 24 h after treatment. Combretastatin A4 phosphate was synthesized by a modification of the published procedure and the nitric oxide synthase inhibitors L-NNA, L-NMMA, L-NIO, L-NIL, S-MTC, S-EIT, AMP, AMT, and L-TC, obtained from commercial sources. Results: A statistically significant augmentation of the reduction in perfused vascular volume by CA4P in the CaNT tumor was observed with L-NNA, AMP, and AMT. An increase in CA4P-induced necrosis in the same tumor achieved significance with L-NNA, L-NMMA, L-NIL, and AMT. CA4P induced little necrosis in the SaS tumor, but combination with the inhibitors L-NNA, L-NMMA, L-NIO, S-EIT, and L-TC was effective. Conclusions: Augmentation of CA4P activity by nitric oxide synthase inhibitors of different structural classes supports a nitric oxide-related mechanism for this effect. L-NNA was the most effective inhibitor studied

  3. Plant polyketide synthases: a chalcone synthase-type enzyme which performs a condensation reaction with methylmalonyl-CoA in the biosynthesis of C-methylated chalcones.

    Science.gov (United States)

    Schröder, J; Raiber, S; Berger, T; Schmidt, A; Schmidt, J; Soares-Sello, A M; Bardshiri, E; Strack, D; Simpson, T J; Veit, M; Schröder, G

    1998-06-09

    Heterologous screening of a cDNA library from Pinusstrobus seedlings identified clones for two chalcone synthase (CHS) related proteins (PStrCHS1 and PStrCHS2, 87.6% identity). Heterologous expression in Escherichia coli showed that PStrCHS1 performed the typical CHS reaction, that it used starter CoA-esters from the phenylpropanoid pathway, and that it performed three condensation reactions with malonyl-CoA, followed by the ring closure to the chalcone. PstrCHS2 was completely inactive with these starters and also with linear CoA-esters. Activity was detected only with a diketide derivative (N-acetylcysteamine thioester of 3-oxo-5-phenylpent-4-enoic acid) that corresponded to the CHS reaction intermediate postulated after the first condensation reaction. PstrCHS2 performed only one condensation, with 6-styryl-4-hydroxy-2-pyrone derivatives as release products. The enzyme preferred methylmalonyl-CoA against malonyl-CoA, if only methylmalonyl-CoA was available. These properties and a comparison with the CHS from Pinus sylvestris suggested for PstrCHS2 a special function in the biosynthesis of secondary products. In contrast to P. sylvestris, P. strobus contains C-methylated chalcone derivatives, and the methyl group is at the position predicted from a chain extension with methylmalonyl-CoA in the second condensation of the biosynthetic reaction sequence. We propose that PstrCHS2 specifically contributes the condensing reaction with methylmalonyl-CoA to yield a methylated triketide intermediate. We discuss a model that the biosynthesis of C-methylated chalcones represents the simplest example of a modular polyketide synthase.

  4. Ketamine up-regulates a cluster of intronic miRNAs within the serotonin receptor 2C gene by inhibiting glycogen synthase kinase-3.

    Science.gov (United States)

    Grieco, Steven F; Velmeshev, Dmitry; Magistri, Marco; Eldar-Finkelman, Hagit; Faghihi, Mohammad A; Jope, Richard S; Beurel, Eleonore

    2017-09-01

    We examined mechanisms that contribute to the rapid antidepressant effect of ketamine in mice that is dependent on glycogen synthase kinase-3 (GSK3) inhibition. We measured serotonergic (5HT)-2C-receptor (5HTR2C) cluster microRNA (miRNA) levels in mouse hippocampus after administering an antidepressant dose of ketamine (10 mg/kg) in wild-type and GSK3 knockin mice, after GSK3 inhibition with L803-mts, and in learned helpless mice. Ketamine up-regulated cluster miRNAs 448-3p, 764-5p, 1264-3p, 1298-5p and 1912-3p (2- to 11-fold). This up-regulation was abolished in GSK3 knockin mice that express mutant constitutively active GSK3. The GSK3 specific inhibitor L803-mts was antidepressant in the learned helplessness and novelty suppressed feeding depression-like behaviours and up-regulated the 5HTR2C miRNA cluster in mouse hippocampus. After administration of the learned helplessness paradigm mice were divided into cohorts that were resilient (non-depressed) or were susceptible (depressed) to learned helplessness. The resilient, but not depressed, mice displayed increased hippocampal levels of miRNAs 448-3p and 1264-3p. Administration of an antagonist to miRNA 448-3p diminished the antidepressant effect of ketamine in the learned helplessness paradigm, indicating that up-regulation of miRNA 448-3p provides an antidepressant action. These findings identify a new outcome of GSK3 inhibition by ketamine that may contribute to antidepressant effects.

  5. Critical role of glycogen synthase kinase-3β in regulating the avian heterophil response to Salmonella enterica serovar Enteritidis

    Directory of Open Access Journals (Sweden)

    Michael eKogut

    2014-11-01

    Full Text Available A microarray-assisted gene expression screen of chicken heterophils revealed glycogen synthase kinase-3β (GSK-3β, a multifunctional Ser/Thr kinase, to be consistently up-regulated 30-180 min following stimulation with Salmonella enterica serovar Enteritidis (S. Enteritidis. The present study was designed to delineate the role of GSK-3β in regulating the innate function of chicken heterophils in response to S. Enteritidis exposure. Using a specific GSK-3β ELISA assay, 30 min after infection with S. Enteritidis, heterophils had a significant decrease in total GSK-3β, but a significant increase in phosphorylated GSK-3 (Ser9. By 60 min post-infection, there was no difference in the amount of phosphorylated GSK-3β (Ser9 in either the uninfected and infected heterophils. S. Enteritidis interaction with heterophils alters GSK-3 activity by stimulating phosphorylation at Ser9 and that peaks by 30 min post-infection. Further, inhibition of GSK3β with lithium chloride resulted in a significant decrease in NF-κB activation and expression of IL-6, but induces a significant increase in the expression of the anti-inflammatory cytokine, IL-10. Using a phospho-specific antibody array confirmed the phosphorylation of GSK-3β (Ser9 as well as the phosphorylation of the downstream cytokine-activated intracellular signaling pathway involved in stimulating immune responses, IκB, the IκB subunit IKK-β, and the NF-κB subunits p105, p65, and c-Rel. Our data revealed that the phosphorylation of GSK-3β (Ser9 is responsible for inducing and controlling an innate response to the bacteria. Our findings suggest that the repression of GSK-3 activity is beneficial to the host cell and may act as a target for treatment in controlling intestinal colonization in chickens. Further experiments will define the in vivo modulation of GSK-3 as a potential alternative to antibiotics in salmonella and other intestinal bacterial infections.

  6. In vitro biochemical characterization of all barley endosperm starch synthases

    DEFF Research Database (Denmark)

    Cuesta-Seijo, Jose A.; Nielsen, Morten M.; Ruzanski, Christian

    2016-01-01

    Starch is the main storage polysaccharide in cereals and the major source of calories in the human diet. It is synthesized by a panel of enzymes including five classes of starch synthases (SSs). While the overall starch synthase (SS) reaction is known, the functional differences between the five SS....... Here we provide a detailed biochemical study of the activity of all five classes of SSs in barley endosperm. Each enzyme was produced recombinantly in E. coli and the properties and modes of action in vitro were studied in isolation from other SSs and other substrate modifying activities. Our results...... define the mode of action of each SS class in unprecedented detail; we analyze their substrate selection, temperature dependence and stability, substrate affinity and temporal abundance during barley development. Our results are at variance with some generally accepted ideas about starch biosynthesis...

  7. Insulin like growth factor-1 prevents 1-mentyl-4-phenylphyridinium-induced apoptosis in PC12 cells through activation of glycogen synthase kinase-3beta

    International Nuclear Information System (INIS)

    Sun, Xin; Huang, Luqi; Zhang, Min; Sun, Shenggang; Wu, Yan

    2010-01-01

    Dopaminergic neurons are lost mainly through apoptosis in Parkinson's disease. Insulin like growth factor-1 (IGF-1) inhibits apoptosis in a wide variety of tissues. Here we have shown that IGF-1 protects PC12 cells from toxic effects of 1-methyl-4-phenylpyridiniumion (MPP + ). Treatment of PC12 cells with recombinant human IGF-1 significantly decreased apoptosis caused by MPP + as measured by acridine orange/ethidium bromide staining. IGF-1 treatment induced sustained phosphorylation of glycogen synthase kinase-3beta (GSK-3beta) as shown by western blot analysis. The anti-apoptotic effect of IGF-1 was abrogated by LY294002, which indirectly inhibits phosphorylation of GSK-3beta. Lithium chloride (LiCl), a known inhibitor of GSK-3beta, also blocked MPP + -induced apoptosis. Finally, although IGF-1 enhanced phosphorylation of extracellular signal-regulated kinases ERK1 and 2 (ERK1/2), PD98059, a specific inhibitor of ERK1/2, did not alter the survival effect of IGF-1. Thus, our findings indicate that IGF-1 protects PC12 cells exposed to MPP + from apoptosis via the GSK-3beta signaling pathway.

  8. Persistence of the mitochondrial permeability transition in the absence of subunit c of human ATP synthase.

    Science.gov (United States)

    He, Jiuya; Ford, Holly C; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2017-03-28

    The permeability transition in human mitochondria refers to the opening of a nonspecific channel, known as the permeability transition pore (PTP), in the inner membrane. Opening can be triggered by calcium ions, leading to swelling of the organelle, disruption of the inner membrane, and ATP synthesis, followed by cell death. Recent proposals suggest that the pore is associated with the ATP synthase complex and specifically with the ring of c-subunits that constitute the membrane domain of the enzyme's rotor. The c-subunit is produced from three nuclear genes, ATP5G1 , ATP5G2 , and ATP5G3 , encoding identical copies of the mature protein with different mitochondrial-targeting sequences that are removed during their import into the organelle. To investigate the involvement of the c-subunit in the PTP, we generated a clonal cell, HAP1-A12, from near-haploid human cells, in which ATP5G1 , ATP5G2 , and ATP5G3 were disrupted. The HAP1-A12 cells are incapable of producing the c-subunit, but they preserve the characteristic properties of the PTP. Therefore, the c-subunit does not provide the PTP. The mitochondria in HAP1-A12 cells assemble a vestigial ATP synthase, with intact F 1 -catalytic and peripheral stalk domains and the supernumerary subunits e, f, and g, but lacking membrane subunits ATP6 and ATP8. The same vestigial complex plus associated c-subunits was characterized from human 143B ρ 0 cells, which cannot make the subunits ATP6 and ATP8, but retain the PTP. Therefore, none of the membrane subunits of the ATP synthase that are involved directly in transmembrane proton translocation is involved in forming the PTP.

  9. Glucose-Modulated Mitochondria Adaptation in Tumor Cells: A Focus on ATP Synthase and Inhibitor Factor 1

    Directory of Open Access Journals (Sweden)

    Irene Mavelli

    2012-02-01

    Full Text Available Warburg’s hypothesis has been challenged by a number of studies showing that oxidative phosphorylation is repressed in some tumors, rather than being inactive per se. Thus, treatments able to shift energy metabolism by activating mitochondrial pathways have been suggested as an intriguing basis for the optimization of antitumor strategies. In this study, HepG2 hepatocarcinoma cells were cultivated with different metabolic substrates under conditions mimicking “positive” (activation/biogenesis or “negative” (silencing mitochondrial adaptation. In addition to the expected up-regulation of mitochondrial biogenesis, glucose deprivation caused an increase in phosphorylating respiration and a rise in the expression levels of the ATP synthase β subunit and Inhibitor Factor 1 (IF1. Hyperglycemia, on the other hand, led to a markedly decreased level of the transcriptional coactivator PGC-α suggesting down-regulation of mitochondrial biogenesis, although no change in mitochondrial mass and no impairment of phosphorylating respiration were observed. Moreover, a reduction in mitochondrial networking and in ATP synthase dimer stability was produced. No effect on β-ATP synthase expression was elicited. Notably, hyperglycemia caused an increase in IF1 expression levels, but it did not alter the amount of IF1 associated with ATP synthase. These results point to a new role of IF1 in relation to high glucose utilization by tumor cells, in addition to its well known effect upon mitochondrial ATP synthase regulation.

  10. HOMOLOGY MODELING AND FUNCTIONAL CHARACTERIZATION OF THREE-DIMENSIONAL STRUCTURE OF DAHP SYNTHASE FROM BRACHYPODIUM DISTACHYON

    Directory of Open Access Journals (Sweden)

    Aditya Dev

    2013-06-01

    Full Text Available The Shikimate pathway is an attractive target for herbicides and antimicrobial agents because it is essential in microbes and plants but absent in animals. The 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS is the first enzyme of this pathway, which is involved in the condensation of phosphoenolpyruvate (PEP and D-erythrose 4-phosphate (E4P to produce 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP. DAHPS enzymes have been divided into two types, class I and class II, based on their primary amino acid sequence and three dimensional structures. The plant DAHPS belongs to class II and is regulated differently than DAHPS from microorganisms. To understand the structural basis of such differences in DAHPS from plants and its catalytic mechanism, we have used sequence analysis, homology modeling and docking approach to generate the three dimensional models of DAHP synthase from Brachypodium distachyon (Bd-DAHPS complexed with substrate PEP for the first time. The three dimensional models of Bd-DAHPS provides a detailed knowledge of the active site and the important secondary structural regions that play significant roles in the regulatory mechanism and further may be helpful for design of specific inhibitors towards herbicide development.

  11. Interaction of human biliverdin reductase with Akt/protein kinase B and phosphatidylinositol-dependent kinase 1 regulates glycogen synthase kinase 3 activity: a novel mechanism of Akt activation.

    Science.gov (United States)

    Miralem, Tihomir; Lerner-Marmarosh, Nicole; Gibbs, Peter E M; Jenkins, Jermaine L; Heimiller, Chelsea; Maines, Mahin D

    2016-08-01

    Biliverdin reductase A (BVR) and Akt isozymes have overlapping pleiotropic functions in the insulin/PI3K/MAPK pathway. Human BVR (hBVR) also reduces the hemeoxygenase activity product biliverdin to bilirubin and is directly activated by insulin receptor kinase (IRK). Akt isoenzymes (Akt1-3) are downstream of IRK and are activated by phosphatidylinositol-dependent kinase 1 (PDK1) phosphorylating T(308) before S(473) autophosphorylation. Akt (RxRxxSF) and PDK1 (RFxFPxFS) binding motifs are present in hBVR. Phosphorylation of glycogen synthase kinase 3 (GSK3) isoforms α/β by Akts inhibits their activity; nonphosphorylated GSK3β inhibits activation of various genes. We examined the role of hBVR in PDK1/Akt1/GSK3 signaling and Akt1 in hBVR phosphorylation. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. hBVR and Akt1 coimmunoprecipitated, and in-cell Förster resonance energy transfer (FRET) and glutathione S-transferase pulldown analyses identified Akt1 pleckstrin homology domain as the interactive domain. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. Site-directed mutagenesis, mass spectrometry, and kinetic analyses identified S(230) in hBVR (225)RNRYLSF sequence as the Akt1 target. Underlined amino acids are the essential residues of the signaling motifs. In cells, hBVR-activated Akt1 increased both GSK3α/β and forkhead box of the O class transcription class 3 (FoxO3) phosphorylation and inhibited total GSK3 activity; depletion of hBVR released inhibition and stimulated glucose uptake. Immunoprecipitation analysis showed that PDK1 and hBVR interact through hBVR's PDK1 binding (161)RFGFPAFS motif and formation of the PDK1/hBVR/Akt1 complex. sihBVR blocked complex formation. Findings identify hBVR as a previously unknown coactivator of Akt1 and as a key mediator of Akt1/GSK3 pathway, as well as define a key role for hBVR in Akt1 activation by PDK1.-Miralem, T., Lerner

  12. Endothelial nitric oxide synthase polymorphism G298T in ...

    Indian Academy of Sciences (India)

    Supplementary data: Endothelial nitric oxide synthase polymorphism G298T in association with oxidative DNA damage in coronary atherosclerosis. Rajesh G. Kumar, Mrudula K. Spurthi, Kishore G. Kumar, Sanjib K. Sahu and Surekha H. Rani. J. Genet. 91, 349–352. Table 1. The demographic and clinical data of the CHD ...

  13. ATP synthase--a marvellous rotary engine of the cell.

    Science.gov (United States)

    Yoshida, M; Muneyuki, E; Hisabori, T

    2001-09-01

    ATP synthase can be thought of as a complex of two motors--the ATP-driven F1 motor and the proton-driven Fo motor--that rotate in opposite directions. The mechanisms by which rotation and catalysis are coupled in the working enzyme are now being unravelled on a molecular scale.

  14. E3 Ligase Subunit Fbxo15 and PINK1 Kinase Regulate Cardiolipin Synthase 1 Stability and Mitochondrial Function in Pneumonia

    Directory of Open Access Journals (Sweden)

    Bill B. Chen

    2014-04-01

    Full Text Available Acute lung injury (ALI is linked to mitochondrial injury, resulting in impaired cellular oxygen utilization; however, it is unknown how these events are linked on the molecular level. Cardiolipin, a mitochondrial-specific lipid, is generated by cardiolipin synthase (CLS1. Here, we show that S. aureus activates a ubiquitin E3 ligase component, Fbxo15, that is sufficient to mediate proteasomal degradation of CLS1 in epithelia, resulting in decreased cardiolipin availability and disrupted mitochondrial function. CLS1 is destabilized by the phosphatase and tensin homolog (PTEN-induced putative kinase 1 (PINK1, which binds CLS1 to phosphorylate and regulates CLS1 disposal. Like Fbxo15, PINK1 interacts with and regulates levels of CLS1 through a mechanism dependent upon Thr219. S. aureus infection upregulates this Fbxo15-PINK1 pathway to impair mitochondrial integrity, and Pink1 knockout mice are less prone to S. aureus-induced ALI. Thus, ALI-associated disruption of cellular bioenergetics involves bioeffectors that utilize a phosphodegron to elicit ubiquitin-mediated disposal of a key mitochondrial enzyme.

  15. Neuronal Nitric Oxide Synthase Induction in the Antitumorigenic and Neurotoxic Effects of 2-Methoxyestradiol

    Directory of Open Access Journals (Sweden)

    Magdalena Gorska

    2014-08-01

    Full Text Available Objective: 2-Methoxyestradiol, one of the natural 17β-estradiol derivatives, is a novel, potent anticancer agent currently being evaluated in advanced phases of clinical trials. The main goal of the study was to investigate the anticancer activity of 2-methoxy-estradiol towards osteosarcoma cells and its possible neurodegenerative effects. We used an experimental model of neurotoxicity and anticancer activity of the physiological agent, 2-methoxyestradiol. Thus, we used highly metastatic osteosarcoma 143B and mouse immortalized hippocampal HT22 cell lines. The cells were treated with pharmacological (1 μM, 10 μM concentrations of 2-methoxyestradiol. Experimental: Neuronal nitric oxide synthase and 3-nitrotyrosine protein levels were determined by western blotting. Cell viability and induction of cell death were measured by MTT and PI/Annexin V staining and a DNA fragmentation ELISA kit, respectively. Intracellular levels of nitric oxide were determined by flow cytometry. Results: Here we demonstrated that the signaling pathways of neurodegenerative diseases and cancer may overlap. We presented evidence that 2-methoxyestradiol, in contrast to 17β-estradiol, specifically affects neuronal nitric oxide synthase and augments 3-nitrotyrosine level leading to osteosarcoma and immortalized hippocampal cell death. Conclusions: We report the dual facets of 2-methoxyestradiol, that causes cancer cell death, but on the other hand may play a key role as a neurotoxin.

  16. Mechanical unloading of the failing human heart fails to activate the protein kinase B/Akt/glycogen synthase kinase-3beta survival pathway.

    Science.gov (United States)

    Razeghi, Peter; Bruckner, Brian A; Sharma, Saumya; Youker, Keith A; Frazier, O H; Taegtmeyer, Heinrich

    2003-01-01

    Left ventricular assist device (LVAD) support of the failing human heart improves myocyte function and increases cell survival. One potential mechanism underlying this phenomenon is activation of the protein kinase B (PKB)/Akt/glycogen synthase kinase-3beta (GSK-3beta) survival pathway. Left ventricular tissue was obtained both at the time of implantation and explantation of the LVAD (n = 11). Six patients were diagnosed with idiopathic dilated cardiomyopathy, 4 patients with ischemic cardiomyopathy and 1 patient with peripartum cardiomyopathy. The mean duration of LVAD support was 205 +/- 35 days. Myocyte diameter and phosphorylation of ERK were used as indices for reverse remodeling. Transcript levels of genes required for the activation of PKB/Akt (insulin-like growth factor-1, insulin receptor substrate-1) were measured by quantitative RT-PCR. In addition, we measured the relative activity of PKB/Akt and GSK-3beta, and assayed for molecular and histological indices of PKB/Akt activation (cyclooxygenase mRNA levels and glycogen levels). Myocyte diameter and phosphorylation of ERK decreased with LVAD support. In contrast, none of the components of the PKB/Akt/GSK-3beta pathway changed significantly with mechanical unloading. The PKB/Akt/GSK-3beta pathway is not activated during LVAD support. Other signaling pathways must be responsible for the improvement of cellular function and cell survival during LVAD support. Copyright 2003 S. Karger AG, Basel

  17. Use of heterologous expressed polyketide synthase and small molecule foldases to make aromatic and cyclic compounds

    DEFF Research Database (Denmark)

    2016-01-01

    A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell.......A method for producing individual or libraries of tri- to pentadecaketide-derived aromatic compounds of interest by heterologous expression of polyketide synthase and aromatase/cyclase in a recombinant host cell....

  18. Synthesis of N-(Methoxycarbonylthienylmethylthioureas and Evaluation of Their Interaction with Inducible and Neuronal Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    Michael D. Threadgill

    2010-04-01

    Full Text Available Two isomeric N-(methoxycarbonylthienylmethylthioureas were synthesised by a sequence of radical bromination of methylthiophenecarboxylic esters, substitution with trifluoroacetamide anion, deprotection, formation of the corresponding isothiocyanates and addition of ammonia. The interaction of these new thiophene-based thioureas with inducible and neuronal nitric oxide synthase was evaluauted. These novel thienylmethylthioureas stimulated the activity of inducible Nitric Oxide Synthase (iNOS.

  19. Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.

    Science.gov (United States)

    Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng

    2017-03-01

    Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.

  20. Caveolin versus calmodulin. Counterbalancing allosteric modulators of endothelial nitric oxide synthase.

    Science.gov (United States)

    Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T

    1997-10-10

    Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.

  1. In silico peptide prediction for antibody generation to recognize 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) in genetically modified organisms.

    Science.gov (United States)

    Marani, Mariela M; Costa, Joana; Mafra, Isabel; Oliveira, Maria Beatriz P P; Camperi, Silvia A; Leite, José Roberto de Souza Almeida

    2015-03-01

    For the prospective immunorecognition of 5-enolpyruvylshikimate-3-phosphate synthase (CP4-EPSPS) as a biomarker protein expressed by transgenic soybean, an extensive in silico evaluation of the referred protein was performed. The main objective of this study was the selection of a set of peptides that could function as potential immunogens for the production of novel antibodies against CP4-EPSPS protein. For this purpose, the protein was in silico cleaved with trypsin/chymotrypsin and the resultant peptides were extensively analyzed for further selection of the best candidates for antibody production. The analysis enabled the successful proposal of four peptides with potential immunogenicity for their future use as screening biomarkers of genetically modified organisms. To our knowledge, this is the first attempt to select and define potential linear epitopes for the immunization of animals and, subsequently, to generate adequate antibodies for CP4-EPSPS recognition. The present work will be followed by the synthesis of the candidate peptides to be incubated in animals for antibody generation and potential applicability for the development of an immunosensor for CP4-EPSPS detection. © 2015 Wiley Periodicals, Inc.

  2. Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana)

    Science.gov (United States)

    2013-01-01

    Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205

  3. Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana).

    Science.gov (United States)

    Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg

    2013-05-16

    The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.

  4. Valsartan regulates the interaction of angiotensin II type 1 receptor and endothelial nitric oxide synthase via Src/PI3K/Akt signalling.

    Science.gov (United States)

    Su, Kuo-Hui; Tsai, Jin-Yi; Kou, Yu Ru; Chiang, An-Na; Hsiao, Sheng-Huang; Wu, Yuh-Lin; Hou, Hsin-Han; Pan, Ching-Chian; Shyue, Song-Kun; Lee, Tzong-Shyuan

    2009-06-01

    Valsartan, a selective angiotensin II type 1 receptor (AT1R) blocker, has beneficial effects in the cardiovascular system in part by its increase of nitric oxide (NO) bioavailability, yet the mechanisms are unclear. We investigated the molecular mechanisms underlying this effect in endothelial cells (ECs). NO production was examined by Griess reagent assay, DAF-2 DA fluorescence staining and cGMP ELISA kits. Protein interaction was determined by western blotting and immunoprecipitation. Treating bovine or human aortic ECs with valsartan increased NO production, as evidenced by elevated level of stable NO metabolites and intracellular cGMP. Valsartan increased the phosphorylation but not the protein level of endothelial NO synthase (eNOS). Inhibition of phosphoinositide-3 kinase (PI3K)/Akt and Src pathways by specific inhibitors suppressed valsartan-induced NO release. In addition, valsartan increased the tyrosine residue phosphorylation of AT1R, which was attenuated by inhibition of Src but not PI3K activities. Valsartan also suppressed the interaction of eNOS and AT1R, which was blocked by Src or PI3K inhibition. Valsartan-induced NO production in ECs is mediated through Src/PI3K/Akt-dependent phosphorylation of eNOS. Valsartan-induced AT1R phosphorylation depends on Src but not PI3K, whereas valsartan-induced suppression of AT1R-eNOS interaction depends on Src/PI3K/Akt signalling. These results indicate a novel vasoprotective mechanism of valsartan in upregulating NO production in ECs.

  5. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  6. Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction

    Science.gov (United States)

    2012-01-01

    Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis increased HPV during

  7. Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction

    Directory of Open Access Journals (Sweden)

    Ketabchi Farzaneh

    2012-01-01

    Full Text Available Abstract Background Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV optimizes gas exchange during local acute (0-30 min, as well as sustained (> 30 min hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. Method We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate, and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min and endothelial permeability. Results In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA, a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS, decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc. This increase disappeared after administration of 1400 W. Conclusion Hypercapnia with and without acidosis

  8. Effects of hypercapnia and NO synthase inhibition in sustained hypoxic pulmonary vasoconstriction.

    Science.gov (United States)

    Ketabchi, Farzaneh; Ghofrani, Hossein A; Schermuly, Ralph T; Seeger, Werner; Grimminger, Friedrich; Egemnazarov, Bakytbek; Shid-Moosavi, S Mostafa; Dehghani, Gholam A; Weissmann, Norbert; Sommer, Natascha

    2012-01-31

    Acute respiratory disorders may lead to sustained alveolar hypoxia with hypercapnia resulting in impaired pulmonary gas exchange. Hypoxic pulmonary vasoconstriction (HPV) optimizes gas exchange during local acute (0-30 min), as well as sustained (> 30 min) hypoxia by matching blood perfusion to alveolar ventilation. Hypercapnia with acidosis improves pulmonary gas exchange in repetitive conditions of acute hypoxia by potentiating HPV and preventing pulmonary endothelial dysfunction. This study investigated, if the beneficial effects of hypercapnia with acidosis are preserved during sustained hypoxia as it occurs, e.g in permissive hypercapnic ventilation in intensive care units. Furthermore, the effects of NO synthase inhibitors under such conditions were examined. We employed isolated perfused and ventilated rabbit lungs to determine the influence of hypercapnia with or without acidosis (pH corrected with sodium bicarbonate), and inhibitors of endothelial as well as inducible NO synthase on acute or sustained HPV (180 min) and endothelial permeability. In hypercapnic acidosis, HPV was intensified in sustained hypoxia, in contrast to hypercapnia without acidosis when HPV was amplified during both phases. L-NG-Nitroarginine (L-NNA), a non-selective NO synthase inhibitor, enhanced acute as well as sustained HPV under all conditions, however, the amplification of sustained HPV induced by hypercapnia with or without acidosis compared to normocapnia disappeared. In contrast 1400 W, a selective inhibitor of inducible NO synthase (iNOS), decreased HPV in normocapnia and hypercapnia without acidosis at late time points of sustained HPV and selectively reversed the amplification of sustained HPV during hypercapnia without acidosis. Hypoxic hypercapnia without acidosis increased capillary filtration coefficient (Kfc). This increase disappeared after administration of 1400 W. Hypercapnia with and without acidosis increased HPV during conditions of sustained hypoxia. The

  9. Lithium ameliorates open-field and elevated plus maze behaviors, and brain phospho-glycogen synthase kinase 3-beta expression in fragile X syndrome model mice.

    Science.gov (United States)

    Chen, Xi; Sun, Weiwen; Pan, Ying; Yang, Quan; Cao, Kaiyi; Zhang, Jin; Zhang, Yizhi; Chen, Mincong; Chen, Feidi; Huang, Yueling; Dai, Lijun; Chen, Shengqiang

    2013-10-01

    To investigate whether lithium modifies open-field and elevated plus maze behavior, and brain phospho-glycogen synthase kinase 3 (P-GSK3beta) expression in Fmr1 knockout mice. One hundred and eighty FVB mice, including knockout and wild type, with an age of 30 days were used. An open-field and elevated plus maze was utilized to test behavior, while western blot was used to measure the P-GSK3beta expression. Six groups were formed: control (saline), lithium chloride 30, 60, 90, 120, and 200 mg/kg. The experiments were carried out in the Institute of Neuroscience, Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China between January and June 2012. Lithium significantly decreased total distance, crossing, central area time, and center entry in the open-field test (popen-arm tracking, open-arm entry, and open-arm time in the elevated plus maze (popen-field and elevated plus maze behaviors of Fmr1 knockout mice. This effect may be related to its enhancement of P-GSK3beta expression. Our findings suggest that lithium might have a therapeutic effect in fragile X syndrome.

  10. The assembly of F1FO-ATP synthase is disrupted upon interference of RNA editing in Trypanosoma brucei

    Czech Academy of Sciences Publication Activity Database

    Hashimi, Hassan; Benkovičová, V.; Čermáková, P.; Lai, De Hua; Horváth, A.; Lukeš, Julius

    2010-01-01

    Roč. 40, č. 1 (2010), s. 45-54 ISSN 0020-7519 R&D Projects: GA ČR GA204/06/1558; GA AV ČR IAA500960705 Institutional research plan: CEZ:AV0Z60220518 Keywords : RNA editing * ATP synthase * mitochondrion * Trypanosoma * respiratory complex * membrane potential Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.822, year: 2010

  11. Glycogen synthase kinase 3 beta alters anxiety-, depression-, and addiction-related behaviors and neuronal activity in the nucleus accumbens shell

    Science.gov (United States)

    Crofton, Elizabeth J.; Nenov, Miroslav N.; Zhang, Yafang; Scala, Federico; Page, Sean A.; McCue, David L.; Li, Dingge; Hommel, Jonathan D.; Laezza, Fernanda; Green, Thomas A.

    2017-01-01

    Psychiatric disorders such as anxiety, depression and addiction are often comorbid brain pathologies thought to share common mechanistic biology. As part of the cortico-limbic circuit, the nucleus accumbens shell (NAcSh) plays a fundamental role in integrating information in the circuit, such that modulation of NAcSh circuitry alters anxiety, depression, and addiction-related behaviors. Intracellular kinase cascades in the NAcSh have proven important mediators of behavior. To investigate glycogen-synthase kinase 3 (GSK3) beta signaling in the NAcSh in vivo we knocked down GSK3beta expression with a novel adeno-associated viral vector (AAV2) and assessed changes in anxiety- and depression-like behavior and cocaine self-administration in GSK3beta knockdown rats. GSK3beta knockdown reduced anxiety-like behavior while increasing depression-like behavior and cocaine self-administration. Correlative electrophysiological recordings in acute brain slices were used to assess the effect of AAV-shGSK3beta on spontaneous firing and intrinsic excitability of tonically active interneurons (TANs), cells required for input and output signal integration in the NAcSh and for processing reward-related behaviors. Loose-patch recordings showed that TANs transduced by AAV-shGSK3beta exhibited reduction in tonic firing and increased spike half width. When assessed by whole-cell patch clamp recordings these changes were mirrored by reduction in action potential firing and accompanied by decreased hyperpolarization-induced depolarizing sag potentials, increased action potential current threshold, and decreased maximum rise time. These results suggest that silencing of GSK3beta in the NAcSh increases depression- and addiction-related behavior, possibly by decreasing intrinsic excitability of TANs. However, this study does not rule out contributions from other neuronal sub-types. PMID:28126496

  12. Structural characterization and comparison of three acyl-carrier-protein synthases from pathogenic bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Halavaty, Andrei S. [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Kim, Youngchang [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States); Zhou, Min [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Onopriyenko, Olena; Skarina, Tatiana [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N. [Center for Structural Genomics of Infectious Diseases, (United States); J. Craig Venter Institute, Rockville, MD 20850 (United States); Joachimiak, Andrzej [Center for Structural Genomics of Infectious Diseases, (United States); Argonne National Laboratory, Argonne, IL 60439 (United States); University of Chicago, Chicago, IL 60637 (United States); Savchenko, Alexei [Center for Structural Genomics of Infectious Diseases, (United States); University of Toronto, Toronto, Ontario M5G 1L6 (Canada); Anderson, Wayne F., E-mail: wf-anderson@northwestern.edu [Center for Structural Genomics of Infectious Diseases, (United States); Northwestern University, Chicago, IL 60611 (United States)

    2012-10-01

    The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS{sub SA}), Vibrio cholerae (AcpS{sub VC}) and Bacillus anthracis (AcpS{sub BA}) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS{sub BA} is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS{sub BA} may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP.

  13. Structural characterization and comparison of three acyl-carrier-protein synthases from pathogenic bacteria

    International Nuclear Information System (INIS)

    Halavaty, Andrei S.; Kim, Youngchang; Minasov, George; Shuvalova, Ludmilla; Dubrovska, Ievgeniia; Winsor, James; Zhou, Min; Onopriyenko, Olena; Skarina, Tatiana; Papazisi, Leka; Kwon, Keehwan; Peterson, Scott N.; Joachimiak, Andrzej; Savchenko, Alexei; Anderson, Wayne F.

    2012-01-01

    The structural characterization of acyl-carrier-protein synthase (AcpS) from three different pathogenic microorganisms is reported. One interesting finding of the present work is a crystal artifact related to the activity of the enzyme, which fortuitously represents an opportunity for a strategy to design a potential inhibitor of a pathogenic AcpS. Some bacterial type II fatty-acid synthesis (FAS II) enzymes have been shown to be important candidates for drug discovery. The scientific and medical quest for new FAS II protein targets continues to stimulate research in this field. One of the possible additional candidates is the acyl-carrier-protein synthase (AcpS) enzyme. Its holo form post-translationally modifies the apo form of an acyl carrier protein (ACP), which assures the constant delivery of thioester intermediates to the discrete enzymes of FAS II. At the Center for Structural Genomics of Infectious Diseases (CSGID), AcpSs from Staphylococcus aureus (AcpS SA ), Vibrio cholerae (AcpS VC ) and Bacillus anthracis (AcpS BA ) have been structurally characterized in their apo, holo and product-bound forms, respectively. The structure of AcpS BA is emphasized because of the two 3′, 5′-adenosine diphosphate (3′, 5′-ADP) product molecules that are found in each of the three coenzyme A (CoA) binding sites of the trimeric protein. One 3′, 5′-ADP is bound as the 3′, 5′-ADP part of CoA in the known structures of the CoA–AcpS and 3′, 5′-ADP–AcpS binary complexes. The position of the second 3′, 5′-ADP has never been described before. It is in close proximity to the first 3′, 5′-ADP and the ACP-binding site. The coordination of two ADPs in AcpS BA may possibly be exploited for the design of AcpS inhibitors that can block binding of both CoA and ACP

  14. Osteopontin protects against hyperoxia-induced lung injury by inhibiting nitric oxide synthases.

    Science.gov (United States)

    Zhang, Xiang-Feng; Liu, Shuang; Zhou, Yu-Jie; Zhu, Guang-Fa; Foda, Hussein D

    2010-04-05

    Exposure of adult mice to more than 95% O(2) produces a lethal injury by 72 hours. Nitric oxide synthase (NOS) is thought to contribute to the pathophysiology of murine hyperoxia-induced acute lung injury (ALI). Osteopontin (OPN) is a phosphorylated glycoprotein produced principally by macrophages. OPN inhibits inducible nitric oxide synthase (iNOS), which generates large amounts of nitric oxide production. However, the relationship between nitric oxide and endogenous OPN in lung tissue during hyperoxia-induced ALI has not yet been elucidated, thus we examined the role that OPN plays in the hyperoxia-induced lung injury and its relationships with NOS. One hundred and forty-four osteopontin knock-out (KO) mice and their matched wild type background control (WT) were exposed in sealed cages > 95% oxygen or room air for 24- 72 hours, and the severity of lung injury was assessed; expression of OPN, endothelial nitric oxide synthase (eNOS) and iNOS mRNA in lung tissues at 24, 48 and 72 hours of hyperoxia were studied by reverse transcription-polymerase chain reaction (RT-PCR); immunohistochemistry (IHC) was performed for the detection of iNOS, eNOS, and OPN protein in lung tissues. OPN KO mice developed more severe acute lung injury at 72 hours of hyperoxia. The wet/dry weight ratio increased to 6.85 +/- 0.66 in the KO mice at 72 hours of hyperoxia as compared to 5.31 +/- 0.92 in the WT group (P < 0.05). iNOS mRNA (48 hours: 1.04 +/- 0.08 vs. 0.63 +/- 0.09, P < 0.01; 72 hours: 0.89 +/- 0.08 vs. 0.72 +/- 0.09, P < 0.05) and eNOS mRNA (48 hours: 0.62 +/- 0.08 vs. 0.43 +/- 0.09, P < 0.05; 72 hours: 0.67 +/- 0.08 vs. 0.45 +/- 0.09, P < 0.05) expression was more significantly increased in OPN KO mice than their matched WT mice when exposed to hyperoxia. IHC study showed higher expression of iNOS (20.54 +/- 3.18 vs. 12.52 +/- 2.46, P < 0.05) and eNOS (19.83 +/- 5.64 vs. 9.45 +/- 3.82, P < 0.05) in lung tissues of OPN KO mice at 72 hours of hyperoxia. OPN can protect against

  15. Protective Effects of Kaempferol against Myocardial Ischemia/Reperfusion Injury in Isolated Rat Heart via Antioxidant Activity and Inhibition of Glycogen Synthase Kinase-3β

    Science.gov (United States)

    Zhou, Mingjie; Ren, Huanhuan; Wang, Wenjuan; Zheng, Qiusheng; Wang, Dong

    2015-01-01

    Objective. This study aimed to evaluate the protective effect of kaempferol against myocardial ischemia/reperfusion (I/R) injury in rats. Method. Left ventricular developed pressure (LVDP) and its maximum up/down rate (±dp/dt max) were recorded as myocardial function. Infarct size was detected with 2,3,5-triphenyltetrazolium chloride staining. Cardiomyocyte apoptosis was determined using terminal deoxynucleotidyl nick-end labeling (TUNEL). The levels of creatine kinase (CK), lactate dehydrogenase (LDH), malondialdehyde (MDA), superoxide dismutase (SOD), glutathione/glutathione disulfide (GSH/GSSG) ratio, and tumor necrosis factor-alpha (TNF-α) were determined using enzyme linked immunosorbent assay (ELISA). Moreover, total glycogen synthase kinase-3β (GSK-3β), phospho-GSK-3β (P-GSK-3β), precaspase-3, cleaved caspase-3, and cytoplasm cytochrome C were assayed using Western blot analysis. Results. Pretreatment with kaempferol significantly improved the recovery of LVDP and ±dp/dt max, as well as increased the levels of SOD and P-GSK-3β and GSH/GSSG ratio. However, the pretreatment reduced myocardial infarct size and TUNEL-positive cell rate, as well as decreased the levels of cleaved caspase-3, cytoplasm cytochrome C, CK, LDH, MDA, and TNF-α. Conclusion. These results suggested that kaempferol provides cardioprotection via antioxidant activity and inhibition of GSK-3β activity in rats with I/R. PMID:26265983

  16. Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis.

    Science.gov (United States)

    Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U

    2001-02-01

    cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.

  17. Highly Divergent Mitochondrial ATP Synthase Complexes in Tetrahymena thermophila

    NARCIS (Netherlands)

    Nina, Praveen Balabaskaran; Dudkina, Natalya V.; Kane, Lesley A.; van Eyk, Jennifer E.; Boekema, Egbert J.; Mather, Michael W.; Vaidya, Akhil B.; Eisen, Jonathan A.

    The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1) sector catalyzes ATP synthesis, whereas the F(o) sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1) and F(o) sectors are

  18. Contribution of granule bound starch synthase in kernel modification ...

    African Journals Online (AJOL)

    The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...

  19. Isolation of an ATP synthase cDNA from Sinonovacula constricta ...

    African Journals Online (AJOL)

    Yomi

    2012-01-24

    Jan 24, 2012 ... protein involved in temperature challenge in S. constricta. Key words: Sinonovacula constricta, ATP synthase, ... MATERIALS AND METHODS. Experimental animals. Sinonovacula constricta (7 to 8 g ... Dissociation curve analysis of amplification products was performed at the end of each PCR reaction to ...

  20. Recurrent De Novo Mutations Affecting Residue Arg1 38 of Pyrroline-5-Carboxylate Synthase Cause a Progeroid Form of Autosomal-Dominant Cutis Laxa

    NARCIS (Netherlands)

    Fischer-Zirnsak, Björn; Escande-Beillard, Nathalie; Ganesh, Jaya; Tan, Yu Xuan; Al Bughaili, Mohammed; Lin, Angela E.; Sahai, Inderneel; Bahena, Paulina; Reichert, Sara L.; Loh, Abigail; Wright, Graham D.; Liu, Jaron; Rahikkala, Elisa; Pivnick, Eniko K.; Choudhri, Asim F.; Krüger, Ulrike; Zemojtel, Tomasz; van Ravenswaaij-Arts, Conny; Mostafavi, Roya; Stolte-Dijkstra, Irene; Symoens, Sofie; Pajunen, Leila; Al-Gazali, Lihadh; Meierhofer, David; Robinson, Peter N.; Mundlos, Stefan; Villarroel, Camilo E.; Byers, Peter; Masri, Amira; Robertson, Stephen P.; Schwarze, Ulrike; Callewaert, Bert; Reversade, Bruno; Kornak, Uwe

    2015-01-01

    Progeroid disorders overlapping with De Barsy syndrome (DBS) are collectively denoted as autosomal-recessive cutis laxa type 3 (ARCL3). They are caused by biallelic mutations in PYCR1 or ALDH18A1, encoding pyrroline-5-carboxylate reductase 1 and pyrroline-5-carboxylate synthase (P5CS), respectively,