WorldWideScience

Sample records for phylogenetic motif identification

  1. An integrative and applicable phylogenetic footprinting framework for cis-regulatory motifs identification in prokaryotic genomes.

    Science.gov (United States)

    Liu, Bingqiang; Zhang, Hanyuan; Zhou, Chuan; Li, Guojun; Fennell, Anne; Wang, Guanghui; Kang, Yu; Liu, Qi; Ma, Qin

    2016-08-09

    Phylogenetic footprinting is an important computational technique for identifying cis-regulatory motifs in orthologous regulatory regions from multiple genomes, as motifs tend to evolve slower than their surrounding non-functional sequences. Its application, however, has several difficulties for optimizing the selection of orthologous data and reducing the false positives in motif prediction. Here we present an integrative phylogenetic footprinting framework for accurate motif predictions in prokaryotic genomes (MP(3)). The framework includes a new orthologous data preparation procedure, an additional promoter scoring and pruning method and an integration of six existing motif finding algorithms as basic motif search engines. Specifically, we collected orthologous genes from available prokaryotic genomes and built the orthologous regulatory regions based on sequence similarity of promoter regions. This procedure made full use of the large-scale genomic data and taxonomy information and filtered out the promoters with limited contribution to produce a high quality orthologous promoter set. The promoter scoring and pruning is implemented through motif voting by a set of complementary predicting tools that mine as many motif candidates as possible and simultaneously eliminate the effect of random noise. We have applied the framework to Escherichia coli k12 genome and evaluated the prediction performance through comparison with seven existing programs. This evaluation was systematically carried out at the nucleotide and binding site level, and the results showed that MP(3) consistently outperformed other popular motif finding tools. We have integrated MP(3) into our motif identification and analysis server DMINDA, allowing users to efficiently identify and analyze motifs in 2,072 completely sequenced prokaryotic genomes. The performance evaluation indicated that MP(3) is effective for predicting regulatory motifs in prokaryotic genomes. Its application may enhance

  2. Molecular Detection, Phylogenetic Analysis, and Identification of Transcription Motifs in Feline Leukemia Virus from Naturally Infected Cats in Malaysia

    Directory of Open Access Journals (Sweden)

    Faruku Bande

    2014-01-01

    Full Text Available A nested PCR assay was used to determine the viral RNA and proviral DNA status of naturally infected cats. Selected samples that were FeLV-positive by PCR were subjected to sequencing, phylogenetic analysis, and motifs search. Of the 39 samples that were positive for FeLV p27 antigen, 87.2% (34/39 were confirmed positive with nested PCR. FeLV proviral DNA was detected in 38 (97.3% of p27-antigen negative samples. Malaysian FeLV isolates are found to be highly similar with a homology of 91% to 100%. Phylogenetic analysis revealed that Malaysian FeLV isolates divided into two clusters, with a majority (86.2% sharing similarity with FeLV-K01803 and fewer isolates (13.8% with FeLV-GM1 strain. Different enhancer motifs including NF-GMa, Krox-20/WT1I-del2, BAF1, AP-2, TBP, TFIIF-beta, TRF, and TFIID are found to occur either in single, duplicate, triplicate, or sets of 5 in different positions within the U3-LTR-gag region. The present result confirms the occurrence of FeLV viral RNA and provirus DNA in naturally infected cats. Malaysian FeLV isolates are highly similar, and a majority of them are closely related to a UK isolate. This study provides the first molecular based information on FeLV in Malaysia. Additionally, different enhancer motifs likely associated with FeLV related pathogenesis have been identified.

  3. An efficient identification strategy of clonal tea cultivars using long-core motif SSR markers.

    Science.gov (United States)

    Wang, Rang Jian; Gao, Xiang Feng; Kong, Xiang Rui; Yang, Jun

    2016-01-01

    Microsatellites, or simple sequence repeats (SSRs), especially those with long-core motifs (tri-, tetra-, penta-, and hexa-nucleotide) represent an excellent tool for DNA fingerprinting. SSRs with long-core motifs are preferred since neighbor alleles are more easily separated and identified from each other, which render the interpretation of electropherograms and the true alleles more reliable. In the present work, with the purpose of characterizing a set of core SSR markers with long-core motifs for well fingerprinting clonal cultivars of tea (Camellia sinensis), we analyzed 66 elite clonal tea cultivars in China with 33 initially-chosen long-core motif SSR markers covering all the 15 linkage groups of tea plant genome. A set of 6 SSR markers were conclusively selected as core SSR markers after further selection. The polymorphic information content (PIC) of the core SSR markers was >0.5, with ≤5 alleles in each marker containing 10 or fewer genotypes. Phylogenetic analysis revealed that the core SSR markers were not strongly correlated with the trait 'cultivar processing-property'. The combined probability of identity (PID) between two random cultivars for the whole set of 6 SSR markers was estimated to be 2.22 × 10(-5), which was quite low, confirmed the usefulness of the proposed SSR markers for fingerprinting analyses in Camellia sinensis. Moreover, for the sake of quickly discriminating the clonal tea cultivars, a cultivar identification diagram (CID) was subsequently established using these core markers, which fully reflected the identification process and provided the immediate information about which SSR markers were needed to identify a cultivar chosen among the tested ones. The results suggested that long-core motif SSR markers used in the investigation contributed to the accurate and efficient identification of the clonal tea cultivars and enabled the protection of intellectual property.

  4. The identification of functional motifs in temporal gene expression analysis

    Directory of Open Access Journals (Sweden)

    Michael G. Surette

    2005-01-01

    Full Text Available The identification of transcription factor binding sites is essential to the understanding of the regulation of gene expression and the reconstruction of genetic regulatory networks. The in silico identification of cis-regulatory motifs is challenging due to sequence variability and lack of sufficient data to generate consensus motifs that are of quantitative or even qualitative predictive value. To determine functional motifs in gene expression, we propose a strategy to adopt false discovery rate (FDR and estimate motif effects to evaluate combinatorial analysis of motif candidates and temporal gene expression data. The method decreases the number of predicted motifs, which can then be confirmed by genetic analysis. To assess the method we used simulated motif/expression data to evaluate parameters. We applied this approach to experimental data for a group of iron responsive genes in Salmonella typhimurium 14028S. The method identified known and potentially new ferric-uptake regulator (Fur binding sites. In addition, we identified uncharacterized functional motif candidates that correlated with specific patterns of expression. A SAS code for the simulation and analysis gene expression data is available from the first author upon request.

  5. DMINDA: an integrated web server for DNA motif identification and analyses.

    Science.gov (United States)

    Ma, Qin; Zhang, Hanyuan; Mao, Xizeng; Zhou, Chuan; Liu, Bingqiang; Chen, Xin; Xu, Ying

    2014-07-01

    DMINDA (DNA motif identification and analyses) is an integrated web server for DNA motif identification and analyses, which is accessible at http://csbl.bmb.uga.edu/DMINDA/. This web site is freely available to all users and there is no login requirement. This server provides a suite of cis-regulatory motif analysis functions on DNA sequences, which are important to elucidation of the mechanisms of transcriptional regulation: (i) de novo motif finding for a given set of promoter sequences along with statistical scores for the predicted motifs derived based on information extracted from a control set, (ii) scanning motif instances of a query motif in provided genomic sequences, (iii) motif comparison and clustering of identified motifs, and (iv) co-occurrence analyses of query motifs in given promoter sequences. The server is powered by a backend computer cluster with over 150 computing nodes, and is particularly useful for motif prediction and analyses in prokaryotic genomes. We believe that DMINDA, as a new and comprehensive web server for cis-regulatory motif finding and analyses, will benefit the genomic research community in general and prokaryotic genome researchers in particular. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Highly scalable Ab initio genomic motif identification

    KAUST Repository

    Marchand, Benoit; Bajic, Vladimir B.; Kaushik, Dinesh

    2011-01-01

    We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

  7. Protein clustering and RNA phylogenetic reconstruction of the influenza A [corrected] virus NS1 protein allow an update in classification and identification of motif conservation.

    Science.gov (United States)

    Sevilla-Reyes, Edgar E; Chavaro-Pérez, David A; Piten-Isidro, Elvira; Gutiérrez-González, Luis H; Santos-Mendoza, Teresa

    2013-01-01

    The non-structural protein 1 (NS1) of influenza A virus (IAV), coded by its third most diverse gene, interacts with multiple molecules within infected cells. NS1 is involved in host immune response regulation and is a potential contributor to the virus host range. Early phylogenetic analyses using 50 sequences led to the classification of NS1 gene variants into groups (alleles) A and B. We reanalyzed NS1 diversity using 14,716 complete NS IAV sequences, downloaded from public databases, without host bias. Removal of sequence redundancy and further structured clustering at 96.8% amino acid similarity produced 415 clusters that enhanced our capability to detect distinct subgroups and lineages, which were assigned a numerical nomenclature. Maximum likelihood phylogenetic reconstruction using RNA sequences indicated the previously identified deep branching separating group A from group B, with five distinct subgroups within A as well as two and five lineages within the A4 and A5 subgroups, respectively. Our classification model proposes that sequence patterns in thirteen amino acid positions are sufficient to fit >99.9% of all currently available NS1 sequences into the A subgroups/lineages or the B group. This classification reduces host and virus bias through the prioritization of NS1 RNA phylogenetics over host or virus phenetics. We found significant sequence conservation within the subgroups and lineages with characteristic patterns of functional motifs, such as the differential binding of CPSF30 and crk/crkL or the availability of a C-terminal PDZ-binding motif. To understand selection pressures and evolution acting on NS1, it is necessary to organize the available data. This updated classification may help to clarify and organize the study of NS1 interactions and pathogenic differences and allow the drawing of further functional inferences on sequences in each group, subgroup and lineage rather than on a strain-by-strain basis.

  8. Identification of helix capping and {beta}-turn motifs from NMR chemical shifts

    Energy Technology Data Exchange (ETDEWEB)

    Shen Yang; Bax, Ad, E-mail: bax@nih.gov [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

    2012-03-15

    We present an empirical method for identification of distinct structural motifs in proteins on the basis of experimentally determined backbone and {sup 13}C{sup {beta}} chemical shifts. Elements identified include the N-terminal and C-terminal helix capping motifs and five types of {beta}-turns: I, II, I Prime , II Prime and VIII. Using a database of proteins of known structure, the NMR chemical shifts, together with the PDB-extracted amino acid preference of the helix capping and {beta}-turn motifs are used as input data for training an artificial neural network algorithm, which outputs the statistical probability of finding each motif at any given position in the protein. The trained neural networks, contained in the MICS (motif identification from chemical shifts) program, also provide a confidence level for each of their predictions, and values ranging from ca 0.7-0.9 for the Matthews correlation coefficient of its predictions far exceed those attainable by sequence analysis. MICS is anticipated to be useful both in the conventional NMR structure determination process and for enhancing on-going efforts to determine protein structures solely on the basis of chemical shift information, where it can aid in identifying protein database fragments suitable for use in building such structures.

  9. Identification of helix capping and β-turn motifs from NMR chemical shifts

    International Nuclear Information System (INIS)

    Shen Yang; Bax, Ad

    2012-01-01

    We present an empirical method for identification of distinct structural motifs in proteins on the basis of experimentally determined backbone and 13 C β chemical shifts. Elements identified include the N-terminal and C-terminal helix capping motifs and five types of β-turns: I, II, I′, II′ and VIII. Using a database of proteins of known structure, the NMR chemical shifts, together with the PDB-extracted amino acid preference of the helix capping and β-turn motifs are used as input data for training an artificial neural network algorithm, which outputs the statistical probability of finding each motif at any given position in the protein. The trained neural networks, contained in the MICS (motif identification from chemical shifts) program, also provide a confidence level for each of their predictions, and values ranging from ca 0.7–0.9 for the Matthews correlation coefficient of its predictions far exceed those attainable by sequence analysis. MICS is anticipated to be useful both in the conventional NMR structure determination process and for enhancing on-going efforts to determine protein structures solely on the basis of chemical shift information, where it can aid in identifying protein database fragments suitable for use in building such structures.

  10. Molecular identification and phylogenetic study of Demodex caprae.

    Science.gov (United States)

    Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

    2014-10-01

    The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

  11. galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M

    2004-06-12

    The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se

  12. BayesMotif: de novo protein sorting motif discovery from impure datasets.

    Science.gov (United States)

    Hu, Jianjun; Zhang, Fan

    2010-01-18

    Protein sorting is the process that newly synthesized proteins are transported to their target locations within or outside of the cell. This process is precisely regulated by protein sorting signals in different forms. A major category of sorting signals are amino acid sub-sequences usually located at the N-terminals or C-terminals of protein sequences. Genome-wide experimental identification of protein sorting signals is extremely time-consuming and costly. Effective computational algorithms for de novo discovery of protein sorting signals is needed to improve the understanding of protein sorting mechanisms. We formulated the protein sorting motif discovery problem as a classification problem and proposed a Bayesian classifier based algorithm (BayesMotif) for de novo identification of a common type of protein sorting motifs in which a highly conserved anchor is present along with a less conserved motif regions. A false positive removal procedure is developed to iteratively remove sequences that are unlikely to contain true motifs so that the algorithm can identify motifs from impure input sequences. Experiments on both implanted motif datasets and real-world datasets showed that the enhanced BayesMotif algorithm can identify anchored sorting motifs from pure or impure protein sequence dataset. It also shows that the false positive removal procedure can help to identify true motifs even when there is only 20% of the input sequences containing true motif instances. We proposed BayesMotif, a novel Bayesian classification based algorithm for de novo discovery of a special category of anchored protein sorting motifs from impure datasets. Compared to conventional motif discovery algorithms such as MEME, our algorithm can find less-conserved motifs with short highly conserved anchors. Our algorithm also has the advantage of easy incorporation of additional meta-sequence features such as hydrophobicity or charge of the motifs which may help to overcome the limitations of

  13. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin

    2015-01-01

    Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

  14. Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

    KAUST Repository

    Wong, Ka-Chun

    2015-09-27

    Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

  15. Insights into the molecular evolution of the PDZ/LIM family and identification of a novel conserved protein motif.

    Directory of Open Access Journals (Sweden)

    Aartjan J W Te Velthuis

    Full Text Available The PDZ and LIM domain-containing protein family is encoded by a diverse group of genes whose phylogeny has currently not been analyzed. In mammals, ten genes are found that encode both a PDZ- and one or several LIM-domains. These genes are: ALP, RIL, Elfin (CLP36, Mystique, Enigma (LMP-1, Enigma homologue (ENH, ZASP (Cypher, Oracle, LMO7 and the two LIM domain kinases (LIMK1 and LIMK2. As conventional alignment and phylogenetic procedures of full-length sequences fell short of elucidating the evolutionary history of these genes, we started to analyze the PDZ and LIM domain sequences themselves. Using information from most sequenced eukaryotic lineages, our phylogenetic analysis is based on full-length cDNA-, EST-derived- and genomic- PDZ and LIM domain sequences of over 25 species, ranging from yeast to humans. Plant and protozoan homologs were not found. Our phylogenetic analysis identifies a number of domain duplication and rearrangement events, and shows a single convergent event during evolution of the PDZ/LIM family. Further, we describe the separation of the ALP and Enigma subfamilies in lower vertebrates and identify a novel consensus motif, which we call 'ALP-like motif' (AM. This motif is highly-conserved between ALP subfamily proteins of diverse organisms. We used here a combinatorial approach to define the relation of the PDZ and LIM domain encoding genes and to reconstruct their phylogeny. This analysis allowed us to classify the PDZ/LIM family and to suggest a meaningful model for the molecular evolution of the diverse gene architectures found in this multi-domain family.

  16. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

    Science.gov (United States)

    Catania, Francesco; Lynch, Michael

    2010-05-04

    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  17. MotifNet: a web-server for network motif analysis.

    Science.gov (United States)

    Smoly, Ilan Y; Lerman, Eugene; Ziv-Ukelson, Michal; Yeger-Lotem, Esti

    2017-06-15

    Network motifs are small topological patterns that recur in a network significantly more often than expected by chance. Their identification emerged as a powerful approach for uncovering the design principles underlying complex networks. However, available tools for network motif analysis typically require download and execution of computationally intensive software on a local computer. We present MotifNet, the first open-access web-server for network motif analysis. MotifNet allows researchers to analyze integrated networks, where nodes and edges may be labeled, and to search for motifs of up to eight nodes. The output motifs are presented graphically and the user can interactively filter them by their significance, number of instances, node and edge labels, and node identities, and view their instances. MotifNet also allows the user to distinguish between motifs that are centered on specific nodes and motifs that recur in distinct parts of the network. MotifNet is freely available at http://netbio.bgu.ac.il/motifnet . The website was implemented using ReactJs and supports all major browsers. The server interface was implemented in Python with data stored on a MySQL database. estiyl@bgu.ac.il or michaluz@cs.bgu.ac.il. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  18. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael

    2010-05-01

    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  19. A speedup technique for (l, d-motif finding algorithms

    Directory of Open Access Journals (Sweden)

    Dinh Hieu

    2011-03-01

    Full Text Available Abstract Background The discovery of patterns in DNA, RNA, and protein sequences has led to the solution of many vital biological problems. For instance, the identification of patterns in nucleic acid sequences has resulted in the determination of open reading frames, identification of promoter elements of genes, identification of intron/exon splicing sites, identification of SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have proven to be extremely helpful in domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, etc. Motifs are important patterns that are helpful in finding transcriptional regulatory elements, transcription factor binding sites, functional genomics, drug design, etc. As a result, numerous papers have been written to solve the motif search problem. Results Three versions of the motif search problem have been proposed in the literature: Simple Motif Search (SMS, (l, d-motif search (or Planted Motif Search (PMS, and Edit-distance-based Motif Search (EMS. In this paper we focus on PMS. Two kinds of algorithms can be found in the literature for solving the PMS problem: exact and approximate. An exact algorithm identifies the motifs always and an approximate algorithm may fail to identify some or all of the motifs. The exact version of PMS problem has been shown to be NP-hard. Exact algorithms proposed in the literature for PMS take time that is exponential in some of the underlying parameters. In this paper we propose a generic technique that can be used to speedup PMS algorithms. Conclusions We present a speedup technique that can be used on any PMS algorithm. We have tested our speedup technique on a number of algorithms. These experimental results show that our speedup technique is indeed very

  20. Motif-role-fingerprints: the building-blocks of motifs, clustering-coefficients and transitivities in directed networks.

    Directory of Open Access Journals (Sweden)

    Mark D McDonnell

    Full Text Available Complex networks are frequently characterized by metrics for which particular subgraphs are counted. One statistic from this category, which we refer to as motif-role fingerprints, differs from global subgraph counts in that the number of subgraphs in which each node participates is counted. As with global subgraph counts, it can be important to distinguish between motif-role fingerprints that are 'structural' (induced subgraphs and 'functional' (partial subgraphs. Here we show mathematically that a vector of all functional motif-role fingerprints can readily be obtained from an arbitrary directed adjacency matrix, and then converted to structural motif-role fingerprints by multiplying that vector by a specific invertible conversion matrix. This result demonstrates that a unique structural motif-role fingerprint exists for any given functional motif-role fingerprint. We demonstrate a similar result for the cases of functional and structural motif-fingerprints without node roles, and global subgraph counts that form the basis of standard motif analysis. We also explicitly highlight that motif-role fingerprints are elemental to several popular metrics for quantifying the subgraph structure of directed complex networks, including motif distributions, directed clustering coefficient, and transitivity. The relationships between each of these metrics and motif-role fingerprints also suggest new subtypes of directed clustering coefficients and transitivities. Our results have potential utility in analyzing directed synaptic networks constructed from neuronal connectome data, such as in terms of centrality. Other potential applications include anomaly detection in networks, identification of similar networks and identification of similar nodes within networks. Matlab code for calculating all stated metrics following calculation of functional motif-role fingerprints is provided as S1 Matlab File.

  1. MotifMark: Finding regulatory motifs in DNA sequences.

    Science.gov (United States)

    Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D

    2017-07-01

    The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

  2. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  3. Identification of sequence motifs significantly associated with antisense activity

    Directory of Open Access Journals (Sweden)

    Peek Andrew S

    2007-06-01

    Full Text Available Abstract Background Predicting the suppression activity of antisense oligonucleotide sequences is the main goal of the rational design of nucleic acids. To create an effective predictive model, it is important to know what properties of an oligonucleotide sequence associate significantly with antisense activity. Also, for the model to be efficient we must know what properties do not associate significantly and can be omitted from the model. This paper will discuss the results of a randomization procedure to find motifs that associate significantly with either high or low antisense suppression activity, analysis of their properties, as well as the results of support vector machine modelling using these significant motifs as features. Results We discovered 155 motifs that associate significantly with high antisense suppression activity and 202 motifs that associate significantly with low suppression activity. The motifs range in length from 2 to 5 bases, contain several motifs that have been previously discovered as associating highly with antisense activity, and have thermodynamic properties consistent with previous work associating thermodynamic properties of sequences with their antisense activity. Statistical analysis revealed no correlation between a motif's position within an antisense sequence and that sequences antisense activity. Also, many significant motifs existed as subwords of other significant motifs. Support vector regression experiments indicated that the feature set of significant motifs increased correlation compared to all possible motifs as well as several subsets of the significant motifs. Conclusion The thermodynamic properties of the significantly associated motifs support existing data correlating the thermodynamic properties of the antisense oligonucleotide with antisense efficiency, reinforcing our hypothesis that antisense suppression is strongly associated with probe/target thermodynamics, as there are no enzymatic

  4. Peptomics, identification of novel cationic Arabidopsis peptides with conserved sequence motifs

    DEFF Research Database (Denmark)

    Olsen, Addie Nina; Mundy, John; Skriver, Karen

    2002-01-01

    Arabidopsis family of 34 genes. The predicted peptides are characterized by a conserved C-terminal sequence motif and additional primary structure conservation in a core region. The majority of these genes had not previously been annotated. A subset of the predicted peptides show high overall sequence...... similarity to Rapid Alkalinization Factor (RALF), a peptide isolated from tobacco. We therefore refer to this peptide family as RALFL for RALF-Like. RT-PCR analysis confirmed that several of the Arabidopsis genes are expressed and that their expression patterns vary. The identification of a large gene family...

  5. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  6. Phyloproteomic Analysis of 11780 Six-Residue-Long Motifs Occurrences

    Directory of Open Access Journals (Sweden)

    O. V. Galzitskaya

    2015-01-01

    Full Text Available How is it possible to find good traits for phylogenetic reconstructions? Here, we present a new phyloproteomic criterion that is an occurrence of simple motifs which can be imprints of evolution history. We studied the occurrences of 11780 six-residue-long motifs consisting of two randomly located amino acids in 97 eukaryotic and 25 bacterial proteomes. For all eukaryotic proteomes, with the exception of the Amoebozoa, Stramenopiles, and Diplomonadida kingdoms, the number of proteins containing the motifs from the first group (one of the two amino acids occurs once at the terminal position made about 20%; in the case of motifs from the second (one of two amino acids occurs one time within the pattern and third (the two amino acids occur randomly groups, 30% and 50%, respectively. For bacterial proteomes, this relationship was 10%, 27%, and 63%, respectively. The matrices of correlation coefficients between numbers of proteins where a motif from the set of 11780 motifs appears at least once in 9 kingdoms and 5 phyla of bacteria were calculated. Among the correlation coefficients for eukaryotic proteomes, the correlation between the animal and fungi kingdoms (0.62 is higher than between fungi and plants (0.54. Our study provides support that animals and fungi are sibling kingdoms. Comparison of the frequencies of six-residue-long motifs in different proteomes allows obtaining phylogenetic relationships based on similarities between these frequencies: the Diplomonadida kingdoms are more close to Bacteria than to Eukaryota; Stramenopiles and Amoebozoa are more close to each other than to other kingdoms of Eukaryota.

  7. Identification of putative regulatory motifs in the upstream regions of co-expressed functional groups of genes in Plasmodium falciparum

    Directory of Open Access Journals (Sweden)

    Joshi NV

    2009-01-01

    Full Text Available Abstract Background Regulation of gene expression in Plasmodium falciparum (Pf remains poorly understood. While over half the genes are estimated to be regulated at the transcriptional level, few regulatory motifs and transcription regulators have been found. Results The study seeks to identify putative regulatory motifs in the upstream regions of 13 functional groups of genes expressed in the intraerythrocytic developmental cycle of Pf. Three motif-discovery programs were used for the purpose, and motifs were searched for only on the gene coding strand. Four motifs – the 'G-rich', the 'C-rich', the 'TGTG' and the 'CACA' motifs – were identified, and zero to all four of these occur in the 13 sets of upstream regions. The 'CACA motif' was absent in functional groups expressed during the ring to early trophozoite transition. For functional groups expressed in each transition, the motifs tended to be similar. Upstream motifs in some functional groups showed 'positional conservation' by occurring at similar positions relative to the translational start site (TLS; this increases their significance as regulatory motifs. In the ribonucleotide synthesis, mitochondrial, proteasome and organellar translation machinery genes, G-rich, C-rich, CACA and TGTG motifs, respectively, occur with striking positional conservation. In the organellar translation machinery group, G-rich motifs occur close to the TLS. The same motifs were sometimes identified for multiple functional groups; differences in location and abundance of the motifs appear to ensure different modes of action. Conclusion The identification of positionally conserved over-represented upstream motifs throws light on putative regulatory elements for transcription in Pf.

  8. Robust identification of noncoding RNA from transcriptomes requires phylogenetically-informed sampling.

    Directory of Open Access Journals (Sweden)

    Stinus Lindgreen

    2014-10-01

    Full Text Available Noncoding RNAs are integral to a wide range of biological processes, including translation, gene regulation, host-pathogen interactions and environmental sensing. While genomics is now a mature field, our capacity to identify noncoding RNA elements in bacterial and archaeal genomes is hampered by the difficulty of de novo identification. The emergence of new technologies for characterizing transcriptome outputs, notably RNA-seq, are improving noncoding RNA identification and expression quantification. However, a major challenge is to robustly distinguish functional outputs from transcriptional noise. To establish whether annotation of existing transcriptome data has effectively captured all functional outputs, we analysed over 400 publicly available RNA-seq datasets spanning 37 different Archaea and Bacteria. Using comparative tools, we identify close to a thousand highly-expressed candidate noncoding RNAs. However, our analyses reveal that capacity to identify noncoding RNA outputs is strongly dependent on phylogenetic sampling. Surprisingly, and in stark contrast to protein-coding genes, the phylogenetic window for effective use of comparative methods is perversely narrow: aggregating public datasets only produced one phylogenetic cluster where these tools could be used to robustly separate unannotated noncoding RNAs from a null hypothesis of transcriptional noise. Our results show that for the full potential of transcriptomics data to be realized, a change in experimental design is paramount: effective transcriptomics requires phylogeny-aware sampling.

  9. Genome-Wide Identification, Phylogenetic and Expression Analyses of the Ubiquitin-Conjugating Enzyme Gene Family in Maize

    Science.gov (United States)

    Jue, Dengwei; Sang, Xuelian; Lu, Shengqiao; Dong, Chen; Zhao, Qiufang; Chen, Hongliang; Jia, Liqiang

    2015-01-01

    Background Ubiquitination is a post-translation modification where ubiquitin is attached to a substrate. Ubiquitin-conjugating enzymes (E2s) play a major role in the ubiquitin transfer pathway, as well as a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). Methodology/Principal Findings In the present study, a total of 75 putative ZmUBC genes have been identified and located in the maize genome. Phylogenetic analysis revealed that ZmUBC proteins could be divided into 15 subfamilies, which include 13 ubiquitin-conjugating enzymes (ZmE2s) and two independent ubiquitin-conjugating enzyme variant (UEV) groups. The predicted ZmUBC genes were distributed across 10 chromosomes at different densities. In addition, analysis of exon-intron junctions and sequence motifs in each candidate gene has revealed high levels of conservation within and between phylogenetic groups. Tissue expression analysis indicated that most ZmUBC genes were expressed in at least one of the tissues, indicating that these are involved in various physiological and developmental processes in maize. Moreover, expression profile analyses of ZmUBC genes under different stress treatments (4°C, 20% PEG6000, and 200 mM NaCl) and various expression patterns indicated that these may play crucial roles in the response of plants to stress. Conclusions Genome-wide identification, chromosome organization, gene structure, evolutionary and expression analyses of ZmUBC genes have facilitated in the characterization of this gene family, as well as determined its potential involvement in growth, development, and stress responses. This study provides valuable information for better understanding the classification and putative functions of the UBC-encoding genes of maize. PMID:26606743

  10. I-Ad-binding peptides derived from unrelated protein antigens share a common structural motif

    DEFF Research Database (Denmark)

    Sette, A; Buus, S; Colon, S

    1988-01-01

    on the I-Ad binding of the immunogenic peptide OVA 323-339. The results obtained demonstrated the very permissive nature of Ag-Ia interaction. We also showed that unrelated peptides that are good I-Ad binders share a common structural motif and speculated that recognition of such motifs could represent...... that I-Ad molecules recognize a large library of Ag by virtue of common structural motifs present in peptides derived from phylogenetically unrelated proteins....

  11. Convergent evolution and mimicry of protein linear motifs in host-pathogen interactions.

    Science.gov (United States)

    Chemes, Lucía Beatriz; de Prat-Gay, Gonzalo; Sánchez, Ignacio Enrique

    2015-06-01

    Pathogen linear motif mimics are highly evolvable elements that facilitate rewiring of host protein interaction networks. Host linear motifs and pathogen mimics differ in sequence, leading to thermodynamic and structural differences in the resulting protein-protein interactions. Moreover, the functional output of a mimic depends on the motif and domain repertoire of the pathogen protein. Regulatory evolution mediated by linear motifs can be understood by measuring evolutionary rates, quantifying positive and negative selection and performing phylogenetic reconstructions of linear motif natural history. Convergent evolution of linear motif mimics is widespread among unrelated proteins from viral, prokaryotic and eukaryotic pathogens and can also take place within individual protein phylogenies. Statistics, biochemistry and laboratory models of infection link pathogen linear motifs to phenotypic traits such as tropism, virulence and oncogenicity. In vitro evolution experiments and analysis of natural sequences suggest that changes in linear motif composition underlie pathogen adaptation to a changing environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. RMOD: a tool for regulatory motif detection in signaling network.

    Directory of Open Access Journals (Sweden)

    Jinki Kim

    Full Text Available Regulatory motifs are patterns of activation and inhibition that appear repeatedly in various signaling networks and that show specific regulatory properties. However, the network structures of regulatory motifs are highly diverse and complex, rendering their identification difficult. Here, we present a RMOD, a web-based system for the identification of regulatory motifs and their properties in signaling networks. RMOD finds various network structures of regulatory motifs by compressing the signaling network and detecting the compressed forms of regulatory motifs. To apply it into a large-scale signaling network, it adopts a new subgraph search algorithm using a novel data structure called path-tree, which is a tree structure composed of isomorphic graphs of query regulatory motifs. This algorithm was evaluated using various sizes of signaling networks generated from the integration of various human signaling pathways and it showed that the speed and scalability of this algorithm outperforms those of other algorithms. RMOD includes interactive analysis and auxiliary tools that make it possible to manipulate the whole processes from building signaling network and query regulatory motifs to analyzing regulatory motifs with graphical illustration and summarized descriptions. As a result, RMOD provides an integrated view of the regulatory motifs and mechanism underlying their regulatory motif activities within the signaling network. RMOD is freely accessible online at the following URL: http://pks.kaist.ac.kr/rmod.

  13. Motif-Based Text Mining of Microbial Metagenome Redundancy Profiling Data for Disease Classification.

    Science.gov (United States)

    Wang, Yin; Li, Rudong; Zhou, Yuhua; Ling, Zongxin; Guo, Xiaokui; Xie, Lu; Liu, Lei

    2016-01-01

    Text data of 16S rRNA are informative for classifications of microbiota-associated diseases. However, the raw text data need to be systematically processed so that features for classification can be defined/extracted; moreover, the high-dimension feature spaces generated by the text data also pose an additional difficulty. Here we present a Phylogenetic Tree-Based Motif Finding algorithm (PMF) to analyze 16S rRNA text data. By integrating phylogenetic rules and other statistical indexes for classification, we can effectively reduce the dimension of the large feature spaces generated by the text datasets. Using the retrieved motifs in combination with common classification methods, we can discriminate different samples of both pneumonia and dental caries better than other existing methods. We extend the phylogenetic approaches to perform supervised learning on microbiota text data to discriminate the pathological states for pneumonia and dental caries. The results have shown that PMF may enhance the efficiency and reliability in analyzing high-dimension text data.

  14. Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

    Science.gov (United States)

    Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel

    2012-01-01

    Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.

  15. Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

    Directory of Open Access Journals (Sweden)

    Saray Santamaría-Hernando

    Full Text Available Proteins of the animal heme peroxidase (ANP superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20, where it was found to be involved in Ca(2+ coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+ binding with a K(D of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821 is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of

  16. Motif-Based Text Mining of Microbial Metagenome Redundancy Profiling Data for Disease Classification

    Directory of Open Access Journals (Sweden)

    Yin Wang

    2016-01-01

    Full Text Available Background. Text data of 16S rRNA are informative for classifications of microbiota-associated diseases. However, the raw text data need to be systematically processed so that features for classification can be defined/extracted; moreover, the high-dimension feature spaces generated by the text data also pose an additional difficulty. Results. Here we present a Phylogenetic Tree-Based Motif Finding algorithm (PMF to analyze 16S rRNA text data. By integrating phylogenetic rules and other statistical indexes for classification, we can effectively reduce the dimension of the large feature spaces generated by the text datasets. Using the retrieved motifs in combination with common classification methods, we can discriminate different samples of both pneumonia and dental caries better than other existing methods. Conclusions. We extend the phylogenetic approaches to perform supervised learning on microbiota text data to discriminate the pathological states for pneumonia and dental caries. The results have shown that PMF may enhance the efficiency and reliability in analyzing high-dimension text data.

  17. Assessing local structure motifs using order parameters for motif recognition, interstitial identification, and diffusion path characterization

    Science.gov (United States)

    Zimmermann, Nils E. R.; Horton, Matthew K.; Jain, Anubhav; Haranczyk, Maciej

    2017-11-01

    Structure-property relationships form the basis of many design rules in materials science, including synthesizability and long-term stability of catalysts, control of electrical and optoelectronic behavior in semiconductors as well as the capacity of and transport properties in cathode materials for rechargeable batteries. The immediate atomic environments (i.e., the first coordination shells) of a few atomic sites are often a key factor in achieving a desired property. Some of the most frequently encountered coordination patterns are tetrahedra, octahedra, body and face-centered cubic as well as hexagonal closed packed-like environments. Here, we showcase the usefulness of local order parameters to identify these basic structural motifs in inorganic solid materials by developing classification criteria. We introduce a systematic testing framework, the Einstein crystal test rig, that probes the response of order parameters to distortions in perfect motifs to validate our approach. Subsequently, we highlight three important application cases. First, we map basic crystal structure information of a large materials database in an intuitive manner by screening the Materials Project (MP) database (61,422 compounds) for element-specific motif distributions. Second, we use the structure-motif recognition capabilities to automatically find interstitials in metals, semiconductor, and insulator materials. Our Interstitialcy Finding Tool (InFiT) facilitates high-throughput screenings of defect properties. Third, the order parameters are reliable and compact quantitative structure descriptors for characterizing diffusion hops of intercalants as our example of magnesium in MnO2-spinel indicates. Finally, the tools developed in our work are readily and freely available as software implementations in the pymatgen library, and we expect them to be further applied to machine-learning approaches for emerging applications in materials science.

  18. Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.

    Science.gov (United States)

    Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha

    2013-03-01

    Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Identification of a putative nuclear export signal motif in human NANOG homeobox domain

    International Nuclear Information System (INIS)

    Park, Sung-Won; Do, Hyun-Jin; Huh, Sun-Hyung; Sung, Boreum; Uhm, Sang-Jun; Song, Hyuk; Kim, Nam-Hyung; Kim, Jae-Hwan

    2012-01-01

    Highlights: ► We found the putative nuclear export signal motif within human NANOG homeodomain. ► Leucine-rich residues are important for human NANOG homeodomain nuclear export. ► CRM1-specific inhibitor LMB blocked the potent human NANOG NES-mediated nuclear export. -- Abstract: NANOG is a homeobox-containing transcription factor that plays an important role in pluripotent stem cells and tumorigenic cells. To understand how nuclear localization of human NANOG is regulated, the NANOG sequence was examined and a leucine-rich nuclear export signal (NES) motif ( 125 MQELSNILNL 134 ) was found in the homeodomain (HD). To functionally validate the putative NES motif, deletion and site-directed mutants were fused to an EGFP expression vector and transfected into COS-7 cells, and the localization of the proteins was examined. While hNANOG HD exclusively localized to the nucleus, a mutant with both NLSs deleted and only the putative NES motif contained (hNANOG HD-ΔNLSs) was predominantly cytoplasmic, as observed by nucleo/cytoplasmic fractionation and Western blot analysis as well as confocal microscopy. Furthermore, site-directed mutagenesis of the putative NES motif in a partial hNANOG HD only containing either one of the two NLS motifs led to localization in the nucleus, suggesting that the NES motif may play a functional role in nuclear export. Furthermore, CRM1-specific nuclear export inhibitor LMB blocked the hNANOG potent NES-mediated export, suggesting that the leucine-rich motif may function in CRM1-mediated nuclear export of hNANOG. Collectively, a NES motif is present in the hNANOG HD and may be functionally involved in CRM1-mediated nuclear export pathway.

  20. Assessing Local Structure Motifs Using Order Parameters for Motif Recognition, Interstitial Identification, and Diffusion Path Characterization

    Directory of Open Access Journals (Sweden)

    Nils E. R. Zimmermann

    2017-11-01

    Full Text Available Structure–property relationships form the basis of many design rules in materials science, including synthesizability and long-term stability of catalysts, control of electrical and optoelectronic behavior in semiconductors, as well as the capacity of and transport properties in cathode materials for rechargeable batteries. The immediate atomic environments (i.e., the first coordination shells of a few atomic sites are often a key factor in achieving a desired property. Some of the most frequently encountered coordination patterns are tetrahedra, octahedra, body and face-centered cubic as well as hexagonal close packed-like environments. Here, we showcase the usefulness of local order parameters to identify these basic structural motifs in inorganic solid materials by developing classification criteria. We introduce a systematic testing framework, the Einstein crystal test rig, that probes the response of order parameters to distortions in perfect motifs to validate our approach. Subsequently, we highlight three important application cases. First, we map basic crystal structure information of a large materials database in an intuitive manner by screening the Materials Project (MP database (61,422 compounds for element-specific motif distributions. Second, we use the structure-motif recognition capabilities to automatically find interstitials in metals, semiconductor, and insulator materials. Our Interstitialcy Finding Tool (InFiT facilitates high-throughput screenings of defect properties. Third, the order parameters are reliable and compact quantitative structure descriptors for characterizing diffusion hops of intercalants as our example of magnesium in MnO2-spinel indicates. Finally, the tools developed in our work are readily and freely available as software implementations in the pymatgen library, and we expect them to be further applied to machine-learning approaches for emerging applications in materials science.

  1. CompariMotif: quick and easy comparisons of sequence motifs.

    Science.gov (United States)

    Edwards, Richard J; Davey, Norman E; Shields, Denis C

    2008-05-15

    CompariMotif is a novel tool for making motif-motif comparisons, identifying and describing similarities between regular expression motifs. CompariMotif can identify a number of different relationships between motifs, including exact matches, variants of degenerate motifs and complex overlapping motifs. Motif relationships are scored using shared information content, allowing the best matches to be easily identified in large comparisons. Many input and search options are available, enabling a list of motifs to be compared to itself (to identify recurring motifs) or to datasets of known motifs. CompariMotif can be run online at http://bioware.ucd.ie/ and is freely available for academic use as a set of open source Python modules under a GNU General Public License from http://bioinformatics.ucd.ie/shields/software/comparimotif/

  2. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Directory of Open Access Journals (Sweden)

    Nicolás Sarute

    Full Text Available Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  3. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Science.gov (United States)

    Sarute, Nicolás; Calderón, Marina Gallo; Pérez, Ruben; La Torre, José; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

    2013-01-01

    Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus) is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H) gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp) coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  4. Identification of a Baeyer-Villiger monooxygenase sequence motif

    NARCIS (Netherlands)

    Fraaije, MW; Kamerbeek, NM; van Berkel, WJH; Janssen, DB; Kamerbeek, Nanne M.; Berkel, Willem J.H. van

    2002-01-01

    Baeyer-Villiger monooxygenases (BVMOs) form a distinct class of flavoproteins that catalyze the insertion of an oxygen atom in a C-C bond using dioxygen and NAD(P)H. Using newly characterized BVMO sequences, we have uncovered a BVMO-identifying sequence motif: FXGXXXRXXXW(P/D). Studies with

  5. Identification of group specific motifs in Beta-lactamase family of proteins

    Directory of Open Access Journals (Sweden)

    Saxena Akansha

    2009-12-01

    Full Text Available Abstract Background Beta-lactamases are one of the most serious threats to public health. In order to combat this threat we need to study the molecular and functional diversity of these enzymes and identify signatures specific to these enzymes. These signatures will enable us to develop inhibitors and diagnostic probes specific to lactamases. The existing classification of beta-lactamases was developed nearly 30 years ago when few lactamases were available. DLact database contain more than 2000 beta-lactamase, which can be used to study the molecular diversity and to identify signatures specific to this family. Methods A set of 2020 beta-lactamase proteins available in the DLact database http://59.160.102.202/DLact were classified using graph-based clustering of Best Bi-Directional Hits. Non-redundant (> 90 percent identical protein sequences from each group were aligned using T-Coffee and annotated using information available in literature. Motifs specific to each group were predicted using PRATT program. Results The graph-based classification of beta-lactamase proteins resulted in the formation of six groups (Four major groups containing 191, 726, 774 and 73 proteins while two minor groups containing 50 and 8 proteins. Based on the information available in literature, we found that each of the four major groups correspond to the four classes proposed by Ambler. The two minor groups were novel and do not contain molecular signatures of beta-lactamase proteins reported in literature. The group-specific motifs showed high sensitivity (> 70% and very high specificity (> 90%. The motifs from three groups (corresponding to class A, C and D had a high level of conservation at DNA as well as protein level whereas the motifs from the fourth group (corresponding to class B showed conservation at only protein level. Conclusion The graph-based classification of beta-lactamase proteins corresponds with the classification proposed by Ambler, thus there is

  6. Sorting through the chaff, nDNA gene trees for phylogenetic inference and hybrid identification of annual sunflowers (Helianthus sect. Helianthus).

    Science.gov (United States)

    Moody, Michael L; Rieseberg, Loren H

    2012-07-01

    The annual sunflowers (Helianthus sect. Helianthus) present a formidable challenge for phylogenetic inference because of ancient hybrid speciation, recent introgression, and suspected issues with deep coalescence. Here we analyze sequence data from 11 nuclear DNA (nDNA) genes for multiple genotypes of species within the section to (1) reconstruct the phylogeny of this group, (2) explore the utility of nDNA gene trees for detecting hybrid speciation and introgression; and (3) test an empirical method of hybrid identification based on the phylogenetic congruence of nDNA gene trees from tightly linked genes. We uncovered considerable topological heterogeneity among gene trees with or without three previously identified hybrid species included in the analyses, as well as a general lack of reciprocal monophyly of species. Nonetheless, partitioned Bayesian analyses provided strong support for the reciprocal monophyly of all species except H. annuus (0.89 PP), the most widespread and abundant annual sunflower. Previous hypotheses of relationships among taxa were generally strongly supported (1.0 PP), except among taxa typically associated with H. annuus, apparently due to the paraphyly of the latter in all gene trees. While the individual nDNA gene trees provided a useful means for detecting recent hybridization, identification of ancient hybridization was problematic for all ancient hybrid species, even when linkage was considered. We discuss biological factors that affect the efficacy of phylogenetic methods for hybrid identification.

  7. Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

    Science.gov (United States)

    Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

    2017-11-01

    The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

  8. Genome-wide identification, phylogeny and expression analyses of SCARECROW-LIKE(SCL) genes in millet (Setaria italica).

    Science.gov (United States)

    Liu, Hongyun; Qin, Jiajia; Fan, Hui; Cheng, Jinjin; Li, Lin; Liu, Zheng

    2017-07-01

    As a member of the GRAS gene family, SCARECROW - LIKE ( SCL ) genes encode transcriptional regulators that are involved in plant information transmission and signal transduction. In this study, 44 SCL genes including two SCARECROW genes in millet were identified to be distributed on eight chromosomes, except chromosome 6. All the millet genes contain motifs 6-8, indicating that these motifs are conserved during the evolution. SCL genes of millet were divided into eight groups based on the phylogenetic relationship and classification of Arabidopsis SCL genes. Several putative millet orthologous genes in Arabidopsis , maize and rice were identified. High throughput RNA sequencing revealed that the expressions of millet SCL genes in root, stem, leaf, spica, and along leaf gradient varied greatly. Analyses combining the gene expression patterns, gene structures, motif compositions, promoter cis -elements identification, alternative splicing of transcripts and phylogenetic relationship of SCL genes indicate that the these genes may play diverse functions. Functionally characterized SCL genes in maize, rice and Arabidopsis would provide us some clues for future characterization of their homologues in millet. To the best of our knowledge, this is the first study of millet SCL genes at the genome wide level. Our work provides a useful platform for functional analysis of SCL genes in millet, a model crop for C 4 photosynthesis and bioenergy studies.

  9. Identification of accelerated evolution in the metalloproteinase ...

    African Journals Online (AJOL)

    U

    2016-02-24

    Feb 24, 2016 ... rich (about 194 residues long) domains are aligned separately. Cys- switch sites (PKMCGV) and Zn2+ binding motifs (HEXXHXXGXXH) are marked in the box of black color. Phylogenetic tree and homology construction. Phylogenetic tree of 12 SVMPs sequences was done using. *Corresponding author.

  10. Lipase genes in Mucor circinelloides: identification, sub-cellular location, phylogenetic analysis and expression profiling during growth and lipid accumulation.

    Science.gov (United States)

    Zan, Xinyi; Tang, Xin; Chu, Linfang; Zhao, Lina; Chen, Haiqin; Chen, Yong Q; Chen, Wei; Song, Yuanda

    2016-10-01

    Lipases or triacylglycerol hydrolases are widely spread in nature and are particularly common in the microbial world. The filamentous fungus Mucor circinelloides is a potential lipase producer, as it grows well in triacylglycerol-contained culture media. So far only one lipase from M. circinelloides has been characterized, while the majority of lipases remain unknown in this fungus. In the present study, 47 potential lipase genes in M. circinelloides WJ11 and 30 potential lipase genes in M. circinelloides CBS 277.49 were identified by extensive bioinformatics analysis. An overview of these lipases is presented, including several characteristics, sub-cellular location, phylogenetic analysis and expression profiling of the lipase genes during growth and lipid accumulation. All of these proteins contained the consensus sequence for a classical lipase (GXSXG motif) and were divided into four types including α/β-hydrolase_1, α/β-hydrolase_3, class_3 and GDSL lipase (GDSL) based on gene annotations. Phylogenetic analyses revealed that class_3 family and α/β-hydrolase_3 family were the conserved lipase family in M. circinelloides. Additionally, some lipases also contained a typical acyltransferase motif of H-(X) 4-D, and these lipases may play a dual role in lipid metabolism, catalyzing both lipid hydrolysis and transacylation reactions. The differential expression of all lipase genes were confirmed by quantitative real-time PCR, and the expression profiling were analyzed to predict the possible biological roles of these lipase genes in lipid metabolism in M. circinelloides. We preliminarily hypothesized that lipases may be involved in triacylglycerol degradation, phospholipid synthesis and beta-oxidation. Moreover, the results of sub-cellular localization, the presence of signal peptide and transcriptional analyses of lipase genes indicated that four lipase in WJ11 most likely belong to extracellular lipases with a signal peptide. These findings provide a platform

  11. Identification of multiple distinct Snf2 subfamilies with conserved structural motifs.

    Science.gov (United States)

    Flaus, Andrew; Martin, David M A; Barton, Geoffrey J; Owen-Hughes, Tom

    2006-01-01

    The Snf2 family of helicase-related proteins includes the catalytic subunits of ATP-dependent chromatin remodelling complexes found in all eukaryotes. These act to regulate the structure and dynamic properties of chromatin and so influence a broad range of nuclear processes. We have exploited progress in genome sequencing to assemble a comprehensive catalogue of over 1300 Snf2 family members. Multiple sequence alignment of the helicase-related regions enables 24 distinct subfamilies to be identified, a considerable expansion over earlier surveys. Where information is known, there is a good correlation between biological or biochemical function and these assignments, suggesting Snf2 family motor domains are tuned for specific tasks. Scanning of complete genomes reveals all eukaryotes contain members of multiple subfamilies, whereas they are less common and not ubiquitous in eubacteria or archaea. The large sample of Snf2 proteins enables additional distinguishing conserved sequence blocks within the helicase-like motor to be identified. The establishment of a phylogeny for Snf2 proteins provides an opportunity to make informed assignments of function, and the identification of conserved motifs provides a framework for understanding the mechanisms by which these proteins function.

  12. Functional identification of a Lippia dulcis bornyl diphosphate synthase that contains a duplicated, inhibitory arginine-rich motif.

    Science.gov (United States)

    Hurd, Matthew C; Kwon, Moonhyuk; Ro, Dae-Kyun

    2017-08-26

    Lippia dulcis (Aztec sweet herb) contains the potent natural sweetener hernandulcin, a sesquiterpene ketone found in the leaves and flowers. Utilizing the leaves for agricultural application is challenging due to the presence of the bitter-tasting and toxic monoterpene, camphor. To unlock the commercial potential of L. dulcis leaves, the first step of camphor biosynthesis by a bornyl diphosphate synthase needs to be elucidated. Two putative monoterpene synthases (LdTPS3 and LdTPS9) were isolated from L. dulcis leaf cDNA. To elucidate their catalytic functions, E. coli-produced recombinant enzymes with truncations of their chloroplast transit peptides were assayed with geranyl diphosphate (GPP). In vitro enzyme assays showed that LdTPS3 encodes bornyl diphosphate synthase (thus named LdBPPS) while LdTPS9 encodes linalool synthase. Interestingly, the N-terminus of LdBPPS possesses two arginine-rich (RRX 8 W) motifs, and enzyme assays showed that the presence of both RRX 8 W motifs completely inhibits the catalytic activity of LdBPPS. Only after the removal of the putative chloroplast transit peptide and the first RRX 8 W, LdBPPS could react with GPP to produce bornyl diphosphate. LdBPPS is distantly related to the known bornyl diphosphate synthase from sage in a phylogenetic analysis, indicating a converged evolution of camphor biosynthesis in sage and L. dulcis. The discovery of LdBPPS opens up the possibility of engineering L. dulcis to remove the undesirable product, camphor. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Bacterial identification and subtyping using DNA microarray and DNA sequencing.

    Science.gov (United States)

    Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

    2012-01-01

    The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

  14. Identification of important nodes in directed biological networks: a network motif approach.

    Directory of Open Access Journals (Sweden)

    Pei Wang

    Full Text Available Identification of important nodes in complex networks has attracted an increasing attention over the last decade. Various measures have been proposed to characterize the importance of nodes in complex networks, such as the degree, betweenness and PageRank. Different measures consider different aspects of complex networks. Although there are numerous results reported on undirected complex networks, few results have been reported on directed biological networks. Based on network motifs and principal component analysis (PCA, this paper aims at introducing a new measure to characterize node importance in directed biological networks. Investigations on five real-world biological networks indicate that the proposed method can robustly identify actually important nodes in different networks, such as finding command interneurons, global regulators and non-hub but evolutionary conserved actually important nodes in biological networks. Receiver Operating Characteristic (ROC curves for the five networks indicate remarkable prediction accuracy of the proposed measure. The proposed index provides an alternative complex network metric. Potential implications of the related investigations include identifying network control and regulation targets, biological networks modeling and analysis, as well as networked medicine.

  15. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  16. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Science.gov (United States)

    Fauteux, François; Strömvik, Martina V

    2009-01-01

    Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

  17. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  18. Genomic characterization, phylogenetic comparison and differential expression of the cyclic nucleotide-gated channels gene family in pear (Pyrus bretchneideri Rehd.).

    Science.gov (United States)

    Chen, Jianqing; Yin, Hao; Gu, Jinping; Li, Leiting; Liu, Zhe; Jiang, Xueting; Zhou, Hongsheng; Wei, Shuwei; Zhang, Shaoling; Wu, Juyou

    2015-01-01

    The cyclic nucleotide-gated channel (CNGC) family is involved in the uptake of various cations, such as Ca(2+), to regulate plant growth and respond to biotic and abiotic stresses. However, there is far less information about this family in woody plants such as pear. Here, we provided a genome-wide identification and analysis of the CNGC gene family in pear. Phylogenetic analysis showed that the 21 pear CNGC genes could be divided into five groups (I, II, III, IVA and IVB). The majority of gene duplications in pear appeared to have been caused by segmental duplication and occurred 32.94-39.14 million years ago. Evolutionary analysis showed that positive selection had driven the evolution of pear CNGCs. Motif analyses showed that Group I CNGCs generally contained 26 motifs, which was the greatest number of motifs in all CNGC groups. Among these, eight motifs were shared by each group, suggesting that these domains play a conservative role in CNGC activity. Tissue-specific expression analysis indicated that functional diversification of the duplicated CNGC genes was a major feature of long-term evolution. Our results also suggested that the P-S6 and PBC & hinge domains had co-evolved during the evolution. These results provide valuable information to increase our understanding of the function, evolution and expression analyses of the CNGC gene family in higher plants. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  20. SA-Mot: a web server for the identification of motifs of interest extracted from protein loops.

    Science.gov (United States)

    Regad, Leslie; Saladin, Adrien; Maupetit, Julien; Geneix, Colette; Camproux, Anne-Claude

    2011-07-01

    The detection of functional motifs is an important step for the determination of protein functions. We present here a new web server SA-Mot (Structural Alphabet Motif) for the extraction and location of structural motifs of interest from protein loops. Contrary to other methods, SA-Mot does not focus only on functional motifs, but it extracts recurrent and conserved structural motifs involved in structural redundancy of loops. SA-Mot uses the structural word notion to extract all structural motifs from uni-dimensional sequences corresponding to loop structures. Then, SA-Mot provides a description of these structural motifs using statistics computed in the loop data set and in SCOP superfamily, sequence and structural parameters. SA-Mot results correspond to an interactive table listing all structural motifs extracted from a target structure and their associated descriptors. Using this information, the users can easily locate loop regions that are important for the protein folding and function. The SA-Mot web server is available at http://sa-mot.mti.univ-paris-diderot.fr.

  1. Direct AUC optimization of regulatory motifs.

    Science.gov (United States)

    Zhu, Lin; Zhang, Hong-Bo; Huang, De-Shuang

    2017-07-15

    The discovery of transcription factor binding site (TFBS) motifs is essential for untangling the complex mechanism of genetic variation under different developmental and environmental conditions. Among the huge amount of computational approaches for de novo identification of TFBS motifs, discriminative motif learning (DML) methods have been proven to be promising for harnessing the discovery power of accumulated huge amount of high-throughput binding data. However, they have to sacrifice accuracy for speed and could fail to fully utilize the information of the input sequences. We propose a novel algorithm called CDAUC for optimizing DML-learned motifs based on the area under the receiver-operating characteristic curve (AUC) criterion, which has been widely used in the literature to evaluate the significance of extracted motifs. We show that when the considered AUC loss function is optimized in a coordinate-wise manner, the cost function of each resultant sub-problem is a piece-wise constant function, whose optimal value can be found exactly and efficiently. Further, a key step of each iteration of CDAUC can be efficiently solved as a computational geometry problem. Experimental results on real world high-throughput datasets illustrate that CDAUC outperforms competing methods for refining DML motifs, while being one order of magnitude faster. Meanwhile, preliminary results also show that CDAUC may also be useful for improving the interpretability of convolutional kernels generated by the emerging deep learning approaches for predicting TF sequences specificities. CDAUC is available at: https://drive.google.com/drive/folders/0BxOW5MtIZbJjNFpCeHlBVWJHeW8 . dshuang@tongji.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  2. Phylogenetic diversity of insecticolous fusaria inferred from multilocus DNA sequence data and their molecular identification via FUSARIUM-ID and Fusarium MLST

    NARCIS (Netherlands)

    O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.

    2012-01-01

    We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the

  3. The valine and lysine residues in the conserved FxVTxK motif are important for the function of phylogenetically distant plant cellulose synthases

    Energy Technology Data Exchange (ETDEWEB)

    Slabaugh, Erin; Scavuzzo-Duggan, Tess; Chaves, Arielle; Wilson, Liza; Wilson, Carmen; Davis, Jonathan K.; Cosgrove, Daniel J.; Anderson, Charles T.; Roberts, Alison W.; Haigler, Candace H.

    2015-12-08

    Cellulose synthases (CESAs) synthesize the β-1,4-glucan chains that coalesce to form cellulose microfibrils in plant cell walls. In addition to a large cytosolic (catalytic) domain, CESAs have eight predicted transmembrane helices (TMHs). However, analogous to the structure of BcsA, a bacterial CESA, predicted TMH5 in CESA may instead be an interfacial helix. This would place the conserved FxVTxK motif in the plant cell cytosol where it could function as a substrate-gating loop as occurs in BcsA. To define the functional importance of the CESA region containing FxVTxK, we tested five parallel mutations in Arabidopsis thaliana CESA1 and Physcomitrella patens CESA5 in complementation assays of the relevant cesa mutants. In both organisms, the substitution of the valine or lysine residues in FxVTxK severely affected CESA function. In Arabidopsis roots, both changes were correlated with lower cellulose anisotropy, as revealed by Pontamine Fast Scarlet. Analysis of hypocotyl inner cell wall layers by atomic force microscopy showed that two altered versions of Atcesa1 could rescue cell wall phenotypes observed in the mutant background line. Overall, the data show that the FxVTxK motif is functionally important in two phylogenetically distant plant CESAs. The results show that Physcomitrella provides an efficient model for assessing the effects of engineered CESA mutations affecting primary cell wall synthesis and that diverse testing systems can lead to nuanced insights into CESA structure–function relationships. Although CESA membrane topology needs to be experimentally determined, the results support the possibility that the FxVTxK region functions similarly in CESA and BcsA.

  4. Expanding the Halohydrin Dehalogenase Enzyme Family: Identification of Novel Enzymes by Database Mining.

    Science.gov (United States)

    Schallmey, Marcus; Koopmeiners, Julia; Wells, Elizabeth; Wardenga, Rainer; Schallmey, Anett

    2014-12-01

    Halohydrin dehalogenases are very rare enzymes that are naturally involved in the mineralization of halogenated xenobiotics. Due to their catalytic potential and promiscuity, many biocatalytic reactions have been described that have led to several interesting and industrially important applications. Nevertheless, only a few of these enzymes have been made available through recombinant techniques; hence, it is of general interest to expand the repertoire of these enzymes so as to enable novel biocatalytic applications. After the identification of specific sequence motifs, 37 novel enzyme sequences were readily identified in public sequence databases. All enzymes that could be heterologously expressed also catalyzed typical halohydrin dehalogenase reactions. Phylogenetic inference for enzymes of the halohydrin dehalogenase enzyme family confirmed that all enzymes form a distinct monophyletic clade within the short-chain dehydrogenase/reductase superfamily. In addition, the majority of novel enzymes are substantially different from previously known phylogenetic subtypes. Consequently, four additional phylogenetic subtypes were defined, greatly expanding the halohydrin dehalogenase enzyme family. We show that the enormous wealth of environmental and genome sequences present in public databases can be tapped for in silico identification of very rare but biotechnologically important biocatalysts. Our findings help to readily identify halohydrin dehalogenases in ever-growing sequence databases and, as a consequence, make even more members of this interesting enzyme family available to the scientific and industrial community. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  6. Genome-wide identification of VQ motif-containing proteins and their expression profiles under abiotic stresses in maize

    Directory of Open Access Journals (Sweden)

    Weibin eSong

    2016-01-01

    Full Text Available VQ motif-containing proteins play crucial roles in abiotic stress responses in plants. Recent studies have shown that some VQ proteins physically interact with WRKY transcription factors to activate downstream genes. In the present study, we identified and characterized genes encoding VQ motif-containing proteins using the most recent version of the maize genome sequence. In total, 61VQ genes were identified. In a cluster analysis, these genes clustered into nine groups together with their homologous genes in rice and Arabidopsis. Most of the VQ genes (57 out of 61 numbers identified in maize were found to be single-copy genes. Analyses of RNA-seq data obtained using seedlings under long-term drought treatment showed that the expression levels of most ZmVQ genes (41 out of 61 members changed during the drought stress response. Quantitative real-time PCR analyses showed that most of the ZmVQ genes were responsive to NaCl treatment. Also, approximately half of the ZmVQ genes were co-expressed with ZmWRKY genes. The identification of these VQ genes in the maize genome and knowledge of their expression profiles under drought and osmotic stresses will provide a solid foundation for exploring their specific functions in the abiotic stress responses of maize.

  7. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  8. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  9. Why and how might genetic and phylogenetic diversity be reflected in the identification of key biodiversity areas?

    Science.gov (United States)

    Brooks, T M; Cuttelod, A; Faith, D P; Garcia-Moreno, J; Langhammer, P; Pérez-Espona, S

    2015-02-19

    'Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326-337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for 'threatened species' to consider 'threatened taxa' and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites.

  10. Polytomy identification in microbial phylogenetic reconstruction

    Directory of Open Access Journals (Sweden)

    Lin Guan

    2011-12-01

    Full Text Available Abstract Background A phylogenetic tree, showing ancestral relations among organisms, is commonly represented as a rooted tree with sets of bifurcating branches (dichotomies for simplicity, although polytomies (multifurcating branches may reflect more accurate evolutionary relationships. To represent the true evolutionary relationships, it is important to systematically identify the polytomies from a bifurcating tree and generate a taxonomy-compatible multifurcating tree. For this purpose we propose a novel approach, "PolyPhy", which would classify a set of bifurcating branches of a phylogenetic tree into a set of branches with dichotomies and polytomies by considering genome distances among genomes and tree topological properties. Results PolyPhy employs a machine learning technique, BLR (Bayesian logistic regression classifier, to identify possible bifurcating subtrees as polytomies from the trees resulted from ComPhy. Other than considering genome-scale distances between all pairs of species, PolyPhy also takes into account different properties of tree topology between dichotomy and polytomy, such as long-branch retraction and short-branch contraction, and quantifies these properties into comparable rates among different sub-branches. We extract three tree topological features, 'LR' (Leaf rate, 'IntraR' (Intra-subset branch rate and 'InterR' (Inter-subset branch rate, all of which are calculated from bifurcating tree branch sets for classification. We have achieved F-measure (balanced measure between precision and recall of 81% with about 0.9 area under the curve (AUC of ROC. Conclusions PolyPhy is a fast and robust method to identify polytomies from phylogenetic trees based on genome-wide inference of evolutionary relationships among genomes. The software package and test data can be downloaded from http://digbio.missouri.edu/ComPhy/phyloTreeBiNonBi-1.0.zip.

  11. Genome-wide identification, characterization and phylogenetic analysis of 50 catfish ATP-binding cassette (ABC) transporter genes.

    Science.gov (United States)

    Liu, Shikai; Li, Qi; Liu, Zhanjiang

    2013-01-01

    Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.

  12. In Silico Phylogenetic Analysis and Molecular Modelling Study of 2-Haloalkanoic Acid Dehalogenase Enzymes from Bacterial and Fungal Origin

    Directory of Open Access Journals (Sweden)

    Raghunath Satpathy

    2016-01-01

    Full Text Available 2-Haloalkanoic acid dehalogenase enzymes have broad range of applications, starting from bioremediation to chemical synthesis of useful compounds that are widely distributed in fungi and bacteria. In the present study, a total of 81 full-length protein sequences of 2-haloalkanoic acid dehalogenase from bacteria and fungi were retrieved from NCBI database. Sequence analysis such as multiple sequence alignment (MSA, conserved motif identification, computation of amino acid composition, and phylogenetic tree construction were performed on these primary sequences. From MSA analysis, it was observed that the sequences share conserved lysine (K and aspartate (D residues in them. Also, phylogenetic tree indicated a subcluster comprised of both fungal and bacterial species. Due to nonavailability of experimental 3D structure for fungal 2-haloalkanoic acid dehalogenase in the PDB, molecular modelling study was performed for both fungal and bacterial sources of enzymes present in the subcluster. Further structural analysis revealed a common evolutionary topology shared between both fungal and bacterial enzymes. Studies on the buried amino acids showed highly conserved Leu and Ser in the core, despite variation in their amino acid percentage. Additionally, a surface exposed tryptophan was conserved in all of these selected models.

  13. Phylogenetic analysis of ferlin genes reveals ancient eukaryotic origins

    Directory of Open Access Journals (Sweden)

    Lek Monkol

    2010-07-01

    Full Text Available Abstract Background The ferlin gene family possesses a rare and identifying feature consisting of multiple tandem C2 domains and a C-terminal transmembrane domain. Much currently remains unknown about the fundamental function of this gene family, however, mutations in its two most well-characterised members, dysferlin and otoferlin, have been implicated in human disease. The availability of genome sequences from a wide range of species makes it possible to explore the evolution of the ferlin family, providing contextual insight into characteristic features that define the ferlin gene family in its present form in humans. Results Ferlin genes were detected from all species of representative phyla, with two ferlin subgroups partitioned within the ferlin phylogenetic tree based on the presence or absence of a DysF domain. Invertebrates generally possessed two ferlin genes (one with DysF and one without, with six ferlin genes in most vertebrates (three DysF, three non-DysF. Expansion of the ferlin gene family is evident between the divergence of lamprey (jawless vertebrates and shark (cartilaginous fish. Common to almost all ferlins is an N-terminal C2-FerI-C2 sandwich, a FerB motif, and two C-terminal C2 domains (C2E and C2F adjacent to the transmembrane domain. Preservation of these structural elements throughout eukaryotic evolution suggests a fundamental role of these motifs for ferlin function. In contrast, DysF, C2DE, and FerA are optional, giving rise to subtle differences in domain topologies of ferlin genes. Despite conservation of multiple C2 domains in all ferlins, the C-terminal C2 domains (C2E and C2F displayed higher sequence conservation and greater conservation of putative calcium binding residues across paralogs and orthologs. Interestingly, the two most studied non-mammalian ferlins (Fer-1 and Misfire in model organisms C. elegans and D. melanogaster, present as outgroups in the phylogenetic analysis, with results suggesting

  14. Exploiting publicly available biological and biochemical information for the discovery of novel short linear motifs.

    KAUST Repository

    Sayadi, Ahmed

    2011-07-20

    The function of proteins is often mediated by short linear segments of their amino acid sequence, called Short Linear Motifs or SLiMs, the identification of which can provide important information about a protein function. However, the short length of the motifs and their variable degree of conservation makes their identification hard since it is difficult to correctly estimate the statistical significance of their occurrence. Consequently, only a small fraction of them have been discovered so far. We describe here an approach for the discovery of SLiMs based on their occurrence in evolutionarily unrelated proteins belonging to the same biological, signalling or metabolic pathway and give specific examples of its effectiveness in both rediscovering known motifs and in discovering novel ones. An automatic implementation of the procedure, available for download, allows significant motifs to be identified, automatically annotated with functional, evolutionary and structural information and organized in a database that can be inspected and queried. An instance of the database populated with pre-computed data on seven organisms is accessible through a publicly available server and we believe it constitutes by itself a useful resource for the life sciences (http://www.biocomputing.it/modipath).

  15. An intracellular motif of GLUT4 regulates fusion of GLUT4-containing vesicles.

    Science.gov (United States)

    Heyward, Catherine A; Pettitt, Trevor R; Leney, Sophie E; Welsh, Gavin I; Tavaré, Jeremy M; Wakelam, Michael J O

    2008-05-20

    Insulin stimulates glucose uptake by adipocytes through increasing translocation of the glucose transporter GLUT4 from an intracellular compartment to the plasma membrane. Fusion of GLUT4-containing vesicles at the cell surface is thought to involve phospholipase D activity, generating the signalling lipid phosphatidic acid, although the mechanism of action is not yet clear. Here we report the identification of a putative phosphatidic acid-binding motif in a GLUT4 intracellular loop. Mutation of this motif causes a decrease in the insulin-induced exposure of GLUT4 at the cell surface of 3T3-L1 adipocytes via an effect on vesicle fusion. The potential phosphatidic acid-binding motif identified in this study is unique to GLUT4 among the sugar transporters, therefore this motif may provide a unique mechanism for regulating insulin-induced translocation by phospholipase D signalling.

  16. Mutational analysis of the RecJ exonuclease of Escherichia coli: identification of phosphoesterase motifs.

    Science.gov (United States)

    Sutera, V A; Han, E S; Rajman, L A; Lovett, S T

    1999-10-01

    The recJ gene, identified in Escherichia coli, encodes a Mg(+2)-dependent 5'-to-3' exonuclease with high specificity for single-strand DNA. Genetic and biochemical experiments implicate RecJ exonuclease in homologous recombination, base excision, and methyl-directed mismatch repair. Genes encoding proteins with strong similarities to RecJ have been found in every eubacterial genome sequenced to date, with the exception of Mycoplasma and Mycobacterium tuberculosis. Multiple genes encoding proteins similar to RecJ are found in some eubacteria, including Bacillus and Helicobacter, and in the archaea. Among this divergent set of sequences, seven conserved motifs emerge. We demonstrate here that amino acids within six of these motifs are essential for both the biochemical and genetic functions of E. coli RecJ. These motifs may define interactions with Mg(2+) ions or substrate DNA. A large family of proteins more distantly related to RecJ is present in archaea, eubacteria, and eukaryotes, including a hypothetical protein in the MgPa adhesin operon of Mycoplasma, a domain of putative polyA polymerases in Synechocystis and Aquifex, PRUNE of Drosophila, and an exopolyphosphatase (PPX1) of Saccharomyces cereviseae. Because these six RecJ motifs are shared between exonucleases and exopolyphosphatases, they may constitute an ancient phosphoesterase domain now found in all kingdoms of life.

  17. Identification of early zygotic genes in the yellow fever mosquito Aedes aegypti and discovery of a motif involved in early zygotic genome activation.

    Science.gov (United States)

    Biedler, James K; Hu, Wanqi; Tae, Hongseok; Tu, Zhijian

    2012-01-01

    During early embryogenesis the zygotic genome is transcriptionally silent and all mRNAs present are of maternal origin. The maternal-zygotic transition marks the time over which embryogenesis changes its dependence from maternal RNAs to zygotically transcribed RNAs. Here we present the first systematic investigation of early zygotic genes (EZGs) in a mosquito species and focus on genes involved in the onset of transcription during 2-4 hr. We used transcriptome sequencing to identify the "pure" (without maternal expression) EZGs by analyzing transcripts from four embryonic time ranges of 0-2, 2-4, 4-8, and 8-12 hr, which includes the time of cellular blastoderm formation and up to the start of gastrulation. Blast of 16,789 annotated transcripts vs. the transcriptome reads revealed evidence for 63 (P<0.001) and 143 (P<0.05) nonmaternally derived transcripts having a significant increase in expression at 2-4 hr. One third of the 63 EZG transcripts do not have predicted introns compared to 10% of all Ae. aegypti genes. We have confirmed by RT-PCR that zygotic transcription starts as early as 2-3 hours. A degenerate motif VBRGGTA was found to be overrepresented in the upstream sequences of the identified EZGs using a motif identification software called SCOPE. We find evidence for homology between this motif and the TAGteam motif found in Drosophila that has been implicated in EZG activation. A 38 bp sequence in the proximal upstream sequence of a kinesin light chain EZG (KLC2.1) contains two copies of the mosquito motif. This sequence was shown to support EZG transcription by luciferase reporter assays performed on injected early embryos, and confers early zygotic activity to a heterologous promoter from a divergent mosquito species. The results of these studies are consistent with the model of early zygotic genome activation via transcriptional activators, similar to what has been found recently in Drosophila.

  18. Identification of early zygotic genes in the yellow fever mosquito Aedes aegypti and discovery of a motif involved in early zygotic genome activation.

    Directory of Open Access Journals (Sweden)

    James K Biedler

    Full Text Available During early embryogenesis the zygotic genome is transcriptionally silent and all mRNAs present are of maternal origin. The maternal-zygotic transition marks the time over which embryogenesis changes its dependence from maternal RNAs to zygotically transcribed RNAs. Here we present the first systematic investigation of early zygotic genes (EZGs in a mosquito species and focus on genes involved in the onset of transcription during 2-4 hr. We used transcriptome sequencing to identify the "pure" (without maternal expression EZGs by analyzing transcripts from four embryonic time ranges of 0-2, 2-4, 4-8, and 8-12 hr, which includes the time of cellular blastoderm formation and up to the start of gastrulation. Blast of 16,789 annotated transcripts vs. the transcriptome reads revealed evidence for 63 (P<0.001 and 143 (P<0.05 nonmaternally derived transcripts having a significant increase in expression at 2-4 hr. One third of the 63 EZG transcripts do not have predicted introns compared to 10% of all Ae. aegypti genes. We have confirmed by RT-PCR that zygotic transcription starts as early as 2-3 hours. A degenerate motif VBRGGTA was found to be overrepresented in the upstream sequences of the identified EZGs using a motif identification software called SCOPE. We find evidence for homology between this motif and the TAGteam motif found in Drosophila that has been implicated in EZG activation. A 38 bp sequence in the proximal upstream sequence of a kinesin light chain EZG (KLC2.1 contains two copies of the mosquito motif. This sequence was shown to support EZG transcription by luciferase reporter assays performed on injected early embryos, and confers early zygotic activity to a heterologous promoter from a divergent mosquito species. The results of these studies are consistent with the model of early zygotic genome activation via transcriptional activators, similar to what has been found recently in Drosophila.

  19. Phylogenetic reconstruction and the identification of ancient polymorphism in the Bovini tribe (Bovidae, Bovinae

    Directory of Open Access Journals (Sweden)

    MacEachern Sean

    2009-04-01

    Full Text Available Abstract Background The Bovinae subfamily incorporates an array of antelope, buffalo and cattle species. All of the members of this subfamily have diverged recently. Not surprisingly, a number of phylogenetic studies from molecular and morphological data have resulted in ambiguous trees and relationships amongst species, especially for Yak and Bison species. A partial phylogenetic reconstruction of 13 extant members of the Bovini tribe (Bovidae, Bovinae from 15 complete or partially sequenced autosomal genes is presented. Results We identified 3 distinct lineages after the Bovini split from the Boselaphini and Tragelaphini tribes, which has lead to the (1 Buffalo clade (Bubalus and Syncerus species and a more recent divergence leading to the (2 Banteng, Gaur and Mithan and (3 Domestic cattle clades. A fourth lineage may also exist that leads to Bison and Yak. However, there was some ambiguity as to whether this was a divergence from the Banteng/Gaur/Mithan or the Domestic cattle clade. From an analysis of approximately 30,000 sites that were amplified in all species 133 sites were identified with ambiguous inheritance, in that all trees implied more than one mutation at the same site. Closer examination of these sites has identified that they are the result of ancient polymorphisms that have subsequently undergone lineage sorting in the Bovini tribe, of which 53 have remained polymorphic since Bos and Bison species last shared a common ancestor with Bubalus between 5–8 million years ago (MYA. Conclusion Uncertainty arises in our phylogenetic reconstructions because many species in the Bovini diverged over a short period of time. It appears that a number of sites with ambiguous inheritance have been maintained in subsequent populations by chance (lineage sorting and that they have contributed to an association between Yak and Domestic cattle and an unreliable phylogenetic reconstruction for the Bison/Yak clade. Interestingly, a number of these

  20. Phylogenetic reconstruction and the identification of ancient polymorphism in the Bovini tribe (Bovidae, Bovinae).

    Science.gov (United States)

    MacEachern, Sean; McEwan, John; Goddard, Mike

    2009-04-24

    The Bovinae subfamily incorporates an array of antelope, buffalo and cattle species. All of the members of this subfamily have diverged recently. Not surprisingly, a number of phylogenetic studies from molecular and morphological data have resulted in ambiguous trees and relationships amongst species, especially for Yak and Bison species. A partial phylogenetic reconstruction of 13 extant members of the Bovini tribe (Bovidae, Bovinae) from 15 complete or partially sequenced autosomal genes is presented. We identified 3 distinct lineages after the Bovini split from the Boselaphini and Tragelaphini tribes, which has lead to the (1) Buffalo clade (Bubalus and Syncerus species) and a more recent divergence leading to the (2) Banteng, Gaur and Mithan and (3) Domestic cattle clades. A fourth lineage may also exist that leads to Bison and Yak. However, there was some ambiguity as to whether this was a divergence from the Banteng/Gaur/Mithan or the Domestic cattle clade. From an analysis of approximately 30,000 sites that were amplified in all species 133 sites were identified with ambiguous inheritance, in that all trees implied more than one mutation at the same site. Closer examination of these sites has identified that they are the result of ancient polymorphisms that have subsequently undergone lineage sorting in the Bovini tribe, of which 53 have remained polymorphic since Bos and Bison species last shared a common ancestor with Bubalus between 5-8 million years ago (MYA). Uncertainty arises in our phylogenetic reconstructions because many species in the Bovini diverged over a short period of time. It appears that a number of sites with ambiguous inheritance have been maintained in subsequent populations by chance (lineage sorting) and that they have contributed to an association between Yak and Domestic cattle and an unreliable phylogenetic reconstruction for the Bison/Yak clade. Interestingly, a number of these aberrant sites are in coding sections of the genome

  1. An intracellular motif of GLUT4 regulates fusion of GLUT4-containing vesicles

    Directory of Open Access Journals (Sweden)

    Welsh Gavin I

    2008-05-01

    Full Text Available Abstract Background Insulin stimulates glucose uptake by adipocytes through increasing translocation of the glucose transporter GLUT4 from an intracellular compartment to the plasma membrane. Fusion of GLUT4-containing vesicles at the cell surface is thought to involve phospholipase D activity, generating the signalling lipid phosphatidic acid, although the mechanism of action is not yet clear. Results Here we report the identification of a putative phosphatidic acid-binding motif in a GLUT4 intracellular loop. Mutation of this motif causes a decrease in the insulin-induced exposure of GLUT4 at the cell surface of 3T3-L1 adipocytes via an effect on vesicle fusion. Conclusion The potential phosphatidic acid-binding motif identified in this study is unique to GLUT4 among the sugar transporters, therefore this motif may provide a unique mechanism for regulating insulin-induced translocation by phospholipase D signalling.

  2. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Directory of Open Access Journals (Sweden)

    Guido W. Grimm

    2006-01-01

    Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.

  3. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Science.gov (United States)

    Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera

    2007-01-01

    The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198

  4. Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas

    Science.gov (United States)

    Petrov, Anton I.; Zirbel, Craig L.; Leontis, Neocles B.

    2013-01-01

    The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access. PMID:23970545

  5. Pipeline for the Analysis of ChIP-seq Data and New Motif Ranking Procedure

    KAUST Repository

    Ashoor, Haitham

    2011-06-01

    This thesis presents a computational methodology for ab-initio identification of transcription factor binding sites based on ChIP-seq data. This method consists of three main steps, namely ChIP-seq data processing, motif discovery and models selection. A novel method for ranking the models of motifs identified in this process is proposed. This method combines multiple factors in order to rank the provided candidate motifs. It combines the model coverage of the ChIP-seq fragments that contain motifs from which that model is built, the suitable background data made up of shuffled ChIP-seq fragments, and the p-value that resulted from evaluating the model on actual and background data. Two ChIP-seq datasets retrieved from ENCODE project are used to evaluate and demonstrate the ability of the method to predict correct TFBSs with high precision. The first dataset relates to neuron-restrictive silencer factor, NRSF, while the second one corresponds to growth-associated binding protein, GABP. The pipeline system shows high precision prediction for both datasets, as in both cases the top ranked motif closely resembles the known motifs for the respective transcription factors.

  6. A survey of motif finding Web tools for detecting binding site motifs in ChIP-Seq data.

    Science.gov (United States)

    Tran, Ngoc Tam L; Huang, Chun-Hsi

    2014-02-20

    ChIP-Seq (chromatin immunoprecipitation sequencing) has provided the advantage for finding motifs as ChIP-Seq experiments narrow down the motif finding to binding site locations. Recent motif finding tools facilitate the motif detection by providing user-friendly Web interface. In this work, we reviewed nine motif finding Web tools that are capable for detecting binding site motifs in ChIP-Seq data. We showed each motif finding Web tool has its own advantages for detecting motifs that other tools may not discover. We recommended the users to use multiple motif finding Web tools that implement different algorithms for obtaining significant motifs, overlapping resemble motifs, and non-overlapping motifs. Finally, we provided our suggestions for future development of motif finding Web tool that better assists researchers for finding motifs in ChIP-Seq data.

  7. APOCALYPTIC MOTIFS IN THE CYCLE OF STORIES BY M.A. BULGAKOV «NOTES OF A YOUNG DOCTOR»

    Directory of Open Access Journals (Sweden)

    Evgeniy Igorevich Erokhov

    2015-10-01

    Full Text Available The motif analysis of a cycle of stories by M.A. Bulgakov «Notes of a Young Doctor» from the point of view of their apocalyptic problematics was first performed in this article. To identify apocalyptic motifs the method of motif analysis, developed by B.M. Gasparov, was used which will also help to prove the interpenetration of motifs in the cycle of stories. The result of the research work is the identification of apocalyptic motifs which are manifested in the experiences of the main character and the events taking place around him and passing through the prism of physician’s perception of the world. Our identified motifs show that the stories in the cycle are united not only thematically and with the help of the image of the main character, but with the help of the motifs which reflect interpenetration of apocalyptic motifs in the stories of one cycle. There are the following apocalyptic motifs in the cycle of stories by Bulgakov: diseases, darkness (as part of the landscape, resurrection from the dead and beast. They all belong to the biblical type which is allocated on the basis of the associative bond of these motifs with the biblical texts.

  8. Molecular phylogenetic identification of Fasciola flukes in Nepal.

    Science.gov (United States)

    Shoriki, Takuya; Ichikawa-Seki, Madoka; Devkota, Bhuminand; Rana, Hari B; Devkota, Shiva P; Humagain, Sudeep K; Itagaki, Tadashi

    2014-12-01

    Eighty-one Fasciola flukes collected from 8 districts in Nepal were analyzed for their species identification on the basis of their spermatogenic status and nuclear ribosomal internal transcribed spacer 1 (ITS1) and for their phylogenetic relation with Fasciola flukes from other Asian countries on the basis of the mitochondrial NADH dehydrogenase subunit 1 (nad1) gene. Sixty-one flukes (75.3%) were aspermic Fasciola sp., and 20 flukes (24.7%) were identified as Fasciola gigantica. All of the aspermic flukes displayed the Fh/Fg type in ITS1, which was predominant in aspermic Fasciola sp. from China, and most (60 flukes) displayed the Fsp-ND1-N1 haplotype in the nad1, which had an identical nucleotide sequence to the major haplotype (Fg-C2) of the aspermic flukes from China. These results suggest that aspermic Fasciola sp. was introduced into Nepal from China. Furthermore, the results of the diversity indices, neutrality indices, and median-joining network analysis with reference haplotypes from Asian countries suggest that aspermic Fasciola sp. rapidly expanded its distribution. In contrasts, F. gigantica displayed 10 nad1 haplotypes, which showed higher population diversity indices than the haplotypes of aspermic flukes, indicating that the F. gigantica population was clearly distributed in Nepal earlier than the aspermic Fasciola population. Although the F. gigantica haplotypes from Nepal formed a star-like phylogeny consisting of a main founder haplotype (Fg-ND1-N1), together with some F. gigantica haplotypes from Myanmar and Thailand, the Nepal population differed genetically from F. gigantica populations of neighboring countries as each country had distinct founder haplotype(s). Copyright © 2014 Elsevier Inc. All rights reserved.

  9. galaxieEST: addressing EST identity through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Rajashekar, Balaji; Larsson, Karl-Henrik; Ursing, Björn M

    2004-07-05

    Research involving expressed sequence tags (ESTs) is intricately coupled to the existence of large, well-annotated sequence repositories. Comparatively complete and satisfactory annotated public sequence libraries are, however, available only for a limited range of organisms, rendering the absence of sequences and gene structure information a tangible problem for those working with taxa lacking an EST or genome sequencing project. Paralogous genes belonging to the same gene family but distinguished by derived characteristics are particularly prone to misidentification and erroneous annotation; high but incomplete levels of sequence similarity are typically difficult to interpret and have formed the basis of many unsubstantiated assumptions of orthology. In these cases, a phylogenetic study of the query sequence together with the most similar sequences in the database may be of great value to the identification process. In order to facilitate this laborious procedure, a project to employ automated phylogenetic analysis in the identification of ESTs was initiated. galaxieEST is an open source Perl-CGI script package designed to complement traditional similarity-based identification of EST sequences through employment of automated phylogenetic analysis. It uses a series of BLAST runs as a sieve to retrieve nucleotide and protein sequences for inclusion in neighbour joining and parsimony analyses; the output includes the BLAST output, the results of the phylogenetic analyses, and the corresponding multiple alignments. galaxieEST is available as an on-line web service for identification of fungal ESTs and for download / local installation for use with any organism group at http://galaxie.cgb.ki.se/galaxieEST.html. By addressing sequence relatedness in addition to similarity, galaxieEST provides an integrative view on EST origin and identity, which may prove particularly useful in cases where similarity searches return one or more pertinent, but not full, matches and

  10. An enhanced computational platform for investigating the roles of regulatory RNA and for identifying functional RNA motifs

    OpenAIRE

    Chang, Tzu-Hao; Huang, Hsi-Yuan; Hsu, Justin Bo-Kai; Weng, Shun-Long; Horng, Jorng-Tzong; Huang, Hsien-Da

    2013-01-01

    Background Functional RNA molecules participate in numerous biological processes, ranging from gene regulation to protein synthesis. Analysis of functional RNA motifs and elements in RNA sequences can obtain useful information for deciphering RNA regulatory mechanisms. Our previous work, RegRNA, is widely used in the identification of regulatory motifs, and this work extends it by incorporating more comprehensive and updated data sources and analytical approaches into a new platform. Methods ...

  11. Identification of novel conserved functional motifs across most Influenza A viral strains

    Directory of Open Access Journals (Sweden)

    El-Azab Iman

    2011-01-01

    Full Text Available Abstract Background Influenza A virus poses a continuous threat to global public health. Design of novel universal drugs and vaccine requires a careful analysis of different strains of Influenza A viral genome from diverse hosts and subtypes. We performed a systematic in silico analysis of Influenza A viral segments of all available Influenza A viral strains and subtypes and grouped them based on host, subtype, and years isolated, and through multiple sequence alignments we extrapolated conserved regions, motifs, and accessible regions for functional mapping and annotation. Results Across all species and strains 87 highly conserved regions (conservation percentage > = 90% and 19 functional motifs (conservation percentage = 100% were found in PB2, PB1, PA, NP, M, and NS segments. The conservation percentage of these segments ranged between 94 - 98% in human strains (the most conserved, 85 - 93% in swine strains (the most variable, and 91 - 94% in avian strains. The most conserved segment was different in each host (PB1 for human strains, NS for avian strains, and M for swine strains. Target accessibility prediction yielded 324 accessible regions, with a single stranded probability > 0.5, of which 78 coincided with conserved regions. Some of the interesting annotations in these regions included sites for protein-protein interactions, the RNA binding groove, and the proton ion channel. Conclusions The influenza virus has evolved to adapt to its host through variations in the GC content and conservation percentage of the conserved regions. Nineteen universal conserved functional motifs were discovered, of which some were accessible regions with interesting biological functions. These regions will serve as a foundation for universal drug targets as well as universal vaccine design.

  12. Comprehensive Identification of Glycated Peptides and Their Glycation Motifs in Plasma and Erythrocytes of Control and Diabetic Subjects

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qibin; Monroe, Matthew E.; Schepmoes, Athena A.; Clauss, Therese RW; Gritsenko, Marina A.; Meng, Da; Petyuk, Vladislav A.; Smith, Richard D.; Metz, Thomas O.

    2011-07-01

    Non-enzymatic glycation of proteins is implicated in diabetes mellitus and its related complications. In this report, we extend our previous development and refinement of proteomics-based methods for the analysis of non-enzymatically glycated proteins to comprehensively identify glycated proteins in normal and diabetic human plasma and erythrocytes. Using immunodepletion, enrichment, and fractionation strategies, we identified 7749 unique glycated peptides, corresponding to 3742 unique glycated proteins. Semi-quantitative comparisons revealed a number of proteins with glycation levels significantly increased in diabetes relative to control samples and that erythrocyte proteins are more extensively glycated than plasma proteins. A glycation motif analysis revealed amino acids that are favored more than others in the protein primary structures in the vicinity of the glycation sites in both sample types. The glycated peptides and corresponding proteins reported here provide a foundation for the potential identification of novel markers for diabetes, glycemia, or diabetic complications.

  13. Computational identification and phylogenetic analysis of the oil-body structural proteins, oleosin and caleosin, in castor bean and flax.

    Science.gov (United States)

    Hyun, Tae Kyung; Kumar, Dhinesh; Cho, Young-Yeol; Hyun, Hae-Nam; Kim, Ju-Sung

    2013-02-25

    Oil bodies (OBs) are the intracellular particles derived from oilseeds. These OBs store lipids as a carbon resource, and have been exploited for a variety of industrial applications including biofuels. Oleosin and caleosin are the common OB structural proteins which are enabling biotechnological enhancement of oil content and OB-based pharmaceutical formations via stabilizing OBs. Although the draft whole genome sequence information for Ricinus communis L. (castor bean) and Linum usitatissimum L. (flax), important oil seed plants, is available in public database, OB-structural proteins in these plants are poorly indentified. Therefore, in this study, we performed a comprehensive bioinformatic analysis including analysis of the genome sequence, conserved domains and phylogenetic relationships to identify OB structural proteins in castor bean and flax genomes. Using comprehensive analysis, we have identified 6 and 15 OB-structural proteins from castor bean and flax, respectively. A complete overview of this gene family in castor bean and flax is presented, including the gene structures, phylogeny and conserved motifs, resulting in the presence of central hydrophobic regions with proline knot motif, providing an evolutionary proof that this central hydrophobic region had evolved from duplications in the primitive eukaryotes. In addition, expression analysis of L-oleosin and caleosin genes using quantitative real-time PCR demonstrated that seed contained their maximum expression, except that RcCLO-1 expressed maximum in cotyledon. Thus, our comparative genomics analysis of oleosin and caleosin genes and their putatively encoded proteins in two non-model plant species provides insights into the prospective usage of gene resources for improving OB-stability. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  15. Space-related pharma-motifs for fast search of protein binding motifs and polypharmacological targets.

    Science.gov (United States)

    Chiu, Yi-Yuan; Lin, Chun-Yu; Lin, Chih-Ta; Hsu, Kai-Cheng; Chang, Li-Zen; Yang, Jinn-Moon

    2012-01-01

    To discover a compound inhibiting multiple proteins (i.e. polypharmacological targets) is a new paradigm for the complex diseases (e.g. cancers and diabetes). In general, the polypharmacological proteins often share similar local binding environments and motifs. As the exponential growth of the number of protein structures, to find the similar structural binding motifs (pharma-motifs) is an emergency task for drug discovery (e.g. side effects and new uses for old drugs) and protein functions. We have developed a Space-Related Pharmamotifs (called SRPmotif) method to recognize the binding motifs by searching against protein structure database. SRPmotif is able to recognize conserved binding environments containing spatially discontinuous pharma-motifs which are often short conserved peptides with specific physico-chemical properties for protein functions. Among 356 pharma-motifs, 56.5% interacting residues are highly conserved. Experimental results indicate that 81.1% and 92.7% polypharmacological targets of each protein-ligand complex are annotated with same biological process (BP) and molecular function (MF) terms, respectively, based on Gene Ontology (GO). Our experimental results show that the identified pharma-motifs often consist of key residues in functional (active) sites and play the key roles for protein functions. The SRPmotif is available at http://gemdock.life.nctu.edu.tw/SRP/. SRPmotif is able to identify similar pharma-interfaces and pharma-motifs sharing similar binding environments for polypharmacological targets by rapidly searching against the protein structure database. Pharma-motifs describe the conservations of binding environments for drug discovery and protein functions. Additionally, these pharma-motifs provide the clues for discovering new sequence-based motifs to predict protein functions from protein sequence databases. We believe that SRPmotif is useful for elucidating protein functions and drug discovery.

  16. Identification of the divergent calmodulin binding motif in yeast Ssb1/Hsp75 protein and in other HSP70 family members.

    Science.gov (United States)

    Heinen, R C; Diniz-Mendes, L; Silva, J T; Paschoalin, V M F

    2006-11-01

    Yeast soluble proteins were fractionated by calmodulin-agarose affinity chromatography and the Ca2+/calmodulin-binding proteins were analyzed by SDS-PAGE. One prominent protein of 66 kDa was excised from the gel, digested with trypsin and the masses of the resultant fragments were determined by MALDI/MS. Twenty-one of 38 monoisotopic peptide masses obtained after tryptic digestion were matched to the heat shock protein Ssb1/Hsp75, covering 37% of its sequence. Computational analysis of the primary structure of Ssb1/Hsp75 identified a unique potential amphipathic alpha-helix in its N-terminal ATPase domain with features of target regions for Ca2+/calmodulin binding. This region, which shares 89% similarity to the experimentally determined calmodulin-binding domain from mouse, Hsc70, is conserved in near half of the 113 members of the HSP70 family investigated, from yeast to plant and animals. Based on the sequence of this region, phylogenetic analysis grouped the HSP70s in three distinct branches. Two of them comprise the non-calmodulin binding Hsp70s BIP/GR78, a subfamily of eukaryotic HSP70 localized in the endoplasmic reticulum, and DnaK, a subfamily of prokaryotic HSP70. A third heterogeneous group is formed by eukaryotic cytosolic HSP70s containing the new calmodulin-binding motif and other cytosolic HSP70s whose sequences do not conform to those conserved motif, indicating that not all eukaryotic cytosolic Hsp70s are target for calmodulin regulation. Furthermore, the calmodulin-binding domain found in eukaryotic HSP70s is also the target for binding of Bag-1 - an enhancer of ADP/ATP exchange activity of Hsp70s. A model in which calmodulin displaces Bag-1 and modulates Ssb1/Hsp75 chaperone activity is discussed.

  17. Identification of the divergent calmodulin binding motif in yeast Ssb1/Hsp75 protein and in other HSP70 family members

    Directory of Open Access Journals (Sweden)

    R.C. Heinen

    2006-11-01

    Full Text Available Yeast soluble proteins were fractionated by calmodulin-agarose affinity chromatography and the Ca2+/calmodulin-binding proteins were analyzed by SDS-PAGE. One prominent protein of 66 kDa was excised from the gel, digested with trypsin and the masses of the resultant fragments were determined by MALDI/MS. Twenty-one of 38 monoisotopic peptide masses obtained after tryptic digestion were matched to the heat shock protein Ssb1/Hsp75, covering 37% of its sequence. Computational analysis of the primary structure of Ssb1/Hsp75 identified a unique potential amphipathic alpha-helix in its N-terminal ATPase domain with features of target regions for Ca2+/calmodulin binding. This region, which shares 89% similarity to the experimentally determined calmodulin-binding domain from mouse, Hsc70, is conserved in near half of the 113 members of the HSP70 family investigated, from yeast to plant and animals. Based on the sequence of this region, phylogenetic analysis grouped the HSP70s in three distinct branches. Two of them comprise the non-calmodulin binding Hsp70s BIP/GR78, a subfamily of eukaryotic HSP70 localized in the endoplasmic reticulum, and DnaK, a subfamily of prokaryotic HSP70. A third heterogeneous group is formed by eukaryotic cytosolic HSP70s containing the new calmodulin-binding motif and other cytosolic HSP70s whose sequences do not conform to those conserved motif, indicating that not all eukaryotic cytosolic Hsp70s are target for calmodulin regulation. Furthermore, the calmodulin-binding domain found in eukaryotic HSP70s is also the target for binding of Bag-1 - an enhancer of ADP/ATP exchange activity of Hsp70s. A model in which calmodulin displaces Bag-1 and modulates Ssb1/Hsp75 chaperone activity is discussed.

  18. Application of unweighted pair group methods with arithmetic average (UPGMA) for identification of kinship types and spreading of ebola virus through establishment of phylogenetic tree

    Science.gov (United States)

    Andriani, Tri; Irawan, Mohammad Isa

    2017-08-01

    Ebola Virus Disease (EVD) is a disease caused by a virus of the genus Ebolavirus (EBOV), family Filoviridae. Ebola virus is classifed into five types, namely Zaire ebolavirus (ZEBOV), Sudan ebolavirus (SEBOV), Bundibugyo ebolavirus (BEBOV), Tai Forest ebolavirus also known as Cote d'Ivoire ebolavirus (CIEBOV), and Reston ebolavirus (REBOV). Identification of kinship types of Ebola virus can be performed using phylogenetic trees. In this study, the phylogenetic tree constructed by UPGMA method in which there are Multiple Alignment using Progressive Method. The results concluded that the phylogenetic tree formation kinship ebola virus types that kind of Tai Forest ebolavirus close to Bundibugyo ebolavirus but the layout state ebola epidemic spread far apart. The genetic distance for this type of Bundibugyo ebolavirus with Tai Forest ebolavirus is 0.3725. Type Tai Forest ebolavirus similar to Bundibugyo ebolavirus not inuenced by the proximity of the area ebola epidemic spread.

  19. Identification and phylogenetic analysis of a novel starch synthase in maize

    Directory of Open Access Journals (Sweden)

    Hanmei eLiu

    2015-11-01

    Full Text Available Starch is an important reserve of carbon and energy in plants, providing the majority of calories in the human diet and animal feed. Its synthesis is orchestrated by several key enzymes, and the amount and structure of starch, affecting crop yield and quality, are determined mainly by starch synthase (SS activity. To date, five SS isoforms, including SSI-IV and Granule Bound Starch Synthase (GBSS have been identified and their physiological functions have been well characterized. Here, we report the identification of a new SS isoform in maize, designated SSV. By searching sequenced genomes, SSV has been found in all green plants with conserved sequences and gene structures. Our phylogenetic analysis based on 780 base pairs has suggested that SSIV and SSV resulted from a gene duplication event, which may have occurred before the algae formation. An expression profile analysis of SSV in maize has indicated that ZmSSV is mainly transcribed in the kernel and ear leaf during the grain filling stage, which is partly similar to other SS isoforms. Therefore, it is likely that SSV may play an important role in starch biosynthesis. Subsequent analysis of SSV function may facilitate understanding the mechanism of starch granules formation, number and structure.

  20. Exploiting publicly available biological and biochemical information for the discovery of novel short linear motifs.

    KAUST Repository

    Sayadi, Ahmed; Briganti, Leonardo; Tramontano, Anna; Via, Allegra

    2011-01-01

    The function of proteins is often mediated by short linear segments of their amino acid sequence, called Short Linear Motifs or SLiMs, the identification of which can provide important information about a protein function. However, the short length

  1. Identification and phylogenetic analysis of a sheep pox virus isolated from the Ningxia Hui Autonomous Region of China.

    Science.gov (United States)

    Zhu, X L; Yang, F; Li, H X; Dou, Y X; Meng, X L; Li, H; Luo, X N; Cai, X P

    2013-05-14

    An outbreak of sheep pox was investigated in the Ningxia Hui Autonomous Region in China. Through immunofluorescence testing, isolated viruses, polymerase chain reaction identification, and electron microscopic examination, the isolated strain was identified as a sheep pox virus. The virus was identified through sequence and phylogenetic analysis of the P32 gene, open reading frame (ORF) 095, and ORF 103 genes. This study is the first to use the ORF 095 and ORF 103 genes as candidate genes for the analysis of sheep pox. The results showed that the ORF 095 and ORF 103 genes could be used for the genotyping of the sheep pox virus.

  2. LDsplit: screening for cis-regulatory motifs stimulating meiotic recombination hotspots by analysis of DNA sequence polymorphisms.

    Science.gov (United States)

    Yang, Peng; Wu, Min; Guo, Jing; Kwoh, Chee Keong; Przytycka, Teresa M; Zheng, Jie

    2014-02-17

    As a fundamental genomic element, meiotic recombination hotspot plays important roles in life sciences. Thus uncovering its regulatory mechanisms has broad impact on biomedical research. Despite the recent identification of the zinc finger protein PRDM9 and its 13-mer binding motif as major regulators for meiotic recombination hotspots, other regulators remain to be discovered. Existing methods for finding DNA sequence motifs of recombination hotspots often rely on the enrichment of co-localizations between hotspots and short DNA patterns, which ignore the cross-individual variation of recombination rates and sequence polymorphisms in the population. Our objective in this paper is to capture signals encoded in genetic variations for the discovery of recombination-associated DNA motifs. Recently, an algorithm called "LDsplit" has been designed to detect the association between single nucleotide polymorphisms (SNPs) and proximal meiotic recombination hotspots. The association is measured by the difference of population recombination rates at a hotspot between two alleles of a candidate SNP. Here we present an open source software tool of LDsplit, with integrative data visualization for recombination hotspots and their proximal SNPs. Applying LDsplit on SNPs inside an established 7-mer motif bound by PRDM9 we observed that SNP alleles preserving the original motif tend to have higher recombination rates than the opposite alleles that disrupt the motif. Running on SNP windows around hotspots each containing an occurrence of the 7-mer motif, LDsplit is able to guide the established motif finding algorithm of MEME to recover the 7-mer motif. In contrast, without LDsplit the 7-mer motif could not be identified. LDsplit is a software tool for the discovery of cis-regulatory DNA sequence motifs stimulating meiotic recombination hotspots by screening and narrowing down to hotspot associated SNPs. It is the first computational method that utilizes the genetic variation of

  3. Identification of high-efficiency 3′GG gRNA motifs in indexed FASTA files with ngg2

    Directory of Open Access Journals (Sweden)

    Elisha D. Roberson

    2015-11-01

    Full Text Available CRISPR/Cas9 is emerging as one of the most-used methods of genome modification in organisms ranging from bacteria to human cells. However, the efficiency of editing varies tremendously site-to-site. A recent report identified a novel motif, called the 3′GG motif, which substantially increases the efficiency of editing at all sites tested in C. elegans. Furthermore, they highlighted that previously published gRNAs with high editing efficiency also had this motif. I designed a Python command-line tool, ngg2, to identify 3′GG gRNA sites from indexed FASTA files. As a proof-of-concept, I screened for these motifs in six model genomes: Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, Danio rerio, Mus musculus, and Homo sapiens. I also scanned the genomes of pig (Sus scrofa and African elephant (Loxodonta africana to demonstrate the utility in non-model organisms. I identified more than 60 million single match 3′GG motifs in these genomes. Greater than 61% of all protein coding genes in the reference genomes had at least one unique 3′GG gRNA site overlapping an exon. In particular, more than 96% of mouse and 93% of human protein coding genes have at least one unique, overlapping 3′GG gRNA. These identified sites can be used as a starting point in gRNA selection, and the ngg2 tool provides an important ability to identify 3′GG editing sites in any species with an available genome sequence.

  4. Potentials and limitations of histone repeat sequences for phylogenetic reconstruction of Sophophora.

    Science.gov (United States)

    Baldo, A M; Les, D H; Strausbaugh, L D

    1999-11-01

    Simplified DNA sequence acquisition has provided many new data sets that are useful for phylogenetic reconstruction, including single- and multiple-copy nuclear and organellar genes. Although transcribed regions receive much attention, nontranscribed regions have recently been added to the repertoire of sequences suitable for phylogenetic studies, especially for closely related taxa. We evaluated the efficacy of a small portion of the histone repeat for phylogenetic reconstruction among Drosophila species. Histone repeats in invertebrates offer distinct advantages similar to those of widely used ribosomal repeats. First, the units are tandemly repeated and undergo concerted evolution. Second, histone repeats include both highly conserved coding and variable intergenic regions. This composition facilitates application of "universal" primers spanning potentially informative sites. We examined a small region of the histone repeat, including the intergenic spacer segments of coding regions from the divergently transcribed H2A and H2B histone genes. The spacer (about 230 bp) exists as a mosaic with highly conserved functional motifs interspersed with rapidly diverging regions; the former aid in alignment of the spacer. There are no ambiguities in alignment of coding regions. Coding and noncoding regions were analyzed together and separately for phylogenetic information. Parsimony, distance, and maximum-likelihood methods successfully retrieve the corroborated phylogeny for the taxa examined. This study demonstrates the resolving power of a small histone region which may now be added to the growing collection of phylogenetically useful DNA sequences.

  5. The MHC motif viewer: a visualization tool for MHC binding motifs

    DEFF Research Database (Denmark)

    Rapin, Nicolas; Hoof, Ilka; Lund, Ole

    2010-01-01

    is hampered by the lack of tools for browsing and comparing specificity of these molecules. We have developed a Web server, MHC Motif Viewer, which allows the display of the binding motif for MHC class I proteins for human, chimpanzee, rhesus monkey, mouse, and swine, as well as HLA-DR protein sequences...

  6. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  7. Kopi dan Kakao dalam Kreasi Motif Batik Khas Jember

    Directory of Open Access Journals (Sweden)

    Irfa'ina Rohana Salma

    2015-06-01

    Full Text Available ABSTRAK Batik Jember selama ini identik dengan motif daun tembakau. Visualisasi daun tembakau dalam motif Batik Jember cukup lemah, yaitu kurang berkarakter karena motif yang muncul adalah seperti gambar daun pada umumnya. Oleh karena itu perlu diciptakan desain motif batik khas Jember yang sumber inspirasinya digali dari kekayaan alam lainnya dari Jember yang mempunyai bentuk spesifik dan karakteristik sehingga identitas motif bisa didapatkan dengan lebih kuat. Hasil alam khas Jember tersebut adalah kopi dan kakao. Tujuan penciptaan seni ini adalah untuk menghasilkan motif batik  baru yang mempunyai ciri khas Jember. Metode yang digunakan yaitu pengumpulan data, pengamatan mendalam terhadap objek penciptaan, pengkajian sumber inspirasi, pembuatan desain motif, dan perwujudan menjadi batik. Dari penciptaan seni ini berhasil dikreasikan 6 (enam motif batik yaitu: (1 Motif Uwoh Kopi; (2 Motif Godong Kopi;  (3 Motif Ceplok Kakao; (4 Motif Kakao Raja; (5 Motif Kakao Biru; dan (6 Motif Wiji Mukti. Berdasarkan hasil penilaian “Selera Estetika” diketahui bahwa motif yang paling banyak disukai adalah Motif Uwoh Kopi dan Motif Kakao Raja. Kata kunci: Motif Woh Kopi, Motif Godong Kopi, Motif Ceplok Kakao, Motif Kakao Raja, Motif Kakao Biru, Motif Wiji Mukti ABSTRACTBatik Jember is synonymous with tobacco leaf motif. Tobacco leaf shape is quite weak in the visual appearance characterized as that motif emerges like a picture of leaves in general. Therefore, it is necessary to create a distinctive design motif extracted from other natural resources of Jember that have specific shapes and characteristics that can be obtained as the stronger motif identity. The typical natural resources from Jember are coffee and cocoa. The purpose of the creation of this art is to produce the unique, creative and innovative batik and have specific characteristics of Jember. The method used are data collection, observation of the object, reviewing inspiration sources

  8. Extensive 5.8S nrDNA polymorphism in Mammillaria (Cactaceae) with special reference to the identification of pseudogenic internal transcribed spacer regions.

    Science.gov (United States)

    Harpke, Doerte; Peterson, Angela

    2008-05-01

    The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.

  9. Dimensional Reduction for the General Markov Model on Phylogenetic Trees.

    Science.gov (United States)

    Sumner, Jeremy G

    2017-03-01

    We present a method of dimensional reduction for the general Markov model of sequence evolution on a phylogenetic tree. We show that taking certain linear combinations of the associated random variables (site pattern counts) reduces the dimensionality of the model from exponential in the number of extant taxa, to quadratic in the number of taxa, while retaining the ability to statistically identify phylogenetic divergence events. A key feature is the identification of an invariant subspace which depends only bilinearly on the model parameters, in contrast to the usual multi-linear dependence in the full space. We discuss potential applications including the computation of split (edge) weights on phylogenetic trees from observed sequence data.

  10. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. CombiMotif: A new algorithm for network motifs discovery in protein-protein interaction networks

    Science.gov (United States)

    Luo, Jiawei; Li, Guanghui; Song, Dan; Liang, Cheng

    2014-12-01

    Discovering motifs in protein-protein interaction networks is becoming a current major challenge in computational biology, since the distribution of the number of network motifs can reveal significant systemic differences among species. However, this task can be computationally expensive because of the involvement of graph isomorphic detection. In this paper, we present a new algorithm (CombiMotif) that incorporates combinatorial techniques to count non-induced occurrences of subgraph topologies in the form of trees. The efficiency of our algorithm is demonstrated by comparing the obtained results with the current state-of-the art subgraph counting algorithms. We also show major differences between unicellular and multicellular organisms. The datasets and source code of CombiMotif are freely available upon request.

  12. MSDmotif: exploring protein sites and motifs

    Directory of Open Access Journals (Sweden)

    Henrick Kim

    2008-07-01

    Full Text Available Abstract Background Protein structures have conserved features – motifs, which have a sufficient influence on the protein function. These motifs can be found in sequence as well as in 3D space. Understanding of these fragments is essential for 3D structure prediction, modelling and drug-design. The Protein Data Bank (PDB is the source of this information however present search tools have limited 3D options to integrate protein sequence with its 3D structure. Results We describe here a web application for querying the PDB for ligands, binding sites, small 3D structural and sequence motifs and the underlying database. Novel algorithms for chemical fragments, 3D motifs, ϕ/ψ sequences, super-secondary structure motifs and for small 3D structural motif associations searches are incorporated. The interface provides functionality for visualization, search criteria creation, sequence and 3D multiple alignment options. MSDmotif is an integrated system where a results page is also a search form. A set of motif statistics is available for analysis. This set includes molecule and motif binding statistics, distribution of motif sequences, occurrence of an amino-acid within a motif, correlation of amino-acids side-chain charges within a motif and Ramachandran plots for each residue. The binding statistics are presented in association with properties that include a ligand fragment library. Access is also provided through the distributed Annotation System (DAS protocol. An additional entry point facilitates XML requests with XML responses. Conclusion MSDmotif is unique by combining chemical, sequence and 3D data in a single search engine with a range of search and visualisation options. It provides multiple views of data found in the PDB archive for exploring protein structures.

  13. The Verrucomicrobia LexA-binding Motif: Insights into the Evolutionary Dynamics of the SOS Response

    Directory of Open Access Journals (Sweden)

    Ivan Erill

    2016-07-01

    Full Text Available The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

  14. The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.

    Science.gov (United States)

    Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi

    2016-01-01

    The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

  15. A phylogenetic study of SPBP and RAI1: evolutionary conservation of chromatin binding modules.

    Directory of Open Access Journals (Sweden)

    Sagar Darvekar

    Full Text Available Our genome is assembled into and array of highly dynamic nucleosome structures allowing spatial and temporal access to DNA. The nucleosomes are subject to a wide array of post-translational modifications, altering the DNA-histone interaction and serving as docking sites for proteins exhibiting effector or "reader" modules. The nuclear proteins SPBP and RAI1 are composed of several putative "reader" modules which may have ability to recognise a set of histone modification marks. Here we have performed a phylogenetic study of their putative reader modules, the C-terminal ePHD/ADD like domain, a novel nucleosome binding region and an AT-hook motif. Interactions studies in vitro and in yeast cells suggested that despite the extraordinary long loop region in their ePHD/ADD-like chromatin binding domains, the C-terminal region of both proteins seem to adopt a cross-braced topology of zinc finger interactions similar to other structurally determined ePHD/ADD structures. Both their ePHD/ADD-like domain and their novel nucleosome binding domain are highly conserved in vertebrate evolution, and construction of a phylogenetic tree displayed two well supported clusters representing SPBP and RAI1, respectively. Their genome and domain organisation suggest that SPBP and RAI1 have occurred from a gene duplication event. The phylogenetic tree suggests that this duplication has happened early in vertebrate evolution, since only one gene was identified in insects and lancelet. Finally, experimental data confirm that the conserved novel nucleosome binding region of RAI1 has the ability to bind the nucleosome core and histones. However, an adjacent conserved AT-hook motif as identified in SPBP is not present in RAI1, and deletion of the novel nucleosome binding region of RAI1 did not significantly affect its nuclear localisation.

  16. Statistical tests to compare motif count exceptionalities

    Directory of Open Access Journals (Sweden)

    Vandewalle Vincent

    2007-03-01

    Full Text Available Abstract Background Finding over- or under-represented motifs in biological sequences is now a common task in genomics. Thanks to p-value calculation for motif counts, exceptional motifs are identified and represent candidate functional motifs. The present work addresses the related question of comparing the exceptionality of one motif in two different sequences. Just comparing the motif count p-values in each sequence is indeed not sufficient to decide if this motif is significantly more exceptional in one sequence compared to the other one. A statistical test is required. Results We develop and analyze two statistical tests, an exact binomial one and an asymptotic likelihood ratio test, to decide whether the exceptionality of a given motif is equivalent or significantly different in two sequences of interest. For that purpose, motif occurrences are modeled by Poisson processes, with a special care for overlapping motifs. Both tests can take the sequence compositions into account. As an illustration, we compare the octamer exceptionalities in the Escherichia coli K-12 backbone versus variable strain-specific loops. Conclusion The exact binomial test is particularly adapted for small counts. For large counts, we advise to use the likelihood ratio test which is asymptotic but strongly correlated with the exact binomial test and very simple to use.

  17. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  18. Delimiting invasive Myriophyllum aquaticum in Kashmir Himalaya using a molecular phylogenetic approach.

    Science.gov (United States)

    Shah, M A; Ali, M A; Al-Hemaid, F M; Reshi, Z A

    2014-09-12

    Myriophyllum aquaticum (Vell.) Verdc. (family Haloragaceae) is one of the most invasive and destructive South American aquatic plant species and is present in a wide range of geographic regions, including the Kashmir Himalaya. Confusion regarding the taxonomic delimitation of M. aquaticum in the Himalayan region impedes effective and targeted management. Hence, our goal was improve the identification of M. aquaticum for exclusive delimitation from other related species in the study region using a molecular phylogenetic approach. A maximum parsimony tree recovered from phylogenetic analyses of the internal transcribed spacer sequences of nuclear ribosomal DNA was used to authenticate the identification of M. aquaticum. The results of this study can be used for targeted management of this tropical invader into the temperate Kashmir Himalaya.

  19. Identity and functions of CxxC-derived motifs.

    Science.gov (United States)

    Fomenko, Dmitri E; Gladyshev, Vadim N

    2003-09-30

    Two cysteines separated by two other residues (the CxxC motif) are employed by many redox proteins for formation, isomerization, and reduction of disulfide bonds and for other redox functions. The place of the C-terminal cysteine in this motif may be occupied by serine (the CxxS motif), modifying the functional repertoire of redox proteins. Here we found that the CxxC motif may also give rise to a motif, in which the C-terminal cysteine is replaced with threonine (the CxxT motif). Moreover, in contrast to a view that the N-terminal cysteine in the CxxC motif always serves as a nucleophilic attacking group, this residue could also be replaced with threonine (the TxxC motif), serine (the SxxC motif), or other residues. In each of these CxxC-derived motifs, the presence of a downstream alpha-helix was strongly favored. A search for conserved CxxC-derived motif/helix patterns in four complete genomes representing bacteria, archaea, and eukaryotes identified known redox proteins and suggested possible redox functions for several additional proteins. Catalytic sites in peroxiredoxins were major representatives of the TxxC motif, whereas those in glutathione peroxidases represented the CxxT motif. Structural assessments indicated that threonines in these enzymes could stabilize catalytic thiolates, suggesting revisions to previously proposed catalytic triads. Each of the CxxC-derived motifs was also observed in natural selenium-containing proteins, in which selenocysteine was present in place of a catalytic cysteine.

  20. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    2007-06-28

    Jun 28, 2007 ... Diabetes mellitus, commonly referred to as diabetes, is a medical condition associated with abnormally high levels of glucose (or sugar) in the blood. Keeping this view, we demonstrate the phylogenetic motifs (PMs) identification in type 2 diabetes mellitus very likely corresponding to protein functional sites.

  1. Motif decomposition of the phosphotyrosine proteome reveals a new N-terminal binding motif for SHIP2

    DEFF Research Database (Denmark)

    Miller, Martin Lee; Hanke, S.; Hinsby, A. M.

    2008-01-01

    set of 481 unique phosphotyrosine (Tyr(P)) peptides by sequence similarity to known ligands of the Src homology 2 (SH2) and the phosphotyrosine binding (PTB) domains. From 20 clusters we extracted 16 known and four new interaction motifs. Using quantitative mass spectrometry we pulled down Tyr......(P)-specific binding partners for peptides corresponding to the extracted motifs. We confirmed numerous previously known interaction motifs and found 15 new interactions mediated by phosphosites not previously known to bind SH2 or PTB. Remarkably, a novel hydrophobic N-terminal motif ((L/V/I)(L/V/I)pY) was identified...

  2. Hal: an automated pipeline for phylogenetic analyses of genomic data.

    Science.gov (United States)

    Robbertse, Barbara; Yoder, Ryan J; Boyd, Alex; Reeves, John; Spatafora, Joseph W

    2011-02-07

    The rapid increase in genomic and genome-scale data is resulting in unprecedented levels of discrete sequence data available for phylogenetic analyses. Major analytical impasses exist, however, prior to analyzing these data with existing phylogenetic software. Obstacles include the management of large data sets without standardized naming conventions, identification and filtering of orthologous clusters of proteins or genes, and the assembly of alignments of orthologous sequence data into individual and concatenated super alignments. Here we report the production of an automated pipeline, Hal that produces multiple alignments and trees from genomic data. These alignments can be produced by a choice of four alignment programs and analyzed by a variety of phylogenetic programs. In short, the Hal pipeline connects the programs BLASTP, MCL, user specified alignment programs, GBlocks, ProtTest and user specified phylogenetic programs to produce species trees. The script is available at sourceforge (http://sourceforge.net/projects/bio-hal/). The results from an example analysis of Kingdom Fungi are briefly discussed.

  3. [Personal motif in art].

    Science.gov (United States)

    Gerevich, József

    2015-01-01

    One of the basic questions of the art psychology is whether a personal motif is to be found behind works of art and if so, how openly or indirectly it appears in the work itself. Analysis of examples and documents from the fine arts and literature allow us to conclude that the personal motif that can be identified by the viewer through symbols, at times easily at others with more difficulty, gives an emotional plus to the artistic product. The personal motif may be found in traumatic experiences, in communication to the model or with other emotionally important persons (mourning, disappointment, revenge, hatred, rivalry, revolt etc.), in self-searching, or self-analysis. The emotions are expressed in artistic activity either directly or indirectly. The intention nourished by the artist's identity (Kunstwollen) may stand in the way of spontaneous self-expression, channelling it into hidden paths. Under the influence of certain circumstances, the artist may arouse in the viewer, consciously or unconsciously, an illusionary, misleading image of himself. An examination of the personal motif is one of the important research areas of art therapy.

  4. Temporal motifs in time-dependent networks

    International Nuclear Information System (INIS)

    Kovanen, Lauri; Karsai, Márton; Kaski, Kimmo; Kertész, János; Saramäki, Jari

    2011-01-01

    Temporal networks are commonly used to represent systems where connections between elements are active only for restricted periods of time, such as telecommunication, neural signal processing, biochemical reaction and human social interaction networks. We introduce the framework of temporal motifs to study the mesoscale topological–temporal structure of temporal networks in which the events of nodes do not overlap in time. Temporal motifs are classes of similar event sequences, where the similarity refers not only to topology but also to the temporal order of the events. We provide a mapping from event sequences to coloured directed graphs that enables an efficient algorithm for identifying temporal motifs. We discuss some aspects of temporal motifs, including causality and null models, and present basic statistics of temporal motifs in a large mobile call network

  5. Comparative genomics of metabolic capacities of regulons controlled by cis-regulatory RNA motifs in bacteria.

    Science.gov (United States)

    Sun, Eric I; Leyn, Semen A; Kazanov, Marat D; Saier, Milton H; Novichkov, Pavel S; Rodionov, Dmitry A

    2013-09-02

    In silico comparative genomics approaches have been efficiently used for functional prediction and reconstruction of metabolic and regulatory networks. Riboswitches are metabolite-sensing structures often found in bacterial mRNA leaders controlling gene expression on transcriptional or translational levels.An increasing number of riboswitches and other cis-regulatory RNAs have been recently classified into numerous RNA families in the Rfam database. High conservation of these RNA motifs provides a unique advantage for their genomic identification and comparative analysis. A comparative genomics approach implemented in the RegPredict tool was used for reconstruction and functional annotation of regulons controlled by RNAs from 43 Rfam families in diverse taxonomic groups of Bacteria. The inferred regulons include ~5200 cis-regulatory RNAs and more than 12000 target genes in 255 microbial genomes. All predicted RNA-regulated genes were classified into specific and overall functional categories. Analysis of taxonomic distribution of these categories allowed us to establish major functional preferences for each analyzed cis-regulatory RNA motif family. Overall, most RNA motif regulons showed predictable functional content in accordance with their experimentally established effector ligands. Our results suggest that some RNA motifs (including thiamin pyrophosphate and cobalamin riboswitches that control the cofactor metabolism) are widespread and likely originated from the last common ancestor of all bacteria. However, many more analyzed RNA motifs are restricted to a narrow taxonomic group of bacteria and likely represent more recent evolutionary innovations. The reconstructed regulatory networks for major known RNA motifs substantially expand the existing knowledge of transcriptional regulation in bacteria. The inferred regulons can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. The obtained genome

  6. Motif enrichment tool.

    Science.gov (United States)

    Blatti, Charles; Sinha, Saurabh

    2014-07-01

    The Motif Enrichment Tool (MET) provides an online interface that enables users to find major transcriptional regulators of their gene sets of interest. MET searches the appropriate regulatory region around each gene and identifies which transcription factor DNA-binding specificities (motifs) are statistically overrepresented. Motif enrichment analysis is currently available for many metazoan species including human, mouse, fruit fly, planaria and flowering plants. MET also leverages high-throughput experimental data such as ChIP-seq and DNase-seq from ENCODE and ModENCODE to identify the regulatory targets of a transcription factor with greater precision. The results from MET are produced in real time and are linked to a genome browser for easy follow-up analysis. Use of the web tool is free and open to all, and there is no login requirement. ADDRESS: http://veda.cs.uiuc.edu/MET/. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Identification, occurrence, and validation of DRE and ABRE Cis-regulatory motifs in the promoter regions of genes of Arabidopsis thaliana.

    Science.gov (United States)

    Mishra, Sonal; Shukla, Aparna; Upadhyay, Swati; Sanchita; Sharma, Pooja; Singh, Seema; Phukan, Ujjal J; Meena, Abha; Khan, Feroz; Tripathi, Vineeta; Shukla, Rakesh Kumar; Shrama, Ashok

    2014-04-01

    Plants posses a complex co-regulatory network which helps them to elicit a response under diverse adverse conditions. We used an in silico approach to identify the genes with both DRE and ABRE motifs in their promoter regions in Arabidopsis thaliana. Our results showed that Arabidopsis contains a set of 2,052 genes with ABRE and DRE motifs in their promoter regions. Approximately 72% or more of the total predicted 2,052 genes had a gap distance of less than 400 bp between DRE and ABRE motifs. For positional orientation of the DRE and ABRE motifs, we found that the DR form (one in direct and the other one in reverse orientation) was more prevalent than other forms. These predicted 2,052 genes include 155 transcription factors. Using microarray data from The Arabidopsis Information Resource (TAIR) database, we present 44 transcription factors out of 155 which are upregulated by more than twofold in response to osmotic stress and ABA treatment. Fifty-one transcripts from the one predicted above were validated using semiquantitative expression analysis to support the microarray data in TAIR. Taken together, we report a set of genes containing both DRE and ABRE motifs in their promoter regions in A. thaliana, which can be useful to understand the role of ABA under osmotic stress condition. © 2013 Institute of Botany, Chinese Academy of Sciences.

  8. An effective approach for annotation of protein families with low sequence similarity and conserved motifs: identifying GDSL hydrolases across the plant kingdom.

    Science.gov (United States)

    Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica

    2016-02-18

    The massive accumulation of protein sequences arising from the rapid development of high-throughput sequencing, coupled with automatic annotation, results in high levels of incorrect annotations. In this study, we describe an approach to decrease annotation errors of protein families characterized by low overall sequence similarity. The GDSL lipolytic family comprises proteins with multifunctional properties and high potential for pharmaceutical and industrial applications. The number of proteins assigned to this family has increased rapidly over the last few years. In particular, the natural abundance of GDSL enzymes reported recently in plants indicates that they could be a good source of novel GDSL enzymes. We noticed that a significant proportion of annotated sequences lack specific GDSL motif(s) or catalytic residue(s). Here, we applied motif-based sequence analyses to identify enzymes possessing conserved GDSL motifs in selected proteomes across the plant kingdom. Motif-based HMM scanning (Viterbi decoding-VD and posterior decoding-PD) and the here described PD/VD protocol were successfully applied on 12 selected plant proteomes to identify sequences with GDSL motifs. A significant number of identified GDSL sequences were novel. Moreover, our scanning approach successfully detected protein sequences lacking at least one of the essential motifs (171/820) annotated by Pfam profile search (PfamA) as GDSL. Based on these analyses we provide a curated list of GDSL enzymes from the selected plants. CLANS clustering and phylogenetic analysis helped us to gain a better insight into the evolutionary relationship of all identified GDSL sequences. Three novel GDSL subfamilies as well as unreported variations in GDSL motifs were discovered in this study. In addition, analyses of selected proteomes showed a remarkable expansion of GDSL enzymes in the lycophyte, Selaginella moellendorffii. Finally, we provide a general motif-HMM scanner which is easily accessible through

  9. KIRMES: kernel-based identification of regulatory modules in euchromatic sequences.

    Science.gov (United States)

    Schultheiss, Sebastian J; Busch, Wolfgang; Lohmann, Jan U; Kohlbacher, Oliver; Rätsch, Gunnar

    2009-08-15

    Understanding transcriptional regulation is one of the main challenges in computational biology. An important problem is the identification of transcription factor (TF) binding sites in promoter regions of potential TF target genes. It is typically approached by position weight matrix-based motif identification algorithms using Gibbs sampling, or heuristics to extend seed oligos. Such algorithms succeed in identifying single, relatively well-conserved binding sites, but tend to fail when it comes to the identification of combinations of several degenerate binding sites, as those often found in cis-regulatory modules. We propose a new algorithm that combines the benefits of existing motif finding with the ones of support vector machines (SVMs) to find degenerate motifs in order to improve the modeling of regulatory modules. In experiments on microarray data from Arabidopsis thaliana, we were able to show that the newly developed strategy significantly improves the recognition of TF targets. The python source code (open source-licensed under GPL), the data for the experiments and a Galaxy-based web service are available at http://www.fml.mpg.de/raetsch/suppl/kirmes/.

  10. Data set for phylogenetic tree and RAMPAGE Ramachandran plot analysis of SODs in Gossypium raimondii and G. arboreum.

    Science.gov (United States)

    Wang, Wei; Xia, Minxuan; Chen, Jie; Deng, Fenni; Yuan, Rui; Zhang, Xiaopei; Shen, Fafu

    2016-12-01

    The data presented in this paper is supporting the research article "Genome-Wide Analysis of Superoxide Dismutase Gene Family in Gossypium raimondii and G. arboreum" [1]. In this data article, we present phylogenetic tree showing dichotomy with two different clusters of SODs inferred by the Bayesian method of MrBayes (version 3.2.4), "Bayesian phylogenetic inference under mixed models" [2], Ramachandran plots of G. raimondii and G. arboreum SODs, the protein sequence used to generate 3D sructure of proteins and the template accession via SWISS-MODEL server, "SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information." [3] and motif sequences of SODs identified by InterProScan (version 4.8) with the Pfam database, "Pfam: the protein families database" [4].

  11. Motif-Independent De Novo Detection of Secondary Metabolite Gene Clusters – Towards Identification of Novel Secondary Metabolisms from Filamentous Fungi -

    Directory of Open Access Journals (Sweden)

    Myco eUmemura

    2015-05-01

    Full Text Available Secondary metabolites are produced mostly by clustered genes that are essential to their biosynthesis. The transcriptional expression of these genes is often cooperatively regulated by a transcription factor located inside or close to a cluster. Most of the secondary metabolism biosynthesis (SMB gene clusters identified to date contain so-called core genes with distinctive sequence features, such as polyketide synthase (PKS and non-ribosomal peptide synthetase (NRPS. Recent efforts in sequencing fungal genomes have revealed far more SMB gene clusters than expected based on the number of core genes in the genomes. Several bioinformatics tools have been developed to survey SMB gene clusters using the sequence motif information of the core genes, including SMURF and antiSMASH.More recently, accompanied by the development of sequencing techniques allowing to obtain large-scale genomic and transcriptomic data, motif-independent prediction methods of SMB gene clusters, including MIDDAS-M, have been developed. Most these methods detect the clusters in which the genes are cooperatively regulated at transcriptional levels, thus allowing the identification of novel SMB gene clusters regardless of the presence of the core genes. Another type of the method, MIPS-CG, uses the characteristics of SMB genes, which are highly enriched in non-syntenic blocks (NSBs, enabling the prediction even without transcriptome data although the results have not been evaluated in detail. Considering that large portion of SMB gene clusters might be sufficiently expressed only in limited uncommon conditions, it seems that prediction of SMB gene clusters by bioinformatics and successive experimental validation is an only way to efficiently uncover hidden SMB gene clusters. Here, we describe and discuss possible novel approaches for the determination of SMB gene clusters that have not been identified using conventional methods.

  12. Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

    Science.gov (United States)

    Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo

    2013-01-01

    The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

  13. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  14. Identification and phylogenetic inferences on stocks of sharks affected by the fishing industry off the Northern coast of Brazil

    Directory of Open Access Journals (Sweden)

    Luis Fernando da Silva Rodrigues-Filho

    2009-01-01

    Full Text Available The ongoing decline in abundance and diversity of shark stocks, primarily due to uncontrolled fishery exploitation, is a worldwide problem. An additional problem for the development of conservation and management programmes is the identification of species diversity within a given area, given the morphological similarities among shark species, and the typical disembarkation of processed carcasses which are almost impossible to differentiate. The main aim of the present study was to identify those shark species being exploited off northern Brazil, by using the 12S-16S molecular marker. For this, DNA sequences were obtained from 122 specimens collected on the docks and the fish market in Bragança, in the Brazilian state of Pará. We identified at least 11 species. Three-quarters of the specimens collected were either Carcharhinus porosus or Rhizoprionodon sp, while a notable absence was the daggernose shark, Isogomphodon oxyrhyncus, previously one of the most common species in local catches. The study emphasises the value of molecular techniques for the identification of cryptic shark species, and the potential of the 12S-16S marker as a tool for phylogenetic inferences in a study of elasmobranchs.

  15. Phylogenetic distribution of plant snoRNA families

    DEFF Research Database (Denmark)

    Patra Bhattacharya, Deblina; Canzler, Sebastian; Kehr, Stephanie

    2016-01-01

    RNAs and box H/ACA snoRNAs, which are clearly distinguished by conserved sequence motifs and the type of chemical modification that they govern. Similarly to microRNAs, snoRNAs appear in distinct families of homologs that affect homologous targets. In animals, snoRNAs and their evolution have been studied...... in much detail. In plants, however, their evolution has attracted comparably little attention. RESULTS: In order to chart the phylogenetic distribution of individual snoRNA families in plants, we applied a sophisticated approach for identifying homologs of known plant snoRNAs across the plant kingdom....... In response to the relatively fast evolution of snoRNAs, information on conserved sequence boxes, target sequences, and secondary structure is combined to identify additional snoRNAs. We identified 296 families of snoRNAs in 24 species and traced their evolution throughout the plant kingdom. Many of the plant...

  16. UKIRAN KERAWANG ACEH GAYO SEBAGAI INSPIRASI PENCIPTAAN MOTIF BATIK KHAS GAYO

    Directory of Open Access Journals (Sweden)

    Irfa ina Rohana Salma

    2016-12-01

    Full Text Available ABSTRAK Industri batik mulai berkembang di Gayo, tetapi belum memiliki motif batik khas daerah. Oleh karena itu perlu diciptakan motif batik khas Gayo, dengan mengambil inspirasi dari ukiran yang terdapat pada rumah tradisional yang biasa disebut ukiran kerawang Gayo. Tujuan penciptaan seni ini adalah untuk menciptakan motif batik yang memiliki ciri khas Gayo. Metode yang digunakan yaitu eksplorasi ide, perancangan, dan perwujudan menjadi motif batik. Dalam kegiatan ini telah diciptakan enam motif batik khas Gayo yaitu: (1 Motif Ceplok Gayo; (2 Motif Gayo Tegak; (3 Motif Gayo Lurus; (4 Motif Parang Gayo; (5 Motif Gayo Lembut; dan (6 Motif Geometris Gayo. Hasil uji kesukaan terhadap motif kepada lima puluh responden menunjukkan bahwa Motif Ceplok Gayo paling banyak dipilih oleh responden yaitu sebesar 19%, sedangkan Motif Parang Gayo 18%, Motif Gayo Lembut 17%, Motif Geometris Gayo 17%, Motif Gayo Lurus 15% dan Motif Gayo Tegak 14%. Rata-rata motif yang dihasilkan mendapatkan apresiasi yang baik dari responden, sehingga semua motif layak diproduksi sebagai batik khas Gayo.Kata kunci: batik Gayo, Motif Ceplok Gayo, Motif Parang Gayo.ABSTRACTBatik industry began to develop in Gayo, but have not had a typical batik motif itself. Therefore, it is necessary to create batik motifs of Gayo, by taking inspiration from the carvings found in traditional houses commonly called kerawang Gayo. The purpose of this art is to create motifs those have a Gayo characteristic. The method used are the idea exploration, design, and motifs embodiment. In this activity has created six Gayo batik motifs, namely: (1 Motif Ceplok Gayo; (2 Motif Gayo Tegak; (3 Motif GayoLurus; (4 Motif Parang Gayo; (5 Motif Gayo Lembut; dan (6 Motif Geometris Gayo. The test results fondness of the motives to fifty respondents indicated that the Motif Ceplok Gayo most preferred by respondents ie 19%, while Motif Parang Gayo 18%, Motif Gayo Lembut 17%, Motif Geometris Gayo 17%, Motif Gayo

  17. Identification and characterization of a selenoprotein family containing a diselenide bond in a redox motif

    Science.gov (United States)

    Shchedrina, Valentina A.; Novoselov, Sergey V.; Malinouski, Mikalai Yu.; Gladyshev, Vadim N.

    2007-01-01

    Selenocysteine (Sec, U) insertion into proteins is directed by translational recoding of specific UGA codons located upstream of a stem-loop structure known as Sec insertion sequence (SECIS) element. Selenoproteins with known functions are oxidoreductases containing a single redox-active Sec in their active sites. In this work, we identified a family of selenoproteins, designated SelL, containing two Sec separated by two other residues to form a UxxU motif. SelL proteins show an unusual occurrence, being present in diverse aquatic organisms, including fish, invertebrates, and marine bacteria. Both eukaryotic and bacterial SelL genes use single SECIS elements for insertion of two Sec. In eukaryotes, the SECIS is located in the 3′ UTR, whereas the bacterial SelL SECIS is within a coding region and positioned at a distance that supports the insertion of either of the two Sec or both of these residues. SelL proteins possess a thioredoxin-like fold wherein the UxxU motif corresponds to the catalytic CxxC motif in thioredoxins, suggesting a redox function of SelL proteins. Distantly related SelL-like proteins were also identified in a variety of organisms that had either one or both Sec replaced with Cys. Danio rerio SelL, transiently expressed in mammalian cells, incorporated two Sec and localized to the cytosol. In these cells, it occurred in an oxidized form and was not reducible by DTT. In a bacterial expression system, we directly demonstrated the formation of a diselenide bond between the two Sec, establishing it as the first diselenide bond found in a natural protein. PMID:17715293

  18. Identification of Phylogenetic Position in the Chlamydiaceae Family for Chlamydia Strains Released from Monkeys and Humans with Chlamydial Pathology

    Directory of Open Access Journals (Sweden)

    Alexander Karaulov

    2010-01-01

    Full Text Available Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S–23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S–23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration

  19. Large-scale discovery of promoter motifs in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Thomas A Down

    2007-01-01

    Full Text Available A key step in understanding gene regulation is to identify the repertoire of transcription factor binding motifs (TFBMs that form the building blocks of promoters and other regulatory elements. Identifying these experimentally is very laborious, and the number of TFBMs discovered remains relatively small, especially when compared with the hundreds of transcription factor genes predicted in metazoan genomes. We have used a recently developed statistical motif discovery approach, NestedMICA, to detect candidate TFBMs from a large set of Drosophila melanogaster promoter regions. Of the 120 motifs inferred in our initial analysis, 25 were statistically significant matches to previously reported motifs, while 87 appeared to be novel. Analysis of sequence conservation and motif positioning suggested that the great majority of these discovered motifs are predictive of functional elements in the genome. Many motifs showed associations with specific patterns of gene expression in the D. melanogaster embryo, and we were able to obtain confident annotation of expression patterns for 25 of our motifs, including eight of the novel motifs. The motifs are available through Tiffin, a new database of DNA sequence motifs. We have discovered many new motifs that are overrepresented in D. melanogaster promoter regions, and offer several independent lines of evidence that these are novel TFBMs. Our motif dictionary provides a solid foundation for further investigation of regulatory elements in Drosophila, and demonstrates techniques that should be applicable in other species. We suggest that further improvements in computational motif discovery should narrow the gap between the set of known motifs and the total number of transcription factors in metazoan genomes.

  20. MHC motif viewer

    DEFF Research Database (Denmark)

    Rapin, Nicolas Philippe Jean-Pierre; Hoof, Ilka; Lund, Ole

    2008-01-01

    . Algorithms that predict which peptides MHC molecules bind have recently been developed and cover many different alleles, but the utility of these algorithms is hampered by the lack of tools for browsing and comparing the specificity of these molecules. We have, therefore, developed a web server, MHC motif....... A special viewing feature, MHC fight, allows for display of the specificity of two different MHC molecules side by side. We show how the web server can be used to discover and display surprising similarities as well as differences between MHC molecules within and between different species. The MHC motif...

  1. TreeScaper: Visualizing and Extracting Phylogenetic Signal from Sets of Trees.

    Science.gov (United States)

    Huang, Wen; Zhou, Guifang; Marchand, Melissa; Ash, Jeremy R; Morris, David; Van Dooren, Paul; Brown, Jeremy M; Gallivan, Kyle A; Wilgenbusch, Jim C

    2016-12-01

    Modern phylogenomic analyses often result in large collections of phylogenetic trees representing uncertainty in individual gene trees, variation across genes, or both. Extracting phylogenetic signal from these tree sets can be challenging, as they are difficult to visualize, explore, and quantify. To overcome some of these challenges, we have developed TreeScaper, an application for tree set visualization as well as the identification of distinct phylogenetic signals. GUI and command-line versions of TreeScaper and a manual with tutorials can be downloaded from https://github.com/whuang08/TreeScaper/releases TreeScaper is distributed under the GNU General Public License. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Motif discovery in ranked lists of sequences

    DEFF Research Database (Denmark)

    Nielsen, Morten Muhlig; Tataru, Paula; Madsen, Tobias

    2016-01-01

    Motif analysis has long been an important method to characterize biological functionality and the current growth of sequencing-based genomics experiments further extends its potential. These diverse experiments often generate sequence lists ranked by some functional property. There is therefore...... advantage of the regular expression feature, including enrichments for combinations of different microRNA seed sites. The method is implemented and made publicly available as an R package and supports high parallelization on multi-core machinery....... a growing need for motif analysis methods that can exploit this coupled data structure and be tailored for specific biological questions. Here, we present an exploratory motif analysis tool, Regmex (REGular expression Motif EXplorer), which offers several methods to evaluate the correlation of motifs...

  3. Genome-wide targeted prediction of ABA responsive genes in rice based on over-represented cis-motif in co-expressed genes.

    Science.gov (United States)

    Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C

    2009-02-01

    Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.

  4. Deciphering functional glycosaminoglycan motifs in development.

    Science.gov (United States)

    Townley, Robert A; Bülow, Hannes E

    2018-03-23

    Glycosaminoglycans (GAGs) such as heparan sulfate, chondroitin/dermatan sulfate, and keratan sulfate are linear glycans, which when attached to protein backbones form proteoglycans. GAGs are essential components of the extracellular space in metazoans. Extensive modifications of the glycans such as sulfation, deacetylation and epimerization create structural GAG motifs. These motifs regulate protein-protein interactions and are thereby repsonsible for many of the essential functions of GAGs. This review focusses on recent genetic approaches to characterize GAG motifs and their function in defined signaling pathways during development. We discuss a coding approach for GAGs that would enable computational analyses of GAG sequences such as alignments and the computation of position weight matrices to describe GAG motifs. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Fitness for synchronization of network motifs

    DEFF Research Database (Denmark)

    Vega, Y.M.; Vázquez-Prada, M.; Pacheco, A.F.

    2004-01-01

    We study the synchronization of Kuramoto's oscillators in small parts of networks known as motifs. We first report on the system dynamics for the case of a scale-free network and show the existence of a non-trivial critical point. We compute the probability that network motifs synchronize, and fi...... that the fitness for synchronization correlates well with motifs interconnectedness and structural complexity. Possible implications for present debates about network evolution in biological and other systems are discussed....

  6. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  7. Aplikasi Ornamen Khas Maluku untuk Pengembangan Desain Motif Batik

    Directory of Open Access Journals (Sweden)

    Masiswo Masiswo

    2016-04-01

    Full Text Available ABSTRAKMaluku memiliki banyak ragam hias budaya warisan nilai leluhur berupa ornamen etnis yang merupakan kesenian dan keterampilan kerajinan. Hasil warisan tersebut sampai saat ini masih lestari hidup serta dapat dinikmati sebagai konsumsi rohani yang memuaskan manusia. Berkaitan dengan keberlangsungan nilai-nilai tradisi etnis yang berwujud pada ornamen-ornamen daerah Maluku, maka dikembangkan untuk kebutuhan manusia berupa motif batik pada kain. Pengembangan ornamen ini lebih menekankan pada representasi akan bentuk-bentuk ornamen yang diterapkan pada kerajinan batik berupa motif khas Maluku. Pengembangan alternatif desain motif batik dibuat tiga variasi yang bersumber dari ornamen khas Maluku dibuat prototipe produknya dan diuji ketahanan luntur warnanya. Hasil uji ketahanan luntur warna terhadap gosokan basah dari tiga prototipe produk berpredikat baik sekali terdapat pada “Motif Siwa” dan predikat baik pada motif “Siwa Talang” dan motif “Matahari Siwa Talang”.Kata kunci: desain, Maluku, motif batik, ornamenABSTRACTMaluku has much decorative ancestral cultural heritage value in the form of ornament ethnic arts and crafts skills. The result of the legacy is still sustainable living can be enjoyed as well as satisfying spiritual human consumption.Related to the sustainability of traditional values in the form of ethnic ornaments Maluku, it was developed for human needs in the form of batik cloth . The development of these ornaments will be more emphasis on the representation forms of ornamentation that is applied to a batik motif Maluku. Development of alternative design motif made three variations. The development of three alternative design motifs derived from the Maluku ornaments made and tested a prototype product color fastness. The test results of color fastness to wet rubbing of the three prototypes are excellent products predicated on the "Motif Siwa" and a good rating on the motif "Siwa Talang" and motif "Matahari Siwa

  8. The limits of de novo DNA motif discovery.

    Directory of Open Access Journals (Sweden)

    David Simcha

    Full Text Available A major challenge in molecular biology is reverse-engineering the cis-regulatory logic that plays a major role in the control of gene expression. This program includes searching through DNA sequences to identify "motifs" that serve as the binding sites for transcription factors or, more generally, are predictive of gene expression across cellular conditions. Several approaches have been proposed for de novo motif discovery-searching sequences without prior knowledge of binding sites or nucleotide patterns. However, unbiased validation is not straightforward. We consider two approaches to unbiased validation of discovered motifs: testing the statistical significance of a motif using a DNA "background" sequence model to represent the null hypothesis and measuring performance in predicting membership in gene clusters. We demonstrate that the background models typically used are "too null," resulting in overly optimistic assessments of significance, and argue that performance in predicting TF binding or expression patterns from DNA motifs should be assessed by held-out data, as in predictive learning. Applying this criterion to common motif discovery methods resulted in universally poor performance, although there is a marked improvement when motifs are statistically significant against real background sequences. Moreover, on synthetic data where "ground truth" is known, discriminative performance of all algorithms is far below the theoretical upper bound, with pronounced "over-fitting" in training. A key conclusion from this work is that the failure of de novo discovery approaches to accurately identify motifs is basically due to statistical intractability resulting from the fixed size of co-regulated gene clusters, and thus such failures do not necessarily provide evidence that unfound motifs are not active biologically. Consequently, the use of prior knowledge to enhance motif discovery is not just advantageous but necessary. An implementation of

  9. Parole, Sintagmatik, dan Paradigmatik Motif Batik Mega Mendung

    Directory of Open Access Journals (Sweden)

    Rudi - Nababan

    2012-04-01

    Full Text Available ABSTRACT   Discussing traditional batik is related a lot to the organization system of fine arts element ac- companying it, either the pattern of the motif or the technique of the making. In this case, the motif of Mega Mendung Cirebon certainly has patterns and rules which are traditionally different from the other motifs in other areas. Through  semiotics analysis especially with Saussure and Pierce concept, it can be traced that batik with Cirebon motif, in this case Mega Mendung motif, has parole and langue system, as unique fine arts language in batik, and structure of visual syntagmatic and paradigmatic. In the context of batik motif as fine arts language, it is surely related to sign system as symbol and icon.       Keywords: visual semiotic, Cirebon’s batik.

  10. Phylogenetic reconstruction in the order Nymphaeales: ITS2 secondary structure analysis and in silico testing of maturase k (matK) as a potential marker for DNA bar coding.

    Science.gov (United States)

    Biswal, Devendra Kumar; Debnath, Manish; Kumar, Shakti; Tandon, Pramod

    2012-01-01

    The Nymphaeales (waterlilly and relatives) lineage has diverged as the second branch of basal angiosperms and comprises of two families: Cabombaceae and Nymphaceae. The classification of Nymphaeales and phylogeny within the flowering plants are quite intriguing as several systems (Thorne system, Dahlgren system, Cronquist system, Takhtajan system and APG III system (Angiosperm Phylogeny Group III system) have attempted to redefine the Nymphaeales taxonomy. There have been also fossil records consisting especially of seeds, pollen, stems, leaves and flowers as early as the lower Cretaceous. Here we present an in silico study of the order Nymphaeales taking maturaseK (matK) and internal transcribed spacer (ITS2) as biomarkers for phylogeny reconstruction (using character-based methods and Bayesian approach) and identification of motifs for DNA barcoding. The Maximum Likelihood (ML) and Bayesian approach yielded congruent fully resolved and well-supported trees using a concatenated (ITS2+ matK) supermatrix aligned dataset. The taxon sampling corroborates the monophyly of Cabombaceae. Nuphar emerges as a monophyletic clade in the family Nymphaeaceae while there are slight discrepancies in the monophyletic nature of the genera Nymphaea owing to Victoria-Euryale and Ondinea grouping in the same node of Nymphaeaceae. ITS2 secondary structures alignment corroborate the primary sequence analysis. Hydatellaceae emerged as a sister clade to Nymphaeaceae and had a basal lineage amongst the water lilly clades. Species from Cycas and Ginkgo were taken as outgroups and were rooted in the overall tree topology from various methods. MatK genes are fast evolving highly variant regions of plant chloroplast DNA that can serve as potential biomarkers for DNA barcoding and also in generating primers for angiosperms with identification of unique motif regions. We have reported unique genus specific motif regions in the Order Nymphaeles from matK dataset which can be further validated for

  11. Divergent Synthesis of Chondroitin Sulfate Disaccharides and Identification of Sulfate Motifs that Inhibit Triple Negative Breast Cancer

    Science.gov (United States)

    Wei Poh, Zhong; Heng Gan, Chin; Lee, Eric J.; Guo, Suxian; Yip, George W.; Lam, Yulin

    2015-09-01

    Glycosaminoglycans (GAGs) regulate many important physiological processes. A pertinent issue to address is whether GAGs encode important functional information via introduction of position specific sulfate groups in the GAG structure. However, procurement of pure, homogenous GAG motifs to probe the “sulfation code” is a challenging task due to isolation difficulty and structural complexity. To this end, we devised a versatile synthetic strategy to obtain all the 16 theoretically possible sulfation patterns in the chondroitin sulfate (CS) repeating unit; these include rare but potentially important sulfated motifs which have not been isolated earlier. Biological evaluation indicated that CS sulfation patterns had differing effects for different breast cancer cell types, and the greatest inhibitory effect was observed for the most aggressive, triple negative breast cancer cell line MDA-MB-231.

  12. Motif statistics and spike correlations in neuronal networks

    International Nuclear Information System (INIS)

    Hu, Yu; Shea-Brown, Eric; Trousdale, James; Josić, Krešimir

    2013-01-01

    Motifs are patterns of subgraphs of complex networks. We studied the impact of such patterns of connectivity on the level of correlated, or synchronized, spiking activity among pairs of cells in a recurrent network of integrate and fire neurons. For a range of network architectures, we find that the pairwise correlation coefficients, averaged across the network, can be closely approximated using only three statistics of network connectivity. These are the overall network connection probability and the frequencies of two second order motifs: diverging motifs, in which one cell provides input to two others, and chain motifs, in which two cells are connected via a third intermediary cell. Specifically, the prevalence of diverging and chain motifs tends to increase correlation. Our method is based on linear response theory, which enables us to express spiking statistics using linear algebra, and a resumming technique, which extrapolates from second order motifs to predict the overall effect of coupling on network correlation. Our motif-based results seek to isolate the effect of network architecture perturbatively from a known network state. (paper)

  13. Bayesian centroid estimation for motif discovery.

    Science.gov (United States)

    Carvalho, Luis

    2013-01-01

    Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.

  14. Bayesian centroid estimation for motif discovery.

    Directory of Open Access Journals (Sweden)

    Luis Carvalho

    Full Text Available Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.

  15. Genome-wide analysis of SINA family in plants and their phylogenetic relationships.

    Science.gov (United States)

    Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying

    2008-06-01

    SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.

  16. Identification of a vertically transmitted strain from Anaplasma marginale (UFMG3): Molecular and phylogenetic characterization, and evaluation of virulence.

    Science.gov (United States)

    Silvestre, Bruna T; Silveira, Júlia A G; Meneses, Rodrigo M; Facury-Filho, Elias J; Carvalho, Antônio U; Ribeiro, Múcio F B

    2016-02-01

    Bovine anaplasmosis is a disease caused by the intraerythrocytic rickettsia species Anaplasma marginale and results in great economic losses in tropical and subtropical regions. Vertical transmission is an important phenomenon that contributes to the persistence of different strains of the agent within the same herd. The identification of new strains and genetic characterization studies are essential to understanding their epidemiology and virulence and for vaccine development. The aim of this study was to perform molecular and phylogenetic characterizations of a new vertically transmitted strain from A. marginale and to evaluate its virulence by experimental inoculation of rickettsia-free calves. Thirty newborn Holstein calves were subjected to molecular tests for the detection of A. marginale, Babesia bovis and Babesia bigemina. Calves positive for A. marginale (n=3) were splenectomized and monitored for the clinical manifestations of anaplasmosis. Blood samples from one of the calves that presented rickettsemia of 42.8% and spontaneous recovery of clinical parameters were used for molecular and phylogenetic characterization (msp1a gene), and inoculum production was used for the evaluation of virulence. This strain was identified as UFMG3. Three tandem repeat forms (13 and MGI19) were identified from the analysis of the msp1a gene, in which the form MGI19 appeared twice. Analysis of these repeats revealed the presence of the sequences QASTSS and SSASGQQQESS and of aspartic acid (D) at position 20 of both repeats. Phylogenetic analysis showed a close relationship among the UFMG3, MGI19 and UFMG2 strains. For virulence evaluation, six Holstein calves were inoculated intravenously with 2×10(7)A. marginale UFMG3-infected erythrocytes. The calves showed maximum rickettsemia of 5.1%, a moderate decrease in packed cell volume and spontaneous recovery of clinical parameters without the need for treatment. The results of experimental inoculation suggest that the strain A

  17. A systematic identification of Kolobok superfamily transposons in Trichomonas vaginalis and sequence analysis on related transposases

    Institute of Scientific and Technical Information of China (English)

    Qingshu Meng; Kaifu Chen; Lina Ma; Songnian Hu; Jun Yu

    2011-01-01

    Transposons are sequence elements widely distributed among genomes of all three kingdoms of life, providing genomic changes and playing significant roles in genome evolution. Trichomonas vaginalis is an excellent model system for transposon study since its genome ( ~ 160 Mb) has been sequenced and is composed of ~65% transposons and other repetitive elements. In this study, we primarily report the identification of Kolobok-type transposons (termed tvBac) in T. vaginalis and the results of transposase sequence analysis. We categorized 24 novel subfamilies of the Kolobok element, including one autonomous subfamily and 23 non-autonomous subfamilies. We also identified a novel H2CH motif in tvBac transposases based on multiple sequence alignment. In addition, we supposed that tvBac and Mutator transposons may have evolved independently from a common ancestor according to our phylogenetic analysis. Our results provide basic information for the understanding of the function and evolution of tvBac transposons in particular and other related transposon families in general.

  18. AMP-acetyl CoA synthetase from Leishmania donovani: identification and functional analysis of 'PX4GK' motif.

    Science.gov (United States)

    Soumya, Neelagiri; Kumar, I Sravan; Shivaprasad, S; Gorakh, Landage Nitin; Dinesh, Neeradi; Swamy, Kayala Kambagiri; Singh, Sushma

    2015-04-01

    An adenosine monophosphate forming acetyl CoA synthetase (AceCS) which is the key enzyme involved in the conversion of acetate to acetyl CoA has been identified from Leishmania donovani for the first time. Sequence analysis of L. donovani AceCS (LdAceCS) revealed the presence of a 'PX4GK' motif which is highly conserved throughout organisms with higher sequence identity (96%) to lower sequence identity (38%). A ∼ 77 kDa heterologous protein with C-terminal 6X His-tag was expressed in Escherichia coli. Expression of LdAceCS in promastigotes was confirmed by western blot and RT-PCR analysis. Immunolocalization studies revealed that it is a cytosolic protein. We also report the kinetic characterization of recombinant LdAceCS with acetate, adenosine 5'-triphosphate, coenzyme A and propionate as substrates. Site directed mutagenesis of residues in conserved PX4GK motif of LdAceCS was performed to gain insight into its potential role in substrate binding, catalysis and its role in maintaining structural integrity of the protein. P646A, G651A and K652R exhibited more than 90% loss in activity signifying its indispensible role in the enzyme activity. Substitution of other residues in this motif resulted in altered substrate specificity and catalysis. However, none of them had any role in modulation of the secondary structure of the protein except G651A mutant. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Orthology prediction at scalable resolution by phylogenetic tree analysis

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2007-03-01

    Full Text Available Abstract Background Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic relations results in inparalogs and outparalogs. For situations with more than two species we lack semantics to specifically describe the phylogenetic relations, let alone to exploit them. Published procedures to extract orthologous groups from phylogenetic trees do not allow identification of orthology at various levels of resolution, nor do they document the relations between the orthologous groups. Results We introduce "levels of orthology" to describe the multi-level nature of gene relations. This is implemented in a program LOFT (Levels of Orthology From Trees that assigns hierarchical orthology numbers to genes based on a phylogenetic tree. To decide upon speciation and gene duplication events in a tree LOFT can be instructed either to perform classical species-tree reconciliation or to use the species overlap between partitions in the tree. The hierarchical orthology numbers assigned by LOFT effectively summarize the phylogenetic relations between genes. The resulting high-resolution orthologous groups are depicted in colour, facilitating visual inspection of (large trees. A benchmark for orthology prediction, that takes into account the varying levels of orthology between genes, shows that the phylogeny-based high-resolution orthology assignments made by LOFT are reliable. Conclusion The "levels of orthology" concept offers high resolution, reliable orthology, while preserving the relations between orthologous groups. A Windows as well as a preliminary Java version of LOFT is available from the LOFT website http://www.cmbi.ru.nl/LOFT.

  20. CONTEMPORARY USAGE OF TRADITIONAL TURKISH MOTIFS IN PRODUCT DESIGNS

    Directory of Open Access Journals (Sweden)

    Tulay Gumuser

    2012-12-01

    Full Text Available The aim of this study is to identify the traditional Turkish motifs and its relations among present industrial designs. Traditional Turkish motifs played a very important role in 16th century onwards. The arts of the Ottoman Empire were used because of their symbolic meanings and unique styles. When we examine these motifs we encounter; Tiger Stripe, Three Spot (Çintemani, Rumi, Hatayi, Penç, Cloud, Crescent, Star, Crown, Hyacinth, Tulip and Carnation motifs. Nowadays, Turkish designers have begun to use these traditional Turkish motifs in their designs so as to create differences and awareness in the world design. The examples of these industrial designs, using the Turkish motifs, have survived and have Ottoman heritage and historical value. In this study, the Turkish motifs will be examined along with their focus on contemporary Turkish industrial designs used today.

  1. RNA motif search with data-driven element ordering.

    Science.gov (United States)

    Rampášek, Ladislav; Jimenez, Randi M; Lupták, Andrej; Vinař, Tomáš; Brejová, Broňa

    2016-05-18

    In this paper, we study the problem of RNA motif search in long genomic sequences. This approach uses a combination of sequence and structure constraints to uncover new distant homologs of known functional RNAs. The problem is NP-hard and is traditionally solved by backtracking algorithms. We have designed a new algorithm for RNA motif search and implemented a new motif search tool RNArobo. The tool enhances the RNAbob descriptor language, allowing insertions in helices, which enables better characterization of ribozymes and aptamers. A typical RNA motif consists of multiple elements and the running time of the algorithm is highly dependent on their ordering. By approaching the element ordering problem in a principled way, we demonstrate more than 100-fold speedup of the search for complex motifs compared to previously published tools. We have developed a new method for RNA motif search that allows for a significant speedup of the search of complex motifs that include pseudoknots. Such speed improvements are crucial at a time when the rate of DNA sequencing outpaces growth in computing. RNArobo is available at http://compbio.fmph.uniba.sk/rnarobo .

  2. Molecular identification of tsetse fly ( Diptera: Glossinidae ) species ...

    African Journals Online (AJOL)

    Inspite of the few mixed clusters, the pattern produced in the phylogenetic trees can provide a good guide to support any other method of Glossina identification. It was recommended that evaluations be made to validate other genetic markers that can produce better resolutions to identify tsetse fly species using phylogenetic ...

  3. Phylogenetic analysis, based on EPIYA repeats in the cagA gene of Indian Helicobacter pylori, and the implications of sequence variation in tyrosine phosphorylation motifs on determining the clinical outcome

    Directory of Open Access Journals (Sweden)

    Santosh K. Tiwari

    2011-01-01

    Full Text Available The population of India harbors one of the world's most highly diverse gene pools, owing to the influx of successive waves of immigrants over regular periods in time. Several phylogenetic studies involving mitochondrial DNA and Y chromosomal variation have demonstrated Europeans to have been the first settlers in India. Nevertheless, certain controversy exists, due to the support given to the thesis that colonization was by the Austro-Asiatic group, prior to the Europeans. Thus, the aim was to investigate pre-historic colonization of India by anatomically modern humans, using conserved stretches of five amino acid (EPIYA sequences in the cagA gene of Helicobacter pylori. Simultaneously, the existence of a pathogenic relationship of tyrosine phosphorylation motifs (TPMs, in 32 H. pylori strains isolated from subjects with several forms of gastric diseases, was also explored. High resolution sequence analysis of the above described genes was performed. The nucleotide sequences obtained were translated into amino acids using MEGA (version 4.0 software for EPIYA. An MJ-Network was constructed for obtaining TPM haplotypes by using NETWORK (version 4.5 software. The findings of the study suggest that Indian H. pylori strains share a common ancestry with Europeans. No specific association of haplotypes with the outcome of disease was revealed through additional network analysis of TPMs.

  4. Complete mitochondrial genomes of five skippers (Lepidoptera: Hesperiidae) and phylogenetic reconstruction of Lepidoptera.

    Science.gov (United States)

    Kim, Min Jee; Wang, Ah Rha; Park, Jeong Sun; Kim, Iksoo

    2014-10-01

    We sequenced mitogenomes of five skippers (family Hesperiidae, Lepidoptera) to obtain further insight into the characteristics of butterfly mitogenomes and performed phylogenetic reconstruction using all available gene sequences (PCGs, rRNAs, and tRNAs) from 85 species (20 families in eight superfamilies). The general genomic features found in the butterflies also were found in the five skippers: a high A+T composition (79.3%-80.9%), dominant usage of TAA stop codon, similar skewness pattern in both strands, consistently length intergenic spacer sequence between tRNA(Gln) and ND2 (64-87 bp), conserved ATACTAA motif between tRNA(Ser (UCN)) and ND1, and characteristic features of the A+T-rich region (the ATAGA motif, varying length of poly-T stretch, and poly-A stretch). The start codon for COI was CGA in four skippers as typical, but Lobocla bifasciatus evidently possessed canonical ATG as start codon. All species had the ancestral arrangement tRNA(Asn)/tRNA(Ser (AGN)), instead of the rearrangement tRNA(Ser (AGN))/tRNA(Asn), found in another skipper species (Erynnis). Phylogenetic analyses using all available genes (PCGs, rRNAS, and tRNAs) yielded the consensus superfamilial relationships ((((((Bombycoidea+Noctuoidea+Geometroidea)+Pyraloidea)+Papilionoidea)+Tortricoidea)+Yponomeutoidea)+Hepialoidea), confirming the validity of Macroheterocera (Bombycoidea, Noctuoidea, and Geometroidea in this study) and its sister relationship to Pyraloidea. Within Rhopalocera (butterflies and skippers) the familial relationships (Papilionidae+(Hesperiidae+(Pieridae+((Lycaenidae+Riodinidae)+Nymphalidae)))) were strongly supported in all analyses (0.98-1 by BI and 96-100 by ML methods), rendering invalid the superfamily status for Hesperioidea. On the other hand, current mitogenome-based phylogeny did not find consistent superfamilial relationships among Noctuoidea, Geometroidea, and Bombycoidea and the familial relationships within Bombycoidea between analyses, requiring further

  5. Analisis Unsur Matematika pada Motif Sulam Usus

    Directory of Open Access Journals (Sweden)

    Fredi Ganda Putra

    2017-12-01

    Full Text Available Based on interviews with researchers sources said that the beginning of the intestine embroidery is an art of genuine crafts. Called the intestine embroidery because this technique is a technique of combining a strand of cloth resembling the intestine formed according to the pattern by means of embroidered using a thread. Intestinal embroidery techniques were originally used to create a cover of the women's customary wardrobe of Lampung or often referred to as bebe. But not many people in Lampung, especially people who live in Lampung are still many who do not know and recognize the intestine embroidery because most only know tapis only characteristic of Lampung, besides that there are other cultural results that is embroidered intestine. There are still many who do not know that the intestine motif there is a knowledge of mathematics. The researcher's problem formulation is whether there are mathematical elements contained in the intestine embroidery motif based on the concept of geometry. The purpose of this study is to determine whether there are elements of mathematics contained in the intestine motif based on the concept of geometry. Subjects in this study consisted of 4 people obtained by purposive sampling technique. From the results of data analysis conducted by using descriptive analysis and discussion as follows: (1 Intestinal embroidery motif contains the meaning of mathematics and culture or often called Etnomatematika. On the meaning of culture there is a link between the embroidery intestine with a culture that has been there before as the existence of cultural linkage between Hindu belief Buddhism and there are similarities of motifs and decorative patterns contained in the motif embroidery intestine with ornamental variety in Indonesia. (2 The relationship between the intestine with mathematical motifs there are elements of mathematics such as geometry elements in the form of geometry of dimension one and dimension two, and the

  6. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  7. Phylogenetic Study of the Evolution of PEP-Carboxykinase

    Directory of Open Access Journals (Sweden)

    Sanjukta Aich

    2007-01-01

    Full Text Available Phosphoenolpyruvate carboxykinase (PCK is the key enzyme to initiate the gluconeogenic pathway in vertebrates, yeast, plants and most bacteria. Nucleotide specificity divided all PCKs into two groups. All the eukaryotic mammalian and most archaeal PCKs are GTP-specifi c. Bacterial and fungal PCKs can be ATP-or GTP-specific but all plant PCKs are ATPspecific. Amino acid sequence alignment of PCK enzymes shows that the nucleotide binding sites are somewhat conserved within each class with few exceptions that do not have any clear ATP- or GTP-specific binding motif. Although the active site residues are mostly conserved in all PCKs, not much significant sequence homology persists between ATP- and GTPdependent PCK enzymes. There is only one planctomycetes PCK enzyme (from Cadidatus Kuenenia stuttgartiensis that shows sequence homology with both ATP-and GTP-dependent PCKs. Phylogenetic studies have been performed to understand the evolutionary relationship of various PCKs from different sources. Based on this study a flowchart of the evolution of PCK has been proposed.

  8. Motif signatures of transcribed enhancers

    KAUST Repository

    Kleftogiannis, Dimitrios

    2017-09-14

    In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.

  9. Ixodes ricinus tick lipocalins: identification, cloning, phylogenetic analysis and biochemical characterization.

    Directory of Open Access Journals (Sweden)

    Jérôme Beaufays

    Full Text Available BACKGROUND: During their blood meal, ticks secrete a wide variety of proteins that interfere with their host's defense mechanisms. Among these proteins, lipocalins play a major role in the modulation of the inflammatory response. METHODOLOGY/PRINCIPAL FINDINGS: Screening a cDNA library in association with RT-PCR and RACE methodologies allowed us to identify 14 new lipocalin genes in the salivary glands of the Ixodes ricinus hard tick. A computational in-depth structural analysis confirmed that LIRs belong to the lipocalin family. These proteins were called LIR for "Lipocalin from I. ricinus" and numbered from 1 to 14 (LIR1 to LIR14. According to their percentage identity/similarity, LIR proteins may be assigned to 6 distinct phylogenetic groups. The mature proteins have calculated pM and pI varying from 21.8 kDa to 37.2 kDa and from 4.45 to 9.57 respectively. In a western blot analysis, all recombinant LIRs appeared as a series of thin bands at 50-70 kDa, suggesting extensive glycosylation, which was experimentally confirmed by treatment with N-glycosidase F. In addition, the in vivo expression analysis of LIRs in I. ricinus, examined by RT-PCR, showed homogeneous expression profiles for certain phylogenetic groups and relatively heterogeneous profiles for other groups. Finally, we demonstrated that LIR6 codes for a protein that specifically binds leukotriene B4. CONCLUSIONS/SIGNIFICANCE: This work confirms that, regarding their biochemical properties, expression profile, and sequence signature, lipocalins in Ixodes hard tick genus, and more specifically in the Ixodes ricinus species, are segregated into distinct phylogenetic groups suggesting potential distinct function. This was particularly demonstrated by the ability of LIR6 to scavenge leukotriene B4. The other LIRs did not bind any of the ligands tested, such as 5-hydroxytryptamine, ADP, norepinephrine, platelet activating factor, prostaglandins D2 and E2, and finally leukotrienes B4 and C

  10. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  11. Rtt107/Esc4 binds silent chromatin and DNA repair proteins using different BRCT motifs

    Directory of Open Access Journals (Sweden)

    Jockusch Rebecca A

    2006-11-01

    Full Text Available Abstract Background By screening a plasmid library for proteins that could cause silencing when targeted to the HMR locus in Saccharomyces cerevisiae, we previously reported the identification of Rtt107/Esc4 based on its ability to establish silent chromatin. In this study we aimed to determine the mechanism of Rtt107/Esc4 targeted silencing and also learn more about its biological functions. Results Targeted silencing by Rtt107/Esc4 was dependent on the SIR genes, which encode obligatory structural and enzymatic components of yeast silent chromatin. Based on its sequence, Rtt107/Esc4 was predicted to contain six BRCT motifs. This motif, originally identified in the human breast tumor suppressor gene BRCA1, is a protein interaction domain. The targeted silencing activity of Rtt107/Esc4 resided within the C-terminal two BRCT motifs, and this region of the protein bound to Sir3 in two-hybrid tests. Deletion of RTT107/ESC4 caused sensitivity to the DNA damaging agent MMS as well as to hydroxyurea. A two-hybrid screen showed that the N-terminal BRCT motifs of Rtt107/Esc4 bound to Slx4, a protein previously shown to be involved in DNA repair and required for viability in a strain lacking the DNA helicase Sgs1. Like SLX genes, RTT107ESC4 interacted genetically with SGS1; esc4Δ sgs1Δ mutants were viable, but exhibited a slow-growth phenotype and also a synergistic DNA repair defect. Conclusion Rtt107/Esc4 binds to the silencing protein Sir3 and the DNA repair protein Slx4 via different BRCT motifs, thus providing a bridge linking silent chromatin to DNA repair enzymes.

  12. Identification of putative orthologous genes for the phylogenetic reconstruction of temperate woody bamboos (Poaceae: Bambusoideae).

    Science.gov (United States)

    Zhang, Li-Na; Zhang, Xian-Zhi; Zhang, Yu-Xiao; Zeng, Chun-Xia; Ma, Peng-Fei; Zhao, Lei; Guo, Zhen-Hua; Li, De-Zhu

    2014-09-01

    The temperate woody bamboos (Arundinarieae) are highly diverse in morphology but lack a substantial amount of genetic variation. The taxonomy of this lineage is intractable, and the relationships within the tribe have not been well resolved. Recent studies indicated that this tribe could have a complex evolutionary history. Although phylogenetic studies of the tribe have been carried out, most of these phylogenetic reconstructions were based on plastid data, which provide lower phylogenetic resolution compared with nuclear data. In this study, we intended to identify a set of desirable nuclear genes for resolving the phylogeny of the temperate woody bamboos. Using two different methodologies, we identified 209 and 916 genes, respectively, as putative single copy orthologous genes. A total of 112 genes was successfully amplified and sequenced by next-generation sequencing technologies in five species sampled from the tribe. As most of the genes exhibited intra-individual allele heterozygotes, we investigated phylogenetic utility by reconstructing the phylogeny based on individual genes. Discordance among gene trees was observed and, to resolve the conflict, we performed a range of analyses using BUCKy and HybTree. While caution should be taken when inferring a phylogeny from multiple conflicting genes, our analysis indicated that 74 of the 112 investigated genes are potential markers for resolving the phylogeny of the temperate woody bamboos. © 2014 John Wiley & Sons Ltd.

  13. The Monitoring and Affinity Purification of Proteins Using Dual Tags with Tetracysteine Motifs

    Science.gov (United States)

    Giannone, Richard J.; Liu, Yie; Wang, Yisong

    Identification and characterization of protein-protein interaction networks is essential for the elucidation of biochemical mechanisms and cellular function. Affinity purification in combination with liquid chromatography-tandem mass spectrometry (LC-MS/MS) has emerged as a very powerful tactic for the identification of specific protein-protein interactions. In this chapter, we describe a comprehensive methodology that uses our recently developed dual-tag affinity purification system for the enrichment and identification of mammalian protein complexes. The protocol covers a series of separate but sequentially related techniques focused on the facile monitoring and purification of a dual-tagged protein of interest and its interacting partners via a system built with tetracysteine motifs and various combinations of affinity tags. Using human telomeric repeat binding factor 2 (TRF2) as an example, we demonstrate the power of the system in terms of bait protein recovery after dual-tag affinity purification, detection of bait protein subcellular localization and expression, and successful identification of known and potentially novel TRF2 interacting proteins. Although the protocol described here has been optimized for the identification and characterization of TRF2-associated proteins, it is, in principle, applicable to the study of any other mammalian protein complexes that may be of interest to the research community.

  14. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d

    Directory of Open Access Journals (Sweden)

    Moffatt Barbara A

    2010-08-01

    Full Text Available Abstract Background Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB for coplanar aromatic motifs similar to those found in known glycan-binding proteins. Results The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192 in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Conclusions Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  15. Structural motif screening reveals a novel, conserved carbohydrate-binding surface in the pathogenesis-related protein PR-5d.

    Science.gov (United States)

    Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J

    2010-08-03

    Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.

  16. Triadic motifs in the dependence networks of virtual societies

    Science.gov (United States)

    Xie, Wen-Jie; Li, Ming-Xia; Jiang, Zhi-Qiang; Zhou, Wei-Xing

    2014-06-01

    In friendship networks, individuals have different numbers of friends, and the closeness or intimacy between an individual and her friends is heterogeneous. Using a statistical filtering method to identify relationships about who depends on whom, we construct dependence networks (which are directed) from weighted friendship networks of avatars in more than two hundred virtual societies of a massively multiplayer online role-playing game (MMORPG). We investigate the evolution of triadic motifs in dependence networks. Several metrics show that the virtual societies evolved through a transient stage in the first two to three weeks and reached a relatively stable stage. We find that the unidirectional loop motif (M9) is underrepresented and does not appear, open motifs are also underrepresented, while other close motifs are overrepresented. We also find that, for most motifs, the overall level difference of the three avatars in the same motif is significantly lower than average, whereas the sum of ranks is only slightly larger than average. Our findings show that avatars' social status plays an important role in the formation of triadic motifs.

  17. Triadic motifs in the dependence networks of virtual societies.

    Science.gov (United States)

    Xie, Wen-Jie; Li, Ming-Xia; Jiang, Zhi-Qiang; Zhou, Wei-Xing

    2014-06-10

    In friendship networks, individuals have different numbers of friends, and the closeness or intimacy between an individual and her friends is heterogeneous. Using a statistical filtering method to identify relationships about who depends on whom, we construct dependence networks (which are directed) from weighted friendship networks of avatars in more than two hundred virtual societies of a massively multiplayer online role-playing game (MMORPG). We investigate the evolution of triadic motifs in dependence networks. Several metrics show that the virtual societies evolved through a transient stage in the first two to three weeks and reached a relatively stable stage. We find that the unidirectional loop motif (M9) is underrepresented and does not appear, open motifs are also underrepresented, while other close motifs are overrepresented. We also find that, for most motifs, the overall level difference of the three avatars in the same motif is significantly lower than average, whereas the sum of ranks is only slightly larger than average. Our findings show that avatars' social status plays an important role in the formation of triadic motifs.

  18. Genome Wide Identification, Evolutionary, and Expression Analysis of VQ Genes from Two Pyrus Species.

    Science.gov (United States)

    Cao, Yunpeng; Meng, Dandan; Abdullah, Muhammad; Jin, Qing; Lin, Yi; Cai, Yongping

    2018-04-23

    The VQ motif-containing gene, a member of the plant-specific genes, is involved in the plant developmental process and various stress responses. The VQ motif-containing gene family has been studied in several plants, such as rice ( Oryza sativa ), maize ( Zea mays ), and Arabidopsis ( Arabidopsis thaliana ). However, no systematic study has been performed in Pyrus species, which have important economic value. In our study, we identified 41 and 28 VQ motif-containing genes in Pyrus bretschneideri and Pyrus communis , respectively. Phylogenetic trees were calculated using A. thaliana and O. sativa VQ motif-containing genes as a template, allowing us to categorize these genes into nine subfamilies. Thirty-two and eight paralogous of VQ motif-containing genes were found in P. bretschneideri and P. communis , respectively, showing that the VQ motif-containing genes had a more remarkable expansion in P. bretschneideri than in P. communis . A total of 31 orthologous pairs were identified from the P. bretschneideri and P. communis VQ motif-containing genes. Additionally, among the paralogs, we found that these duplication gene pairs probably derived from segmental duplication/whole-genome duplication (WGD) events in the genomes of P. bretschneideri and P. communis , respectively. The gene expression profiles in both P. bretschneideri and P. communis fruits suggested functional redundancy for some orthologous gene pairs derived from a common ancestry, and sub-functionalization or neo-functionalization for some of them. Our study provided the first systematic evolutionary analysis of the VQ motif-containing genes in Pyrus , and highlighted the diversification and duplication of VQ motif-containing genes in both P. bretschneideri and P. communis .

  19. Efficient motif finding algorithms for large-alphabet inputs

    Directory of Open Access Journals (Sweden)

    Pavlovic Vladimir

    2010-10-01

    Full Text Available Abstract Background We consider the problem of identifying motifs, recurring or conserved patterns, in the biological sequence data sets. To solve this task, we present a new deterministic algorithm for finding patterns that are embedded as exact or inexact instances in all or most of the input strings. Results The proposed algorithm (1 improves search efficiency compared to existing algorithms, and (2 scales well with the size of alphabet. On a synthetic planted DNA motif finding problem our algorithm is over 10× more efficient than MITRA, PMSPrune, and RISOTTO for long motifs. Improvements are orders of magnitude higher in the same setting with large alphabets. On benchmark TF-binding site problems (FNP, CRP, LexA we observed reduction in running time of over 12×, with high detection accuracy. The algorithm was also successful in rapidly identifying protein motifs in Lipocalin, Zinc metallopeptidase, and supersecondary structure motifs for Cadherin and Immunoglobin families. Conclusions Our algorithm reduces computational complexity of the current motif finding algorithms and demonstrate strong running time improvements over existing exact algorithms, especially in important and difficult cases of large-alphabet sequences.

  20. Construction of a phylogenetic tree of photosynthetic prokaryotes based on average similarities of whole genome sequences.

    Directory of Open Access Journals (Sweden)

    Soichirou Satoh

    Full Text Available Phylogenetic trees have been constructed for a wide range of organisms using gene sequence information, especially through the identification of orthologous genes that have been vertically inherited. The number of available complete genome sequences is rapidly increasing, and many tools for construction of genome trees based on whole genome sequences have been proposed. However, development of a reasonable method of using complete genome sequences for construction of phylogenetic trees has not been established. We have developed a method for construction of phylogenetic trees based on the average sequence similarities of whole genome sequences. We used this method to examine the phylogeny of 115 photosynthetic prokaryotes, i.e., cyanobacteria, Chlorobi, proteobacteria, Chloroflexi, Firmicutes and nonphotosynthetic organisms including Archaea. Although the bootstrap values for the branching order of phyla were low, probably due to lateral gene transfer and saturated mutation, the obtained tree was largely consistent with the previously reported phylogenetic trees, indicating that this method is a robust alternative to traditional phylogenetic methods.

  1. Use of phylogenetic and phenotypic analyses to identify nonhemolytic streptococci isolated from bacteremic patients.

    Science.gov (United States)

    Hoshino, Tomonori; Fujiwara, Taku; Kilian, Mogens

    2005-12-01

    The aim of this study was to evaluate molecular and phenotypic methods for the identification of nonhemolytic streptococci. A collection of 148 strains consisting of 115 clinical isolates from cases of infective endocarditis, septicemia, and meningitis and 33 reference strains, including type strains of all relevant Streptococcus species, were examined. Identification was performed by phylogenetic analysis of nucleotide sequences of four housekeeping genes, ddl, gdh, rpoB, and sodA; by PCR analysis of the glucosyltransferase (gtf) gene; and by conventional phenotypic characterization and identification using two commercial kits, Rapid ID 32 STREP and STREPTOGRAM and the associated databases. A phylogenetic tree based on concatenated sequences of the four housekeeping genes allowed unequivocal differentiation of recognized species and was used as the reference. Analysis of single gene sequences revealed deviation clustering in eight strains (5.4%) due to homologous recombination with other species. This was particularly evident in S. sanguinis and in members of the anginosus group of streptococci. The rate of correct identification of the strains by both commercial identification kits was below 50% but varied significantly between species. The most significant problems were observed with S. mitis and S. oralis and 11 Streptococcus species described since 1991. Our data indicate that identification based on multilocus sequence analysis is optimal. As a more practical alternative we recommend identification based on sodA sequences with reference to a comprehensive set of sequences that is available for downloading from our server. An analysis of the species distribution of 107 nonhemolytic streptococci from bacteremic patients showed a predominance of S. oralis and S. anginosus with various underlying infections.

  2. Identification and characterization of a selenoprotein family containing a diselenide bond in a redox motif

    OpenAIRE

    Shchedrina, Valentina A.; Novoselov, Sergey V.; Malinouski, Mikalai Yu.; Gladyshev, Vadim N.

    2007-01-01

    Selenocysteine (Sec, U) insertion into proteins is directed by translational recoding of specific UGA codons located upstream of a stem-loop structure known as Sec insertion sequence (SECIS) element. Selenoproteins with known functions are oxidoreductases containing a single redox-active Sec in their active sites. In this work, we identified a family of selenoproteins, designated SelL, containing two Sec separated by two other residues to form a UxxU motif. SelL proteins show an unusual occur...

  3. Discovery of candidate KEN-box motifs using cell cycle keyword enrichment combined with native disorder prediction and motif conservation.

    Science.gov (United States)

    Michael, Sushama; Travé, Gilles; Ramu, Chenna; Chica, Claudia; Gibson, Toby J

    2008-02-15

    KEN-box-mediated target selection is one of the mechanisms used in the proteasomal destruction of mitotic cell cycle proteins via the APC/C complex. While annotating the Eukaryotic Linear Motif resource (ELM, http://elm.eu.org/), we found that KEN motifs were significantly enriched in human protein entries with cell cycle keywords in the UniProt/Swiss-Prot database-implying that KEN-boxes might be more common than reported. Matches to short linear motifs in protein database searches are not, per se, significant. KEN-box enrichment with cell cycle Gene Ontology terms suggests that collectively these motifs are functional but does not prove that any given instance is so. Candidates were surveyed for native disorder prediction using GlobPlot and IUPred and for motif conservation in homologues. Among >25 strong new candidates, the most notable are human HIPK2, CHFR, CDC27, Dab2, Upf2, kinesin Eg5, DNA Topoisomerase 1 and yeast Cdc5 and Swi5. A similar number of weaker candidates were present. These proteins have yet to be tested for APC/C targeted destruction, providing potential new avenues of research.

  4. Use of phylogenetic and phenotypic analyses to identify nonhemolytic streptococci isolated from bacteremic patients

    DEFF Research Database (Denmark)

    Hoshino, T; Fujivwara, T; Kilian, Mogens

    2005-01-01

    and identification using two commercial kits, Rapid ID 32 STREP and STREPTOGRAM and the associated databases. A phylogenetic tree based on concatenated sequences of the four housekeeping genes allowed unequivocal differentiation of recognized species and was used as the reference. Analysis of single gene sequences...

  5. μXRF analysis of decoration motifs on Majolica pottery

    International Nuclear Information System (INIS)

    Padilla Lavarez, Roman; Van Espen, Pierr M.; Janssens, K; Schalm, O.

    2001-01-01

    μXRF analysis of decoration motifs on Majolica pottery in fragments corresponding to several Majolica types was carried out using an spectrometer comprising a low power Mo X-ray tube and a elliptic-shape concentration lens with a 60 um spot. Both surface scanning and spot measurements were carried a out, allowing the qualitative identification of the inorganic pigments used for the surface painting decoration and the quantitative analysis of the main glaze composition. The absence of interference signal arising from the excitation on the underlying paste when analysing thin-lead glazing was evaluated, allowing ensuring the suitable of the analytical procedures. A distinction was found between different types of majolica by the composition of the lead tin glaze enamel and by the presence of other elements in the blue, black and orange decoration

  6. DNA motif alignment by evolving a population of Markov chains.

    Science.gov (United States)

    Bi, Chengpeng

    2009-01-30

    Deciphering cis-regulatory elements or de novo motif-finding in genomes still remains elusive although much algorithmic effort has been expended. The Markov chain Monte Carlo (MCMC) method such as Gibbs motif samplers has been widely employed to solve the de novo motif-finding problem through sequence local alignment. Nonetheless, the MCMC-based motif samplers still suffer from local maxima like EM. Therefore, as a prerequisite for finding good local alignments, these motif algorithms are often independently run a multitude of times, but without information exchange between different chains. Hence it would be worth a new algorithm design enabling such information exchange. This paper presents a novel motif-finding algorithm by evolving a population of Markov chains with information exchange (PMC), each of which is initialized as a random alignment and run by the Metropolis-Hastings sampler (MHS). It is progressively updated through a series of local alignments stochastically sampled. Explicitly, the PMC motif algorithm performs stochastic sampling as specified by a population-based proposal distribution rather than individual ones, and adaptively evolves the population as a whole towards a global maximum. The alignment information exchange is accomplished by taking advantage of the pooled motif site distributions. A distinct method for running multiple independent Markov chains (IMC) without information exchange, or dubbed as the IMC motif algorithm, is also devised to compare with its PMC counterpart. Experimental studies demonstrate that the performance could be improved if pooled information were used to run a population of motif samplers. The new PMC algorithm was able to improve the convergence and outperformed other popular algorithms tested using simulated and biological motif sequences.

  7. DNA motif elucidation using belief propagation.

    Science.gov (United States)

    Wong, Ka-Chun; Chan, Tak-Ming; Peng, Chengbin; Li, Yue; Zhang, Zhaolei

    2013-09-01

    Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k=8∼10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors' websites: e.g. http://www.cs.toronto.edu/∼wkc/kmerHMM.

  8. DNA motif elucidation using belief propagation

    KAUST Repository

    Wong, Ka-Chun; Chan, Tak-Ming; Peng, Chengbin; Li, Yue; Zhang, Zhaolei

    2013-01-01

    Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k = 8 ?10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors' websites: e.g. http://www.cs.toronto.edu/?wkc/kmerHMM. 2013 The Author(s).

  9. DNA motif elucidation using belief propagation

    KAUST Repository

    Wong, Ka-Chun

    2013-06-29

    Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k = 8 ?10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors\\' websites: e.g. http://www.cs.toronto.edu/?wkc/kmerHMM. 2013 The Author(s).

  10. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    Science.gov (United States)

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  11. [Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

    Science.gov (United States)

    Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

    2013-07-04

    Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

  12. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  13. Barcoding and Phylogenetic Inferences in Nine Mugilid Species (Pisces, Mugiliformes

    Directory of Open Access Journals (Sweden)

    Neonila Polyakova

    2013-10-01

    Full Text Available Accurate identification of fish and fish products, from eggs to adults, is important in many areas. Grey mullets of the family Mugilidae are distributed worldwide and inhabit marine, estuarine, and freshwater environments in all tropical and temperate regions. Various Mugilid species are commercially important species in fishery and aquaculture of many countries. For the present study we have chosen two Mugilid genes with different phylogenetic signals: relatively variable mitochondrial cytochrome oxidase subunit I (COI and conservative nuclear rhodopsin (RHO. We examined their diversity within and among 9 Mugilid species belonging to 4 genera, many of which have been examined from multiple specimens, with the goal of determining whether DNA barcoding can achieve unambiguous species recognition of Mugilid species. The data obtained showed that information based on COI sequences was diagnostic not only for species-level identification but also for recognition of intraspecific units, e.g., allopatric populations of circumtropical Mugil cephalus, or even native and acclimatized specimens of Chelon haematocheila. All RHO sequences appeared strictly species specific. Based on the data obtained, we conclude that COI, as well as RHO sequencing can be used to unambiguously identify fish species. Topologies of phylogeny based on RHO and COI sequences coincided with each other, while together they had a good phylogenetic signal.

  14. Hybrid DNA i-motif: Aminoethylprolyl-PNA (pC5) enhance the stability of DNA (dC5) i-motif structure.

    Science.gov (United States)

    Gade, Chandrasekhar Reddy; Sharma, Nagendra K

    2017-12-15

    This report describes the synthesis of C-rich sequence, cytosine pentamer, of aep-PNA and its biophysical studies for the formation of hybrid DNA:aep-PNAi-motif structure with DNA cytosine pentamer (dC 5 ) under acidic pH conditions. Herein, the CD/UV/NMR/ESI-Mass studies strongly support the formation of stable hybrid DNA i-motif structure with aep-PNA even near acidic conditions. Hence aep-PNA C-rich sequence cytosine could be considered as potential DNA i-motif stabilizing agents in vivo conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Automatic annotation of protein motif function with Gene Ontology terms

    Directory of Open Access Journals (Sweden)

    Gopalakrishnan Vanathi

    2004-09-01

    Full Text Available Abstract Background Conserved protein sequence motifs are short stretches of amino acid sequence patterns that potentially encode the function of proteins. Several sequence pattern searching algorithms and programs exist foridentifying candidate protein motifs at the whole genome level. However, amuch needed and importanttask is to determine the functions of the newly identified protein motifs. The Gene Ontology (GO project is an endeavor to annotate the function of genes or protein sequences with terms from a dynamic, controlled vocabulary and these annotations serve well as a knowledge base. Results This paperpresents methods to mine the GO knowledge base and use the association between the GO terms assigned to a sequence and the motifs matched by the same sequence as evidence for predicting the functions of novel protein motifs automatically. The task of assigning GO terms to protein motifsis viewed as both a binary classification and information retrieval problem, where PROSITE motifs are used as samples for mode training and functional prediction. The mutual information of a motif and aGO term association isfound to be a very useful feature. We take advantageof the known motifs to train a logistic regression classifier, which allows us to combine mutual information with other frequency-based features and obtain a probability of correctassociation. The trained logistic regression model has intuitively meaningful and logically plausible parameter values, and performs very well empirically according to our evaluation criteria. Conclusions In this research, different methods for automatic annotation of protein motifs have been investigated. Empirical result demonstrated that the methods have a great potential for detecting and augmenting information about thefunctions of newly discovered candidate protein motifs.

  16. Verification of the MOTIF code version 3.0

    International Nuclear Information System (INIS)

    Chan, T.; Guvanasen, V.; Nakka, B.W.; Reid, J.A.K.; Scheier, N.W.; Stanchell, F.W.

    1996-12-01

    As part of the Canadian Nuclear Fuel Waste Management Program (CNFWMP), AECL has developed a three-dimensional finite-element code, MOTIF (Model Of Transport In Fractured/ porous media), for detailed modelling of groundwater flow, heat transport and solute transport in a fractured rock mass. The code solves the transient and steady-state equations of groundwater flow, solute (including one-species radionuclide) transport, and heat transport in variably saturated fractured/porous media. The initial development was completed in 1985 (Guvanasen 1985) and version 3.0 was completed in 1986. This version is documented in detail in Guvanasen and Chan (in preparation). This report describes a series of fourteen verification cases which has been used to test the numerical solution techniques and coding of MOTIF, as well as demonstrate some of the MOTIF analysis capabilities. For each case the MOTIF solution has been compared with a corresponding analytical or independently developed alternate numerical solution. Several of the verification cases were included in Level 1 of the International Hydrologic Code Intercomparison Project (HYDROCOIN). The MOTIF results for these cases were also described in the HYDROCOIN Secretariat's compilation and comparison of results submitted by the various project teams (Swedish Nuclear Power Inspectorate 1988). It is evident from the graphical comparisons presented that the MOTIF solutions for the fourteen verification cases are generally in excellent agreement with known analytical or numerical solutions obtained from independent sources. This series of verification studies has established the ability of the MOTIF finite-element code to accurately model the groundwater flow and solute and heat transport phenomena for which it is intended. (author). 20 refs., 14 tabs., 32 figs

  17. Purification and functional motifs of the recombinant ATPase of orf virus.

    Science.gov (United States)

    Lin, Fong-Yuan; Chan, Kun-Wei; Wang, Chi-Young; Wong, Min-Liang; Hsu, Wei-Li

    2011-10-01

    Our previous study showed that the recombinant ATPase encoded by the A32L gene of orf virus displayed ATP hydrolysis activity as predicted from its amino acids sequence. This viral ATPase contains four known functional motifs (motifs I-IV) and a novel AYDG motif; they are essential for ATP hydrolysis reaction by binding ATP and magnesium ions. The motifs I and II correspond with the Walker A and B motifs of the typical ATPase, respectively. To examine the biochemical roles of these five conserved motifs, recombinant ATPases of five deletion mutants derived from the Taiping strain were expressed and purified. Their ATPase functions were assayed and compared with those of two wild type strains, Taiping and Nantou isolated in Taiwan. Our results showed that deletions at motifs I-III or IV exhibited lower activity than that of the wild type. Interestingly, deletion of AYDG motif decreased the ATPase activity more significantly than those of motifs I-IV deletions. Divalent ions such as magnesium and calcium were essential for ATPase activity. Moreover, our recombinant proteins of orf virus also demonstrated GTPase activity, though weaker than the original ATPase activity. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. A phosphorylation-motif for tuneable helix stabilisation in intrinsically disordered proteins - Lessons from the sodium proton exchanger 1 (NHE1)

    DEFF Research Database (Denmark)

    Hendus-Altenburger, Ruth; Lambrughi, Matteo; Terkelsen, Thilde Bagger

    2017-01-01

    ). Using NMR spectroscopy, we found that two out of those six phosphorylation sites had a stabilizing effect on transient helices. One of these was further investigated by circular dichroism and NMR spectroscopy as well as by molecular dynamic simulations, which confirmed the stabilizing effect......-spread role in phosphorylation-mediated regulation of intrinsically disordered proteins. The identification of such motifs is important for understanding the molecular mechanism of cellular signalling, and is crucial for the development of predictors for the structural effect of phosphorylation; a tool......Intrinsically disordered proteins (IDPs) are involved in many pivotal cellular processes including phosphorylation and signalling. The structural and functional effects of phosphorylation of IDPs remain poorly understood and difficult to predict. Thus, a need exists to identify motifs that confer...

  19. Phylogenetic analysis of Newcastle disease viruses isolated from commercial poultry in Mozambique, 2011 to 2016

    International Nuclear Information System (INIS)

    Mapaco, L.P.; Monjane, I.V.A.; Nhamusso, A.E.; Viljoen, G.J; Dundon, W.G.; Achá, S.J.

    2016-01-01

    Full text: The complete sequence of the fusion (F) protein gene from eleven Newcastle disease viruses (NDV) isolated from commercial poultry in Mozambique between 2011 and 2016 has been generated. The F gene cleavage site motif for all eleven isolates was 112RRRKRF117 indicating that the viruses are virulent. A phylogenetic analysis using the full F gene sequence revealed that the viruses clustered within genotype VIIh and showed a higher similarity to NDVs from South Africa, China and Southeast Asia than to viruses previously described in Mozambique in 1994 to 1995 and 2005. The characterization of these new NDVs has important implications for Newcastle disease management and control in Mozambique. (author)

  20. Combining Phylogenetic and Occurrence Information for Risk Assessment of Pest and Pathogen Interactions with Host Plants

    Directory of Open Access Journals (Sweden)

    Ángel L. Robles-Fernández

    2017-08-01

    Full Text Available Phytosanitary agencies conduct plant biosecurity activities, including early detection of potential introduction pathways, to improve control and eradication of pest and pathogen incursions. For such actions, analytical tools based on solid scientific knowledge regarding plant-pest or pathogen relationships for pest risk assessment are needed. Recent evidence indicating that closely related species share a higher chance of becoming infected or attacked by pests has allowed the identification of taxa with different degrees of vulnerability. Here, we use information readily available online about pest-host interactions and their geographic distributions, in combination with host phylogenetic reconstructions, to estimate a pest-host interaction (in some cases infection index in geographic space as a more comprehensive, spatially explicit tool for risk assessment. We demonstrate this protocol using phylogenetic relationships for 20 beetle species and 235 host plant genera: first, we estimate the probability of a host sharing pests, and second, we project the index in geographic space. Overall, the predictions allow identification of the pest-host interaction type (e.g., generalist or specialist, which is largely determined by both host range and phylogenetic constraints. Furthermore, the results can be valuable in terms of identifying hotspots where pests and vulnerable hosts interact. This knowledge is useful for anticipating biological invasions or spreading of disease. We suggest that our understanding of biotic interactions will improve after combining information from multiple dimensions of biodiversity at multiple scales (e.g., phylogenetic signal and host-vector-pathogen geographic distribution.

  1. An experimental test of a fundamental food web motif.

    Science.gov (United States)

    Rip, Jason M K; McCann, Kevin S; Lynn, Denis H; Fawcett, Sonia

    2010-06-07

    Large-scale changes to the world's ecosystem are resulting in the deterioration of biostructure-the complex web of species interactions that make up ecological communities. A difficult, yet crucial task is to identify food web structures, or food web motifs, that are the building blocks of this baroque network of interactions. Once identified, these food web motifs can then be examined through experiments and theory to provide mechanistic explanations for how structure governs ecosystem stability. Here, we synthesize recent ecological research to show that generalist consumers coupling resources with different interaction strengths, is one such motif. This motif amazingly occurs across an enormous range of spatial scales, and so acts to distribute coupled weak and strong interactions throughout food webs. We then perform an experiment that illustrates the importance of this motif to ecological stability. We find that weak interactions coupled to strong interactions by generalist consumers dampen strong interaction strengths and increase community stability. This study takes a critical step by isolating a common food web motif and through clear, experimental manipulation, identifies the fundamental stabilizing consequences of this structure for ecological communities.

  2. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  3. Mechanisms of zero-lag synchronization in cortical motifs.

    Directory of Open Access Journals (Sweden)

    Leonardo L Gollo

    2014-04-01

    Full Text Available Zero-lag synchronization between distant cortical areas has been observed in a diversity of experimental data sets and between many different regions of the brain. Several computational mechanisms have been proposed to account for such isochronous synchronization in the presence of long conduction delays: Of these, the phenomenon of "dynamical relaying"--a mechanism that relies on a specific network motif--has proven to be the most robust with respect to parameter mismatch and system noise. Surprisingly, despite a contrary belief in the community, the common driving motif is an unreliable means of establishing zero-lag synchrony. Although dynamical relaying has been validated in empirical and computational studies, the deeper dynamical mechanisms and comparison to dynamics on other motifs is lacking. By systematically comparing synchronization on a variety of small motifs, we establish that the presence of a single reciprocally connected pair--a "resonance pair"--plays a crucial role in disambiguating those motifs that foster zero-lag synchrony in the presence of conduction delays (such as dynamical relaying from those that do not (such as the common driving triad. Remarkably, minor structural changes to the common driving motif that incorporate a reciprocal pair recover robust zero-lag synchrony. The findings are observed in computational models of spiking neurons, populations of spiking neurons and neural mass models, and arise whether the oscillatory systems are periodic, chaotic, noise-free or driven by stochastic inputs. The influence of the resonance pair is also robust to parameter mismatch and asymmetrical time delays amongst the elements of the motif. We call this manner of facilitating zero-lag synchrony resonance-induced synchronization, outline the conditions for its occurrence, and propose that it may be a general mechanism to promote zero-lag synchrony in the brain.

  4. Rapid identification of DNA-binding proteins by mass spectrometry

    DEFF Research Database (Denmark)

    Nordhoff, E.; Korgsdam, A.-M.; Jørgensen, H.F.

    1999-01-01

    We report a protocol for the rapid identification of DNA-binding proteins. Immobilized DNA probes harboring a specific sequence motif are incubated with cell or nuclear extract. Proteins are analyzed directly off the solid support by matrix-assisted laser desorption/ionization time-of-flight mass...... was validated by the identification of known prokaryotic and eukaryotic DNA-binding proteins, and its use provided evidence that poly(ADP-ribose) polymerase exhibits DNA sequence-specific binding to DNA....

  5. Transduction motif analysis of gastric cancer based on a human signaling network

    Energy Technology Data Exchange (ETDEWEB)

    Liu, G.; Li, D.Z.; Jiang, C.S.; Wang, W. [Fuzhou General Hospital of Nanjing Command, Department of Gastroenterology, Fuzhou, China, Department of Gastroenterology, Fuzhou General Hospital of Nanjing Command, Fuzhou (China)

    2014-04-04

    To investigate signal regulation models of gastric cancer, databases and literature were used to construct the signaling network in humans. Topological characteristics of the network were analyzed by CytoScape. After marking gastric cancer-related genes extracted from the CancerResource, GeneRIF, and COSMIC databases, the FANMOD software was used for the mining of gastric cancer-related motifs in a network with three vertices. The significant motif difference method was adopted to identify significantly different motifs in the normal and cancer states. Finally, we conducted a series of analyses of the significantly different motifs, including gene ontology, function annotation of genes, and model classification. A human signaling network was constructed, with 1643 nodes and 5089 regulating interactions. The network was configured to have the characteristics of other biological networks. There were 57,942 motifs marked with gastric cancer-related genes out of a total of 69,492 motifs, and 264 motifs were selected as significantly different motifs by calculating the significant motif difference (SMD) scores. Genes in significantly different motifs were mainly enriched in functions associated with cancer genesis, such as regulation of cell death, amino acid phosphorylation of proteins, and intracellular signaling cascades. The top five significantly different motifs were mainly cascade and positive feedback types. Almost all genes in the five motifs were cancer related, including EPOR, MAPK14, BCL2L1, KRT18, PTPN6, CASP3, TGFBR2, AR, and CASP7. The development of cancer might be curbed by inhibiting signal transductions upstream and downstream of the selected motifs.

  6. Host-range phylogenetic grouping of capripoxviruses. Genetic typing of CaPVs

    International Nuclear Information System (INIS)

    Le Goff, C.; Chadeyras, A.; Libeau, G.; Albina, E.; Fakhfakh, E.; Hammami, S.; Elexpeter Aba Adulugba; Diallo, A.

    2005-01-01

    Because of their close relationship, specific identification of the CaPVs genus inside the Poxviridae family relies mainly on molecular tools rather than on classical serology. We describe the suitability of the G protein-coupled chemokine receptor (GPCR), for host range phylogenetic grouping. The analysis of 26 CaPVs shows 3 tight genetic clusters consisting of goatpox virus (GPV), lumpy skin disease virus (LSDV), and sheeppox virus (SPV). (author)

  7. Armadillo motifs involved in vesicular transport.

    Directory of Open Access Journals (Sweden)

    Harald Striegl

    Full Text Available Armadillo (ARM repeat proteins function in various cellular processes including vesicular transport and membrane tethering. They contain an imperfect repeating sequence motif that forms a conserved three-dimensional structure. Recently, structural and functional insight into tethering mediated by the ARM-repeat protein p115 has been provided. Here we describe the p115 ARM-motifs for reasons of clarity and nomenclature and show that both sequence and structure are highly conserved among ARM-repeat proteins. We argue that there is no need to invoke repeat types other than ARM repeats for a proper description of the structure of the p115 globular head region. Additionally, we propose to define a new subfamily of ARM-like proteins and show lack of evidence that the ARM motifs found in p115 are present in other long coiled-coil tethering factors of the golgin family.

  8. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Directory of Open Access Journals (Sweden)

    Rahul Karnik

    Full Text Available The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  9. Characterizing Motif Dynamics of Electric Brain Activity Using Symbolic Analysis

    Directory of Open Access Journals (Sweden)

    Massimiliano Zanin

    2014-10-01

    Full Text Available Motifs are small recurring circuits of interactions which constitute the backbone of networked systems. Characterizing motif dynamics is therefore key to understanding the functioning of such systems. Here we propose a method to define and quantify the temporal variability and time scales of electroencephalogram (EEG motifs of resting brain activity. Given a triplet of EEG sensors, links between them are calculated by means of linear correlation; each pattern of links (i.e., each motif is then associated to a symbol, and its appearance frequency is analyzed by means of Shannon entropy. Our results show that each motif becomes observable with different coupling thresholds and evolves at its own time scale, with fronto-temporal sensors emerging at high thresholds and changing at fast time scales, and parietal ones at low thresholds and changing at slower rates. Finally, while motif dynamics differed across individuals, for each subject, it showed robustness across experimental conditions, indicating that it could represent an individual dynamical signature.

  10. Discriminative motif discovery via simulated evolution and random under-sampling.

    Directory of Open Access Journals (Sweden)

    Tao Song

    Full Text Available Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the stage of Hidden Markov Models (HMMs training, a random under-sampling method is introduced for the imbalance between the positive and negative datasets. It is shown that, in the task of discovering targeting motifs of nine subcellular compartments, the motifs found by our method are more conserved than the methods without considering data imbalance problem and recover the most known targeting motifs from Minimotif Miner and InterPro. Meanwhile, we use the found motifs to predict protein subcellular localization and achieve higher prediction precision and recall for the minority classes.

  11. Discriminative motif discovery via simulated evolution and random under-sampling.

    Science.gov (United States)

    Song, Tao; Gu, Hong

    2014-01-01

    Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the stage of Hidden Markov Models (HMMs) training, a random under-sampling method is introduced for the imbalance between the positive and negative datasets. It is shown that, in the task of discovering targeting motifs of nine subcellular compartments, the motifs found by our method are more conserved than the methods without considering data imbalance problem and recover the most known targeting motifs from Minimotif Miner and InterPro. Meanwhile, we use the found motifs to predict protein subcellular localization and achieve higher prediction precision and recall for the minority classes.

  12. Improved i-motif thermal stability by insertion of anthraquinone monomers

    DEFF Research Database (Denmark)

    Gouda, Alaa S; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

    2017-01-01

    In order to gain insight into how to improve thermal stability of i-motifs when used in the context of biomedical and nanotechnological applications, novel anthraquinone-modified i-motifs were synthesized by insertion of 1,8-, 1,4-, 1,5- and 2,6-disubstituted anthraquinone monomers into the TAA...... loops of a 22mer cytosine-rich human telomeric DNA sequence. The influence of the four anthraquinone linkers on the i-motif thermal stability was investigated at 295 nm and pH 5.5. Anthraquinone monomers modulate the i-motif stability in a position-depending manner and the modulation also depends...... unlocked nucleic acid monomers or twisted intercalating nucleic acid. The 2,6-disubstituted anthraquinone linker replacing T10 enabled a significant increase of i-motif thermal melting by 8.2 °C. A substantial increase of 5.0 °C in i-motif thermal melting was recorded when both A6 and T16 were modified...

  13. Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

    Science.gov (United States)

    Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

    2016-08-05

    This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

  14. Phylogenetic Variants of Rickettsia africae, and Incidental Identification of "Candidatus Rickettsia Moyalensis" in Kenya.

    Science.gov (United States)

    Kimita, Gathii; Mutai, Beth; Nyanjom, Steven Ger; Wamunyokoli, Fred; Waitumbi, John

    2016-07-01

    Rickettsia africae, the etiological agent of African tick bite fever, is widely distributed in sub-Saharan Africa. Contrary to reports of its homogeneity, a localized study in Asembo, Kenya recently reported high genetic diversity. The present study aims to elucidate the extent of this heterogeneity by examining archived Rickettsia africae DNA samples collected from different eco-regions of Kenya. To evaluate their phylogenetic relationships, archived genomic DNA obtained from 57 ticks a priori identified to contain R. africae by comparison to ompA, ompB and gltA genes was used to amplify five rickettsial genes i.e. gltA, ompA, ompB, 17kDa and sca4. The resulting amplicons were sequenced. Translated amino acid alignments were used to guide the nucleotide alignments. Single gene and concatenated alignments were used to infer phylogenetic relationships. Out of the 57 DNA samples, three were determined to be R. aeschlimanii and not R. africae. One sample turned out to be a novel rickettsiae and an interim name of "Candidatus Rickettsia moyalensis" is proposed. The bonafide R. africae formed two distinct clades. Clade I contained 9% of the samples and branched with the validated R. africae str ESF-5, while clade II (two samples) formed a distinct sub-lineage. This data supports the use of multiple genes for phylogenetic inferences. It is determined that, despite its recent emergence, the R. africae lineage is diverse. This data also provides evidence of a novel Rickettsia species, Candidatus Rickettsia moyalensis.

  15. Identification of Four Distinct Phylogenetic Groups in Flavobacterium columnare With Fish Host Associations

    Directory of Open Access Journals (Sweden)

    Benjamin R. LaFrentz

    2018-03-01

    Full Text Available Columnaris disease, caused by the Gram-negative bacterium Flavobacterium columnare, is one of the most prevalent fish diseases worldwide. An exceptionally high level of genetic diversity among isolates of F. columnare has long been recognized, whereby six established genomovars have been described to date. However, little has been done to quantify or characterize this diversity further in a systematic fashion. The objective of this research was to perform phylogenetic analyses of 16S rRNA and housekeeping gene sequences to decipher the genetic diversity of F. columnare. Fifty isolates and/or genomes of F. columnare, originating from diverse years, geographic locations, fish hosts, and representative of the six genomovars were analyzed in this study. A multilocus phylogenetic analysis (MLPA of the 16S rRNA and six housekeeping genes supported four distinct F. columnare genetic groups. There were associations between genomovar and genetic group, but these relationships were imperfect indicating that genomovar assignment does not accurately reflect F. columnare genetic diversity. To expand the dataset, an additional 90 16S rRNA gene sequences were retrieved from GenBank and a phylogenetic analysis of this larger dataset also supported the establishment of four genetic groups. Examination of isolate historical data indicated biological relevance to the identified genetic diversity, with some genetic groups isolated preferentially from specific fish species or families. It is proposed that F. columnare isolates be assigned to the four genetic groups defined in this study rather than genomovar in order to facilitate a standard nomenclature across the scientific community. An increased understanding of which genetic groups are most prevalent in different regions and/or aquaculture industries may allow for the development of improved targeted control and treatment measures for columnaris disease.

  16. Is invasion success of Australian trees mediated by their native biogeography, phylogenetic history, or both?

    Science.gov (United States)

    Miller, Joseph T; Hui, Cang; Thornhill, Andrew; Gallien, Laure; Le Roux, Johannes J; Richardson, David M

    2016-12-30

    For a plant species to become invasive it has to progress along the introduction-naturalization-invasion (INI) continuum which reflects the joint direction of niche breadth. Identification of traits that correlate with and drive species invasiveness along the continuum is a major focus of invasion biology. If invasiveness is underlain by heritable traits, and if such traits are phylogenetically conserved, then we would expect non-native species with different introduction status (i.e. position along the INI continuum) to show phylogenetic signal. This study uses two clades that contain a large number of invasive tree species from the genera Acacia and Eucalyptus to test whether geographic distribution and a novel phylogenetic conservation method can predict which species have been introduced, became naturalized, and invasive. Our results suggest that no underlying phylogenetic signal underlie the introduction status for both groups of trees, except for introduced acacias. The more invasive acacia clade contains invasive species that have smoother geographic distributions and are more marginal in the phylogenetic network. The less invasive eucalyptus group contains invasive species that are more clustered geographically, more centrally located in the phylogenetic network and have phylogenetic distances between invasive and non-invasive species that are trending toward the mean pairwise distance. This suggests that highly invasive groups may be identified because they have invasive species with smoother and faster expanding native distributions and are located more to the edges of phylogenetic networks than less invasive groups. Published by Oxford University Press on behalf of the Annals of Botany Company.

  17. [Genome-wide identification, phylogenetic analysis and expression profiling of the WOX family genes in Solanum lycopersicum].

    Science.gov (United States)

    Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng

    2016-05-01

    Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.

  18. Positional bias of general and tissue-specific regulatory motifs in mouse gene promoters

    Directory of Open Access Journals (Sweden)

    Farré Domènec

    2007-12-01

    Full Text Available Abstract Background The arrangement of regulatory motifs in gene promoters, or promoter architecture, is the result of mutation and selection processes that have operated over many millions of years. In mammals, tissue-specific transcriptional regulation is related to the presence of specific protein-interacting DNA motifs in gene promoters. However, little is known about the relative location and spacing of these motifs. To fill this gap, we have performed a systematic search for motifs that show significant bias at specific promoter locations in a large collection of housekeeping and tissue-specific genes. Results We observe that promoters driving housekeeping gene expression are enriched in particular motifs with strong positional bias, such as YY1, which are of little relevance in promoters driving tissue-specific expression. We also identify a large number of motifs that show positional bias in genes expressed in a highly tissue-specific manner. They include well-known tissue-specific motifs, such as HNF1 and HNF4 motifs in liver, kidney and small intestine, or RFX motifs in testis, as well as many potentially novel regulatory motifs. Based on this analysis, we provide predictions for 559 tissue-specific motifs in mouse gene promoters. Conclusion The study shows that motif positional bias is an important feature of mammalian proximal promoters and that it affects both general and tissue-specific motifs. Motif positional constraints define very distinct promoter architectures depending on breadth of expression and type of tissue.

  19. Molecular identification and phylogenetic analysis of Dipetalonema evansi (LEWIS, 1882) in camels (Camelus dromedarius) of Iran.

    Science.gov (United States)

    Sazmand, Alireza; Eigner, Barbara; Mirzaei, Mohammad; Hekmatimoghaddam, Seyedhossein; Harl, Josef; Duscher, Georg Gerhard; Fuehrer, Hans-Peter; Joachim, Anja

    2016-04-01

    Despite the economic importance of camels, the parasites that affect them have not received adequate attention so far and molecular studies are scarce compared to other livestock. In this study, we characterized peripheral blood microfilariae in 200 healthy one-humped camels (Camelus dromedarius) from south-east Iran by microscopy and molecular tools to receive a more detailed insight into prevalence and species that affect them. Moreover, adult specimens of the filarial nematode Dipetalonema evansi were collected from the carcass of an infected animal. Microscopic examination was performed on Giemsa-stained blood smears, and blood was also spotted on Whatman FTA(®) cards for DNA analysis. Genomic DNA was extracted, and PCR was carried out for the detection of filaroid helminths, followed by sequence analysis of positive samples. Four samples were positive for microfilariae by microscopy, while 16 animals (8 %) were positive by PCR. Sequence analysis revealed D. evansi in all cases. Phylogenetic analysis of a cytochrome C oxidase subunit I (COI) sequence of filaroid nematodes showed that most species in a single genus cluster in the same clade; however, D. evansi and D. gracile are not monophyletic and branch rather at the base of the tree. Further studies on the life cycle of D. evansi, specifically the identification of intermediate host(s), have become feasible with the provision of the first specific COI sequences in this study.

  20. Computational analyses of synergism in small molecular network motifs.

    Directory of Open Access Journals (Sweden)

    Yili Zhang

    2014-03-01

    Full Text Available Cellular functions and responses to stimuli are controlled by complex regulatory networks that comprise a large diversity of molecular components and their interactions. However, achieving an intuitive understanding of the dynamical properties and responses to stimuli of these networks is hampered by their large scale and complexity. To address this issue, analyses of regulatory networks often focus on reduced models that depict distinct, reoccurring connectivity patterns referred to as motifs. Previous modeling studies have begun to characterize the dynamics of small motifs, and to describe ways in which variations in parameters affect their responses to stimuli. The present study investigates how variations in pairs of parameters affect responses in a series of ten common network motifs, identifying concurrent variations that act synergistically (or antagonistically to alter the responses of the motifs to stimuli. Synergism (or antagonism was quantified using degrees of nonlinear blending and additive synergism. Simulations identified concurrent variations that maximized synergism, and examined the ways in which it was affected by stimulus protocols and the architecture of a motif. Only a subset of architectures exhibited synergism following paired changes in parameters. The approach was then applied to a model describing interlocked feedback loops governing the synthesis of the CREB1 and CREB2 transcription factors. The effects of motifs on synergism for this biologically realistic model were consistent with those for the abstract models of single motifs. These results have implications for the rational design of combination drug therapies with the potential for synergistic interactions.

  1. Identification and analysis of an efficient dicot constitutive promoter from tomato

    International Nuclear Information System (INIS)

    Bacha, S.; Khatoon, A.; Asif, M.; Bashir, A.

    2015-01-01

    The regulatory sequence of sucrose synthase (susy) was explored in HTGS and screened using various bioinformatics tools for promoter prediction and identification of functional regulatory motifs. Transcription start site (TSS) was predicted in the promoter sequence. Species specific motifs were identified by using Plant PAN database. The Plant Care predicted various light responsive, hormone inducible and tissue specific motifs in the full length promoter which may be essential for the constitutive expression governed by this promoter. Full length susy promoter isolated from tomato (Solanum lycopersicum) drove maximum transient expression of GUS gene in various tissues of tobacco, cotton and peas. The susy promoter identified and analyzed in this study is suitable for transgene expression in economically important agricultural crops, especially to avoid strong over-expression. (author)

  2. Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species.

    Science.gov (United States)

    Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf

    2014-01-01

    The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

  3. Methods and statistics for combining motif match scores.

    Science.gov (United States)

    Bailey, T L; Gribskov, M

    1998-01-01

    Position-specific scoring matrices are useful for representing and searching for protein sequence motifs. A sequence family can often be described by a group of one or more motifs, and an effective search must combine the scores for matching a sequence to each of the motifs in the group. We describe three methods for combining match scores and estimating the statistical significance of the combined scores and evaluate the search quality (classification accuracy) and the accuracy of the estimate of statistical significance of each. The three methods are: 1) sum of scores, 2) sum of reduced variates, 3) product of score p-values. We show that method 3) is superior to the other two methods in both regards, and that combining motif scores indeed gives better search accuracy. The MAST sequence homology search algorithm utilizing the product of p-values scoring method is available for interactive use and downloading at URL http:/(/)www.sdsc.edu/MEME.

  4. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    Science.gov (United States)

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  6. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Discovery of novel interacting partners of PSMD9, a proteasomal chaperone: Role of an Atypical and versatile PDZ-domain motif interaction and identification of putative functional modules

    Directory of Open Access Journals (Sweden)

    Nikhil Sangith

    2014-01-01

    Full Text Available PSMD9 (Proteasome Macropain non-ATPase subunit 9, a proteasomal assembly chaperone, harbors an uncharacterized PDZ-like domain. Here we report the identification of five novel interacting partners of PSMD9 and provide the first glimpse at the structure of the PDZ-domain, including the molecular details of the interaction. We based our strategy on two propositions: (a proteins with conserved C-termini may share common functions and (b PDZ domains interact with C-terminal residues of proteins. Screening of C-terminal peptides followed by interactions using full-length recombinant proteins, we discovered hnRNPA1 (an RNA binding protein, S14 (a ribosomal protein, CSH1 (a growth hormone, E12 (a transcription factor and IL6 receptor as novel PSMD9-interacting partners. Through multiple techniques and structural insights, we clearly demonstrate for the first time that human PDZ domain interacts with the predicted Short Linear Sequence Motif (SLIM at the C-termini of the client proteins. These interactions are also recapitulated in mammalian cells. Together, these results are suggestive of the role of PSMD9 in transcriptional regulation, mRNA processing and editing, hormone and receptor activity and protein translation. Our proof-of-principle experiments endorse a novel and quick method for the identification of putative interacting partners of similar PDZ-domain proteins from the proteome and for discovering novel functions.

  8. An Alternative Transcript of the FOG-2 Gene Encodes a FOG-2 Isoform lacking the FOG Repression Motif

    OpenAIRE

    Dale, Rodney M.; Remo, Benjamin F.; Svensson, Eric C.

    2007-01-01

    The FOG family of transcriptional co-factors is composed of two members in mammals: FOG-1 and FOG-2. Both have been shown to bind to GATA factors and function as transcriptional co-repressors in specific cell and promoter contexts. We have previously defined a novel repression domain localized to the N-terminus of each FOG family member, the FOG Repression Motif, which is necessary for FOG-mediated transcriptional repression. In this report, we describe the identification and characterization...

  9. Low-dimensional morphospace of topological motifs in human fMRI brain networks

    Directory of Open Access Journals (Sweden)

    Sarah E. Morgan

    2018-06-01

    Full Text Available We present a low-dimensional morphospace of fMRI brain networks, where axes are defined in a data-driven manner based on the network motifs. The morphospace allows us to identify the key variations in healthy fMRI networks in terms of their underlying motifs, and we observe that two principal components (PCs can account for 97% of the motif variability. The first PC of the motif distribution is correlated with efficiency and inversely correlated with transitivity. Hence this axis approximately conforms to the well-known economical small-world trade-off between integration and segregation in brain networks. Finally, we show that the economical clustering generative model proposed by Vértes et al. (2012 can approximately reproduce the motif morphospace of the real fMRI brain networks, in contrast to other generative models. Overall, the motif morphospace provides a powerful way to visualize the relationships between network properties and to investigate generative or constraining factors in the formation of complex human brain functional networks. Motifs have been described as the building blocks of complex networks. Meanwhile, a morphospace allows networks to be placed in a common space and can reveal the relationships between different network properties and elucidate the driving forces behind network topology. We combine the concepts of motifs and morphospaces to create the first motif morphospace of fMRI brain networks. Crucially, the morphospace axes are defined by the motifs, in a data-driven manner. We observe strong correlations between the networks’ positions in morphospace and their global topological properties, suggesting that motif morphospaces are a powerful way to capture the topology of networks in a low-dimensional space and to compare generative models of brain networks. Motif morphospaces could also be used to study other complex networks’ topologies.

  10. Memetic algorithms for de novo motif-finding in biomedical sequences.

    Science.gov (United States)

    Bi, Chengpeng

    2012-09-01

    The objectives of this study are to design and implement a new memetic algorithm for de novo motif discovery, which is then applied to detect important signals hidden in various biomedical molecular sequences. In this paper, memetic algorithms are developed and tested in de novo motif-finding problems. Several strategies in the algorithm design are employed that are to not only efficiently explore the multiple sequence local alignment space, but also effectively uncover the molecular signals. As a result, there are a number of key features in the implementation of the memetic motif-finding algorithm (MaMotif), including a chromosome replacement operator, a chromosome alteration-aware local search operator, a truncated local search strategy, and a stochastic operation of local search imposed on individual learning. To test the new algorithm, we compare MaMotif with a few of other similar algorithms using simulated and experimental data including genomic DNA, primary microRNA sequences (let-7 family), and transmembrane protein sequences. The new memetic motif-finding algorithm is successfully implemented in C++, and exhaustively tested with various simulated and real biological sequences. In the simulation, it shows that MaMotif is the most time-efficient algorithm compared with others, that is, it runs 2 times faster than the expectation maximization (EM) method and 16 times faster than the genetic algorithm-based EM hybrid. In both simulated and experimental testing, results show that the new algorithm is compared favorably or superior to other algorithms. Notably, MaMotif is able to successfully discover the transcription factors' binding sites in the chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-Seq) data, correctly uncover the RNA splicing signals in gene expression, and precisely find the highly conserved helix motif in the transmembrane protein sequences, as well as rightly detect the palindromic segments in the primary micro

  11. Discovering Motifs in Biological Sequences Using the Micron Automata Processor.

    Science.gov (United States)

    Roy, Indranil; Aluru, Srinivas

    2016-01-01

    Finding approximately conserved sequences, called motifs, across multiple DNA or protein sequences is an important problem in computational biology. In this paper, we consider the (l, d) motif search problem of identifying one or more motifs of length l present in at least q of the n given sequences, with each occurrence differing from the motif in at most d substitutions. The problem is known to be NP-complete, and the largest solved instance reported to date is (26,11). We propose a novel algorithm for the (l,d) motif search problem using streaming execution over a large set of non-deterministic finite automata (NFA). This solution is designed to take advantage of the micron automata processor, a new technology close to deployment that can simultaneously execute multiple NFA in parallel. We demonstrate the capability for solving much larger instances of the (l, d) motif search problem using the resources available within a single automata processor board, by estimating run-times for problem instances (39,18) and (40,17). The paper serves as a useful guide to solving problems using this new accelerator technology.

  12. PISMA: A Visual Representation of Motif Distribution in DNA Sequences

    Directory of Open Access Journals (Sweden)

    Rogelio Alcántara-Silva

    2017-03-01

    Full Text Available Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf .

  13. Aggregation of topological motifs in the Escherichia coli transcriptional regulatory network

    Directory of Open Access Journals (Sweden)

    Barabási Albert-László

    2004-01-01

    Full Text Available Abstract Background Transcriptional regulation of cellular functions is carried out through a complex network of interactions among transcription factors and the promoter regions of genes and operons regulated by them.To better understand the system-level function of such networks simplification of their architecture was previously achieved by identifying the motifs present in the network, which are small, overrepresented, topologically distinct regulatory interaction patterns (subgraphs. However, the interaction of such motifs with each other, and their form of integration into the full network has not been previously examined. Results By studying the transcriptional regulatory network of the bacterium, Escherichia coli, we demonstrate that the two previously identified motif types in the network (i.e., feed-forward loops and bi-fan motifs do not exist in isolation, but rather aggregate into homologous motif clusters that largely overlap with known biological functions. Moreover, these clusters further coalesce into a supercluster, thus establishing distinct topological hierarchies that show global statistical properties similar to the whole network. Targeted removal of motif links disintegrates the network into small, isolated clusters, while random disruptions of equal number of links do not cause such an effect. Conclusion Individual motifs aggregate into homologous motif clusters and a supercluster forming the backbone of the E. coli transcriptional regulatory network and play a central role in defining its global topological organization.

  14. A common minimal motif for the ligands of HLA-B*27 class I molecules.

    Science.gov (United States)

    Barriga, Alejandro; Lorente, Elena; Johnstone, Carolina; Mir, Carmen; del Val, Margarita; López, Daniel

    2014-01-01

    CD8(+) T cells identify and kill infected cells through the specific recognition of short viral antigens bound to human major histocompatibility complex (HLA) class I molecules. The colossal number of polymorphisms in HLA molecules makes it essential to characterize the antigen-presenting properties common to large HLA families or supertypes. In this context, the HLA-B*27 family comprising at least 100 different alleles, some of them widely distributed in the human population, is involved in the cellular immune response against pathogens and also associated to autoimmune spondyloarthritis being thus a relevant target of study. To this end, HLA binding assays performed using nine HLA-B*2705-restricted ligands endogenously processed and presented in virus-infected cells revealed a common minimal peptide motif for efficient binding to the HLA-B*27 family. The motif was independently confirmed using four unrelated peptides. This experimental approach, which could be easily transferred to other HLA class I families and supertypes, has implications for the validation of new bioinformatics tools in the functional clustering of HLA molecules, for the identification of antiviral cytotoxic T lymphocyte responses, and for future vaccine development.

  15. A common minimal motif for the ligands of HLA-B*27 class I molecules.

    Directory of Open Access Journals (Sweden)

    Alejandro Barriga

    Full Text Available CD8(+ T cells identify and kill infected cells through the specific recognition of short viral antigens bound to human major histocompatibility complex (HLA class I molecules. The colossal number of polymorphisms in HLA molecules makes it essential to characterize the antigen-presenting properties common to large HLA families or supertypes. In this context, the HLA-B*27 family comprising at least 100 different alleles, some of them widely distributed in the human population, is involved in the cellular immune response against pathogens and also associated to autoimmune spondyloarthritis being thus a relevant target of study. To this end, HLA binding assays performed using nine HLA-B*2705-restricted ligands endogenously processed and presented in virus-infected cells revealed a common minimal peptide motif for efficient binding to the HLA-B*27 family. The motif was independently confirmed using four unrelated peptides. This experimental approach, which could be easily transferred to other HLA class I families and supertypes, has implications for the validation of new bioinformatics tools in the functional clustering of HLA molecules, for the identification of antiviral cytotoxic T lymphocyte responses, and for future vaccine development.

  16. Parallel motif extraction from very long sequences

    KAUST Repository

    Sahli, Majed

    2013-01-01

    Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern applications require mining of motifs in one very long sequence (i.e., in the order of several gigabytes). For this case, there exist statistical approaches that are fast but inaccurate; or combinatorial methods that are sound and complete. Unfortunately, existing combinatorial methods are serial and very slow. Consequently, they are limited to very short sequences (i.e., a few megabytes), small alphabets (typically 4 symbols for DNA sequences), and restricted types of motifs. This paper presents ACME, a combinatorial method for extracting motifs from a single very long sequence. ACME arranges the search space in contiguous blocks that take advantage of the cache hierarchy in modern architectures, and achieves almost an order of magnitude performance gain in serial execution. It also decomposes the search space in a smart way that allows scalability to thousands of processors with more than 90% speedup. ACME is the only method that: (i) scales to gigabyte-long sequences; (ii) handles large alphabets; (iii) supports interesting types of motifs with minimal additional cost; and (iv) is optimized for a variety of architectures such as multi-core systems, clusters in the cloud, and supercomputers. ACME reduces the extraction time for an exact-length query from 4 hours to 7 minutes on a typical workstation; handles 3 orders of magnitude longer sequences; and scales up to 16, 384 cores on a supercomputer. Copyright is held by the owner/author(s).

  17. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  18. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  19. MODA: an efficient algorithm for network motif discovery in biological networks.

    Science.gov (United States)

    Omidi, Saeed; Schreiber, Falk; Masoudi-Nejad, Ali

    2009-10-01

    In recent years, interest has been growing in the study of complex networks. Since Erdös and Rényi (1960) proposed their random graph model about 50 years ago, many researchers have investigated and shaped this field. Many indicators have been proposed to assess the global features of networks. Recently, an active research area has developed in studying local features named motifs as the building blocks of networks. Unfortunately, network motif discovery is a computationally hard problem and finding rather large motifs (larger than 8 nodes) by means of current algorithms is impractical as it demands too much computational effort. In this paper, we present a new algorithm (MODA) that incorporates techniques such as a pattern growth approach for extracting larger motifs efficiently. We have tested our algorithm and found it able to identify larger motifs with more than 8 nodes more efficiently than most of the current state-of-the-art motif discovery algorithms. While most of the algorithms rely on induced subgraphs as motifs of the networks, MODA is able to extract both induced and non-induced subgraphs simultaneously. The MODA source code is freely available at: http://LBB.ut.ac.ir/Download/LBBsoft/MODA/

  20. Exopolysaccharide-associated protein sorting in environmental organisms: the PEP-CTERM/EpsH system. Application of a novel phylogenetic profiling heuristic

    Directory of Open Access Journals (Sweden)

    Ward Naomi

    2006-08-01

    Full Text Available Abstract Background Protein translocation to the proper cellular destination may be guided by various classes of sorting signals recognizable in the primary sequence. Detection in some genomes, but not others, may reveal sorting system components by comparison of the phylogenetic profile of the class of sorting signal to that of various protein families. Results We describe a short C-terminal homology domain, sporadically distributed in bacteria, with several key characteristics of protein sorting signals. The domain includes a near-invariant motif Pro-Glu-Pro (PEP. This possible recognition or processing site is followed by a predicted transmembrane helix and a cluster rich in basic amino acids. We designate this domain PEP-CTERM. It tends to occur multiple times in a genome if it occurs at all, with a median count of eight instances; Verrucomicrobium spinosum has sixty-five. PEP-CTERM-containing proteins generally contain an N-terminal signal peptide and exhibit high diversity and little homology to known proteins. All bacteria with PEP-CTERM have both an outer membrane and exopolysaccharide (EPS production genes. By a simple heuristic for screening phylogenetic profiles in the absence of pre-formed protein families, we discovered that a homolog of the membrane protein EpsH (exopolysaccharide locus protein H occurs in a species when PEP-CTERM domains are found. The EpsH family contains invariant residues consistent with a transpeptidase function. Most PEP-CTERM proteins are encoded by single-gene operons preceded by large intergenic regions. In the Proteobacteria, most of these upstream regions share a DNA sequence, a probable cis-regulatory site that contains a sigma-54 binding motif. The phylogenetic profile for this DNA sequence exactly matches that of three proteins: a sigma-54-interacting response regulator (PrsR, a transmembrane histidine kinase (PrsK, and a TPR protein (PrsT. Conclusion These findings are consistent with the hypothesis

  1. Analysis of the secondary structure of ITS transcripts in peritrich ciliates (Ciliophora, Oligohymenophorea): implications for structural evolution and phylogenetic reconstruction.

    Science.gov (United States)

    Sun, Ping; Clamp, John C; Xu, Dapeng

    2010-07-01

    Despite extensive previous morphological work, little agreement has been reached about phylogenetic relationships among peritrich ciliates, making it difficult to study the evolution of the group in a phylogenetic framework. In this study, the nucleotide characteristics and secondary structures of internal transcribed spacers 1 and 2 (ITS1 and ITS2) of 26 peritrich ciliates in 12 genera were analyzed. Information from secondary structures of ITS1 and ITS2 then was used to perform the first systematic study of ITS regions in peritrich ciliates, including one species of Rhabdostyla for which no sequence has been reported previously. Lengths of ITS1 and ITS2 sequences varied relatively little among taxa studied, but their G+C content was highly variable. General secondary structure models of ITS1 and ITS2 were proposed for peritrich ciliates and their reliability was assessed by compensatory base changes. The secondary structure of ITS1 contains three major helices in peritrich ciliates and deviations from this basic structure were found in all taxa examined. The core structure of peritrich ITS2 includes four helices, with helix III as the longest and containing a motif 5'-MAC versus GUK-3' at its apex as well as a YU-UY mismatch in helix II. In addition, the structural motifs of both ITS secondary structures were identified. Phylogenetic analyses using ITS data were performed by means of Bayesian inference, maximum likelihood and neighbor joining methods. Trees had a consistent branching pattern that included the following features: (1) Rhabdostyla always clustered with members of the family Vorticellidae, instead of members of the family Epistylididae, in which it is now classified on the basis of morphology. (2) The systematically questionable genus Ophrydium closely associated with Carchesium, forming a clearly defined, monophyletic group within the Vorticellidae. This supported the hypothesis derived from previous study based on small subunit rRNA gene sequences

  2. Dynamic motifs in socio-economic networks

    Science.gov (United States)

    Zhang, Xin; Shao, Shuai; Stanley, H. Eugene; Havlin, Shlomo

    2014-12-01

    Socio-economic networks are of central importance in economic life. We develop a method of identifying and studying motifs in socio-economic networks by focusing on “dynamic motifs,” i.e., evolutionary connection patterns that, because of “node acquaintances” in the network, occur much more frequently than random patterns. We examine two evolving bi-partite networks: i) the world-wide commercial ship chartering market and ii) the ship build-to-order market. We find similar dynamic motifs in both bipartite networks, even though they describe different economic activities. We also find that “influence” and “persistence” are strong factors in the interaction behavior of organizations. When two companies are doing business with the same customer, it is highly probable that another customer who currently only has business relationship with one of these two companies, will become customer of the second in the future. This is the effect of influence. Persistence means that companies with close business ties to customers tend to maintain their relationships over a long period of time.

  3. Phenotypic and phylogenetic identification of coliform bacteria obtained from 12 USEPA approved coliform methods

    KAUST Repository

    Zhang, Ya

    2015-06-26

    The current definition of coliform bacteria is method-dependent, and when different culture-based methods are used, discrepancies in results can occur and affect the accuracy in identifying true coliforms. This study used an alternative approach to identify true coliforms by combing the phenotypic traits of the coliform isolates and the phylogenetic affiliation of 16S rRNA gene sequences together with the use of lacZ and uidA genes. A collection of 1404 isolates from 12 US Environmental Protection Agency approved coliform-testing methods were characterized based on their phylogenetic affiliations and responses to their original isolation medium and Lauryl Tryptose broth, m-Endo and MI agar media. Isolates were phylogenetically classified into 32 true coliform or targeted Enterobacteriaceae (TE) groups, and 14 non-coliform or non-targeted Enterbacteriaceae (NTE) groups. It was statistically shown that detecting true-positive (TP) events is more challenging than detecting true-negative (TN) events. Furthermore, most false-negative (FN) events were associated with four TE groups (i.e., Serratia group I, Providencia, Proteus, and Morganella), and most false-positive (FP) events with two NTE groups, Aeromonas and Plesiomonas. In Escherichia coli testing, 18 out of 145 E. coli isolates identified by those enzymatic methods were validated as FNs. The reasons behind the FP and FN reactions could be explained through the analysis of the lacZ and uidA gene. Overall, combining the analyses of 16S rRNA, lacZ and uidA genes with the growth responses of TE and NTE on culture-based media is an effective way to evaluate the performance of coliform detection methods.

  4. Phenotypic and phylogenetic identification of coliform bacteria obtained from 12 USEPA approved coliform methods

    KAUST Repository

    Zhang, Ya; Hong, Pei-Ying; LeChevallier, Mark W.; Liu, Wen-Tso

    2015-01-01

    The current definition of coliform bacteria is method-dependent, and when different culture-based methods are used, discrepancies in results can occur and affect the accuracy in identifying true coliforms. This study used an alternative approach to identify true coliforms by combing the phenotypic traits of the coliform isolates and the phylogenetic affiliation of 16S rRNA gene sequences together with the use of lacZ and uidA genes. A collection of 1404 isolates from 12 US Environmental Protection Agency approved coliform-testing methods were characterized based on their phylogenetic affiliations and responses to their original isolation medium and Lauryl Tryptose broth, m-Endo and MI agar media. Isolates were phylogenetically classified into 32 true coliform or targeted Enterobacteriaceae (TE) groups, and 14 non-coliform or non-targeted Enterbacteriaceae (NTE) groups. It was statistically shown that detecting true-positive (TP) events is more challenging than detecting true-negative (TN) events. Furthermore, most false-negative (FN) events were associated with four TE groups (i.e., Serratia group I, Providencia, Proteus, and Morganella), and most false-positive (FP) events with two NTE groups, Aeromonas and Plesiomonas. In Escherichia coli testing, 18 out of 145 E. coli isolates identified by those enzymatic methods were validated as FNs. The reasons behind the FP and FN reactions could be explained through the analysis of the lacZ and uidA gene. Overall, combining the analyses of 16S rRNA, lacZ and uidA genes with the growth responses of TE and NTE on culture-based media is an effective way to evaluate the performance of coliform detection methods.

  5. The animal sialyltransferases and sialyltransferase-related genes: a phylogenetic approach.

    Science.gov (United States)

    Harduin-Lepers, Anne; Mollicone, Rosella; Delannoy, Philippe; Oriol, Rafael

    2005-08-01

    The animal sialyltransferases are Golgi type II transmembrane glycosyltransferases. Twenty distinct sialyltransferases have been identified in both human and murine genomes. These enzymes catalyze transfer of sialic acid from CMP-Neu5Ac to the glycan moiety of glycoconjugates. Despite low overall identities, they share four conserved peptide motifs [L (large), S (small), motif III, and motif VS (very small)] that are hallmarks for sialyltransferase identification. We have identified 155 new putative genes in 25 animal species, and we have exploited two lines of evidence: (1) sequence comparisons and (2) exon-intron organization of the genes. An ortholog to the ancestor present before the split of ST6Gal I and II subfamilies was detected in arthropods. An ortholog to the ancestor present before the split of ST6GalNAc III, IV, V, and VI subfamilies was detected in sea urchin. An ortholog to the ancestor present before the split of ST3Gal I and II subfamilies was detected in ciona, and an ortholog to the ancestor of all the ST8Sia was detected in amphioxus. Therefore, single examples of the four families (ST3Gal, ST6Gal, ST6GalNAc, and ST8Sia) have appeared in invertebrates, earlier than previously thought, whereas the four families were all detected in bony fishes, amphibians, birds, and mammals. As previously hypothesized, sequence similarities among sialyltransferases suggest a common genetic origin, by successive duplications of an ancestral gene, followed by divergent evolution. Finally, we propose predictions on these invertebrates sialyltransferase-related activities that have not previously been demonstrated and that will ultimately need to be substantiated by protein expression and enzymatic activity assays.

  6. Composite Structural Motifs of Binding Sites for Delineating Biological Functions of Proteins

    Science.gov (United States)

    Kinjo, Akira R.; Nakamura, Haruki

    2012-01-01

    Most biological processes are described as a series of interactions between proteins and other molecules, and interactions are in turn described in terms of atomic structures. To annotate protein functions as sets of interaction states at atomic resolution, and thereby to better understand the relation between protein interactions and biological functions, we conducted exhaustive all-against-all atomic structure comparisons of all known binding sites for ligands including small molecules, proteins and nucleic acids, and identified recurring elementary motifs. By integrating the elementary motifs associated with each subunit, we defined composite motifs that represent context-dependent combinations of elementary motifs. It is demonstrated that function similarity can be better inferred from composite motif similarity compared to the similarity of protein sequences or of individual binding sites. By integrating the composite motifs associated with each protein function, we define meta-composite motifs each of which is regarded as a time-independent diagrammatic representation of a biological process. It is shown that meta-composite motifs provide richer annotations of biological processes than sequence clusters. The present results serve as a basis for bridging atomic structures to higher-order biological phenomena by classification and integration of binding site structures. PMID:22347478

  7. Identification of a tripartite import signal in the Ewing Sarcoma protein (EWS)

    International Nuclear Information System (INIS)

    Shaw, Debra J.; Morse, Robert; Todd, Adrian G.; Eggleton, Paul; Lorson, Christian L.; Young, Philip J.

    2009-01-01

    The Ewing Sarcoma (EWS) protein is a ubiquitously expressed RNA processing factor that localises predominantly to the nucleus. However, the mechanism through which EWS enters the nucleus remains unclear, with differing reports identifying three separate import signals within the EWS protein. Here we have utilized a panel of truncated EWS proteins to clarify the reported nuclear localisation signals. We describe three C-terminal domains that are important for efficient EWS nuclear localization: (1) the third RGG-motif; (2) the last 10 amino acids (known as the PY-import motif); and (3) the zinc-finger motif. Although these three domains are involved in nuclear import, they are not independently capable of driving the efficient import of a GFP-moiety. However, collectively they form a complex tripartite signal that efficiently drives GFP-import into the nucleus. This study helps clarify the EWS import signal, and the identification of the involvement of both the RGG- and zinc-finger motifs has wide reaching implications.

  8. Identification of a tripartite import signal in the Ewing Sarcoma protein (EWS)

    Energy Technology Data Exchange (ETDEWEB)

    Shaw, Debra J.; Morse, Robert; Todd, Adrian G. [Clinical Neurobiology, IBCS, Peninsula College of Medicine and Dentistry, Exeter EX1 2LU (United Kingdom); Eggleton, Paul [Inflammation and Musculoskeletal Disease, IBCS, Peninsula College of Medicine and Dentistry, Exeter EX1 2LU (United Kingdom); MRC Immunochemistry Unit, University of Oxford, Oxford OX1 3QU (United Kingdom); Lorson, Christian L. [Department of Veterinary Pathobiology, Bond Life Sciences Center, 1201 Rollins Road, University of Missouri, Columbia, MO 65211 (United States); Young, Philip J., E-mail: philip.young@pms.ac.uk [Clinical Neurobiology, IBCS, Peninsula College of Medicine and Dentistry, Exeter EX1 2LU (United Kingdom)

    2009-12-25

    The Ewing Sarcoma (EWS) protein is a ubiquitously expressed RNA processing factor that localises predominantly to the nucleus. However, the mechanism through which EWS enters the nucleus remains unclear, with differing reports identifying three separate import signals within the EWS protein. Here we have utilized a panel of truncated EWS proteins to clarify the reported nuclear localisation signals. We describe three C-terminal domains that are important for efficient EWS nuclear localization: (1) the third RGG-motif; (2) the last 10 amino acids (known as the PY-import motif); and (3) the zinc-finger motif. Although these three domains are involved in nuclear import, they are not independently capable of driving the efficient import of a GFP-moiety. However, collectively they form a complex tripartite signal that efficiently drives GFP-import into the nucleus. This study helps clarify the EWS import signal, and the identification of the involvement of both the RGG- and zinc-finger motifs has wide reaching implications.

  9. Probing structural changes of self assembled i-motif DNA

    KAUST Repository

    Lee, Iljoon; Patil, Sachin; Fhayli, Karim; Alsaiari, Shahad K.; Khashab, Niveen M.

    2015-01-01

    We report an i-motif structural probing system based on Thioflavin T (ThT) as a fluorescent sensor. This probe can discriminate the structural changes of RET and Rb i-motif sequences according to pH change. This journal is

  10. Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated

    Directory of Open Access Journals (Sweden)

    Down Thomas A

    2010-09-01

    Full Text Available Abstract Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS" but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq not to be biological transcription factor binding sites ("empirical TFBS". We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation.

  11. Genomic and phylogenetic characterization of luminous bacteria symbiotic with the deep-sea fish Chlorophthalmus albatrossis (Aulopiformes: Chlorophthalmidae).

    Science.gov (United States)

    Dunlap, Paul V; Ast, Jennifer C

    2005-02-01

    Bacteria forming light-organ symbiosis with deep-sea chlorophthalmid fishes (Aulopiformes: Chlorophthalmidae) are considered to belong to the species Photobacterium phosphoreum. The identification of these bacteria as P. phosphoreum, however, was based exclusively on phenotypic traits, which may not discriminate between phenetically similar but evolutionarily distinct luminous bacteria. Therefore, to test the species identification of chlorophthalmid symbionts, we carried out a genomotypic (repetitive element palindromic PCR genomic profiling) and phylogenetic analysis on strains isolated from the perirectal light organ of Chlorophthalmus albatrossis. Sequence analysis of the 16S rRNA gene of 10 strains from 5 fish specimens placed these bacteria in a cluster related to but phylogenetically distinct from the type strain of P. phosphoreum, ATCC 11040(T), and the type strain of Photobacterium iliopiscarium, ATCC 51760(T). Analysis of gyrB resolved the C. albatrossis strains as a strongly supported clade distinct from P. phosphoreum and P. iliopiscarium. Genomic profiling of 109 strains from the 5 C. albatrossis specimens revealed a high level of similarity among strains but allowed identification of genomotypically different types from each fish. Representatives of each type were then analyzed phylogenetically, using sequence of the luxABFE genes. As with gyrB, analysis of luxABFE resolved the C. albatrossis strains as a robustly supported clade distinct from P. phosphoreum. Furthermore, other strains of luminous bacteria reported as P. phosphoreum, i.e., NCIMB 844, from the skin of Merluccius capensis (Merlucciidae), NZ-11D, from the light organ of Nezumia aequalis (Macrouridae), and pjapo.1.1, from the light organ of Physiculus japonicus (Moridae), grouped phylogenetically by gyrB and luxABFE with the C. albatrossis strains, not with ATCC 11040(T). These results demonstrate that luminous bacteria symbiotic with C. albatrossis, together with certain other strains of

  12. Phylogenetic radiation of the greenbottle flies (Diptera, Calliphoridae, Luciliinae)

    Science.gov (United States)

    Williams, Kirstin A.; Lamb, Jennifer; Villet, Martin H.

    2016-01-01

    Abstract The subfamily Luciliinae is diverse and geographically widespread. Its four currently recognised genera (Dyscritomyia Grimshaw, 1901, Hemipyrellia Townsend, 1918, Hypopygiopsis Townsend 1916 and Lucilia Robineau-Desvoidy, 1830) contain species that range from saprophages to obligate parasites, but their pattern of phylogenetic diversification is unclear. The 28S rRNA, COI and Period genes of 14 species of Lucilia and Hemipyrellia were partially sequenced and analysed together with sequences of 11 further species from public databases. The molecular data confirmed molecular paraphyly in three species-pairs in Lucilia that hamper barcode identifications of those six species. Lucilia sericata and Lucilia cuprina were confirmed as mutual sister species. The placements of Dyscritomyia and Hypopygiopsis were ambiguous, since both made Lucilia paraphyletic in some analyses. Recognising Hemipyrellia as a genus consistently left Lucilia s.l. paraphyletic, and the occasionally-recognised (sub)genus Phaenicia was consistently paraphyletic, so these taxa should be synonymised with Lucilia to maintain monophyly. Analysis of a matrix of 14 morphological characters scored for adults of all genera and for most of the species included in the molecular analysis confirmed several of these findings. The different degrees of parasitism were phylogenetically clustered within this genus but did not form a graded series of evolutionary stages, and there was no particular relationship between feeding habits and biogeography. Because of the ubiquity of hybridization, introgression and incomplete lineage sorting in blow flies, we recommend that using a combination of mitochondrial and nuclear markers should be a procedural standard for medico-criminal forensic identifications of insects. PMID:27103874

  13. BlockLogo: Visualization of peptide and sequence motif conservation

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian

    2013-01-01

    BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...

  14. Epitope discovery with phylogenetic hidden Markov models.

    LENUS (Irish Health Repository)

    Lacerda, Miguel

    2010-05-01

    Existing methods for the prediction of immunologically active T-cell epitopes are based on the amino acid sequence or structure of pathogen proteins. Additional information regarding the locations of epitopes may be acquired by considering the evolution of viruses in hosts with different immune backgrounds. In particular, immune-dependent evolutionary patterns at sites within or near T-cell epitopes can be used to enhance epitope identification. We have developed a mutation-selection model of T-cell epitope evolution that allows the human leukocyte antigen (HLA) genotype of the host to influence the evolutionary process. This is one of the first examples of the incorporation of environmental parameters into a phylogenetic model and has many other potential applications where the selection pressures exerted on an organism can be related directly to environmental factors. We combine this novel evolutionary model with a hidden Markov model to identify contiguous amino acid positions that appear to evolve under immune pressure in the presence of specific host immune alleles and that therefore represent potential epitopes. This phylogenetic hidden Markov model provides a rigorous probabilistic framework that can be combined with sequence or structural information to improve epitope prediction. As a demonstration, we apply the model to a data set of HIV-1 protein-coding sequences and host HLA genotypes.

  15. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  16. Genome Analysis of Conserved Dehydrin Motifs in Vascular Plants

    Directory of Open Access Journals (Sweden)

    Ahmad A. Malik

    2017-05-01

    Full Text Available Dehydrins, a large family of abiotic stress proteins, are defined by the presence of a mostly conserved motif known as the K-segment, and may also contain two other conserved motifs known as the Y-segment and S-segment. Using the dehydrin literature, we developed a sequence motif definition of the K-segment, which we used to create a large dataset of dehydrin sequences by searching the Pfam00257 dehydrin dataset and the Phytozome 10 sequences of vascular plants. A comprehensive analysis of these sequences reveals that lysine residues are highly conserved in the K-segment, while the amino acid type is often conserved at other positions. Despite the Y-segment name, the central tyrosine is somewhat conserved, but can be substituted with two other small aromatic amino acids (phenylalanine or histidine. The S-segment contains a series of serine residues, but in some proteins is also preceded by a conserved LHR sequence. In many dehydrins containing all three of these motifs the S-segment is linked to the K-segment by a GXGGRRKK motif (where X can be any amino acid, suggesting a functional linkage between these two motifs. An analysis of the sequences shows that the dehydrin architecture and several biochemical properties (isoelectric point, molecular mass, and hydrophobicity score are dependent on each other, and that some dehydrin architectures are overexpressed during certain abiotic stress, suggesting that they may be optimized for a specific abiotic stress while others are involved in all forms of dehydration stress (drought, cold, and salinity.

  17. RegRNA: an integrated web server for identifying regulatory RNA motifs and elements

    OpenAIRE

    Huang, Hsi-Yuan; Chien, Chia-Hung; Jen, Kuan-Hua; Huang, Hsien-Da

    2006-01-01

    Numerous regulatory structural motifs have been identified as playing essential roles in transcriptional and post-transcriptional regulation of gene expression. RegRNA is an integrated web server for identifying the homologs of regulatory RNA motifs and elements against an input mRNA sequence. Both sequence homologs and structural homologs of regulatory RNA motifs can be recognized. The regulatory RNA motifs supported in RegRNA are categorized into several classes: (i) motifs in mRNA 5′-untra...

  18. Genome-wide identification and analysis of basic helix-loop-helix domains in dog, Canis lupus familiaris.

    Science.gov (United States)

    Wang, Xu-Hua; Wang, Yong; Liu, A-Ke; Liu, Xiao-Ting; Zhou, Yang; Yao, Qin; Chen, Ke-Ping

    2015-04-01

    The basic helix-loop-helix (bHLH) domain is a highly conserved amino acid motif that defines a group of DNA-binding transcription factors. bHLH proteins play essential regulatory roles in a variety of biological processes in animal, plant, and fungus. The domestic dog, Canis lupus familiaris, is a good model organism for genetic, physiological, and behavioral studies. In this study, we identified 115 putative bHLH genes in the dog genome. Based on a phylogenetic analysis, 51, 26, 14, 4, 12, and 4 dog bHLH genes were assigned to six separate groups (A-F); four bHLH genes were categorized as ''orphans''. Within-group evolutionary relationships inferred from the phylogenetic analysis were consistent with positional conservation, other conserved domains flanking the bHLH motif, and highly conserved intron/exon patterns in other vertebrates. Our analytical results confirmed the GenBank annotations of 89 dog bHLH proteins and provided information that could be used to update the annotations of the remaining 26 dog bHLH proteins. These data will provide good references for further studies on the structures and regulatory functions of bHLH proteins in the growth and development of dogs, which may help in understanding the mechanisms that underlie the physical and behavioral differences between dogs and wolves.

  19. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  20. Enrichment of Circular Code Motifs in the Genes of the Yeast Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Christian J. Michel

    2017-12-01

    Full Text Available A set X of 20 trinucleotides has been found to have the highest average occurrence in the reading frame, compared to the two shifted frames, of genes of bacteria, archaea, eukaryotes, plasmids and viruses. This set X has an interesting mathematical property, since X is a maximal C 3 self-complementary trinucleotide circular code. Furthermore, any motif obtained from this circular code X has the capacity to retrieve, maintain and synchronize the original (reading frame. Since 1996, the theory of circular codes in genes has mainly been developed by analysing the properties of the 20 trinucleotides of X , using combinatorics and statistical approaches. For the first time, we test this theory by analysing the X motifs, i.e., motifs from the circular code X , in the complete genome of the yeast Saccharomyces cerevisiae. Several properties of X motifs are identified by basic statistics (at the frequency level, and evaluated by comparison to R motifs, i.e., random motifs generated from 30 different random codes R . We first show that the frequency of X motifs is significantly greater than that of R motifs in the genome of S. cerevisiae. We then verify that no significant difference is observed between the frequencies of X and R motifs in the non-coding regions of S. cerevisiae, but that the occurrence number of X motifs is significantly higher than R motifs in the genes (protein-coding regions. This property is true for all cardinalities of X motifs (from 4 to 20 and for all 16 chromosomes. We further investigate the distribution of X motifs in the three frames of S. cerevisiae genes and show that they occur more frequently in the reading frame, regardless of their cardinality or their length. Finally, the ratio of X genes, i.e., genes with at least one X motif, to non- X genes, in the set of verified genes is significantly different to that observed in the set of putative or dubious genes with no experimental evidence. These results, taken together

  1. Enrichment of Circular Code Motifs in the Genes of the Yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Michel, Christian J; Ngoune, Viviane Nguefack; Poch, Olivier; Ripp, Raymond; Thompson, Julie D

    2017-12-03

    A set X of 20 trinucleotides has been found to have the highest average occurrence in the reading frame, compared to the two shifted frames, of genes of bacteria, archaea, eukaryotes, plasmids and viruses. This set X has an interesting mathematical property, since X is a maximal C3 self-complementary trinucleotide circular code. Furthermore, any motif obtained from this circular code X has the capacity to retrieve, maintain and synchronize the original (reading) frame. Since 1996, the theory of circular codes in genes has mainly been developed by analysing the properties of the 20 trinucleotides of X, using combinatorics and statistical approaches. For the first time, we test this theory by analysing the X motifs, i.e., motifs from the circular code X, in the complete genome of the yeast Saccharomyces cerevisiae . Several properties of X motifs are identified by basic statistics (at the frequency level), and evaluated by comparison to R motifs, i.e., random motifs generated from 30 different random codes R. We first show that the frequency of X motifs is significantly greater than that of R motifs in the genome of S. cerevisiae . We then verify that no significant difference is observed between the frequencies of X and R motifs in the non-coding regions of S. cerevisiae , but that the occurrence number of X motifs is significantly higher than R motifs in the genes (protein-coding regions). This property is true for all cardinalities of X motifs (from 4 to 20) and for all 16 chromosomes. We further investigate the distribution of X motifs in the three frames of S. cerevisiae genes and show that they occur more frequently in the reading frame, regardless of their cardinality or their length. Finally, the ratio of X genes, i.e., genes with at least one X motif, to non-X genes, in the set of verified genes is significantly different to that observed in the set of putative or dubious genes with no experimental evidence. These results, taken together, represent the first

  2. Phenotypic differentiation and phylogenetic signal of wing shape in western European biting midges, Culicoides spp., of the subgenus Avaritia

    DEFF Research Database (Denmark)

    Muñoz-Muñoz, F.; Talavera, S.; Carpenter, S.

    2014-01-01

    of cytochrome oxidase subunit I barcode sequencing and geometric morphometric analyses to investigate wing shape as a means to infer species identification within this subgenus. In addition the congruence of morphological data with different phylogenetic hypotheses is tested. Five different species...

  3. The Complete Mitochondrial Genome of Corizus tetraspilus (Hemiptera: Rhopalidae) and Phylogenetic Analysis of Pentatomomorpha

    Science.gov (United States)

    Guo, Zhong-Long; Wang, Juan; Shen, Yu-Ying

    2015-01-01

    Insect mitochondrial genome (mitogenome) are the most extensively used genetic information for molecular evolution, phylogenetics and population genetics. Pentatomomorpha (>14,000 species) is the second largest infraorder of Heteroptera and of great economic importance. To better understand the diversity and phylogeny within Pentatomomorpha, we sequenced and annotated the complete mitogenome of Corizus tetraspilus (Hemiptera: Rhopalidae), an important pest of alfalfa in China. We analyzed the main features of the C. tetraspilus mitogenome, and provided a comparative analysis with four other Coreoidea species. Our results reveal that gene content, gene arrangement, nucleotide composition, codon usage, rRNA structures and sequences of mitochondrial transcription termination factor are conserved in Coreoidea. Comparative analysis shows that different protein-coding genes have been subject to different evolutionary rates correlated with the G+C content. All the transfer RNA genes found in Coreoidea have the typical clover leaf secondary structure, except for trnS1 (AGN) which lacks the dihydrouridine (DHU) arm and possesses a unusual anticodon stem (9 bp vs. the normal 5 bp). The control regions (CRs) among Coreoidea are highly variable in size, of which the CR of C. tetraspilus is the smallest (440 bp), making the C. tetraspilus mitogenome the smallest (14,989 bp) within all completely sequenced Coreoidea mitogenomes. No conserved motifs are found in the CRs of Coreoidea. In addition, the A+T content (60.68%) of the CR of C. tetraspilus is much lower than that of the entire mitogenome (74.88%), and is lowest among Coreoidea. Phylogenetic analyses based on mitogenomic data support the monophyly of each superfamily within Pentatomomorpha, and recognize a phylogenetic relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))). PMID:26042898

  4. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D

    2015-05-13

    Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).

  5. Ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses.

    Science.gov (United States)

    Fouquier, Jennifer; Rideout, Jai Ram; Bolyen, Evan; Chase, John; Shiffer, Arron; McDonald, Daniel; Knight, Rob; Caporaso, J Gregory; Kelley, Scott T

    2016-02-24

    Fungi play critical roles in many ecosystems, cause serious diseases in plants and animals, and pose significant threats to human health and structural integrity problems in built environments. While most fungal diversity remains unknown, the development of PCR primers for the internal transcribed spacer (ITS) combined with next-generation sequencing has substantially improved our ability to profile fungal microbial diversity. Although the high sequence variability in the ITS region facilitates more accurate species identification, it also makes multiple sequence alignment and phylogenetic analysis unreliable across evolutionarily distant fungi because the sequences are hard to align accurately. To address this issue, we created ghost-tree, a bioinformatics tool that integrates sequence data from two genetic markers into a single phylogenetic tree that can be used for diversity analyses. Our approach starts with a "foundation" phylogeny based on one genetic marker whose sequences can be aligned across organisms spanning divergent taxonomic groups (e.g., fungal families). Then, "extension" phylogenies are built for more closely related organisms (e.g., fungal species or strains) using a second more rapidly evolving genetic marker. These smaller phylogenies are then grafted onto the foundation tree by mapping taxonomic names such that each corresponding foundation-tree tip would branch into its new "extension tree" child. We applied ghost-tree to graft fungal extension phylogenies derived from ITS sequences onto a foundation phylogeny derived from fungal 18S sequences. Our analysis of simulated and real fungal ITS data sets found that phylogenetic distances between fungal communities computed using ghost-tree phylogenies explained significantly more variance than non-phylogenetic distances. The phylogenetic metrics also improved our ability to distinguish small differences (effect sizes) between microbial communities, though results were similar to non-phylogenetic

  6. RNA recognition motif (RRM)-containing proteins in Bombyx mori

    African Journals Online (AJOL)

    STORAGESEVER

    2009-03-20

    Mar 20, 2009 ... Recognition Motif (RRM), sometimes referred to as. RNP1, is one of the first identified domains for RNA interaction. RRM is very common ..... Apart from the RRM motif, eIF3-S9 has a Trp-Asp. (WD) repeat domain, Poly (A) ...

  7. Biomimetic trapping cocktail to screen reactive metabolites: use of an amino acid and DNA motif mixture as light/heavy isotope pairs differing in mass shift.

    Science.gov (United States)

    Hosaka, Shuto; Honda, Takuto; Lee, Seon Hwa; Oe, Tomoyuki

    2018-06-01

    Candidate drugs that can be metabolically transformed into reactive electrophilic products, such as epoxides, quinones, and nitroso compounds, are of special concern because subsequent covalent binding to bio-macromolecules can cause adverse drug reactions, such as allergic reactions, hepatotoxicity, and genotoxicity. Several strategies have been reported for screening reactive metabolites, such as a covalent binding assay with radioisotope-labeled drugs and a trapping method followed by LC-MS/MS analyses. Of these, a trapping method using glutathione is the most common, especially at the early stage of drug development. However, the cysteine of glutathione is not the only nucleophilic site in vivo; lysine, histidine, arginine, and DNA bases are also nucleophilic. Indeed, the glutathione trapping method tends to overlook several types of reactive metabolites, such as aldehydes, acylglucuronides, and nitroso compounds. Here, we introduce an alternate way for screening reactive metabolites as follows: A mixture of the light and heavy isotopes of simplified amino acid motifs and a DNA motif is used as a biomimetic trapping cocktail. This mixture consists of [ 2 H 0 ]/[ 2 H 3 ]-1-methylguanidine (arginine motif, Δ 3 Da), [ 2 H 0 ]/[ 2 H 4 ]-2-mercaptoethanol (cysteine motif, Δ 4 Da), [ 2 H 0 ]/[ 2 H 5 ]-4-methylimidazole (histidine motif, Δ 5 Da), [ 2 H 0 ]/[ 2 H 9 ]-n-butylamine (lysine motif, Δ 9 Da), and [ 13 C 0 , 15 N 0 ]/[ 13 C 1 , 15 N 2 ]-2'-deoxyguanosine (DNA motif, Δ 3 Da). Mass tag triggered data-dependent acquisition is used to find the characteristic doublet peaks, followed by specific identification of the light isotope peak using MS/MS. Forty-two model drugs were examined using an in vitro microsome experiment to validate the strategy. Graphical abstract Biomimetic trapping cocktail to screen reactive metabolites.

  8. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  9. One motif to bind them: A small-XXX-small motif affects transmembrane domain 1 oligomerization, function, localization, and cross-talk between two yeast GPCRs.

    Science.gov (United States)

    Lock, Antonia; Forfar, Rachel; Weston, Cathryn; Bowsher, Leo; Upton, Graham J G; Reynolds, Christopher A; Ladds, Graham; Dixon, Ann M

    2014-12-01

    G protein-coupled receptors (GPCRs) are the largest family of cell-surface receptors in mammals and facilitate a range of physiological responses triggered by a variety of ligands. GPCRs were thought to function as monomers, however it is now accepted that GPCR homo- and hetero-oligomers also exist and influence receptor properties. The Schizosaccharomyces pombe GPCR Mam2 is a pheromone-sensing receptor involved in mating and has previously been shown to form oligomers in vivo. The first transmembrane domain (TMD) of Mam2 contains a small-XXX-small motif, overrepresented in membrane proteins and well-known for promoting helix-helix interactions. An ortholog of Mam2 in Saccharomyces cerevisiae, Ste2, contains an analogous small-XXX-small motif which has been shown to contribute to receptor homo-oligomerization, localization and function. Here we have used experimental and computational techniques to characterize the role of the small-XXX-small motif in function and assembly of Mam2 for the first time. We find that disruption of the motif via mutagenesis leads to reduction of Mam2 TMD1 homo-oligomerization and pheromone-responsive cellular signaling of the full-length protein. It also impairs correct targeting to the plasma membrane. Mutation of the analogous motif in Ste2 yielded similar results, suggesting a conserved mechanism for assembly. Using co-expression of the two fungal receptors in conjunction with computational models, we demonstrate a functional change in G protein specificity and propose that this is brought about through hetero-dimeric interactions of Mam2 with Ste2 via the complementary small-XXX-small motifs. This highlights the potential of these motifs to affect a range of properties that can be investigated in other GPCRs. Copyright © 2014. Published by Elsevier B.V.

  10. [Identification and phylogenetic analysis of one strain of Lactobacillus delbrueckii subsp. bulgaricus separated from yoghourt].

    Science.gov (United States)

    Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan

    2007-11-01

    For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.

  11. Evolutionarily conserved bias of amino-acid usage refines the definition of PDZ-binding motif

    Directory of Open Access Journals (Sweden)

    Launey Thomas

    2011-06-01

    Full Text Available Abstract Background The interactions between PDZ (PSD-95, Dlg, ZO-1 domains and PDZ-binding motifs play central roles in signal transductions within cells. Proteins with PDZ domains bind to PDZ-binding motifs almost exclusively when the motifs are located at the carboxyl (C- terminal ends of their binding partners. However, it remains little explored whether PDZ-binding motifs show any preferential location at the C-terminal ends of proteins, at genome-level. Results Here, we examined the distribution of the type-I (x-x-S/T-x-I/L/V or type-II (x-x-V-x-I/V PDZ-binding motifs in proteins encoded in the genomes of five different species (human, mouse, zebrafish, fruit fly and nematode. We first established that these PDZ-binding motifs are indeed preferentially present at their C-terminal ends. Moreover, we found specific amino acid (AA bias for the 'x' positions in the motifs at the C-terminal ends. In general, hydrophilic AAs were favored. Our genomics-based findings confirm and largely extend the results of previous interaction-based studies, allowing us to propose refined consensus sequences for all of the examined PDZ-binding motifs. An ontological analysis revealed that the refined motifs are functionally relevant since a large fraction of the proteins bearing the motif appear to be involved in signal transduction. Furthermore, co-precipitation experiments confirmed two new protein interactions predicted by our genomics-based approach. Finally, we show that influenza virus pathogenicity can be correlated with PDZ-binding motif, with high-virulence viral proteins bearing a refined PDZ-binding motif. Conclusions Our refined definition of PDZ-binding motifs should provide important clues for identifying functional PDZ-binding motifs and proteins involved in signal transduction.

  12. Distinct configurations of protein complexes and biochemical pathways revealed by epistatic interaction network motifs

    LENUS (Irish Health Repository)

    Casey, Fergal

    2011-08-22

    Abstract Background Gene and protein interactions are commonly represented as networks, with the genes or proteins comprising the nodes and the relationship between them as edges. Motifs, or small local configurations of edges and nodes that arise repeatedly, can be used to simplify the interpretation of networks. Results We examined triplet motifs in a network of quantitative epistatic genetic relationships, and found a non-random distribution of particular motif classes. Individual motif classes were found to be associated with different functional properties, suggestive of an underlying biological significance. These associations were apparent not only for motif classes, but for individual positions within the motifs. As expected, NNN (all negative) motifs were strongly associated with previously reported genetic (i.e. synthetic lethal) interactions, while PPP (all positive) motifs were associated with protein complexes. The two other motif classes (NNP: a positive interaction spanned by two negative interactions, and NPP: a negative spanned by two positives) showed very distinct functional associations, with physical interactions dominating for the former but alternative enrichments, typical of biochemical pathways, dominating for the latter. Conclusion We present a model showing how NNP motifs can be used to recognize supportive relationships between protein complexes, while NPP motifs often identify opposing or regulatory behaviour between a gene and an associated pathway. The ability to use motifs to point toward underlying biological organizational themes is likely to be increasingly important as more extensive epistasis mapping projects in higher organisms begin.

  13. Fingerprint motifs of phytases | Fan | African Journal of Biotechnology

    African Journals Online (AJOL)

    Among the total of potential 173 phytases gained in 11 plant genomes through MAST, PAPhys are the major phytases, and HAPhys are the minor, and other phytase groups are not found in planta. Keywords: Phytase, fingerprint motif, multiple EM for motif elicitation (MEME), MAST African Journal of Biotechnology Vol.

  14. Principal component and discriminant analyses as powerful tools to support taxonomic identification and their use for functional and phylogenetic signal detection of isolated fossil shark teeth.

    Directory of Open Access Journals (Sweden)

    Giuseppe Marramà

    Full Text Available Identifying isolated teeth of fossil selachians only based on qualitative characters is sometimes hindered by similarity in their morphology, resulting often in heated taxonomic debates. On the other hand, the use of quantitative characters (i.e. measurements has been often neglected or underestimated in characterization and identification of fossil teeth of selachians. Here we show that, employing a robust methodological protocol based on principal component and discriminant analyses on a sample of 175 isolated fossil teeth of lamniform sharks, the traditional morphometrics can be useful to support and complement the classic taxonomic identification made on qualitative features. Furthermore, we show that discriminant analysis can be successfully useful to assign indeterminate isolated shark teeth to a certain taxon. Finally, the degree of separation of the clusters might be used to predict functional and probably also phylogenetic signals in lamniform shark teeth. However, this needs to be tested in the future employing teeth of more extant and extinct lamniform sharks and it must be pointed out that this approach does not replace in any way the qualitative analysis, but it is intended to complement and support it.

  15. Short Arginine Motifs Drive Protein Stickiness in the Escherichia coli Cytoplasm.

    Science.gov (United States)

    Kyne, Ciara; Crowley, Peter B

    2017-09-19

    Although essential to numerous biotech applications, knowledge of molecular recognition by arginine-rich motifs in live cells remains limited. 1 H, 15 N HSQC and 19 F NMR spectroscopies were used to investigate the effects of C-terminal -GR n (n = 1-5) motifs on GB1 interactions in Escherichia coli cells and cell extracts. While the "biologically inert" GB1 yields high-quality in-cell spectra, the -GR n fusions with n = 4 or 5 were undetectable. This result suggests that a tetra-arginine motif is sufficient to drive interactions between a test protein and macromolecules in the E. coli cytoplasm. The inclusion of a 12 residue flexible linker between GB1 and the -GR 5 motif did not improve detection of the "inert" domain. In contrast, all of the constructs were detectable in cell lysates and extracts, suggesting that the arginine-mediated complexes were weak. Together these data reveal the significance of weak interactions between short arginine-rich motifs and the E. coli cytoplasm and demonstrate the potential of such motifs to modify protein interactions in living cells. These interactions must be considered in the design of (in vivo) nanoscale assemblies that rely on arginine-rich sequences.

  16. Genome-wide identification and characterization of the apple (Malus domestica) HECT ubiquitin-protein ligase family and expression analysis of their responsiveness to abiotic stresses.

    Science.gov (United States)

    Xu, Jianing; Xing, Shanshan; Cui, Haoran; Chen, Xuesen; Wang, Xiaoyun

    2016-04-01

    The ubiquitin-protein ligases (E3s) directly participate in ubiquitin (Ub) transferring to the target proteins in the ubiquitination pathway. The HECT ubiquitin-protein ligase (UPL), one type of E3s, is characterized as containing a conserved HECT domain of approximately 350 amino acids in the C terminus. Some UPLs were found to be involved in trichome development and leaf senescence in Arabidopsis. However, studies on plant UPLs, such as characteristics of the protein structure, predicted functional motifs of the HECT domain, and the regulatory expression of UPLs have all been limited. Here, we present genome-wide identification of the genes encoding UPLs (HECT gene) in apple. The 13 genes (named as MdUPL1-MdUPL13) from ten different chromosomes were divided into four groups by phylogenetic analysis. Among these groups, the encoding genes in the intron-exon structure and the included additional functional domains were quite different. Notably, the F-box domain was first found in MdUPL7 in plant UPLs. The HECT domain in different MdUPL groups also presented different spatial features and three types of conservative motifs were identified. The promoters of each MdUPL member carried multiple stress-response related elements by cis-acting element analysis. Experimental results demonstrated that the expressions of several MdUPLs were quite sensitive to cold-, drought-, and salt-stresses by qRT-PCR assay. The results of this study helped to elucidate the functions of HECT proteins, especially in Rosaceae plants.

  17. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Anion induced conformational preference of Cα NN motif residues in functional proteins.

    Science.gov (United States)

    Patra, Piya; Ghosh, Mahua; Banerjee, Raja; Chakrabarti, Jaydeb

    2017-12-01

    Among different ligand binding motifs, anion binding C α NN motif consisting of peptide backbone atoms of three consecutive residues are observed to be important for recognition of free anions, like sulphate or biphosphate and participate in different key functions. Here we study the interaction of sulphate and biphosphate with C α NN motif present in different proteins. Instead of total protein, a peptide fragment has been studied keeping C α NN motif flanked in between other residues. We use classical force field based molecular dynamics simulations to understand the stability of this motif. Our data indicate fluctuations in conformational preferences of the motif residues in absence of the anion. The anion gives stability to one of these conformations. However, the anion induced conformational preferences are highly sequence dependent and specific to the type of anion. In particular, the polar residues are more favourable compared to the other residues for recognising the anion. © 2017 Wiley Periodicals, Inc.

  19. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  20. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  1. Gene regulatory and signaling networks exhibit distinct topological distributions of motifs

    Science.gov (United States)

    Ferreira, Gustavo Rodrigues; Nakaya, Helder Imoto; Costa, Luciano da Fontoura

    2018-04-01

    The biological processes of cellular decision making and differentiation involve a plethora of signaling pathways and gene regulatory circuits. These networks in turn exhibit a multitude of motifs playing crucial parts in regulating network activity. Here we compare the topological placement of motifs in gene regulatory and signaling networks and observe that it suggests different evolutionary strategies in motif distribution for distinct cellular subnetworks.

  2. Finding a Leucine in a Haystack: Searching the Proteome for ambigous Leucine-Aspartic Acid motifs

    KAUST Repository

    Arold, Stefan T.

    2016-01-25

    Leucine-aspartic acid (LD) motifs are short helical protein-protein interaction motifs involved in cell motility, survival and communication. LD motif interactions are also implicated in cancer metastasis and are targeted by several viruses. LD motifs are notoriously difficult to detect because sequence pattern searches lead to an excessively high number of false positives. Hence, despite 20 years of research, only six LD motif–containing proteins are known in humans, three of which are close homologues of the paxillin family. To enable the proteome-wide discovery of LD motifs, we developed LD Motif Finder (LDMF), a web tool based on machine learning that combines sequence information with structural predictions to detect LD motifs with high accuracy. LDMF predicted 13 new LD motifs in humans. Using biophysical assays, we experimentally confirmed in vitro interactions for four novel LD motif proteins. Thus, LDMF allows proteome-wide discovery of LD motifs, despite a highly ambiguous sequence pattern. Functional implications will be discussed.

  3. Identification and phylogenetic diversity of parvovirus circulating in commercial chicken and turkey flocks in Croatia.

    Science.gov (United States)

    Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D

    2011-12-01

    Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.

  4. A proposed vestigial translation initiation motif in VP1 of hepatitis A virus.

    Science.gov (United States)

    Kang, Jeong-Ah; Funkhouser, Ann W

    2002-07-01

    The internal ribosome entry site (IRES) of picornaviruses has a 3' polypyrimidine tract (PPT) 16-24 bases upstream of an AUG triplet (PPT/AUG motif). This motif is critical in determining the efficiency of cap-independent translation. HAV has a conserved PPT/AUG motif consisting of a nine base sequence (AGGUUUUUC) 23 bases upstream of the preferred AUG start codon. This HAV-specific PPT/AUG motif is repeated and conserved in VP1 of HAV, but not of other picornaviruses. We proposed that the PPT/AUG motif in the open reading frame initiated translation and/or had an impact on the life cycle of the virus. In vitro translation of mutant bicistronic mRNAs and growth in cell culture of mutant viruses provided no evidence that the VP1 PPT/AUG motif had any impact on either translation or growth. HAV differs from other picornaviruses in its inefficient growth in cell culture. Since the HAV-specific PPT/AUG motif is found in only 1 in 300,000 reported viral sequences outside the hepatovirus genus, this motif may be a vestigial translation initiation element and may have played a role in determining the unusual phenotype of HAV.

  5. CMD: A Database to Store the Bonding States of Cysteine Motifs with Secondary Structures

    Directory of Open Access Journals (Sweden)

    Hamed Bostan

    2012-01-01

    Full Text Available Computational approaches to the disulphide bonding state and its connectivity pattern prediction are based on various descriptors. One descriptor is the amino acid sequence motifs flanking the cysteine residue motifs. Despite the existence of disulphide bonding information in many databases and applications, there is no complete reference and motif query available at the moment. Cysteine motif database (CMD is the first online resource that stores all cysteine residues, their flanking motifs with their secondary structure, and propensity values assignment derived from the laboratory data. We extracted more than 3 million cysteine motifs from PDB and UniProt data, annotated with secondary structure assignment, propensity value assignment, and frequency of occurrence and coefficiency of their bonding status. Removal of redundancies generated 15875 unique flanking motifs that are always bonded and 41577 unique patterns that are always nonbonded. Queries are based on the protein ID, FASTA sequence, sequence motif, and secondary structure individually or in batch format using the provided APIs that allow remote users to query our database via third party software and/or high throughput screening/querying. The CMD offers extensive information about the bonded, free cysteine residues, and their motifs that allows in-depth characterization of the sequence motif composition.

  6. BEAM web server: a tool for structural RNA motif discovery.

    Science.gov (United States)

    Pietrosanto, Marco; Adinolfi, Marta; Casula, Riccardo; Ausiello, Gabriele; Ferrè, Fabrizio; Helmer-Citterich, Manuela

    2018-03-15

    RNA structural motif finding is a relevant problem that becomes computationally hard when working on high-throughput data (e.g. eCLIP, PAR-CLIP), often represented by thousands of RNA molecules. Currently, the BEAM server is the only web tool capable to handle tens of thousands of RNA in input with a motif discovery procedure that is only limited by the current secondary structure prediction accuracies. The recently developed method BEAM (BEAr Motifs finder) can analyze tens of thousands of RNA molecules and identify RNA secondary structure motifs associated to a measure of their statistical significance. BEAM is extremely fast thanks to the BEAR encoding that transforms each RNA secondary structure in a string of characters. BEAM also exploits the evolutionary knowledge contained in a substitution matrix of secondary structure elements, extracted from the RFAM database of families of homologous RNAs. The BEAM web server has been designed to streamline data pre-processing by automatically handling folding and encoding of RNA sequences, giving users a choice for the preferred folding program. The server provides an intuitive and informative results page with the list of secondary structure motifs identified, the logo of each motif, its significance, graphic representation and information about its position in the RNA molecules sharing it. The web server is freely available at http://beam.uniroma2.it/ and it is implemented in NodeJS and Python with all major browsers supported. marco.pietrosanto@uniroma2.it. Supplementary data are available at Bioinformatics online.

  7. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Review article: The mountain motif in the plot of Matthew

    Directory of Open Access Journals (Sweden)

    Gert J. Volschenk

    2010-09-01

    Full Text Available This article reviewed T.L. Donaldson’s book, Jesus on the mountain: A study in Matthean theology, published in 1985 by JSOT Press, Sheffield, and focused on the mountain motif in the structure and plot of the Gospel of Matthew, in addition to the work of Donaldson on the mountain motif as a literary motif and as theological symbol. The mountain is a primary theological setting for Jesus’ ministry and thus is an important setting, serving as one of the literary devices by which Matthew structured and progressed his narrative. The Zion theological and eschatological significance and Second Temple Judaism serve as the historical and theological background for the mountain motif. The last mountain setting (Mt 28:16–20 is the culmination of the three theological themes in the plot of Matthew, namely Christology, ecclesiology and salvation history.

  9. Phylogenetic and Pathotypic Characterization of a Newcastle Disease Virus Strain Isolated from Ducks and Pigeons in Hubei, China

    Directory of Open Access Journals (Sweden)

    Y Wang

    Full Text Available ABSTRACT Newcastle disease is a highly contagious disease responsible for major outbreaks and considerable economic losses in the poultry industry in China. There is still little information available regarding gene characterization of the NDV, especially in ducks and pigeons. Therefore, the aim of this study was to investigate NDV isolated from ducks and pigeons in Hubei, China. In this study, three NDVs from ducks and pigeons were isolated between 2013 and 2015.The fusion protein (F gene of the NDV isolates was sequenced and phylogenetically analyzed. The clinical signs and gross histopathological lesions were examined. Phylogenetic analysis of these strains indicated that all the sequences are classified as genotype II. The isolates shared a 112 G-R-Q-G-R-L 117motif at the F protein cleavage site, indicating that these three isolates strains are lentogenic. Necropsy and histopathology showed the typical pathological changes. It was concluded that commercial ducks and pigeons in Hubei province carry lentogenic NDV strains with regular genetic divergence, indicating that these species may act as the main reservoirs of NDV in poultry. Therefore, strategies and surveillance should be undertaken to reduce the risk of ND outbreaks.

  10. Transcriptome-wide identification of bread wheat WRKY transcription factors in response to drought stress.

    Science.gov (United States)

    Okay, Sezer; Derelli, Ebru; Unver, Turgay

    2014-10-01

    The WRKY superfamily of transcription factors was shown to be involved in biotic and abiotic stress responses in plants such as wheat (Triticum aestivum L.), one of the major crops largely cultivated and consumed all over the world. Drought is an important abiotic stress resulting in a considerable amount of loss in agronomical yield. Therefore, identification of drought responsive WRKY members in wheat has a profound significance. Here, a total of 160 TaWRKY proteins were characterized according to sequence similarity, motif varieties, and their phylogenetic relationships. The conserved sequences of the TaWRKYs were aligned and classified into three main groups and five subgroups. A novel motif in wheat, WRKYGQR, was identified. To putatively determine the drought responsive TaWRKY members, publicly available RNA-Seq data were analyzed for the first time in this study. Through in silico searches, 35 transcripts were detected having an identity to ten known TaWRKY genes. Furthermore, relative expression levels of TaWRKY16/TaWRKY16-A, TaWRKY17, TaWRKY19-C, TaWRKY24, TaWRKY59, TaWRKY61, and TaWRKY82 were measured in root and leaf tissues of drought-tolerant Sivas 111/33 and susceptible Atay 85 cultivars. All of the quantified TaWRKY transcripts were found to be up-regulated in root tissue of Sivas 111/33. Differential expression of TaWRKY16, TaWRKY24, TaWRKY59, TaWRKY61 and TaWRKY82 genes was discovered for the first time upon drought stress in wheat. These comprehensive analyses bestow a better understanding about the WRKY TFs in bread wheat under water deficit, and increased number of drought responsive WRKYs would contribute to the molecular breeding of tolerant wheat cultivars.

  11. Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

    Science.gov (United States)

    Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

    2018-02-09

    WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

  12. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  13. On the origin of distribution patterns of motifs in biological networks

    Directory of Open Access Journals (Sweden)

    Lesk Arthur M

    2008-08-01

    Full Text Available Abstract Background Inventories of small subgraphs in biological networks have identified commonly-recurring patterns, called motifs. The inference that these motifs have been selected for function rests on the idea that their occurrences are significantly more frequent than random. Results Our analysis of several large biological networks suggests, in contrast, that the frequencies of appearance of common subgraphs are similar in natural and corresponding random networks. Conclusion Indeed, certain topological features of biological networks give rise naturally to the common appearance of the motifs. We therefore question whether frequencies of occurrences are reasonable evidence that the structures of motifs have been selected for their functional contribution to the operation of networks.

  14. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    Science.gov (United States)

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  15. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  16. Systematic comparison of the response properties of protein and RNA mediated gene regulatory motifs.

    Science.gov (United States)

    Iyengar, Bharat Ravi; Pillai, Beena; Venkatesh, K V; Gadgil, Chetan J

    2017-05-30

    We present a framework enabling the dissection of the effects of motif structure (feedback or feedforward), the nature of the controller (RNA or protein), and the regulation mode (transcriptional, post-transcriptional or translational) on the response to a step change in the input. We have used a common model framework for gene expression where both motif structures have an activating input and repressing regulator, with the same set of parameters, to enable a comparison of the responses. We studied the global sensitivity of the system properties, such as steady-state gain, overshoot, peak time, and peak duration, to parameters. We find that, in all motifs, overshoot correlated negatively whereas peak duration varied concavely with peak time. Differences in the other system properties were found to be mainly dependent on the nature of the controller rather than the motif structure. Protein mediated motifs showed a higher degree of adaptation i.e. a tendency to return to baseline levels; in particular, feedforward motifs exhibited perfect adaptation. RNA mediated motifs had a mild regulatory effect; they also exhibited a lower peaking tendency and mean overshoot. Protein mediated feedforward motifs showed higher overshoot and lower peak time compared to the corresponding feedback motifs.

  17. Annotating RNA motifs in sequences and alignments.

    Science.gov (United States)

    Gardner, Paul P; Eldai, Hisham

    2015-01-01

    RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Fast social-like learning of complex behaviors based on motor motifs

    Science.gov (United States)

    Calvo Tapia, Carlos; Tyukin, Ivan Y.; Makarov, Valeri A.

    2018-05-01

    Social learning is widely observed in many species. Less experienced agents copy successful behaviors exhibited by more experienced individuals. Nevertheless, the dynamical mechanisms behind this process remain largely unknown. Here we assume that a complex behavior can be decomposed into a sequence of n motor motifs. Then a neural network capable of activating motor motifs in a given sequence can drive an agent. To account for (n -1 )! possible sequences of motifs in a neural network, we employ the winnerless competition approach. We then consider a teacher-learner situation: one agent exhibits a complex movement, while another one aims at mimicking the teacher's behavior. Despite the huge variety of possible motif sequences we show that the learner, equipped with the provided learning model, can rewire "on the fly" its synaptic couplings in no more than (n -1 ) learning cycles and converge exponentially to the durations of the teacher's motifs. We validate the learning model on mobile robots. Experimental results show that the learner is indeed capable of copying the teacher's behavior composed of six motor motifs in a few learning cycles. The reported mechanism of learning is general and can be used for replicating different functions, including, for example, sound patterns or speech.

  19. Thermal Stability of Modified i-Motif Oligonucleotides with Naphthalimide Intercalating Nucleic Acids

    DEFF Research Database (Denmark)

    El-Sayed, Ahmed Ali; Pedersen, Erik B.; Khaireldin, Nahid Y.

    2016-01-01

    In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion of naphtha......In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion...... of naphthalimide (1H-benzo[de]isoquinoline-1,3(2H)-dione) as the intercalating nucleic acid. The stabilities of i-motif structures with inserted naphthalimide intercalating nucleotides were studied using UV melting temperatures (Tm) and circular dichroism spectra at different pH values and conditions (crowding...

  20. WildSpan: mining structured motifs from protein sequences

    Directory of Open Access Journals (Sweden)

    Chen Chien-Yu

    2011-03-01

    Full Text Available Abstract Background Automatic extraction of motifs from biological sequences is an important research problem in study of molecular biology. For proteins, it is desired to discover sequence motifs containing a large number of wildcard symbols, as the residues associated with functional sites are usually largely separated in sequences. Discovering such patterns is time-consuming because abundant combinations exist when long gaps (a gap consists of one or more successive wildcards are considered. Mining algorithms often employ constraints to narrow down the search space in order to increase efficiency. However, improper constraint models might degrade the sensitivity and specificity of the motifs discovered by computational methods. We previously proposed a new constraint model to handle large wildcard regions for discovering functional motifs of proteins. The patterns that satisfy the proposed constraint model are called W-patterns. A W-pattern is a structured motif that groups motif symbols into pattern blocks interleaved with large irregular gaps. Considering large gaps reflects the fact that functional residues are not always from a single region of protein sequences, and restricting motif symbols into clusters corresponds to the observation that short motifs are frequently present within protein families. To efficiently discover W-patterns for large-scale sequence annotation and function prediction, this paper first formally introduces the problem to solve and proposes an algorithm named WildSpan (sequential pattern mining across large wildcard regions that incorporates several pruning strategies to largely reduce the mining cost. Results WildSpan is shown to efficiently find W-patterns containing conserved residues that are far separated in sequences. We conducted experiments with two mining strategies, protein-based and family-based mining, to evaluate the usefulness of W-patterns and performance of WildSpan. The protein-based mining mode

  1. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  2. Motif formation and industry specific topologies in the Japanese business firm network

    Science.gov (United States)

    Maluck, Julian; Donner, Reik V.; Takayasu, Hideki; Takayasu, Misako

    2017-05-01

    Motifs and roles are basic quantities for the characterization of interactions among 3-node subsets in complex networks. In this work, we investigate how the distribution of 3-node motifs can be influenced by modifying the rules of an evolving network model while keeping the statistics of simpler network characteristics, such as the link density and the degree distribution, invariant. We exemplify this problem for the special case of the Japanese Business Firm Network, where a well-studied and relatively simple yet realistic evolving network model is available, and compare the resulting motif distribution in the real-world and simulated networks. To better approximate the motif distribution of the real-world network in the model, we introduce both subgraph dependent and global additional rules. We find that a specific rule that allows only for the merging process between nodes with similar link directionality patterns reduces the observed excess of densely connected motifs with bidirectional links. Our study improves the mechanistic understanding of motif formation in evolving network models to better describe the characteristic features of real-world networks with a scale-free topology.

  3. Genome Wide Identification of LIM Genes in Cicer arietinum and Response of Ca-2LIMs in Development, Hormone and Pathogenic Stress.

    Directory of Open Access Journals (Sweden)

    Vikas Srivastava

    Full Text Available The eukaryotic lineage-specific LIM protein (LIN11, ISL1, and MEC3 family play pivotal role in modulation of actin dynamics and transcriptional regulation. The systematic investigation of this family has not been carried in detail and rare in legumes. Current study involves the mining of Cicer arietinum genome for the genes coding for LIM domain proteins and displayed significant homology with LIM genes of other species. The analysis led to the identification of 15 members, which were positioned on chickpea chromosomes. The phylogenetic and motif analysis suggested their categorization into two sub-families i.e., Ca-2LIMs and Ca-DA1/DAR, which comprised of nine and six candidates, respectively. Further sub-categories of Ca-2LIMs were recognised as αLIM, βLIM, δLIM and γLIM. The LIM genes within their sub-families displayed conserved genomic and motif organization. The expression pattern of Ca-2LIMs across developmental and reproductive tissues demonstrated strong correlation with established consensus. The Ca-2LIM belongs to PLIM and GLIM (XLIM was found highly expressed in floral tissue. Others showed ubiquitous expression pattern with their dominance in stem. Under hormonal and pathogenic conditions these LIMs were found to up-regulate during salicylic acid, abscisic acid and Ascochyta rabiei treatment or infection; and down-regulated in response to jasmonic acid treatment. The findings of this work, particularly in terms of modulation of LIM genes under biotic stress will open up the way to further explore and establish the role of chickpea LIMs in plant defense response.

  4. Genome Wide Identification of LIM Genes in Cicer arietinum and Response of Ca-2LIMs in Development, Hormone and Pathogenic Stress

    Science.gov (United States)

    Srivastava, Vikas; Verma, Praveen Kumar

    2015-01-01

    The eukaryotic lineage-specific LIM protein (LIN11, ISL1, and MEC3) family play pivotal role in modulation of actin dynamics and transcriptional regulation. The systematic investigation of this family has not been carried in detail and rare in legumes. Current study involves the mining of Cicer arietinum genome for the genes coding for LIM domain proteins and displayed significant homology with LIM genes of other species. The analysis led to the identification of 15 members, which were positioned on chickpea chromosomes. The phylogenetic and motif analysis suggested their categorization into two sub-families i.e., Ca-2LIMs and Ca-DA1/DAR, which comprised of nine and six candidates, respectively. Further sub-categories of Ca-2LIMs were recognised as αLIM, βLIM, δLIM and γLIM. The LIM genes within their sub-families displayed conserved genomic and motif organization. The expression pattern of Ca-2LIMs across developmental and reproductive tissues demonstrated strong correlation with established consensus. The Ca-2LIM belongs to PLIM and GLIM (XLIM) was found highly expressed in floral tissue. Others showed ubiquitous expression pattern with their dominance in stem. Under hormonal and pathogenic conditions these LIMs were found to up-regulate during salicylic acid, abscisic acid and Ascochyta rabiei treatment or infection; and down-regulated in response to jasmonic acid treatment. The findings of this work, particularly in terms of modulation of LIM genes under biotic stress will open up the way to further explore and establish the role of chickpea LIMs in plant defense response. PMID:26418014

  5. Binding properties of SUMO-interacting motifs (SIMs) in yeast.

    Science.gov (United States)

    Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich

    2015-03-01

    Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.

  6. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  7. Evaluation of ITS2 for intraspecific identification of Paeonia lactiflora cultivars

    Directory of Open Access Journals (Sweden)

    Qian Li

    2017-09-01

    Full Text Available Herbaceous peony (Paeonia lactiflora Pall. is an important ornamental and medicinal plant. DNA barcodes can reveal species identity via the nucleotide diversity of short DNA segments. In this study, two main candidate DNA barcodes (ITS2 and psbA-trnH were tested to identify twenty-one cutting cultivars of P. lactiflora and their wild species. The efficacy of the candidate DNA barcodes was assessed by PCR amplification, sequence quality, sequence diversity, rate of correct identification, and phylogenetic analysis. ITS2 was easy to be amplified and sequenced among the samples. The identification by Blastn and phylogenetic analysis was 95.4% and 63.6%, respectively. For psbA-trnH, the presence of poly A-T led to sequencing failure which limited its use as DNA barcode candidate. Moreover, the authentic efficiency of psbA-trnH was lower than ITS2. The results showed that ITS2 is suitable as a candidate DNA barcode for the intraspecific identification of P. lactiflora cultivars.

  8. Efficient sequential and parallel algorithms for finding edit distance based motifs.

    Science.gov (United States)

    Pal, Soumitra; Xiao, Peng; Rajasekaran, Sanguthevar

    2016-08-18

    Motif search is an important step in extracting meaningful patterns from biological data. The general problem of motif search is intractable and there is a pressing need to develop efficient, exact and approximation algorithms to solve this problem. In this paper, we present several novel, exact, sequential and parallel algorithms for solving the (l,d) Edit-distance-based Motif Search (EMS) problem: given two integers l,d and n biological strings, find all strings of length l that appear in each input string with atmost d errors of types substitution, insertion and deletion. One popular technique to solve the problem is to explore for each input string the set of all possible l-mers that belong to the d-neighborhood of any substring of the input string and output those which are common for all input strings. We introduce a novel and provably efficient neighborhood exploration technique. We show that it is enough to consider the candidates in neighborhood which are at a distance exactly d. We compactly represent these candidate motifs using wildcard characters and efficiently explore them with very few repetitions. Our sequential algorithm uses a trie based data structure to efficiently store and sort the candidate motifs. Our parallel algorithm in a multi-core shared memory setting uses arrays for storing and a novel modification of radix-sort for sorting the candidate motifs. The algorithms for EMS are customarily evaluated on several challenging instances such as (8,1), (12,2), (16,3), (20,4), and so on. The best previously known algorithm, EMS1, is sequential and in estimated 3 days solves up to instance (16,3). Our sequential algorithms are more than 20 times faster on (16,3). On other hard instances such as (9,2), (11,3), (13,4), our algorithms are much faster. Our parallel algorithm has more than 600 % scaling performance while using 16 threads. Our algorithms have pushed up the state-of-the-art of EMS solvers and we believe that the techniques introduced in

  9. Physical-chemical property based sequence motifs and methods regarding same

    Science.gov (United States)

    Braun, Werner [Friendswood, TX; Mathura, Venkatarajan S [Sarasota, FL; Schein, Catherine H [Friendswood, TX

    2008-09-09

    A data analysis system, program, and/or method, e.g., a data mining/data exploration method, using physical-chemical property motifs. For example, a sequence database may be searched for identifying segments thereof having physical-chemical properties similar to the physical-chemical property motifs.

  10. Dissecting protein loops with a statistical scalpel suggests a functional implication of some structural motifs.

    Science.gov (United States)

    Regad, Leslie; Martin, Juliette; Camproux, Anne-Claude

    2011-06-20

    One of the strategies for protein function annotation is to search particular structural motifs that are known to be shared by proteins with a given function. Here, we present a systematic extraction of structural motifs of seven residues from protein loops and we explore their correspondence with functional sites. Our approach is based on the structural alphabet HMM-SA (Hidden Markov Model - Structural Alphabet), which allows simplification of protein structures into uni-dimensional sequences, and advanced pattern statistics adapted to short sequences. Structural motifs of interest are selected by looking for structural motifs significantly over-represented in SCOP superfamilies in protein loops. We discovered two types of structural motifs significantly over-represented in SCOP superfamilies: (i) ubiquitous motifs, shared by several superfamilies and (ii) superfamily-specific motifs, over-represented in few superfamilies. A comparison of ubiquitous words with known small structural motifs shows that they contain well-described motifs as turn, niche or nest motifs. A comparison between superfamily-specific motifs and biological annotations of Swiss-Prot reveals that some of them actually correspond to functional sites involved in the binding sites of small ligands, such as ATP/GTP, NAD(P) and SAH/SAM. Our findings show that statistical over-representation in SCOP superfamilies is linked to functional features. The detection of over-represented motifs within structures simplified by HMM-SA is therefore a promising approach for prediction of functional sites and annotation of uncharacterized proteins.

  11. Dissecting protein loops with a statistical scalpel suggests a functional implication of some structural motifs

    Directory of Open Access Journals (Sweden)

    Martin Juliette

    2011-06-01

    Full Text Available Abstract Background One of the strategies for protein function annotation is to search particular structural motifs that are known to be shared by proteins with a given function. Results Here, we present a systematic extraction of structural motifs of seven residues from protein loops and we explore their correspondence with functional sites. Our approach is based on the structural alphabet HMM-SA (Hidden Markov Model - Structural Alphabet, which allows simplification of protein structures into uni-dimensional sequences, and advanced pattern statistics adapted to short sequences. Structural motifs of interest are selected by looking for structural motifs significantly over-represented in SCOP superfamilies in protein loops. We discovered two types of structural motifs significantly over-represented in SCOP superfamilies: (i ubiquitous motifs, shared by several superfamilies and (ii superfamily-specific motifs, over-represented in few superfamilies. A comparison of ubiquitous words with known small structural motifs shows that they contain well-described motifs as turn, niche or nest motifs. A comparison between superfamily-specific motifs and biological annotations of Swiss-Prot reveals that some of them actually correspond to functional sites involved in the binding sites of small ligands, such as ATP/GTP, NAD(P and SAH/SAM. Conclusions Our findings show that statistical over-representation in SCOP superfamilies is linked to functional features. The detection of over-represented motifs within structures simplified by HMM-SA is therefore a promising approach for prediction of functional sites and annotation of uncharacterized proteins.

  12. Phylogenetic reconstruction and DNA barcoding for closely related pine moth species (Dendrolimus) in China with multiple gene markers.

    Science.gov (United States)

    Dai, Qing-Yan; Gao, Qiang; Wu, Chun-Sheng; Chesters, Douglas; Zhu, Chao-Dong; Zhang, Ai-Bing

    2012-01-01

    Unlike distinct species, closely related species offer a great challenge for phylogeny reconstruction and species identification with DNA barcoding due to their often overlapping genetic variation. We tested a sibling species group of pine moth pests in China with a standard cytochrome c oxidase subunit I (COI) gene and two alternative internal transcribed spacer (ITS) genes (ITS1 and ITS2). Five different phylogenetic/DNA barcoding analysis methods (Maximum likelihood (ML)/Neighbor-joining (NJ), "best close match" (BCM), Minimum distance (MD), and BP-based method (BP)), representing commonly used methodology (tree-based and non-tree based) in the field, were applied to both single-gene and multiple-gene analyses. Our results demonstrated clear reciprocal species monophyly for three relatively distant related species, Dendrolimus superans, D. houi, D. kikuchii, as recovered by both single and multiple genes while the phylogenetic relationship of three closely related species, D. punctatus, D. tabulaeformis, D. spectabilis, could not be resolved with the traditional tree-building methods. Additionally, we find the standard COI barcode outperforms two nuclear ITS genes, whatever the methods used. On average, the COI barcode achieved a success rate of 94.10-97.40%, while ITS1 and ITS2 obtained a success rate of 64.70-81.60%, indicating ITS genes are less suitable for species identification in this case. We propose the use of an overall success rate of species identification that takes both sequencing success and assignation success into account, since species identification success rates with multiple-gene barcoding system were generally overestimated, especially by tree-based methods, where only successfully sequenced DNA sequences were used to construct a phylogenetic tree. Non-tree based methods, such as MD, BCM, and BP approaches, presented advantages over tree-based methods by reporting the overall success rates with statistical significance. In addition, our

  13. Phylogenetic reconstruction and DNA barcoding for closely related pine moth species (Dendrolimus in China with multiple gene markers.

    Directory of Open Access Journals (Sweden)

    Qing-Yan Dai

    Full Text Available Unlike distinct species, closely related species offer a great challenge for phylogeny reconstruction and species identification with DNA barcoding due to their often overlapping genetic variation. We tested a sibling species group of pine moth pests in China with a standard cytochrome c oxidase subunit I (COI gene and two alternative internal transcribed spacer (ITS genes (ITS1 and ITS2. Five different phylogenetic/DNA barcoding analysis methods (Maximum likelihood (ML/Neighbor-joining (NJ, "best close match" (BCM, Minimum distance (MD, and BP-based method (BP, representing commonly used methodology (tree-based and non-tree based in the field, were applied to both single-gene and multiple-gene analyses. Our results demonstrated clear reciprocal species monophyly for three relatively distant related species, Dendrolimus superans, D. houi, D. kikuchii, as recovered by both single and multiple genes while the phylogenetic relationship of three closely related species, D. punctatus, D. tabulaeformis, D. spectabilis, could not be resolved with the traditional tree-building methods. Additionally, we find the standard COI barcode outperforms two nuclear ITS genes, whatever the methods used. On average, the COI barcode achieved a success rate of 94.10-97.40%, while ITS1 and ITS2 obtained a success rate of 64.70-81.60%, indicating ITS genes are less suitable for species identification in this case. We propose the use of an overall success rate of species identification that takes both sequencing success and assignation success into account, since species identification success rates with multiple-gene barcoding system were generally overestimated, especially by tree-based methods, where only successfully sequenced DNA sequences were used to construct a phylogenetic tree. Non-tree based methods, such as MD, BCM, and BP approaches, presented advantages over tree-based methods by reporting the overall success rates with statistical significance. In

  14. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  15. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  16. Organization of feed-forward loop motifs reveals architectural principles in natural and engineered networks.

    Science.gov (United States)

    Gorochowski, Thomas E; Grierson, Claire S; di Bernardo, Mario

    2018-03-01

    Network motifs are significantly overrepresented subgraphs that have been proposed as building blocks for natural and engineered networks. Detailed functional analysis has been performed for many types of motif in isolation, but less is known about how motifs work together to perform complex tasks. To address this issue, we measure the aggregation of network motifs via methods that extract precisely how these structures are connected. Applying this approach to a broad spectrum of networked systems and focusing on the widespread feed-forward loop motif, we uncover striking differences in motif organization. The types of connection are often highly constrained, differ between domains, and clearly capture architectural principles. We show how this information can be used to effectively predict functionally important nodes in the metabolic network of Escherichia coli . Our findings have implications for understanding how networked systems are constructed from motif parts and elucidate constraints that guide their evolution.

  17. RSAT matrix-clustering: dynamic exploration and redundancy reduction of transcription factor binding motif collections.

    Science.gov (United States)

    Castro-Mondragon, Jaime Abraham; Jaeger, Sébastien; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

    2017-07-27

    Transcription factor (TF) databases contain multitudes of binding motifs (TFBMs) from various sources, from which non-redundant collections are derived by manual curation. The advent of high-throughput methods stimulated the production of novel collections with increasing numbers of motifs. Meta-databases, built by merging these collections, contain redundant versions, because available tools are not suited to automatically identify and explore biologically relevant clusters among thousands of motifs. Motif discovery from genome-scale data sets (e.g. ChIP-seq) also produces redundant motifs, hampering the interpretation of results. We present matrix-clustering, a versatile tool that clusters similar TFBMs into multiple trees, and automatically creates non-redundant TFBM collections. A feature unique to matrix-clustering is its dynamic visualisation of aligned TFBMs, and its capability to simultaneously treat multiple collections from various sources. We demonstrate that matrix-clustering considerably simplifies the interpretation of combined results from multiple motif discovery tools, and highlights biologically relevant variations of similar motifs. We also ran a large-scale application to cluster ∼11 000 motifs from 24 entire databases, showing that matrix-clustering correctly groups motifs belonging to the same TF families, and drastically reduced motif redundancy. matrix-clustering is integrated within the RSAT suite (http://rsat.eu/), accessible through a user-friendly web interface or command-line for its integration in pipelines. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Structural fragment clustering reveals novel structural and functional motifs in α-helical transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Vassilev Boris

    2010-04-01

    Full Text Available Abstract Background A large proportion of an organism's genome encodes for membrane proteins. Membrane proteins are important for many cellular processes, and several diseases can be linked to mutations in them. With the tremendous growth of sequence data, there is an increasing need to reliably identify membrane proteins from sequence, to functionally annotate them, and to correctly predict their topology. Results We introduce a technique called structural fragment clustering, which learns sequential motifs from 3D structural fragments. From over 500,000 fragments, we obtain 213 statistically significant, non-redundant, and novel motifs that are highly specific to α-helical transmembrane proteins. From these 213 motifs, 58 of them were assigned to function and checked in the scientific literature for a biological assessment. Seventy percent of the motifs are found in co-factor, ligand, and ion binding sites, 30% at protein interaction interfaces, and 12% bind specific lipids such as glycerol or cardiolipins. The vast majority of motifs (94% appear across evolutionarily unrelated families, highlighting the modularity of functional design in membrane proteins. We describe three novel motifs in detail: (1 a dimer interface motif found in voltage-gated chloride channels, (2 a proton transfer motif found in heme-copper oxidases, and (3 a convergently evolved interface helix motif found in an aspartate symporter, a serine protease, and cytochrome b. Conclusions Our findings suggest that functional modules exist in membrane proteins, and that they occur in completely different evolutionary contexts and cover different binding sites. Structural fragment clustering allows us to link sequence motifs to function through clusters of structural fragments. The sequence motifs can be applied to identify and characterize membrane proteins in novel genomes.

  19. Identification and phylogenetic analysis of novel cytochrome P450 1A genes from ungulate species.

    Science.gov (United States)

    Darwish, Wageh Sobhy; Kawai, Yusuke; Ikenaka, Yoshinori; Yamamoto, Hideaki; Muroya, Tarou; Ishizuka, Mayumi

    2010-09-01

    As part of an ongoing effort to understand the biological response of wild and domestic ungulates to different environmental pollutants such as dioxin-like compounds, cDNAs encoding for CYP1A1 and CYP1A2 were cloned and characterized. Four novel CYP1A cDNA fragments from the livers of four wild ungulates (elephant, hippopotamus, tapir and deer) were identified. Three fragments from hippopotamus, tapir and deer were classified as CYP1A2, and the other fragment from elephant was designated as CYP1A1/2. The deduced amino acid sequences of these fragment CYP1As showed identities ranging from 76 to 97% with other animal CYP1As. The phylogenetic analysis of these fragments showed that both elephant and hippopotamus CYP1As made separate branches, while tapir and deer CYP1As were located beside that of horse and cattle respectively in the phylogenetic tree. Analysis of dN/dS ratio among the identified CYP1As indicated that odd toed ungulate CYP1A2s were exposed to different selection pressure.

  20. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  1. [Cover motifs of the Tidsskrift. A 14-year cavalcade].

    Science.gov (United States)

    Nylenna, M

    1998-12-10

    In 1985 the Journal of the Norwegian Medical Association changed its cover policy, moving the table of contents inside the Journal and introducing cover illustrations. This article provides an analysis of all cover illustrations published over this 14-year period, 420 covers in all. There is a great variation in cover motifs and designs and a development towards more general motifs. The initial emphasis on historical and medical aspects is now less pronounced, while the use of works of art and nature motifs has increased, and the cover now more often has a direct bearing on the specific contents of the issue. Professor of medical history Oivind Larsen has photographed two thirds of the covers and contributed 95% of the inside essay-style reflections on the cover motif. Over the years, he has expanded the role of the historian of medicine disseminating knowledge to include that of the raconteur with a personal tone of voice. The Journal's covers are now one of its most characteristic features, emblematic of the Journal's ambition of standing for quality and timelessness vis-à-vis the news media, and of its aim of bridging the gap between medicine and the humanities.

  2. Insights into the motif preference of APOBEC3 enzymes.

    Directory of Open Access Journals (Sweden)

    Diako Ebrahimi

    Full Text Available We used a multivariate data analysis approach to identify motifs associated with HIV hypermutation by different APOBEC3 enzymes. The analysis showed that APOBEC3G targets G mainly within GG, TG, TGG, GGG, TGGG and also GGGT. The G nucleotides flanked by a C at the 3' end (in +1 and +2 positions were indicated as disfavoured targets by APOBEC3G. The G nucleotides within GGGG were found to be targeted at a frequency much less than what is expected. We found that the infrequent G-to-A mutation within GGGG is not limited to the inaccessibility, to APOBEC3, of poly Gs in the central and 3'polypurine tracts (PPTs which remain double stranded during the HIV reverse transcription. GGGG motifs outside the PPTs were also disfavoured. The motifs GGAG and GAGG were also found to be disfavoured targets for APOBEC3. The motif-dependent mutation of G within the HIV genome by members of the APOBEC3 family other than APOBEC3G was limited to GA→AA changes. The results did not show evidence of other types of context dependent G-to-A changes in the HIV genome.

  3. Genome-wide identification of aquaporin encoding genes in Brassica oleracea and their phylogenetic sequence comparison to Brassica crops and Arabidopsis

    Science.gov (United States)

    Diehn, Till A.; Pommerrenig, Benjamin; Bernhardt, Nadine; Hartmann, Anja; Bienert, Gerd P.

    2015-01-01

    Aquaporins (AQPs) are essential channel proteins that regulate plant water homeostasis and the uptake and distribution of uncharged solutes such as metalloids, urea, ammonia, and carbon dioxide. Despite their importance as crop plants, little is known about AQP gene and protein function in cabbage (Brassica oleracea) and other Brassica species. The recent releases of the genome sequences of B. oleracea and Brassica rapa allow comparative genomic studies in these species to investigate the evolution and features of Brassica genes and proteins. In this study, we identified all AQP genes in B. oleracea by a genome-wide survey. In total, 67 genes of four plant AQP subfamilies were identified. Their full-length gene sequences and locations on chromosomes and scaffolds were manually curated. The identification of six additional full-length AQP sequences in the B. rapa genome added to the recently published AQP protein family of this species. A phylogenetic analysis of AQPs of Arabidopsis thaliana, B. oleracea, B. rapa allowed us to follow AQP evolution in closely related species and to systematically classify and (re-) name these isoforms. Thirty-three groups of AQP-orthologous genes were identified between B. oleracea and Arabidopsis and their expression was analyzed in different organs. The two selectivity filters, gene structure and coding sequences were highly conserved within each AQP subfamily while sequence variations in some introns and untranslated regions were frequent. These data suggest a similar substrate selectivity and function of Brassica AQPs compared to Arabidopsis orthologs. The comparative analyses of all AQP subfamilies in three Brassicaceae species give initial insights into AQP evolution in these taxa. Based on the genome-wide AQP identification in B. oleracea and the sequence analysis and reprocessing of Brassica AQP information, our dataset provides a sequence resource for further investigations of the physiological and molecular functions of

  4. I-motif DNA structures are formed in the nuclei of human cells

    Science.gov (United States)

    Zeraati, Mahdi; Langley, David B.; Schofield, Peter; Moye, Aaron L.; Rouet, Romain; Hughes, William E.; Bryan, Tracy M.; Dinger, Marcel E.; Christ, Daniel

    2018-06-01

    Human genome function is underpinned by the primary storage of genetic information in canonical B-form DNA, with a second layer of DNA structure providing regulatory control. I-motif structures are thought to form in cytosine-rich regions of the genome and to have regulatory functions; however, in vivo evidence for the existence of such structures has so far remained elusive. Here we report the generation and characterization of an antibody fragment (iMab) that recognizes i-motif structures with high selectivity and affinity, enabling the detection of i-motifs in the nuclei of human cells. We demonstrate that the in vivo formation of such structures is cell-cycle and pH dependent. Furthermore, we provide evidence that i-motif structures are formed in regulatory regions of the human genome, including promoters and telomeric regions. Our results support the notion that i-motif structures provide key regulatory roles in the genome.

  5. Proteome-level assessment of origin, prevalence and function of Leucine-Aspartic Acid (LD) motifs

    KAUST Repository

    Alam, Tanvir

    2018-03-11

    Short Linear Motifs (SLiMs) contribute to almost every cellular function by connecting appropriate protein partners. Accurate prediction of SLiMs is difficult due to their shortness and sequence degeneracy. Leucine-aspartic acid (LD) motifs are SLiMs that link paxillin family proteins to factors controlling (cancer) cell adhesion, motility and survival. The existence and importance of LD motifs beyond the paxillin family is poorly understood. To enable a proteome-wide assessment of these motifs, we developed an active-learning based framework that iteratively integrates computational predictions with experimental validation. Our analysis of the human proteome identified a dozen proteins that contain LD motifs, all being involved in cell adhesion and migration, and revealed a new type of inverse LD motif consensus. Our evolutionary analysis suggested that LD motif signalling originated in the common unicellular ancestor of opisthokonts and amoebozoa by co-opting nuclear export sequences. Inter-species comparison revealed a conserved LD signalling core, and reveals the emergence of species-specific adaptive connections, while maintaining a strong functional focus of the LD motif interactome. Collectively, our data elucidate the mechanisms underlying the origin and adaptation of an ancestral SLiM.

  6. PhySortR: a fast, flexible tool for sorting phylogenetic trees in R.

    Science.gov (United States)

    Stephens, Timothy G; Bhattacharya, Debashish; Ragan, Mark A; Chan, Cheong Xin

    2016-01-01

    A frequent bottleneck in interpreting phylogenomic output is the need to screen often thousands of trees for features of interest, particularly robust clades of specific taxa, as evidence of monophyletic relationship and/or reticulated evolution. Here we present PhySortR, a fast, flexible R package for classifying phylogenetic trees. Unlike existing utilities, PhySortR allows for identification of both exclusive and non-exclusive clades uniting the target taxa based on tip labels (i.e., leaves) on a tree, with customisable options to assess clades within the context of the whole tree. Using simulated and empirical datasets, we demonstrate the potential and scalability of PhySortR in analysis of thousands of phylogenetic trees without a priori assumption of tree-rooting, and in yielding readily interpretable trees that unambiguously satisfy the query. PhySortR is a command-line tool that is freely available and easily automatable.

  7. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  8. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  9. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  10. Sequence Analysis and Phylogenetic Profiling of the Nonstructural (NS Genes of H9N2 Influenza A Viruses Isolated in Iran during 1998-2007

    Directory of Open Access Journals (Sweden)

    Ebrahimi, M.

    2014-11-01

    Full Text Available The earliest evidences on circulation of Avian Influenza (AI virus on the Iranian poultry farms date back to 1998. Great economic losses through dramatic drop in egg production and high mortality rates are characteristically attributed to H9N2 AI virus. In the present work non-structural (NS genes of 10 Iranian H9N2 chicken AI viruses collected during 1998-2007 were fully sequenced and subjected to a phylogenetic analysis. The observations proved allele A was the single-detectable type of the NS gene within the studied isolates. All the examined Iranian isolates fell into the Korean sublineage with a relatively broad sequence homology (91.6-98% in nucleotide construction of the NS genes. The motif for PDZ ligand recognition of the group one isolates was either EDEV (N=6 or ESEV (N=1 While all viruses as group two contained a PL motif “KSEV” (N=3. The present work provides useful epidemiological data at molecular level on source and contemporary evolution of H9N2 virus population in Iran.

  11. Computational study of the fibril organization of polyglutamine repeats reveals a common motif identified in beta-helices.

    Science.gov (United States)

    Zanuy, David; Gunasekaran, Kannan; Lesk, Arthur M; Nussinov, Ruth

    2006-04-21

    The formation of fibril aggregates by long polyglutamine sequences is assumed to play a major role in neurodegenerative diseases such as Huntington. Here, we model peptides rich in glutamine, through a series of molecular dynamics simulations. Starting from a rigid nanotube-like conformation, we have obtained a new conformational template that shares structural features of a tubular helix and of a beta-helix conformational organization. Our new model can be described as a super-helical arrangement of flat beta-sheet segments linked by planar turns or bends. Interestingly, our comprehensive analysis of the Protein Data Bank reveals that this is a common motif in beta-helices (termed beta-bend), although it has not been identified so far. The motif is based on the alternation of beta-sheet and helical conformation as the protein sequence is followed from the N to the C termini (beta-alpha(R)-beta-polyPro-beta). We further identify this motif in the ssNMR structure of the protofibril of the amyloidogenic peptide Abeta(1-40). The recurrence of the beta-bend suggests a general mode of connecting long parallel beta-sheet segments that would allow the growth of partially ordered fibril structures. The design allows the peptide backbone to change direction with a minimal loss of main chain hydrogen bonds. The identification of a coherent organization beyond that of the beta-sheet segments in different folds rich in parallel beta-sheets suggests a higher degree of ordered structure in protein fibrils, in agreement with their low solubility and dense molecular packing.

  12. Leucine-based receptor sorting motifs are dependent on the spacing relative to the plasma membrane

    DEFF Research Database (Denmark)

    Geisler, C; Dietrich, J; Nielsen, B L

    1998-01-01

    Many integral membrane proteins contain leucine-based motifs within their cytoplasmic domains that mediate internalization and intracellular sorting. Two types of leucine-based motifs have been identified. One type is dependent on phosphorylation, whereas the other type, which includes an acidic...... amino acid, is constitutively active. In this study, we have investigated how the spacing relative to the plasma membrane affects the function of both types of leucine-based motifs. For phosphorylation-dependent leucine-based motifs, a minimal spacing of 7 residues between the plasma membrane...... and the phospho-acceptor was required for phosphorylation and thereby activation of the motifs. For constitutively active leucine-based motifs, a minimal spacing of 6 residues between the plasma membrane and the acidic residue was required for optimal activity of the motifs. In addition, we found that the acidic...

  13. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi

    DEFF Research Database (Denmark)

    Köljalg, U.; Larsson, K.H.; Abarenkov, K.

    2005-01-01

    Identification of ectomycorrhizal (ECM) fungi is often achieved through comparisons of ribosomal DNA internal transcribed spacer (ITS) sequences with accessioned sequences deposited in public databases. A major problem encountered is that annotation of the sequences in these databases is not always....... At present UNITE contains 758 ITS sequences from 455 species and 67 genera of ECM fungi. •  UNITE can be searched by taxon name, via sequence similarity using blastn, and via phylogenetic sequence identification using galaxie. Following implementation, galaxie performs a phylogenetic analysis of the query...... sequence after alignment either to pre-existing generic alignments, or to matches retrieved from a blast search on the UNITE data. It should be noted that the current version of UNITE is dedicated to the reliable identification of ECM fungi. •  The UNITE database is accessible through the URL http://unite.zbi.ee...

  14. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  15. Tree-Based Unrooted Phylogenetic Networks.

    Science.gov (United States)

    Francis, A; Huber, K T; Moulton, V

    2018-02-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.

  16. DistAMo: A web-based tool to characterize DNA-motif distribution on bacterial chromosomes

    Directory of Open Access Journals (Sweden)

    Patrick eSobetzko

    2016-03-01

    Full Text Available Short DNA motifs are involved in a multitude of functions such as for example chromosome segregation, DNA replication or mismatch repair. Distribution of such motifs is often not random and the specific chromosomal pattern relates to the respective motif function. Computational approaches which quantitatively assess such chromosomal motif patterns are necessary. Here we present a new computer tool DistAMo (Distribution Analysis of DNA Motifs. The algorithm uses codon redundancy to calculate the relative abundance of short DNA motifs from single genes to entire chromosomes. Comparative genomics analyses of the GATC-motif distribution in γ-proteobacterial genomes using DistAMo revealed that (i genes beside the replication origin are enriched in GATCs, (ii genome-wide GATC distribution follows a distinct pattern and (iii genes involved in DNA replication and repair are enriched in GATCs. These features are specific for bacterial chromosomes encoding a Dam methyltransferase. The new software is available as a stand-alone or as an easy-to-use web-based server version at http://www.computational.bio.uni-giessen.de/distamo.

  17. Plant DNA barcodes and assessment of phylogenetic community structure of a tropical mixed dipterocarp forest in Brunei Darussalam (Borneo)

    Science.gov (United States)

    Abu Salim, Kamariah; Chase, Mark W.; Dexter, Kyle G.; Pennington, R. Toby; Tan, Sylvester; Kaye, Maria Ellen; Samuel, Rosabelle

    2017-01-01

    DNA barcoding is a fast and reliable tool to assess and monitor biodiversity and, via community phylogenetics, to investigate ecological and evolutionary processes that may be responsible for the community structure of forests. In this study, DNA barcodes for the two widely used plastid coding regions rbcL and matK are used to contribute to identification of morphologically undetermined individuals, as well as to investigate phylogenetic structure of tree communities in 70 subplots (10 × 10m) of a 25-ha forest-dynamics plot in Brunei (Borneo, Southeast Asia). The combined matrix (rbcL + matK) comprised 555 haplotypes (from ≥154 genera, 68 families and 25 orders sensu APG, Angiosperm Phylogeny Group, 2016), making a substantial contribution to tree barcode sequences from Southeast Asia. Barcode sequences were used to reconstruct phylogenetic relationships using maximum likelihood, both with and without constraining the topology of taxonomic orders to match that proposed by the Angiosperm Phylogeny Group. A third phylogenetic tree was reconstructed using the program Phylomatic to investigate the influence of phylogenetic resolution on results. Detection of non-random patterns of community assembly was determined by net relatedness index (NRI) and nearest taxon index (NTI). In most cases, community assembly was either random or phylogenetically clustered, which likely indicates the importance to community structure of habitat filtering based on phylogenetically correlated traits in determining community structure. Different phylogenetic trees gave similar overall results, but the Phylomatic tree produced greater variation across plots for NRI and NTI values, presumably due to noise introduced by using an unresolved phylogenetic tree. Our results suggest that using a DNA barcode tree has benefits over the traditionally used Phylomatic approach by increasing precision and accuracy and allowing the incorporation of taxonomically unidentified individuals into analyses

  18. Plant DNA barcodes and assessment of phylogenetic community structure of a tropical mixed dipterocarp forest in Brunei Darussalam (Borneo.

    Directory of Open Access Journals (Sweden)

    Jacqueline Heckenhauer

    Full Text Available DNA barcoding is a fast and reliable tool to assess and monitor biodiversity and, via community phylogenetics, to investigate ecological and evolutionary processes that may be responsible for the community structure of forests. In this study, DNA barcodes for the two widely used plastid coding regions rbcL and matK are used to contribute to identification of morphologically undetermined individuals, as well as to investigate phylogenetic structure of tree communities in 70 subplots (10 × 10m of a 25-ha forest-dynamics plot in Brunei (Borneo, Southeast Asia. The combined matrix (rbcL + matK comprised 555 haplotypes (from ≥154 genera, 68 families and 25 orders sensu APG, Angiosperm Phylogeny Group, 2016, making a substantial contribution to tree barcode sequences from Southeast Asia. Barcode sequences were used to reconstruct phylogenetic relationships using maximum likelihood, both with and without constraining the topology of taxonomic orders to match that proposed by the Angiosperm Phylogeny Group. A third phylogenetic tree was reconstructed using the program Phylomatic to investigate the influence of phylogenetic resolution on results. Detection of non-random patterns of community assembly was determined by net relatedness index (NRI and nearest taxon index (NTI. In most cases, community assembly was either random or phylogenetically clustered, which likely indicates the importance to community structure of habitat filtering based on phylogenetically correlated traits in determining community structure. Different phylogenetic trees gave similar overall results, but the Phylomatic tree produced greater variation across plots for NRI and NTI values, presumably due to noise introduced by using an unresolved phylogenetic tree. Our results suggest that using a DNA barcode tree has benefits over the traditionally used Phylomatic approach by increasing precision and accuracy and allowing the incorporation of taxonomically unidentified individuals

  19. FluReF, an automated flu virus reassortment finder based on phylogenetic trees.

    Science.gov (United States)

    Yurovsky, Alisa; Moret, Bernard M E

    2011-01-01

    Reassortments are events in the evolution of the genome of influenza (flu), whereby segments of the genome are exchanged between different strains. As reassortments have been implicated in major human pandemics of the last century, their identification has become a health priority. While such identification can be done "by hand" on a small dataset, researchers and health authorities are building up enormous databases of genomic sequences for every flu strain, so that it is imperative to develop automated identification methods. However, current methods are limited to pairwise segment comparisons. We present FluReF, a fully automated flu virus reassortment finder. FluReF is inspired by the visual approach to reassortment identification and uses the reconstructed phylogenetic trees of the individual segments and of the full genome. We also present a simple flu evolution simulator, based on the current, source-sink, hypothesis for flu cycles. On synthetic datasets produced by our simulator, FluReF, tuned for a 0% false positive rate, yielded false negative rates of less than 10%. FluReF corroborated two new reassortments identified by visual analysis of 75 Human H3N2 New York flu strains from 2005-2008 and gave partial verification of reassortments found using another bioinformatics method. FluReF finds reassortments by a bottom-up search of the full-genome and segment-based phylogenetic trees for candidate clades--groups of one or more sampled viruses that are separated from the other variants from the same season. Candidate clades in each tree are tested to guarantee confidence values, using the lengths of key edges as well as other tree parameters; clades with reassortments must have validated incongruencies among segment trees. FluReF demonstrates robustness of prediction for geographically and temporally expanded datasets, and is not limited to finding reassortments with previously collected sequences. The complete source code is available from http://lcbb.epfl.ch/software.html.

  20. Selection against spurious promoter motifs correlates withtranslational efficiency across bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Froula, Jeffrey L.; Francino, M. Pilar

    2007-05-01

    Because binding of RNAP to misplaced sites could compromise the efficiency of transcription, natural selection for the optimization of gene expression should regulate the distribution of DNA motifs capable of RNAP-binding across the genome. Here we analyze the distribution of the -10 promoter motifs that bind the {sigma}{sup 70} subunit of RNAP in 42 bacterial genomes. We show that selection on these motifs operates across the genome, maintaining an over-representation of -10 motifs in regulatory sequences while eliminating them from the nonfunctional and, in most cases, from the protein coding regions. In some genomes, however, -10 sites are over-represented in the coding sequences; these sites could induce pauses effecting regulatory roles throughout the length of a transcriptional unit. For nonfunctional sequences, the extent of motif under-representation varies across genomes in a manner that broadly correlates with the number of tRNA genes, a good indicator of translational speed and growth rate. This suggests that minimizing the time invested in gene transcription is an important selective pressure against spurious binding. However, selection against spurious binding is detectable in the reduced genomes of host-restricted bacteria that grow at slow rates, indicating that components of efficiency other than speed may also be important. Minimizing the number of RNAP molecules per cell required for transcription, and the corresponding energetic expense, may be most relevant in slow growers. These results indicate that genome-level properties affecting the efficiency of transcription and translation can respond in an integrated manner to optimize gene expression. The detection of selection against promoter motifs in nonfunctional regions also implies that no sequence may evolve free of selective constraints, at least in the relatively small and unstructured genomes of bacteria.

  1. Characterization of the Complete Mitochondrion Genome of Diurnal Moth Amata emma (Butler) (Lepidoptera: Erebidae) and Its Phylogenetic Implications

    Science.gov (United States)

    Lu, Hui-Fen; Su, Tian-Juan; Luo, A-Rong; Zhu, Chao-Dong; Wu, Chun-Sheng

    2013-01-01

    Mitogenomes can provide information for phylogenetic analyses and evolutionary biology. The complete mitochondrial genome of Amata emma (Lepidoptera: Erebidae) was sequenced and analyzed in the study. The circular genome is 15,463 bp in size, with the gene content, orientation and order identical to other ditrysian insects. The genome composition of the major strand shows highly A+T biased and exhibits negative AT-skew and GC-skew. The initial codons are the canonical putative start codons ATN with the exception of cox1 gene which uses CGA instead. Ten genes share complete termination codons TAA, and three genes use incomplete stop codons TA or T. Additionally, the codon distribution and Relative Synonymous Codon Usage of the 13 PCGs in the A. emma mitogenome are consistent with those in other Noctuid mitogenomes. All tRNA genes have typical cloverleaf secondary structures, except for the trnS1 (AGN) gene, in which the dihydrouridine (DHU) arm is simplified down to a loop. The secondary structures of two rRNA genes broadly conform with the models proposed for these genes of other Lepidopteran insects. Except for the A+T-rich region, there are three major intergenic spacers, spanning at least 10 bp and five overlapping regions. There are obvious differences in the A+T-rich region between A. emma and other Lepidopteran insects reported previously except that the A+T-rich region contains an ‘ATAGA’ -like motif followed by a 19 bp poly-T stretch and a (AT)9 element preceded by the ‘ATTTA’ motif. It neither has a poly-A (in the α strand) upstream trnM nor potential stem-loop structures and just has some simple structures like (AT)nGTAT. The phylogenetic relationships based on nucleotide sequences of 13 PCGs using Bayesian inference and maximum likelihood methods provided a well-supported a broader outline of Lepidoptera and which agree with the traditional morphological classification and recently working, but with a much higher support. PMID:24069145

  2. Complete Deletion of the Fucose Operon in Haemophilus influenzae Is Associated with a Cluster in Multilocus Sequence Analysis-Based Phylogenetic Group II Related to Haemophilus haemolyticus: Implications for Identification and Typing.

    Science.gov (United States)

    de Gier, Camilla; Kirkham, Lea-Ann S; Nørskov-Lauritsen, Niels

    2015-12-01

    Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the "fuzzy species" strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  3. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  4. Ant-Based Phylogenetic Reconstruction (ABPR: A new distance algorithm for phylogenetic estimation based on ant colony optimization

    Directory of Open Access Journals (Sweden)

    Karla Vittori

    2008-12-01

    Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.

  5. Rooting phylogenetic trees under the coalescent model using site pattern probabilities.

    Science.gov (United States)

    Tian, Yuan; Kubatko, Laura

    2017-12-19

    Phylogenetic tree inference is a fundamental tool to estimate ancestor-descendant relationships among different species. In phylogenetic studies, identification of the root - the most recent common ancestor of all sampled organisms - is essential for complete understanding of the evolutionary relationships. Rooted trees benefit most downstream application of phylogenies such as species classification or study of adaptation. Often, trees can be rooted by using outgroups, which are species that are known to be more distantly related to the sampled organisms than any other species in the phylogeny. However, outgroups are not always available in evolutionary research. In this study, we develop a new method for rooting species tree under the coalescent model, by developing a series of hypothesis tests for rooting quartet phylogenies using site pattern probabilities. The power of this method is examined by simulation studies and by application to an empirical North American rattlesnake data set. The method shows high accuracy across the simulation conditions considered, and performs well for the rattlesnake data. Thus, it provides a computationally efficient way to accurately root species-level phylogenies that incorporates the coalescent process. The method is robust to variation in substitution model, but is sensitive to the assumption of a molecular clock. Our study establishes a computationally practical method for rooting species trees that is more efficient than traditional methods. The method will benefit numerous evolutionary studies that require rooting a phylogenetic tree without having to specify outgroups.

  6. Phylogenetic Framework and Molecular Signatures for the Main Clades of the Phylum Actinobacteria

    Science.gov (United States)

    Gao, Beile

    2012-01-01

    Summary: The phylum Actinobacteria harbors many important human pathogens and also provides one of the richest sources of natural products, including numerous antibiotics and other compounds of biotechnological interest. Thus, a reliable phylogeny of this large phylum and the means to accurately identify its different constituent groups are of much interest. Detailed phylogenetic and comparative analyses of >150 actinobacterial genomes reported here form the basis for achieving these objectives. In phylogenetic trees based upon 35 conserved proteins, most of the main groups of Actinobacteria as well as a number of their superageneric clades are resolved. We also describe large numbers of molecular markers consisting of conserved signature indels in protein sequences and whole proteins that are specific for either all Actinobacteria or their different clades (viz., orders, families, genera, and subgenera) at various taxonomic levels. These signatures independently support the existence of different phylogenetic clades, and based upon them, it is now possible to delimit the phylum Actinobacteria (excluding Coriobacteriia) and most of its major groups in clear molecular terms. The species distribution patterns of these markers also provide important information regarding the interrelationships among different main orders of Actinobacteria. The identified molecular markers, in addition to enabling the development of a stable and reliable phylogenetic framework for this phylum, also provide novel and powerful means for the identification of different groups of Actinobacteria in diverse environments. Genetic and biochemical studies on these Actinobacteria-specific markers should lead to the discovery of novel biochemical and/or other properties that are unique to different groups of Actinobacteria. PMID:22390973

  7. Argo_CUDA: Exhaustive GPU based approach for motif discovery in large DNA datasets.

    Science.gov (United States)

    Vishnevsky, Oleg V; Bocharnikov, Andrey V; Kolchanov, Nikolay A

    2018-02-01

    The development of chromatin immunoprecipitation sequencing (ChIP-seq) technology has revolutionized the genetic analysis of the basic mechanisms underlying transcription regulation and led to accumulation of information about a huge amount of DNA sequences. There are a lot of web services which are currently available for de novo motif discovery in datasets containing information about DNA/protein binding. An enormous motif diversity makes their finding challenging. In order to avoid the difficulties, researchers use different stochastic approaches. Unfortunately, the efficiency of the motif discovery programs dramatically declines with the query set size increase. This leads to the fact that only a fraction of top "peak" ChIP-Seq segments can be analyzed or the area of analysis should be narrowed. Thus, the motif discovery in massive datasets remains a challenging issue. Argo_Compute Unified Device Architecture (CUDA) web service is designed to process the massive DNA data. It is a program for the detection of degenerate oligonucleotide motifs of fixed length written in 15-letter IUPAC code. Argo_CUDA is a full-exhaustive approach based on the high-performance GPU technologies. Compared with the existing motif discovery web services, Argo_CUDA shows good prediction quality on simulated sets. The analysis of ChIP-Seq sequences revealed the motifs which correspond to known transcription factor binding sites.

  8. iFORM: Incorporating Find Occurrence of Regulatory Motifs.

    Science.gov (United States)

    Ren, Chao; Chen, Hebing; Yang, Bite; Liu, Feng; Ouyang, Zhangyi; Bo, Xiaochen; Shu, Wenjie

    2016-01-01

    Accurately identifying the binding sites of transcription factors (TFs) is crucial to understanding the mechanisms of transcriptional regulation and human disease. We present incorporating Find Occurrence of Regulatory Motifs (iFORM), an easy-to-use and efficient tool for scanning DNA sequences with TF motifs described as position weight matrices (PWMs). Both performance assessment with a receiver operating characteristic (ROC) curve and a correlation-based approach demonstrated that iFORM achieves higher accuracy and sensitivity by integrating five classical motif discovery programs using Fisher's combined probability test. We have used iFORM to provide accurate results on a variety of data in the ENCODE Project and the NIH Roadmap Epigenomics Project, and the tool has demonstrated its utility in further elucidating individual roles of functional elements. Both the source and binary codes for iFORM can be freely accessed at https://github.com/wenjiegroup/iFORM. The identified TF binding sites across human cell and tissue types using iFORM have been deposited in the Gene Expression Omnibus under the accession ID GSE53962.

  9. Lucky Motifs in Chinese Folk Art: Interpreting Paper-cut from Chinese Shaanxi

    OpenAIRE

    Xuxiao WANG

    2013-01-01

    Paper-cut is not simply a form of traditional Chinese folk art. Lucky motifs developed in paper-cut certainly acquired profound cultural connotations. As paper-cut is a time-honoured skill across the nation, interpreting those motifs requires cultural receptiveness and anthropological sensitivity. The author of this article analyzes examples of paper-cut from Northern Shaanxi, China, to identify the cohesive motifs and explore the auspiciousness of the specific concepts of Fu, Lu, Shou, Xi. T...

  10. MOMFER: A Search Engine of Thompson's Motif-Index of Folk Literature

    NARCIS (Netherlands)

    Karsdorp, F.B.; van der Meulen, Marten; Meder, Theo; van den Bosch, Antal

    2015-01-01

    More than fifty years after the first edition of Thompson's seminal Motif-Indexof Folk Literature, we present an online search engine tailored to fully disclose the index digitally. This search engine, called MOMFER, greatly enhances the searchability of the Motif-Index and provides exciting new

  11. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

    Directory of Open Access Journals (Sweden)

    Ann L Griffen

    2011-04-01

    Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.

  12. Genome-wide identification of soybean WRKY transcription factors in response to salt stress.

    Science.gov (United States)

    Yu, Yanchong; Wang, Nan; Hu, Ruibo; Xiang, Fengning

    2016-01-01

    Members of the large family of WRKY transcription factors are involved in a wide range of developmental and physiological processes, most particularly in the plant response to biotic and abiotic stress. Here, an analysis of the soybean genome sequence allowed the identification of the full complement of 188 soybean WRKY genes. Phylogenetic analysis revealed that soybean WRKY genes were classified into three major groups (I, II, III), with the second group further categorized into five subgroups (IIa-IIe). The soybean WRKYs from each group shared similar gene structures and motif compositions. The location of the GmWRKYs was dispersed over all 20 soybean chromosomes. The whole genome duplication appeared to have contributed significantly to the expansion of the family. Expression analysis by RNA-seq indicated that in soybean root, 66 of the genes responded rapidly and transiently to the imposition of salt stress, all but one being up-regulated. While in aerial part, 49 GmWRKYs responded, all but two being down-regulated. RT-qPCR analysis showed that in the whole soybean plant, 66 GmWRKYs exhibited distinct expression patterns in response to salt stress, of which 12 showed no significant change, 35 were decreased, while 19 were induced. The data present here provide critical clues for further functional studies of WRKY gene in soybean salt tolerance.

  13. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  14. A Genetic Programming Method for the Identification of Signal Peptides and Prediction of Their Cleavage Sites

    Directory of Open Access Journals (Sweden)

    David Lennartsson

    2004-01-01

    Full Text Available A novel approach to signal peptide identification is presented. We use an evolutionary algorithm for automatic evolution of classification programs, so-called programmatic motifs. The variant of evolutionary algorithm used is called genetic programming where a population of solution candidates in the form of full computer programs is evolved, based on training examples consisting of signal peptide sequences. The method is compared with a previous work using artificial neural network (ANN approaches. Some advantages compared to ANNs are noted. The programmatic motif can perform computational tasks beyond that of feed-forward neural networks and has also other advantages such as readability. The best motif evolved was analyzed and shown to detect the h-region of the signal peptide. A powerful parallel computer cluster was used for the experiment.

  15. UNITE: a database providing web-based methods for the molecular identification of ectomycorrhizal fungi.

    Science.gov (United States)

    Kõljalg, Urmas; Larsson, Karl-Henrik; Abarenkov, Kessy; Nilsson, R Henrik; Alexander, Ian J; Eberhardt, Ursula; Erland, Susanne; Høiland, Klaus; Kjøller, Rasmus; Larsson, Ellen; Pennanen, Taina; Sen, Robin; Taylor, Andy F S; Tedersoo, Leho; Vrålstad, Trude; Ursing, Björn M

    2005-06-01

    Identification of ectomycorrhizal (ECM) fungi is often achieved through comparisons of ribosomal DNA internal transcribed spacer (ITS) sequences with accessioned sequences deposited in public databases. A major problem encountered is that annotation of the sequences in these databases is not always complete or trustworthy. In order to overcome this deficiency, we report on UNITE, an open-access database. UNITE comprises well annotated fungal ITS sequences from well defined herbarium specimens that include full herbarium reference identification data, collector/source and ecological data. At present UNITE contains 758 ITS sequences from 455 species and 67 genera of ECM fungi. UNITE can be searched by taxon name, via sequence similarity using blastn, and via phylogenetic sequence identification using galaxie. Following implementation, galaxie performs a phylogenetic analysis of the query sequence after alignment either to pre-existing generic alignments, or to matches retrieved from a blast search on the UNITE data. It should be noted that the current version of UNITE is dedicated to the reliable identification of ECM fungi. The UNITE database is accessible through the URL http://unite.zbi.ee

  16. How pathogens use linear motifs to perturb host cell networks

    KAUST Repository

    Via, Allegra; Uyar, Bora; Brun, Christine; Zanzoni, Andreas

    2015-01-01

    Molecular mimicry is one of the powerful stratagems that pathogens employ to colonise their hosts and take advantage of host cell functions to guarantee their replication and dissemination. In particular, several viruses have evolved the ability to interact with host cell components through protein short linear motifs (SLiMs) that mimic host SLiMs, thus facilitating their internalisation and the manipulation of a wide range of cellular networks. Here we present convincing evidence from the literature that motif mimicry also represents an effective, widespread hijacking strategy in prokaryotic and eukaryotic parasites. Further insights into host motif mimicry would be of great help in the elucidation of the molecular mechanisms behind host cell invasion and the development of anti-infective therapeutic strategies.

  17. Structural and functional studies of a phosphatidic acid-binding antifungal plant defensin MtDef4: Identification of an RGFRRR motif governing fungal cell entry

    Energy Technology Data Exchange (ETDEWEB)

    Sagaram, Uma S.; El-Mounadi, Kaoutar; Buchko, Garry W.; Berg, Howard R.; Kaur, Jagdeep; Pandurangi, Raghoottama; Smith, Thomas J.; Shah, Dilip

    2013-12-04

    A highly conserved plant defensin MtDef4 potently inhibits the growth of a filamentous fungus Fusarium graminearum. MtDef4 is internalized by cells of F. graminearum. To determine its mechanism of fungal cell entry and antifungal action, NMR solution structure of MtDef4 has been determined. The analysis of its structure has revealed a positively charged patch on the surface of the protein consisting of arginine residues in its γ-core signature, a major determinant of the antifungal activity of MtDef4. Here, we report functional analysis of the RGFRRR motif of the γ-core signature of MtDef4. The replacement of RGFRRR to AAAARR or to RGFRAA not only abolishes fungal cell entry but also results in loss of the antifungal activity of MtDef4. MtDef4 binds strongly to phosphatidic acid (PA), a precursor for the biosynthesis of membrane phospholipids and a signaling lipid known to recruit cytosolic proteins to membranes. Mutations of RGFRRR which abolish fungal cell entry of MtDef4 also impair its binding to PA. Our results suggest that RGFRRR motif is a translocation signal for entry of MtDef4 into fungal cells and that this positively charged motif likely mediates interaction of this defensin with PA as part of its antifungal action.

  18. Visual exploration of parameter influence on phylogenetic trees.

    Science.gov (United States)

    Hess, Martin; Bremm, Sebastian; Weissgraeber, Stephanie; Hamacher, Kay; Goesele, Michael; Wiemeyer, Josef; von Landesberger, Tatiana

    2014-01-01

    Evolutionary relationships between organisms are frequently derived as phylogenetic trees inferred from multiple sequence alignments (MSAs). The MSA parameter space is exponentially large, so tens of thousands of potential trees can emerge for each dataset. A proposed visual-analytics approach can reveal the parameters' impact on the trees. Given input trees created with different parameter settings, it hierarchically clusters the trees according to their structural similarity. The most important clusters of similar trees are shown together with their parameters. This view offers interactive parameter exploration and automatic identification of relevant parameters. Biologists applied this approach to real data of 16S ribosomal RNA and protein sequences of ion channels. It revealed which parameters affected the tree structures. This led to a more reliable selection of the best trees.

  19. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  20. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  1. BayesMD: flexible biological modeling for motif discovery

    DEFF Research Database (Denmark)

    Tang, Man-Hung Eric; Krogh, Anders; Winther, Ole

    2008-01-01

    We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained on trans......We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained...

  2. Lucky Motifs in Chinese Folk Art: Interpreting Paper-cut from Chinese Shaanxi

    Directory of Open Access Journals (Sweden)

    Xuxiao WANG

    2013-11-01

    Full Text Available Paper-cut is not simply a form of traditional Chinese folk art. Lucky motifs developed in paper-cut certainly acquired profound cultural connotations. As paper-cut is a time-honoured skill across the nation, interpreting those motifs requires cultural receptiveness and anthropological sensitivity. The author of this article analyzes examples of paper-cut from Northern Shaanxi, China, to identify the cohesive motifs and explore the auspiciousness of the specific concepts of Fu, Lu, Shou, Xi. The paper-cut of Northern Shaanxi is an ideal representative of the craft as a whole because of the relative stability of this region in history, in terms of both art and culture. Furthermore, its straightforward style provides a clear demonstration of motifs regarding folk understanding of expectations for life.

  3. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  4. A peptide affinity column for the identification of integrin alpha IIb-binding proteins.

    Science.gov (United States)

    Daxecker, Heide; Raab, Markus; Bernard, Elise; Devocelle, Marc; Treumann, Achim; Moran, Niamh

    2008-03-01

    To understand the regulation of integrin alpha(IIb)beta(3), a critical platelet adhesion molecule, we have developed a peptide affinity chromatography method using the known integrin regulatory motif, LAMWKVGFFKR. Using standard Fmoc chemistry, this peptide was synthesized onto a Toyopearl AF-Amino-650 M resin on a 6-aminohexanoic acid (Ahx) linker. Peptide density was controlled by acetylation of 83% of the Ahx amino groups. Four recombinant human proteins (CIB1, PP1, ICln and RN181), previously identified as binding to this integrin regulatory motif, were specifically retained by the column containing the integrin peptide but not by a column presenting an irrelevant peptide. Hemoglobin, creatine kinase, bovine serum albumin, fibrinogen and alpha-tubulin failed to bind under the chosen conditions. Immunodetection methods confirmed the binding of endogenous platelet proteins, including CIB1, PP1, ICln RN181, AUP-1 and beta3-integrin, from a detergent-free platelet lysate. Thus, we describe a reproducible method that facilitates the reliable extraction of specific integrin-binding proteins from complex biological matrices. This methodology may enable the sensitive and specific identification of proteins that interact with linear, membrane-proximal peptide motifs such as the integrin regulatory motif LAMWKVGFFKR.

  5. Sequence alignment reveals possible MAPK docking motifs on HIV proteins.

    Directory of Open Access Journals (Sweden)

    Perry Evans

    Full Text Available Over the course of HIV infection, virus replication is facilitated by the phosphorylation of HIV proteins by human ERK1 and ERK2 mitogen-activated protein kinases (MAPKs. MAPKs are known to phosphorylate their substrates by first binding with them at a docking site. Docking site interactions could be viable drug targets because the sequences guiding them are more specific than phosphorylation consensus sites. In this study we use multiple bioinformatics tools to discover candidate MAPK docking site motifs on HIV proteins known to be phosphorylated by MAPKs, and we discuss the possibility of targeting docking sites with drugs. Using sequence alignments of HIV proteins of different subtypes, we show that MAPK docking patterns previously described for human proteins appear on the HIV matrix, Tat, and Vif proteins in a strain dependent manner, but are absent from HIV Rev and appear on all HIV Nef strains. We revise the regular expressions of previously annotated MAPK docking patterns in order to provide a subtype independent motif that annotates all HIV proteins. One revision is based on a documented human variant of one of the substrate docking motifs, and the other reduces the number of required basic amino acids in the standard docking motifs from two to one. The proposed patterns are shown to be consistent with in silico docking between ERK1 and the HIV matrix protein. The motif usage on HIV proteins is sufficiently different from human proteins in amino acid sequence similarity to allow for HIV specific targeting using small-molecule drugs.

  6. Noisy: Identification of problematic columns in multiple sequence alignments

    Directory of Open Access Journals (Sweden)

    Grünewald Stefan

    2008-06-01

    Full Text Available Abstract Motivation Sequence-based methods for phylogenetic reconstruction from (nucleic acid sequence data are notoriously plagued by two effects: homoplasies and alignment errors. Large evolutionary distances imply a large number of homoplastic sites. As most protein-coding genes show dramatic variations in substitution rates that are not uncorrelated across the sequence, this often leads to a patchwork pattern of (i phylogenetically informative and (ii effectively randomized regions. In highly variable regions, furthermore, alignment errors accumulate resulting in sometimes misleading signals in phylogenetic reconstruction. Results We present here a method that, based on assessing the distribution of character states along a cyclic ordering of the taxa, allows the identification of phylogenetically uninformative homoplastic sites in a multiple sequence alignment. Removal of these sites appears to improve the performance of phylogenetic reconstruction algorithms as measured by various indices of "tree quality". In particular, we obtain more stable trees due to the exclusion of phylogenetically incompatible sites that most likely represent strongly randomized characters. Software The computer program noisy implements this approach. It can be employed to improving phylogenetic reconstruction capability with quite a considerable success rate whenever (1 the average bootstrap support obtained from the original alignment is low, and (2 there are sufficiently many taxa in the data set – at least, say, 12 to 15 taxa. The software can be obtained under the GNU Public License from http://www.bioinf.uni-leipzig.de/Software/noisy/.

  7. Stochastic Resonance in Neuronal Network Motifs with Ornstein-Uhlenbeck Colored Noise

    Directory of Open Access Journals (Sweden)

    Xuyang Lou

    2014-01-01

    Full Text Available We consider here the effect of the Ornstein-Uhlenbeck colored noise on the stochastic resonance of the feed-forward-loop (FFL network motif. The FFL motif is modeled through the FitzHugh-Nagumo neuron model as well as the chemical coupling. Our results show that the noise intensity and the correlation time of the noise process serve as the control parameters, which have great impacts on the stochastic dynamics of the FFL motif. We find that, with a proper choice of noise intensities and the correlation time of the noise process, the signal-to-noise ratio (SNR can display more than one peak.

  8. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  9. Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise

    Science.gov (United States)

    Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San

    2018-01-01

    Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…

  10. Wayward Warriors: The Viking Motif in Swedish and English Children's Literature

    Science.gov (United States)

    Sundmark, Björn

    2014-01-01

    In this article the Viking motif in children's literature is explored--from its roots in (adult) nationalist and antiquarian discourse, over pedagogical and historical texts for children, to the eventual diversification (or dissolution) of the motif into different genres and forms. The focus is on Swedish Viking narratives, but points of…

  11. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  12. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  13. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  14. Phylogenetic structure in tropical hummingbird communities

    DEFF Research Database (Denmark)

    Graham, Catherine H; Parra, Juan L; Rahbek, Carsten

    2009-01-01

    How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...

  15. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  16. Inferring Phylogenetic Networks Using PhyloNet.

    Science.gov (United States)

    Wen, Dingqiao; Yu, Yun; Zhu, Jiafan; Nakhleh, Luay

    2018-07-01

    PhyloNet was released in 2008 as a software package for representing and analyzing phylogenetic networks. At the time of its release, the main functionalities in PhyloNet consisted of measures for comparing network topologies and a single heuristic for reconciling gene trees with a species tree. Since then, PhyloNet has grown significantly. The software package now includes a wide array of methods for inferring phylogenetic networks from data sets of unlinked loci while accounting for both reticulation (e.g., hybridization) and incomplete lineage sorting. In particular, PhyloNet now allows for maximum parsimony, maximum likelihood, and Bayesian inference of phylogenetic networks from gene tree estimates. Furthermore, Bayesian inference directly from sequence data (sequence alignments or biallelic markers) is implemented. Maximum parsimony is based on an extension of the "minimizing deep coalescences" criterion to phylogenetic networks, whereas maximum likelihood and Bayesian inference are based on the multispecies network coalescent. All methods allow for multiple individuals per species. As computing the likelihood of a phylogenetic network is computationally hard, PhyloNet allows for evaluation and inference of networks using a pseudolikelihood measure. PhyloNet summarizes the results of the various analyzes and generates phylogenetic networks in the extended Newick format that is readily viewable by existing visualization software.

  17. Discovery of Conservation and Diversification of miR171 Genes by Phylogenetic Analysis based on Global Genomes

    Directory of Open Access Journals (Sweden)

    Xudong Zhu

    2015-07-01

    Full Text Available The microRNA171 (miR171 family is widely distributed and highly conserved in a range of species and plays critical roles in regulating plant growth and development through repressing expression of ( transcription factors. However, information on the evolutionary conservation and functional diversification of the miRNA171 family members remains scanty. We reconstructed the phylogenetic relationships among miR171 precursor and mature sequences so as to investigate the extent and degree of evolutionary conservation of miR171 in (L. Heynh. (ath, grape ( L. (vvi, poplar ( Torr. & A.Gray ex Hook. (ptc, and rice ( L. (osa. Despite strong conservation of over 80%, some mature miR171 sequences, such as , and and , -, and -, have undergone critical sequence variation, leading to functional diversification, since they target non gene transcript(s. Phylogenetic analyses revealed a combination of old ancestral relationships and recent lineage-specific diversification in the miR171 family within the four model plants. The -regulatory motifs on the upstream promoter sequences of genes were highly divergent and shared some similar elements, indicating their possible contribution to the functional variation observed within the miR171 family. This study will buttress our understanding of the functional differentiation of miRNAs and the relationships of miRNA–target pairs based on the evolutionary history of genes.

  18. Phylogenetic classification of bony fishes.

    Science.gov (United States)

    Betancur-R, Ricardo; Wiley, Edward O; Arratia, Gloria; Acero, Arturo; Bailly, Nicolas; Miya, Masaki; Lecointre, Guillaume; Ortí, Guillermo

    2017-07-06

    Fish classifications, as those of most other taxonomic groups, are being transformed drastically as new molecular phylogenies provide support for natural groups that were unanticipated by previous studies. A brief review of the main criteria used by ichthyologists to define their classifications during the last 50 years, however, reveals slow progress towards using an explicit phylogenetic framework. Instead, the trend has been to rely, in varying degrees, on deep-rooted anatomical concepts and authority, often mixing taxa with explicit phylogenetic support with arbitrary groupings. Two leading sources in ichthyology frequently used for fish classifications (JS Nelson's volumes of Fishes of the World and W. Eschmeyer's Catalog of Fishes) fail to adopt a global phylogenetic framework despite much recent progress made towards the resolution of the fish Tree of Life. The first explicit phylogenetic classification of bony fishes was published in 2013, based on a comprehensive molecular phylogeny ( www.deepfin.org ). We here update the first version of that classification by incorporating the most recent phylogenetic results. The updated classification presented here is based on phylogenies inferred using molecular and genomic data for nearly 2000 fishes. A total of 72 orders (and 79 suborders) are recognized in this version, compared with 66 orders in version 1. The phylogeny resolves placement of 410 families, or ~80% of the total of 514 families of bony fishes currently recognized. The ordinal status of 30 percomorph families included in this study, however, remains uncertain (incertae sedis in the series Carangaria, Ovalentaria, or Eupercaria). Comments to support taxonomic decisions and comparisons with conflicting taxonomic groups proposed by others are presented. We also highlight cases were morphological support exist for the groups being classified. This version of the phylogenetic classification of bony fishes is substantially improved, providing resolution

  19. Sequence and phylogenetic analysis of virulent Newcastle disease virus isolates from Pakistan during 2009–2013 reveals circulation of new sub genotype

    International Nuclear Information System (INIS)

    Siddique, Naila; Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul

    2013-01-01

    Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic 112 GRQGRL 117 and velogenic 112 RRQKRF 117 along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks

  20. Finding a Leucine in a Haystack: Searching the Proteome for ambigous Leucine-Aspartic Acid motifs

    KAUST Repository

    Arold, Stefan T.

    2016-01-01

    LDMF predicted 13 new LD motifs in humans. Using biophysical assays, we experimentally confirmed in vitro interactions for four novel LD motif proteins. Thus, LDMF allows proteome-wide discovery of LD motifs, despite a highly ambiguous sequence pattern. Functional implications will be discussed.

  1. The space of ultrametric phylogenetic trees.

    Science.gov (United States)

    Gavryushkin, Alex; Drummond, Alexei J

    2016-08-21

    The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Discovery of cell-type specific DNA motif grammar in cis-regulatory elements using random Forest.

    Science.gov (United States)

    Wang, Xin; Lin, Peijie; Ho, Joshua W K

    2018-01-19

    It has been observed that many transcription factors (TFs) can bind to different genomic loci depending on the cell type in which a TF is expressed in, even though the individual TF usually binds to the same core motif in different cell types. How a TF can bind to the genome in such a highly cell-type specific manner, is a critical research question. One hypothesis is that a TF requires co-binding of different TFs in different cell types. If this is the case, it may be possible to observe different combinations of TF motifs - a motif grammar - located at the TF binding sites in different cell types. In this study, we develop a bioinformatics method to systematically identify DNA motifs in TF binding sites across multiple cell types based on published ChIP-seq data, and address two questions: (1) can we build a machine learning classifier to predict cell-type specificity based on motif combinations alone, and (2) can we extract meaningful cell-type specific motif grammars from this classifier model. We present a Random Forest (RF) based approach to build a multi-class classifier to predict the cell-type specificity of a TF binding site given its motif content. We applied this RF classifier to two published ChIP-seq datasets of TF (TCF7L2 and MAX) across multiple cell types. Using cross-validation, we show that motif combinations alone are indeed predictive of cell types. Furthermore, we present a rule mining approach to extract the most discriminatory rules in the RF classifier, thus allowing us to discover the underlying cell-type specific motif grammar. Our bioinformatics analysis supports the hypothesis that combinatorial TF motif patterns are cell-type specific.

  3. Identification of three new isolates of Tomato spotted wilt virus from different hosts in China: molecular diversity, phylogenetic and recombination analyses.

    Science.gov (United States)

    Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng

    2016-01-14

    Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative

  4. POWRS: position-sensitive motif discovery.

    Directory of Open Access Journals (Sweden)

    Ian W Davis

    Full Text Available Transcription factors and the short, often degenerate DNA sequences they recognize are central regulators of gene expression, but their regulatory code is challenging to dissect experimentally. Thus, computational approaches have long been used to identify putative regulatory elements from the patterns in promoter sequences. Here we present a new algorithm "POWRS" (POsition-sensitive WoRd Set for identifying regulatory sequence motifs, specifically developed to address two common shortcomings of existing algorithms. First, POWRS uses the position-specific enrichment of regulatory elements near transcription start sites to significantly increase sensitivity, while providing new information about the preferred localization of those elements. Second, POWRS forgoes position weight matrices for a discrete motif representation that appears more resistant to over-generalization. We apply this algorithm to discover sequences related to constitutive, high-level gene expression in the model plant Arabidopsis thaliana, and then experimentally validate the importance of those elements by systematically mutating two endogenous promoters and measuring the effect on gene expression levels. This provides a foundation for future efforts to rationally engineer gene expression in plants, a problem of great importance in developing biotech crop varieties.BSD-licensed Python code at http://grassrootsbio.com/papers/powrs/.

  5. CONREAL web server: identification and visualization of conserved transcription factor binding sites

    NARCIS (Netherlands)

    Berezikov, E.; Guryev, V.; Cuppen, E.

    2005-01-01

    The use of orthologous sequences and phylogenetic footprinting approaches have become popular for the recognition of conserved and potentially functional sequences. Several algorithms have been developed for the identification of conserved transcription factor binding sites (TFBSs), which are

  6. Poly(A) motif prediction using spectral latent features from human DNA sequences

    KAUST Repository

    Xie, Bo; Jankovic, Boris R.; Bajic, Vladimir B.; Song, Le; Gao, Xin

    2013-01-01

    Motivation: Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Identifying DNA sequence motifs that signal the addition of poly(A) tails is essential to improved genome annotation and better understanding of the regulatory mechanisms and stability of mRNA.Existing poly(A) motif predictors demonstrate that information extracted from the surrounding nucleotide sequences of candidate poly(A) motifs can differentiate true motifs from the false ones to a great extent. A variety of sophisticated features has been explored, including sequential, structural, statistical, thermodynamic and evolutionary properties. However, most of these methods involve extensive manual feature engineering, which can be time-consuming and can require in-depth domain knowledge.Results: We propose a novel machine-learning method for poly(A) motif prediction by marrying generative learning (hidden Markov models) and discriminative learning (support vector machines). Generative learning provides a rich palette on which the uncertainty and diversity of sequence information can be handled, while discriminative learning allows the performance of the classification task to be directly optimized. Here, we used hidden Markov models for fitting the DNA sequence dynamics, and developed an efficient spectral algorithm for extracting latent variable information from these models. These spectral latent features were then fed into support vector machines to fine-tune the classification performance.We evaluated our proposed method on a comprehensive human poly(A) dataset that consists of 14 740 samples from 12 of the most abundant variants of human poly(A) motifs. Compared with one of the previous state-of-the-art methods in the literature (the random forest model with expert-crafted features), our method reduces the average error rate, false-negative rate and false-positive rate by 26, 15 and 35%, respectively. Meanwhile, our method makes ?30% fewer error predictions relative to the other

  7. Poly(A) motif prediction using spectral latent features from human DNA sequences

    KAUST Repository

    Xie, Bo

    2013-06-21

    Motivation: Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Identifying DNA sequence motifs that signal the addition of poly(A) tails is essential to improved genome annotation and better understanding of the regulatory mechanisms and stability of mRNA.Existing poly(A) motif predictors demonstrate that information extracted from the surrounding nucleotide sequences of candidate poly(A) motifs can differentiate true motifs from the false ones to a great extent. A variety of sophisticated features has been explored, including sequential, structural, statistical, thermodynamic and evolutionary properties. However, most of these methods involve extensive manual feature engineering, which can be time-consuming and can require in-depth domain knowledge.Results: We propose a novel machine-learning method for poly(A) motif prediction by marrying generative learning (hidden Markov models) and discriminative learning (support vector machines). Generative learning provides a rich palette on which the uncertainty and diversity of sequence information can be handled, while discriminative learning allows the performance of the classification task to be directly optimized. Here, we used hidden Markov models for fitting the DNA sequence dynamics, and developed an efficient spectral algorithm for extracting latent variable information from these models. These spectral latent features were then fed into support vector machines to fine-tune the classification performance.We evaluated our proposed method on a comprehensive human poly(A) dataset that consists of 14 740 samples from 12 of the most abundant variants of human poly(A) motifs. Compared with one of the previous state-of-the-art methods in the literature (the random forest model with expert-crafted features), our method reduces the average error rate, false-negative rate and false-positive rate by 26, 15 and 35%, respectively. Meanwhile, our method makes ?30% fewer error predictions relative to the other

  8. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  9. Biodiversity of Fusarium species in Mexico associated with ear rot in maize, and their identification using a phylogenetic approach.

    Science.gov (United States)

    Morales-Rodríguez, Irma; Yañez-Morales, María de J; Silva-Rojas, Hilda V; García-de-Los-Santos, Gabino; Guzmán-de-Peña, Doralinda A

    2007-01-01

    Fusarium proliferatum, F. subglutinans, and F. verticillioides are known causes of ear and kernel rot in maize worldwide. In Mexico, only F. verticillioides and F. subglutinans, have been reported previously as causal agents of this disease. However, Fusarium isolates with different morphological characteristics to the species that are known to cause this disease were obtained in the Highland-Valley region of this country from symptomatic and symptomless ears of native and commercial maize genotypes. Moreover, while the morphological studies were not sufficient to identify the correct taxonomic position at the species level, analyses based in the Internal Transcribed Spacer region and the Nuclear Large Subunit Ribosomal partial sequences allowed for the identification of F. subglutinans, F. solani, and F. verticillioides, as well as four species (F. chlamydosporum, F. napiforme, F. poae, and F. pseudonygamai) that had not previously been reported to be associated with ear rot. In addition, F. napiforme and F. solani were absent from symptomless kernels. Phylogenetic analysis showed genetic changes in F. napiforme, and F. pseudonygamai isolates because they were not true clones, and probably constitute separate sibling species. The results of this study suggest that the biodiversity of Fusarium species involved in ear rot in Mexico is greater than that reported previously in other places in the world. This new knowledge will permit a better understanding of the relationship between all the species involved in ear rot disease and their relationship with maize.

  10. Phylogenetic analysis of P5 P-type ATPases, a eukaryotic lineage of secretory pathway pumps

    DEFF Research Database (Denmark)

    Møller, Annette; Asp, Torben; Holm, Preben Bach

    2008-01-01

    prokaryotic genome. Based on a protein alignment we could group the P5 ATPases into two subfamilies, P5A and P5B that, based on the number of negative charges in conserved trans-membrane segment 4, are likely to have different ion specificities. P5A ATPases are present in all eukaryotic genomes sequenced so......Eukaryotes encompass a remarkable variety of organisms and unresolved lineages. Different phylogenetic analyses have lead to conflicting conclusions as to the origin and associations between lineages and species. In this work, we investigated evolutionary relationship of a family of cation pumps...... exclusive for the secretory pathway of eukaryotes by combining the identification of lineage-specific genes with phylogenetic evolution of common genes. Sequences of P5 ATPases, which are regarded to be cation pumps in the endoplasmic reticulum (ER), were identified in all eukaryotic lineages but not in any...

  11. Undergraduate Students’ Initial Ability in Understanding Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Hidayat, T.; Sudargo, Fransisca

    2017-04-01

    The Phylogenetic tree is a visual representation depicts a hypothesis about the evolutionary relationship among taxa. Evolutionary experts use this representation to evaluate the evidence for evolution. The phylogenetic tree is currently growing for many disciplines in biology. Consequently, learning about the phylogenetic tree has become an important part of biological education and an interesting area of biology education research. Skill to understanding and reasoning of the phylogenetic tree, (called tree thinking) is an important skill for biology students. However, research showed many students have difficulty in interpreting, constructing, and comparing among the phylogenetic tree, as well as experiencing a misconception in the understanding of the phylogenetic tree. Students are often not taught how to reason about evolutionary relationship depicted in the diagram. Students are also not provided with information about the underlying theory and process of phylogenetic. This study aims to investigate the initial ability of undergraduate students in understanding and reasoning of the phylogenetic tree. The research method is the descriptive method. Students are given multiple choice questions and an essay that representative by tree thinking elements. Each correct answer made percentages. Each student is also given questionnaires. The results showed that the undergraduate students’ initial ability in understanding and reasoning phylogenetic tree is low. Many students are not able to answer questions about the phylogenetic tree. Only 19 % undergraduate student who answered correctly on indicator evaluate the evolutionary relationship among taxa, 25% undergraduate student who answered correctly on indicator applying concepts of the clade, 17% undergraduate student who answered correctly on indicator determines the character evolution, and only a few undergraduate student who can construct the phylogenetic tree.

  12. A genome-wide phylogenetic reconstruction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land.

    Science.gov (United States)

    Caputi, Lorenzo; Malnoy, Mickael; Goremykin, Vadim; Nikiforova, Svetlana; Martens, Stefan

    2012-03-01

    For almost a decade, our knowledge on the organisation of the family 1 UDP-glycosyltransferases (UGTs) has been limited to the model plant A. thaliana. The availability of other plant genomes represents an opportunity to obtain a broader view of the family in terms of evolution and organisation. Family 1 UGTs are known to glycosylate several classes of plant secondary metabolites. A phylogeny reconstruction study was performed to get an insight into the evolution of this multigene family during the adaptation of plants to life on land. The organisation of the UGTs in the different organisms was also investigated. More than 1500 putative UGTs were identified in 12 fully sequenced and assembled plant genomes based on the highly conserved PSPG motif. Analyses by maximum likelihood (ML) method were performed to reconstruct the phylogenetic relationships existing between the sequences. The results of this study clearly show that the UGT family expanded during the transition from algae to vascular plants and that in higher plants the clustering of UGTs into phylogenetic groups appears to be conserved, although gene loss and gene gain events seem to have occurred in certain lineages. Interestingly, two new phylogenetic groups, named O and P, that are not present in A. thaliana were discovered. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  13. Improved Maximum Parsimony Models for Phylogenetic Networks.

    Science.gov (United States)

    Van Iersel, Leo; Jones, Mark; Scornavacca, Celine

    2018-05-01

    Phylogenetic networks are well suited to represent evolutionary histories comprising reticulate evolution. Several methods aiming at reconstructing explicit phylogenetic networks have been developed in the last two decades. In this article, we propose a new definition of maximum parsimony for phylogenetic networks that permits to model biological scenarios that cannot be modeled by the definitions currently present in the literature (namely, the "hardwired" and "softwired" parsimony). Building on this new definition, we provide several algorithmic results that lay the foundations for new parsimony-based methods for phylogenetic network reconstruction.

  14. Genome-Wide Identification of the Alba Gene Family in Plants and Stress-Responsive Expression of the Rice Alba Genes.

    Science.gov (United States)

    Verma, Jitendra Kumar; Wardhan, Vijay; Singh, Deepali; Chakraborty, Subhra; Chakraborty, Niranjan

    2018-03-28

    Architectural proteins play key roles in genome construction and regulate the expression of many genes, albeit the modulation of genome plasticity by these proteins is largely unknown. A critical screening of the architectural proteins in five crop species, viz., Oryza sativa , Zea mays , Sorghum bicolor , Cicer arietinum , and Vitis vinifera , and in the model plant Arabidopsis thaliana along with evolutionary relevant species such as Chlamydomonas reinhardtii , Physcomitrella patens , and Amborella trichopoda , revealed 9, 20, 10, 7, 7, 6, 1, 4, and 4 Alba (acetylation lowers binding affinity) genes, respectively. A phylogenetic analysis of the genes and of their counterparts in other plant species indicated evolutionary conservation and diversification. In each group, the structural components of the genes and motifs showed significant conservation. The chromosomal location of the Alba genes of rice ( OsAlba ), showed an unequal distribution on 8 of its 12 chromosomes. The expression profiles of the OsAlba genes indicated a distinct tissue-specific expression in the seedling, vegetative, and reproductive stages. The quantitative real-time PCR (qRT-PCR) analysis of the OsAlba genes confirmed their stress-inducible expression under multivariate environmental conditions and phytohormone treatments. The evaluation of the regulatory elements in 68 Alba genes from the 9 species studied led to the identification of conserved motifs and overlapping microRNA (miRNA) target sites, suggesting the conservation of their function in related proteins and a divergence in their biological roles across species. The 3D structure and the prediction of putative ligands and their binding sites for OsAlba proteins offered a key insight into the structure-function relationship. These results provide a comprehensive overview of the subtle genetic diversification of the OsAlba genes, which will help in elucidating their functional role in plants.

  15. Novel Strategy for Discrimination of Transcription Factor Binding Motifs Employing Mathematical Neural Network

    Science.gov (United States)

    Sugimoto, Asuka; Sumi, Takuya; Kang, Jiyoung; Tateno, Masaru

    2017-07-01

    Recognition in biological macromolecular systems, such as DNA-protein recognition, is one of the most crucial problems to solve toward understanding the fundamental mechanisms of various biological processes. Since specific base sequences of genome DNA are discriminated by proteins, such as transcription factors (TFs), finding TF binding motifs (TFBMs) in whole genome DNA sequences is currently a central issue in interdisciplinary biophysical and information sciences. In the present study, a novel strategy to create a discriminant function for discrimination of TFBMs by constituting mathematical neural networks (NNs) is proposed, together with a method to determine the boundary of signals (TFBMs) and noise in the NN-score (output) space. This analysis also leads to the mathematical limitation of discrimination in the recognition of features representing TFBMs, in an information geometrical manifold. Thus, the present strategy enables the identification of the whole space of TFBMs, right up to the noise boundary.

  16. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    Science.gov (United States)

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  17. Discriminative Motif Discovery via Simulated Evolution and Random Under-Sampling

    OpenAIRE

    Song, Tao; Gu, Hong

    2014-01-01

    Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the sta...

  18. A novel k-mer set memory (KSM) motif representation improves regulatory variant prediction.

    Science.gov (United States)

    Guo, Yuchun; Tian, Kevin; Zeng, Haoyang; Guo, Xiaoyun; Gifford, David Kenneth

    2018-04-13

    The representation and discovery of transcription factor (TF) sequence binding specificities is critical for understanding gene regulatory networks and interpreting the impact of disease-associated noncoding genetic variants. We present a novel TF binding motif representation, the k -mer set memory (KSM), which consists of a set of aligned k -mers that are overrepresented at TF binding sites, and a new method called KMAC for de novo discovery of KSMs. We find that KSMs more accurately predict in vivo binding sites than position weight matrix (PWM) models and other more complex motif models across a large set of ChIP-seq experiments. Furthermore, KSMs outperform PWMs and more complex motif models in predicting in vitro binding sites. KMAC also identifies correct motifs in more experiments than five state-of-the-art motif discovery methods. In addition, KSM-derived features outperform both PWM and deep learning model derived sequence features in predicting differential regulatory activities of expression quantitative trait loci (eQTL) alleles. Finally, we have applied KMAC to 1600 ENCODE TF ChIP-seq data sets and created a public resource of KSM and PWM motifs. We expect that the KSM representation and KMAC method will be valuable in characterizing TF binding specificities and in interpreting the effects of noncoding genetic variations. © 2018 Guo et al.; Published by Cold Spring Harbor Laboratory Press.

  19. GPUmotif: an ultra-fast and energy-efficient motif analysis program using graphics processing units.

    Science.gov (United States)

    Zandevakili, Pooya; Hu, Ming; Qin, Zhaohui

    2012-01-01

    Computational detection of TF binding patterns has become an indispensable tool in functional genomics research. With the rapid advance of new sequencing technologies, large amounts of protein-DNA interaction data have been produced. Analyzing this data can provide substantial insight into the mechanisms of transcriptional regulation. However, the massive amount of sequence data presents daunting challenges. In our previous work, we have developed a novel algorithm called Hybrid Motif Sampler (HMS) that enables more scalable and accurate motif analysis. Despite much improvement, HMS is still time-consuming due to the requirement to calculate matching probabilities position-by-position. Using the NVIDIA CUDA toolkit, we developed a graphics processing unit (GPU)-accelerated motif analysis program named GPUmotif. We proposed a "fragmentation" technique to hide data transfer time between memories. Performance comparison studies showed that commonly-used model-based motif scan and de novo motif finding procedures such as HMS can be dramatically accelerated when running GPUmotif on NVIDIA graphics cards. As a result, energy consumption can also be greatly reduced when running motif analysis using GPUmotif. The GPUmotif program is freely available at http://sourceforge.net/projects/gpumotif/

  20. GPUmotif: an ultra-fast and energy-efficient motif analysis program using graphics processing units.

    Directory of Open Access Journals (Sweden)

    Pooya Zandevakili

    Full Text Available Computational detection of TF binding patterns has become an indispensable tool in functional genomics research. With the rapid advance of new sequencing technologies, large amounts of protein-DNA interaction data have been produced. Analyzing this data can provide substantial insight into the mechanisms of transcriptional regulation. However, the massive amount of sequence data presents daunting challenges. In our previous work, we have developed a novel algorithm called Hybrid Motif Sampler (HMS that enables more scalable and accurate motif analysis. Despite much improvement, HMS is still time-consuming due to the requirement to calculate matching probabilities position-by-position. Using the NVIDIA CUDA toolkit, we developed a graphics processing unit (GPU-accelerated motif analysis program named GPUmotif. We proposed a "fragmentation" technique to hide data transfer time between memories. Performance comparison studies showed that commonly-used model-based motif scan and de novo motif finding procedures such as HMS can be dramatically accelerated when running GPUmotif on NVIDIA graphics cards. As a result, energy consumption can also be greatly reduced when running motif analysis using GPUmotif. The GPUmotif program is freely available at http://sourceforge.net/projects/gpumotif/

  1. A program for verification of phylogenetic network models.

    Science.gov (United States)

    Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin

    2016-09-01

    Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Overlapping ETS and CRE Motifs (G/CCGGAAGTGACGTCA) Preferentially Bound by GABPα and CREB Proteins

    Science.gov (United States)

    Chatterjee, Raghunath; Zhao, Jianfei; He, Ximiao; Shlyakhtenko, Andrey; Mann, Ishminder; Waterfall, Joshua J.; Meltzer, Paul; Sathyanarayana, B. K.; FitzGerald, Peter C.; Vinson, Charles

    2012-01-01

    Previously, we identified 8-bps long DNA sequences (8-mers) that localize in human proximal promoters and grouped them into known transcription factor binding sites (TFBS). We now examine split 8-mers consisting of two 4-mers separated by 1-bp to 30-bps (X4-N1-30-X4) to identify pairs of TFBS that localize in proximal promoters at a precise distance. These include two overlapping TFBS: the ETS⇔ETS motif (C/GCCGGAAGCGGAA) and the ETS⇔CRE motif (C/GCGGAAGTGACGTCAC). The nucleotides in bold are part of both TFBS. Molecular modeling shows that the ETS⇔CRE motif can be bound simultaneously by both the ETS and the B-ZIP domains without protein-protein clashes. The electrophoretic mobility shift assay (EMSA) shows that the ETS protein GABPα and the B-ZIP protein CREB preferentially bind to the ETS⇔CRE motif only when the two TFBS overlap precisely. In contrast, the ETS domain of ETV5 and CREB interfere with each other for binding the ETS⇔CRE. The 11-mer (CGGAAGTGACG), the conserved part of the ETS⇔CRE motif, occurs 226 times in the human genome and 83% are in known regulatory regions. In vivo GABPα and CREB ChIP-seq peaks identified the ETS⇔CRE as the most enriched motif occurring in promoters of genes involved in mRNA processing, cellular catabolic processes, and stress response, suggesting that a specific class of genes is regulated by this composite motif. PMID:23050235

  3. oPOSSUM: integrated tools for analysis of regulatory motif over-representation

    Science.gov (United States)

    Ho Sui, Shannan J.; Fulton, Debra L.; Arenillas, David J.; Kwon, Andrew T.; Wasserman, Wyeth W.

    2007-01-01

    The identification of over-represented transcription factor binding sites from sets of co-expressed genes provides insights into the mechanisms of regulation for diverse biological contexts. oPOSSUM, an internet-based system for such studies of regulation, has been improved and expanded in this new release. New features include a worm-specific version for investigating binding sites conserved between Caenorhabditis elegans and C. briggsae, as well as a yeast-specific version for the analysis of co-expressed sets of Saccharomyces cerevisiae genes. The human and mouse applications feature improvements in ortholog mapping, sequence alignments and the delineation of multiple alternative promoters. oPOSSUM2, introduced for the analysis of over-represented combinations of motifs in human and mouse genes, has been integrated with the original oPOSSUM system. Analysis using user-defined background gene sets is now supported. The transcription factor binding site models have been updated to include new profiles from the JASPAR database. oPOSSUM is available at http://www.cisreg.ca/oPOSSUM/ PMID:17576675

  4. Identification of Recent Bats belonging to the Rhinolophidae by the Humeral Characters

    OpenAIRE

    Yoon, Myung Hee; Uchida, Teruaki; 内田, 照章

    1983-01-01

    Humeral characters of eleven recent species and one subspecies belonging to three genera of the Rhinolophidae including two subfamilies were described. A key provides for their identification as well as the identification of the fossil bats found on the Akiyoshi-dai Plateau. Further, we discussed differences in the adaptability for flight of the bats not only within each taxon of the family but also between the phylogenetically less advanced Rhinolophidae and the more advanced Vespertilionida...

  5. ROMANIAN TRADITIONAL MOTIF ELEMENT OF MODERNITY IN CLOTHING

    Directory of Open Access Journals (Sweden)

    ŞUTEU Marius Darius

    2017-05-01

    Full Text Available In this paper are presented the phases for improving from an aesthetic point of view a clothing item, the T-shirt for women using software design patterns, computerised graphics and textile different modern technologies including: industrial embroidery, digital printing, sublimation. In the first phase a documentation was prepared in the University of Oradea and traditional motif was selected from a collection comprising a number of Romanian traditional motifs from different parts of the country and were reintepreted and stylized whilst preserving the symbolism and color range specified to the area. For the styling phase was used CorelDraw vector graphics program that allows changing the shape, size and color of the drawings without affecting the identity of the pattern. The embroidery was done using BERNINA Embroidery Software Designer Plus Software. This software allows you to export the model to any domestic or industrial embroidery machine regardless of brand. Finally we observed the resistance of the printed and embroided model to various: elasticity, resistance to abrasion and a sensory analysis on the preservation of color. After testing we noticed the imprint resistance applied to the fabric, resulting in a quality that makes possible to keep the Romanian traditional motif from generation to generation.

  6. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

    Directory of Open Access Journals (Sweden)

    Asita Elengoe

    2015-01-01

    Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

  7. Conserved binding of GCAC motifs by MEC-8, couch potato, and the RBPMS protein family

    Science.gov (United States)

    Soufari, Heddy

    2017-01-01

    Precise regulation of mRNA processing, translation, localization, and stability relies on specific interactions with RNA-binding proteins whose biological function and target preference are dictated by their preferred RNA motifs. The RBPMS family of RNA-binding proteins is defined by a conserved RNA recognition motif (RRM) domain found in metazoan RBPMS/Hermes and RBPMS2, Drosophila couch potato, and MEC-8 from Caenorhabditis elegans. In order to determine the parameters of RNA sequence recognition by the RBPMS family, we have first used the N-terminal domain from MEC-8 in binding assays and have demonstrated a preference for two GCAC motifs optimally separated by >6 nucleotides (nt). We have also determined the crystal structure of the dimeric N-terminal RRM domain from MEC-8 in the unbound form, and in complex with an oligonucleotide harboring two copies of the optimal GCAC motif. The atomic details reveal the molecular network that provides specificity to all four bases in the motif, including multiple hydrogen bonds to the initial guanine. Further studies with human RBPMS, as well as Drosophila couch potato, confirm a general preference for this double GCAC motif by other members of the protein family and the presence of this motif in known targets. PMID:28003515

  8. Analysis of Domain Architecture and Phylogenetics of Family 2 Glycoside Hydrolases (GH2.

    Directory of Open Access Journals (Sweden)

    David Talens-Perales

    Full Text Available In this work we report a detailed analysis of the topology and phylogenetics of family 2 glycoside hydrolases (GH2. We distinguish five topologies or domain architectures based on the presence and distribution of protein domains defined in Pfam and Interpro databases. All of them share a central TIM barrel (catalytic module with two β-sandwich domains (non-catalytic at the N-terminal end, but differ in the occurrence and nature of additional non-catalytic modules at the C-terminal region. Phylogenetic analysis was based on the sequence of the Pfam Glyco_hydro_2_C catalytic module present in most GH2 proteins. Our results led us to propose a model in which evolutionary diversity of GH2 enzymes is driven by the addition of different non-catalytic domains at the C-terminal region. This model accounts for the divergence of β-galactosidases from β-glucuronidases, the diversification of β-galactosidases with different transglycosylation specificities, and the emergence of bicistronic β-galactosidases. This study also allows the identification of groups of functionally uncharacterized protein sequences with potential biotechnological interest.

  9. Parallel motif extraction from very long sequences

    KAUST Repository

    Sahli, Majed; Mansour, Essam; Kalnis, Panos

    2013-01-01

    Motifs are frequent patterns used to identify biological functionality in genomic sequences, periodicity in time series, or user trends in web logs. In contrast to a lot of existing work that focuses on collections of many short sequences, modern

  10. A set of tetra-nucleotide core motif SSR markers for efficient identification of potato (Solanum tuberosum) cultivars.

    Science.gov (United States)

    Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi

    2017-12-01

    Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.

  11. Efficient sequential and parallel algorithms for planted motif search.

    Science.gov (United States)

    Nicolae, Marius; Rajasekaran, Sanguthevar

    2014-01-31

    Motif searching is an important step in the detection of rare events occurring in a set of DNA or protein sequences. One formulation of the problem is known as (l,d)-motif search or Planted Motif Search (PMS). In PMS we are given two integers l and d and n biological sequences. We want to find all sequences of length l that appear in each of the input sequences with at most d mismatches. The PMS problem is NP-complete. PMS algorithms are typically evaluated on certain instances considered challenging. Despite ample research in the area, a considerable performance gap exists because many state of the art algorithms have large runtimes even for moderately challenging instances. This paper presents a fast exact parallel PMS algorithm called PMS8. PMS8 is the first algorithm to solve the challenging (l,d) instances (25,10) and (26,11). PMS8 is also efficient on instances with larger l and d such as (50,21). We include a comparison of PMS8 with several state of the art algorithms on multiple problem instances. This paper also presents necessary and sufficient conditions for 3 l-mers to have a common d-neighbor. The program is freely available at http://engr.uconn.edu/~man09004/PMS8/. We present PMS8, an efficient exact algorithm for Planted Motif Search. PMS8 introduces novel ideas for generating common neighborhoods. We have also implemented a parallel version for this algorithm. PMS8 can solve instances not solved by any previous algorithms.

  12. Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

    Science.gov (United States)

    Zhao, Xiaoyan; Sze, Sing-Hoi

    2011-05-01

    One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

  13. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  14. Rearrangement moves on rooted phylogenetic networks.

    Science.gov (United States)

    Gambette, Philippe; van Iersel, Leo; Jones, Mark; Lafond, Manuel; Pardi, Fabio; Scornavacca, Celine

    2017-08-01

    Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide a solid basis for

  15. Rearrangement moves on rooted phylogenetic networks.

    Directory of Open Access Journals (Sweden)

    Philippe Gambette

    2017-08-01

    Full Text Available Phylogenetic tree reconstruction is usually done by local search heuristics that explore the space of the possible tree topologies via simple rearrangements of their structure. Tree rearrangement heuristics have been used in combination with practically all optimization criteria in use, from maximum likelihood and parsimony to distance-based principles, and in a Bayesian context. Their basic components are rearrangement moves that specify all possible ways of generating alternative phylogenies from a given one, and whose fundamental property is to be able to transform, by repeated application, any phylogeny into any other phylogeny. Despite their long tradition in tree-based phylogenetics, very little research has gone into studying similar rearrangement operations for phylogenetic network-that is, phylogenies explicitly representing scenarios that include reticulate events such as hybridization, horizontal gene transfer, population admixture, and recombination. To fill this gap, we propose "horizontal" moves that ensure that every network of a certain complexity can be reached from any other network of the same complexity, and "vertical" moves that ensure reachability between networks of different complexities. When applied to phylogenetic trees, our horizontal moves-named rNNI and rSPR-reduce to the best-known moves on rooted phylogenetic trees, nearest-neighbor interchange and rooted subtree pruning and regrafting. Besides a number of reachability results-separating the contributions of horizontal and vertical moves-we prove that rNNI moves are local versions of rSPR moves, and provide bounds on the sizes of the rNNI neighborhoods. The paper focuses on the most biologically meaningful versions of phylogenetic networks, where edges are oriented and reticulation events clearly identified. Moreover, our rearrangement moves are robust to the fact that networks with higher complexity usually allow a better fit with the data. Our goal is to provide

  16. Phylogenetic tests of distribution patterns in South Asia: towards

    Indian Academy of Sciences (India)

    The last four decades have seen an increasing integration of phylogenetics and biogeography. However, a dearth of phylogenetic studies has precluded such biogeographic analyses in South Asia until recently. Noting the increase in phylogenetic research and interest in phylogenetic biogeography in the region, we ...

  17. Fourier transform inequalities for phylogenetic trees.

    Science.gov (United States)

    Matsen, Frederick A

    2009-01-01

    Phylogenetic invariants are not the only constraints on site-pattern frequency vectors for phylogenetic trees. A mutation matrix, by its definition, is the exponential of a matrix with non-negative off-diagonal entries; this positivity requirement implies non-trivial constraints on the site-pattern frequency vectors. We call these additional constraints "edge-parameter inequalities". In this paper, we first motivate the edge-parameter inequalities by considering a pathological site-pattern frequency vector corresponding to a quartet tree with a negative internal edge. This site-pattern frequency vector nevertheless satisfies all of the constraints described up to now in the literature. We next describe two complete sets of edge-parameter inequalities for the group-based models; these constraints are square-free monomial inequalities in the Fourier transformed coordinates. These inequalities, along with the phylogenetic invariants, form a complete description of the set of site-pattern frequency vectors corresponding to bona fide trees. Said in mathematical language, this paper explicitly presents two finite lists of inequalities in Fourier coordinates of the form "monomial < or = 1", each list characterizing the phylogenetically relevant semialgebraic subsets of the phylogenetic varieties.

  18. Transcriptome-wide identification of Camellia sinensis WRKY transcription factors in response to temperature stress.

    Science.gov (United States)

    Wu, Zhi-Jun; Li, Xing-Hui; Liu, Zhi-Wei; Li, Hui; Wang, Yong-Xin; Zhuang, Jing

    2016-02-01

    Tea plant [Camellia sinensis (L.) O. Kuntze] is a leaf-type healthy non-alcoholic beverage crop, which has been widely introduced worldwide. Tea is rich in various secondary metabolites, which are important for human health. However, varied climate and complex geography have posed challenges for tea plant survival. The WRKY gene family in plants is a large transcription factor family that is involved in biological processes related to stress defenses, development, and metabolite synthesis. Therefore, identification and analysis of WRKY family transcription factors in tea plant have a profound significance. In the present study, 50 putative C. sinensis WRKY proteins (CsWRKYs) with complete WRKY domain were identified and divided into three Groups (Group I-III) on the basis of phylogenetic analysis results. The distribution of WRKY family transcription factors among plantae, fungi, and protozoa showed that the number of WRKY genes increased in higher plant, whereas the number of these genes did not correspond to the evolutionary relationships of different species. Structural feature and annotation analysis results showed that CsWRKY proteins contained WRKYGQK/WRKYGKK domains and C2H2/C2HC-type zinc-finger structure: D-X18-R-X1-Y-X2-C-X4-7-C-X23-H motif; CsWRKY proteins may be associated with the biological processes of abiotic and biotic stresses, tissue development, and hormone and secondary metabolite biosynthesis. Temperature stresses suggested that the candidate CsWRKY genes were involved in responses to extreme temperatures. The current study established an extensive overview of the WRKY family transcription factors in tea plant. This study also provided a global survey of CsWRKY transcription factors and a foundation of future functional identification and molecular breeding.

  19. Disparate requirements for the Walker A and B ATPase motifs ofhuman RAD51D in homologous recombination

    Energy Technology Data Exchange (ETDEWEB)

    Wiese, Claudia; Hinz, John M.; Tebbs, Robert S.; Nham, Peter B.; Urbin, Salustra S.; Collins, David W.; Thompson, Larry H.; Schild, David

    2006-04-21

    In vertebrates, homologous recombinational repair (HRR) requires RAD51 and five RAD51 paralogs (XRCC2, XRCC3, RAD51B, RAD51C, and RAD51D) that all contain conserved Walker A and B ATPase motifs. In human RAD51D we examined the requirement for these motifs in interactions with XRCC2 and RAD51C, and for survival of cells in response to DNA interstrand crosslinks. Ectopic expression of wild type human RAD51D or mutants having a non-functional A or B motif was used to test for complementation of a rad51d knockout hamster CHO cell line. Although A-motif mutants complement very efficiently, B-motif mutants do not. Consistent with these results, experiments using the yeast two- and three-hybrid systems show that the interactions between RAD51D and its XRCC2 and RAD51C partners also require a functional RAD51D B motif, but not motif A. Similarly, hamster Xrcc2 is unable to bind to the non-complementing human RAD51D B-motif mutants in co-immunoprecipitation assays. We conclude that a functional Walker B motif, but not A motif, is necessary for RAD51D's interactions with other paralogs and for efficient HRR. We present a model in which ATPase sites are formed in a bipartite manner between RAD51D and other RAD51 paralogs.

  20. Phylogenetic search through partial tree mixing

    Science.gov (United States)

    2012-01-01

    Background Recent advances in sequencing technology have created large data sets upon which phylogenetic inference can be performed. Current research is limited by the prohibitive time necessary to perform tree search on a reasonable number of individuals. This research develops new phylogenetic algorithms that can operate on tens of thousands of species in a reasonable amount of time through several innovative search techniques. Results When compared to popular phylogenetic search algorithms, better trees are found much more quickly for large data sets. These algorithms are incorporated in the PSODA application available at http://dna.cs.byu.edu/psoda Conclusions The use of Partial Tree Mixing in a partition based tree space allows the algorithm to quickly converge on near optimal tree regions. These regions can then be searched in a methodical way to determine the overall optimal phylogenetic solution. PMID:23320449

  1. Temporal motifs reveal collaboration patterns in online task-oriented networks

    Science.gov (United States)

    Xuan, Qi; Fang, Huiting; Fu, Chenbo; Filkov, Vladimir

    2015-05-01

    Real networks feature layers of interactions and complexity. In them, different types of nodes can interact with each other via a variety of events. Examples of this complexity are task-oriented social networks (TOSNs), where teams of people share tasks towards creating a quality artifact, such as academic research papers or software development in commercial or open source environments. Accomplishing those tasks involves both work, e.g., writing the papers or code, and communication, to discuss and coordinate. Taking into account the different types of activities and how they alternate over time can result in much more precise understanding of the TOSNs behaviors and outcomes. That calls for modeling techniques that can accommodate both node and link heterogeneity as well as temporal change. In this paper, we report on methodology for finding temporal motifs in TOSNs, limited to a system of two people and an artifact. We apply the methods to publicly available data of TOSNs from 31 Open Source Software projects. We find that these temporal motifs are enriched in the observed data. When applied to software development outcome, temporal motifs reveal a distinct dependency between collaboration and communication in the code writing process. Moreover, we show that models based on temporal motifs can be used to more precisely relate both individual developer centrality and team cohesion to programmer productivity than models based on aggregated TOSNs.

  2. Salt-bridge Swapping in the EXXERFXYY Motif of Proton Coupled Oligopeptide Transporters

    DEFF Research Database (Denmark)

    Aduri, Nanda G; Prabhala, Bala K; Ernst, Heidi A

    2015-01-01

    to as E1XXE2R), located on Helix I, in interactions with the proton. In this study we investigated the intracellular substrate accumulation by motif variants with all possible combinations of glutamate residues changed to glutamine and arginine changed to a tyrosine; the latter being a natural variant......-motif salt bridge, i.e. R-E2 to R-E1, which is consistent with previous structural studies. Molecular dynamics simulations of the motif variants E1XXE2R and E1XXQ2R support this mechanism. The simulations showed that upon changing conformation, arginine pushes Helix V, through interactions with the highly...

  3. A Repeating Sulfated Galactan Motif Resuscitates Dormant Micrococcus luteus Bacteria.

    Science.gov (United States)

    Böttcher, Thomas; Szamosvári, Dávid; Clardy, Jon

    2018-07-01

    Only a small fraction of bacteria can autonomously initiate growth on agar plates. Nongrowing bacteria typically enter a metabolically inactive dormant state and require specific chemical trigger factors or signals to exit this state and to resume growth. Micrococcus luteus has become a model organism for this important yet poorly understood phenomenon. Only a few resuscitation signals have been described to date, and all of them are produced endogenously by bacterial species. We report the discovery of a novel type of resuscitation signal that allows M. luteus to grow on agar but not agarose plates. Fractionation of the agar polysaccharide complex and sulfation of agarose allowed us to identify the signal as highly sulfated saccharides found in agar or carrageenans. Purification of hydrolyzed κ-carrageenan ultimately led to the identification of the signal as a small fragment of a large linear polysaccharide, i.e., an oligosaccharide of five or more sugars with a repeating disaccharide motif containing d-galactose-4-sulfate (G4S) 1,4-linked to 3,6-anhydro-α-d-galactose (DA), G4S-(DA-G4S) n ≥2 IMPORTANCE Most environmental bacteria cannot initiate growth on agar plates, but they can flourish on the same plates once growth is initiated. While there are a number of names for and manifestations of this phenomenon, the underlying cause appears to be the requirement for a molecular signal indicating safe growing conditions. Micrococcus luteus has become a model organism for studying this growth initiation process, often called resuscitation, because of its apparent connection with the persistent or dormant form of Mycobacterium tuberculosis , an important human pathogen. In this report, we identify a highly sulfated saccharide from agar or carrageenans that robustly resuscitates dormant M. luteus on agarose plates. We identified and characterized the signal as a small repeating disaccharide motif. Our results indicate that signals inherent in or absent from the

  4. DNA-based identification and phylogeny of North American Armillaria species

    Science.gov (United States)

    Amy L. Ross-Davis; John W. Hanna; Ned B. Klopfenstein

    2011-01-01

    Because Armillaria species display different ecological behaviors across diverse forest ecosystems, it is critical to identify Armillaria species accurately for any assessment of forest health. To further develop DNA-based identification methods, partial sequences of the translation elongation factor-1 alpha (EF-1α) gene were used to examine the phylogenetic...

  5. Systematic discovery of regulatory motifs in Fusarium graminearum by comparing four Fusarium genomes

    Directory of Open Access Journals (Sweden)

    Kistler Corby

    2010-03-01

    Full Text Available Abstract Background Fusarium graminearum (Fg, a major fungal pathogen of cultivated cereals, is responsible for billions of dollars in agriculture losses. There is a growing interest in understanding the transcriptional regulation of this organism, especially the regulation of genes underlying its pathogenicity. The generation of whole genome sequence assemblies for Fg and three closely related Fusarium species provides a unique opportunity for such a study. Results Applying comparative genomics approaches, we developed a computational pipeline to systematically discover evolutionarily conserved regulatory motifs in the promoter, downstream and the intronic regions of Fg genes, based on the multiple alignments of sequenced Fusarium genomes. Using this method, we discovered 73 candidate regulatory motifs in the promoter regions. Nearly 30% of these motifs are highly enriched in promoter regions of Fg genes that are associated with a specific functional category. Through comparison to Saccharomyces cerevisiae (Sc and Schizosaccharomyces pombe (Sp, we observed conservation of transcription factors (TFs, their binding sites and the target genes regulated by these TFs related to pathways known to respond to stress conditions or phosphate metabolism. In addition, this study revealed 69 and 39 conserved motifs in the downstream regions and the intronic regions, respectively, of Fg genes. The top intronic motif is the splice donor site. For the downstream regions, we noticed an intriguing absence of the mammalian and Sc poly-adenylation signals among the list of conserved motifs. Conclusion This study provides the first comprehensive list of candidate regulatory motifs in Fg, and underscores the power of comparative genomics in revealing functional elements among related genomes. The conservation of regulatory pathways among the Fusarium genomes and the two yeast species reveals their functional significance, and provides new insights in their

  6. Identification, expression and phylogenetic analysis of EgG1Y162 from Echinococcus granulosus

    Science.gov (United States)

    Zhang, Fengbo; Ma, Xiumin; Zhu, Yuejie; Wang, Hongying; Liu, Xianfei; Zhu, Min; Ma, Haimei; Wen, Hao; Fan, Haining; Ding, Jianbing

    2014-01-01

    Objective: This study was to clone, identify and analyze the characteristics of egG1Y162 gene from Echinococcus granulosus. Methods: Genomic DNA and total RNAs were extracted from four different developmental stages of protoscolex, germinal layer, adult and egg of Echinococcus granulosus, respectively. Fluorescent quantitative PCR was used for analyzing the expression of egG1Y162 gene. Prokaryotic expression plasmid of pET41a-EgG1Y162 was constructed to express recombinant His-EgG1Y162 antigen. Western blot analysis was performed to detect antigenicity of EgG1Y162 antigen. Gene sequence, amino acid alignment and phylogenetic tree of EgG1Y162 were analyzed by BLAST, online Spidey and MEGA4 software, respectively. Results: EgG1Y162 gene was expressed in four developmental stages of Echinococcus granulosus. And, egG1Y162 gene expression was the highest in the adult stage, with the relative value of 19.526, significantly higher than other three stages. Additionally, Western blot analysis revealed that EgG1Y162 recombinant protein had good reaction with serum samples from Echinococcus granulosus infected human and dog. Moreover, EgG1Y162 antigen was phylogenetically closest to EmY162 antigen, with the similarity over 90%. Conclusion: Our study identified EgG1Y162 antigen in Echinococcus granulosus for the first time. EgG1Y162 antigen had a high similarity with EmY162 antigen, with the genetic differences mainly existing in the intron region. And, EgG1Y162 recombinant protein showed good antigenicity. PMID:25337206

  7. Identification, expression and phylogenetic analysis of EgG1Y162 from Echinococcus granulosus.

    Science.gov (United States)

    Zhang, Fengbo; Ma, Xiumin; Zhu, Yuejie; Wang, Hongying; Liu, Xianfei; Zhu, Min; Ma, Haimei; Wen, Hao; Fan, Haining; Ding, Jianbing

    2014-01-01

    This study was to clone, identify and analyze the characteristics of egG1Y162 gene from Echinococcus granulosus. Genomic DNA and total RNAs were extracted from four different developmental stages of protoscolex, germinal layer, adult and egg of Echinococcus granulosus, respectively. Fluorescent quantitative PCR was used for analyzing the expression of egG1Y162 gene. Prokaryotic expression plasmid of pET41a-EgG1Y162 was constructed to express recombinant His-EgG1Y162 antigen. Western blot analysis was performed to detect antigenicity of EgG1Y162 antigen. Gene sequence, amino acid alignment and phylogenetic tree of EgG1Y162 were analyzed by BLAST, online Spidey and MEGA4 software, respectively. EgG1Y162 gene was expressed in four developmental stages of Echinococcus granulosus. And, egG1Y162 gene expression was the highest in the adult stage, with the relative value of 19.526, significantly higher than other three stages. Additionally, Western blot analysis revealed that EgG1Y162 recombinant protein had good reaction with serum samples from Echinococcus granulosus infected human and dog. Moreover, EgG1Y162 antigen was phylogenetically closest to EmY162 antigen, with the similarity over 90%. Our study identified EgG1Y162 antigen in Echinococcus granulosus for the first time. EgG1Y162 antigen had a high similarity with EmY162 antigen, with the genetic differences mainly existing in the intron region. And, EgG1Y162 recombinant protein showed good antigenicity.

  8. Phylogenetic Signal in AFLP Data Sets

    NARCIS (Netherlands)

    Koopman, W.J.M.

    2005-01-01

    AFLP markers provide a potential source of phylogenetic information for molecular systematic studies. However, there are properties of restriction fragment data that limit phylogenetic interpretation of AFLPs. These are (a) possible nonindependence of fragments, (b) problems of homology assignment

  9. Wing pattern morphology of three closely related Melitaea (Lepidoptera, Nymphalidae species reveals highly inaccurate external morphology-based species identification

    Directory of Open Access Journals (Sweden)

    Jure Jugovic

    2014-06-01

    Full Text Available Wing morphology of the three closely related species of Melitaea – M. athalia (Rottemburg, 1775, M. aurelia (Nickerl, 1850 and M. britomartis Assmann, 1847 – co-occurring in the Balkans (SE Europe was investigated in detail through visual inspection, morphometric analysis and multivariate statistical analysis. Results are compared to recent phylogenetic studies, searching for concordant patterns and discrepancies between the two approaches. The morphology of the genitalic structures is also compared with the results of the other two approaches. The main conclusions are as follows: (1 small albeit significant differences in wing morphology exist among the three species and (2 while the structure of male genitalia and phylogenetic position of the three species are concordant, they are (3 in discordance with the wing morphology. The present study represents another example where identification based on external morphology would lead to highly unreliable determinations, hence identification based on phylogenetic studies and/or genitalia is strongly recommended not only for the three studied species but also more broadly within the genus. Furthermore, we show that some of the characters generally used in the identification of these three Melitaea species should be avoided in future.

  10. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  11. How does cognition evolve? Phylogenetic comparative psychology.

    Science.gov (United States)

    MacLean, Evan L; Matthews, Luke J; Hare, Brian A; Nunn, Charles L; Anderson, Rindy C; Aureli, Filippo; Brannon, Elizabeth M; Call, Josep; Drea, Christine M; Emery, Nathan J; Haun, Daniel B M; Herrmann, Esther; Jacobs, Lucia F; Platt, Michael L; Rosati, Alexandra G; Sandel, Aaron A; Schroepfer, Kara K; Seed, Amanda M; Tan, Jingzhi; van Schaik, Carel P; Wobber, Victoria

    2012-03-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution.

  12. Through the Portal: Viking Motifs Incorporated in the Romanesque Style in Telemark, Norway

    Directory of Open Access Journals (Sweden)

    Kristine Ødeby

    2013-09-01

    Full Text Available This paper presents the results of an analysis of motifs identified on six carved wooden Romanesque portal panels from the Norwegian county of Telemark. The findings suggest that animal motifs in the Late Viking style survived long into the Late Medieval period and were reused on these medieval portals. Stylistically, late expressions of Viking animal art do not differ a great deal from those of the subsequent Romanesque style. However, their symbolical differences are considered to be significant. The motifs themselves, and the issue of whether the Romanesque style adopted motifs from pre-Christian art, have attracted less attention. The motif portraying Sigurd slaying the dragon is considered in depth. It will be suggested that Sigurd, serving as a mediator between the old and the new beliefs when he appeared in late Viking contexts, was given a new role when portrayed in Christian art. Metaphor and liminality are a central part of this paper, and the theories of Alfred Gell and Margrete Andås suggest that the portal itself affects those who pass through it, and that the iconography is meaningful from a liminal perspective.

  13. Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences

    KAUST Repository

    Kalkatawi, Manal M.

    2011-11-15

    Motivation: Recognition of poly(A) signals in mRNA is relatively straightforward due to the presence of easily recognizable polyadenylic acid tail. However, the task of identifying poly(A) motifs in the primary genomic DNA sequence that correspond to poly(A) signals in mRNA is a far more challenging problem. Recognition of poly(A) signals is important for better gene annotation and understanding of the gene regulation mechanisms. In this work, we present one such poly(A) motif prediction method based on properties of human genomic DNA sequence surrounding a poly(A) motif. These properties include thermodynamic, physico-chemical and statistical characteristics. For predictions, we developed Artificial Neural Network and Random Forest models. These models are trained to recognize 12 most common poly(A) motifs in human DNA. Our predictors are available as a free web-based tool accessible at http://cbrc.kaust.edu.sa/dps. Compared with other reported predictors, our models achieve higher sensitivity and specificity and furthermore provide a consistent level of accuracy for 12 poly(A) motif variants. The Author(s) 2011. Published by Oxford University Press. All rights reserved.

  14. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  15. qPMS7: a fast algorithm for finding (ℓ, d-motifs in DNA and protein sequences.

    Directory of Open Access Journals (Sweden)

    Hieu Dinh

    Full Text Available Detection of rare events happening in a set of DNA/protein sequences could lead to new biological discoveries. One kind of such rare events is the presence of patterns called motifs in DNA/protein sequences. Finding motifs is a challenging problem since the general version of motif search has been proven to be intractable. Motifs discovery is an important problem in biology. For example, it is useful in the detection of transcription factor binding sites and transcriptional regulatory elements that are very crucial in understanding gene function, human disease, drug design, etc. Many versions of the motif search problem have been proposed in the literature. One such is the (ℓ, d-motif search (or Planted Motif Search (PMS. A generalized version of the PMS problem, namely, Quorum Planted Motif Search (qPMS, is shown to accurately model motifs in real data. However, solving the qPMS problem is an extremely difficult task because a special case of it, the PMS Problem, is already NP-hard, which means that any algorithm solving it can be expected to take exponential time in the worse case scenario. In this paper, we propose a novel algorithm named qPMS7 that tackles the qPMS problem on real data as well as challenging instances. Experimental results show that our Algorithm qPMS7 is on an average 5 times faster than the state-of-art algorithm. The executable program of Algorithm qPMS7 is freely available on the web at http://pms.engr.uconn.edu/downloads/qPMS7.zip. Our online motif discovery tools that use Algorithm qPMS7 are freely available at http://pms.engr.uconn.edu or http://motifsearch.com.

  16. How to find a leucine in a haystack? Structure, ligand recognition and regulation of leucine-aspartic acid (LD) motifs

    KAUST Repository

    Alam, Tanvir

    2014-05-29

    LD motifs (leucine-aspartic acidmotifs) are short helical protein-protein interaction motifs that have emerged as key players in connecting cell adhesion with cell motility and survival. LD motifs are required for embryogenesis, wound healing and the evolution of multicellularity. LD motifs also play roles in disease, such as in cancer metastasis or viral infection. First described in the paxillin family of scaffolding proteins, LD motifs and similar acidic LXXLL interaction motifs have been discovered in several other proteins, whereas 16 proteins have been reported to contain LDBDs (LD motif-binding domains). Collectively, structural and functional analyses have revealed a surprising multivalency in LD motif interactions and a wide diversity in LDBD architectures. In the present review, we summarize the molecular basis for function, regulation and selectivity of LD motif interactions that has emerged from more than a decade of research. This overview highlights the intricate multi-level regulation and the inherently noisy and heterogeneous nature of signalling through short protein-protein interaction motifs. © 2014 Biochemical Society.

  17. How to find a leucine in a haystack? Structure, ligand recognition and regulation of leucine-aspartic acid (LD) motifs

    KAUST Repository

    Alam, Tanvir; Alazmi, Meshari; Gao, Xin; Arold, Stefan T.

    2014-01-01

    LD motifs (leucine-aspartic acidmotifs) are short helical protein-protein interaction motifs that have emerged as key players in connecting cell adhesion with cell motility and survival. LD motifs are required for embryogenesis, wound healing and the evolution of multicellularity. LD motifs also play roles in disease, such as in cancer metastasis or viral infection. First described in the paxillin family of scaffolding proteins, LD motifs and similar acidic LXXLL interaction motifs have been discovered in several other proteins, whereas 16 proteins have been reported to contain LDBDs (LD motif-binding domains). Collectively, structural and functional analyses have revealed a surprising multivalency in LD motif interactions and a wide diversity in LDBD architectures. In the present review, we summarize the molecular basis for function, regulation and selectivity of LD motif interactions that has emerged from more than a decade of research. This overview highlights the intricate multi-level regulation and the inherently noisy and heterogeneous nature of signalling through short protein-protein interaction motifs. © 2014 Biochemical Society.

  18. Structural modelling and phylogenetic analyses of PgeIF4A2 (Eukaryotic translation initiation factor) from Pennisetum glaucum reveal signature motifs with a role in stress tolerance and development.

    Science.gov (United States)

    Agarwal, Aakrati; Mudgil, Yashwanti; Pandey, Saurabh; Fartyal, Dhirendra; Reddy, Malireddy K

    2016-01-01

    Eukaryotic translation initiation factor 4A (eIF4A) is an indispensable component of the translation machinery and also play a role in developmental processes and stress alleviation in plants and animals. Different eIF4A isoforms are present in the cytosol of the cell, namely, eIF4A1, eIF4A2, and eIF4A3 and their expression is tightly regulated in cap-dependent translation. We revealed the structural model of PgeIF4A2 protein using the crystal structure of Homo sapiens eIF4A3 (PDB ID: 2J0S) as template by Modeller 9.12. The resultant PgeIF4A2 model structure was refined by PROCHECK, ProSA, Verify3D and RMSD that showed the model structure is reliable with 77 % amino acid sequence identity with template. Investigation revealed two conserved signatures for ATP-dependent RNA Helicase DEAD-box conserved site (VLDEADEML) and RNA helicase DEAD-box type, Q-motif in sheet-turn-helix and α-helical region respectively. All these conserved motifs are responsible for response during developmental stages and stress tolerance in plants.

  19. Origin and evolution of group XI secretory phospholipase A2 from flax (Linum usitatissimum) based on phylogenetic analysis of conserved domains.

    Science.gov (United States)

    Gupta, Payal; Saini, Raman; Dash, Prasanta K

    2017-07-01

    Phospholipase A 2 (PLA 2 ) belongs to class of lipolytic enzymes (EC 3.1.1.4). Lysophosphatidic acid (LPA) and free fatty acids (FFAs) are the products of PLA 2 catalyzed hydrolysis of phosphoglycerides at sn-2 position. LPA and FFA that act as second mediators involved in the development and maturation of plants and animals. Mining of flax genome identified two phospholipase A 2 encoding genes, viz., LusPLA 2 I and LusPLA 2 II (Linum usitatissimum secretory phospholipase A 2 ). Molecular simulation of LusPLA 2 s with already characterized plant sPLA 2 s revealed the presence of conserved motifs and signature domains necessary to classify them as secretory phospholipase A 2 . Phylogenetic analysis of flax sPLA 2 with representative sPLA 2 s from other organisms revealed that they evolved rapidly via gene duplication/deletion events and shares a common ancestor. Our study is the first report of detailed phylogenetic analysis for secretory phospholipase A 2 in flax. Comparative genomic analysis of two LusPLA 2 s with earlier reported plant sPLA 2 s, based on their gene architectures, sequence similarities, and domain structures are presented elucidating the uniqueness of flax sPLA 2 .

  20. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  1. Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.

    Directory of Open Access Journals (Sweden)

    Arnoldo J Müller-Molina

    Full Text Available To know the map between transcription factors (TFs and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.

  2. Memfasilitasi Penalaran Geometri Transformasi Siswa Melalui Eksplorasi Motif Melayu dengan Bantuan Grid

    Directory of Open Access Journals (Sweden)

    Febrian Febrian

    2017-10-01

    Full Text Available Geometri transformasi merupakan pengetahuan yang krusial dalam geometri yang dapat membangun banyak kemampuan lainnya seperti penalaran matematis. Oleh karena itu, geometri transformasi disarankan untuk diberikan pada pebelajar mulai dari usia dini. Penelitian terdahulu menunjukkan bahwa anak-anak memiliki sense untuk melihat karakteristik kedinamisan pada benda, oleh karena itu memfasilitasi pembelajaran yang dapat memanfaatkan sense ini menjadi sangat penting untuk membangun pemahaman geometri transformasi. Penelitian design research ini bertujuan untuk memfasilitasi siswa sekolah dasar untuk dapat mengembangkan pengetahuan awal mereka mengenai komposisi transformasi. Subjek penelitian adalah siswa kelas IV Sekolah Dasar Negeri 001 Toapaya, Kabupaten Bintan, Kepulauan Riau. Pendekatan pembelajaran yang digunakan adalah PMRI dengan konteks motif melayu itik pulang petang dengan bantuan grid. Hasil menunjukkan bahwa setting pembelajaran dapat memfasilitasi penalaran geometri transformasi melalui kegiatan eksplorasi motif dengan bantuan grid. Kata Kunci: komposisi transformasi, penalaran, motif melayu, grid, PMRI Transformation geometry is a crucial knowledge in geometry that can emerge many skills especially mathematical reasoning. Therefore, transformation geometry is suggested to be taught to children especially the young learners. Existing research implies that children have particular sense to see dynamic characteristic of an object or others. On the behalf of this statement, facilitating students in learning process that makes use of this students sense becomes important to undertake to help develop students reasoning of transformation geometry. The subtopic being highlighted is the composition of transformation. This design research aims to facilitate this situation. The subject of the research is fourth graders of the State Elementary School of 001 at Toapaya, Kabupaten Bintan, Kepulauan Riau. The learning approach used was PMRI by using

  3. Genome-wide identification of basic helix-loop-helix and NF-1 motifs underlying GR binding sites in male rat hippocampus

    DEFF Research Database (Denmark)

    Pooley, John R.; Flynn, Ben P.; Grøntved, Lars

    2017-01-01

    linked to structural and organizational roles, an absence of major tethering partners for GRs, and little or no evidence for binding at negative glucocorticoid response elements. A basic helix-loop-helix motif closely resembling a NeuroD1 or Olig2 binding site was found underlying a subset of GR binding......Glucocorticoids regulate hippocampal function in part by modulating gene expression through the glucocorticoid receptor (GR). GR binding is highly cell type specific, directed to accessible chromatin regions established during tissue differentiation. Distinct classes of GR binding sites...

  4. Sequence and phylogenetic analysis of virulent Newcastle disease virus isolates from Pakistan during 2009–2013 reveals circulation of new sub genotype

    Energy Technology Data Exchange (ETDEWEB)

    Siddique, Naila, E-mail: naila.nrlpd@gmail.com [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan); Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan)

    2013-09-15

    Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic {sup 112}GRQGRL{sup 117} and velogenic {sup 112}RRQKRF{sup 117} along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks.

  5. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  6. Multiple TPR motifs characterize the Fanconi anemia FANCG protein.

    Science.gov (United States)

    Blom, Eric; van de Vrugt, Henri J; de Vries, Yne; de Winter, Johan P; Arwert, Fré; Joenje, Hans

    2004-01-05

    The genome protection pathway that is defective in patients with Fanconi anemia (FA) is controlled by at least eight genes, including BRCA2. A key step in the pathway involves the monoubiquitylation of FANCD2, which critically depends on a multi-subunit nuclear 'core complex' of at least six FANC proteins (FANCA, -C, -E, -F, -G, and -L). Except for FANCL, which has WD40 repeats and a RING finger domain, no significant domain structure has so far been recognized in any of the core complex proteins. By using a homology search strategy comparing the human FANCG protein sequence with its ortholog sequences in Oryzias latipes (Japanese rice fish) and Danio rerio (zebrafish) we identified at least seven tetratricopeptide repeat motifs (TPRs) covering a major part of this protein. TPRs are degenerate 34-amino acid repeat motifs which function as scaffolds mediating protein-protein interactions, often found in multiprotein complexes. In four out of five TPR motifs tested (TPR1, -2, -5, and -6), targeted missense mutagenesis disrupting the motifs at the critical position 8 of each TPR caused complete or partial loss of FANCG function. Loss of function was evident from failure of the mutant proteins to complement the cellular FA phenotype in FA-G lymphoblasts, which was correlated with loss of binding to FANCA. Although the TPR4 mutant fully complemented the cells, it showed a reduced interaction with FANCA, suggesting that this TPR may also be of functional importance. The recognition of FANCG as a typical TPR protein predicts this protein to play a key role in the assembly and/or stabilization of the nuclear FA protein core complex.

  7. The city as a motif in Slovene youth literature

    Directory of Open Access Journals (Sweden)

    Milena Mileva Blažić

    2003-01-01

    Full Text Available The article presents the city as motif of Slovenian youth literature in four different periods, beginning in the first period of original Slovenian youth literature in the second half of the 19th century, second period in the first half of the 20th century, third period in the second half of the 20th century and after 1950, when significant books were produced in the field of short modern stories, emphasising on picture books and realistic narrative prose, and the fourth period after 1990. A discernable shift can be observed in the thirties of the 20th century, during the times of socialist realism. The most significant change occurred after 1960, when massive migration from rural to urban environments caused by industrialisation began. The motif of urban environment especially marked modern realistic narrative, coined problematic narrative after 1990, with its focus on issues of growing up in such environments. The city as motif or theme doesn’t appear only in realistic narrative, but since the early 20th century also in fantastic narrative, thus it dichotomically presents the image of real world in Slovenian youth realistic narrative.

  8. Peptide-binding motifs of two common equine class I MHC molecules in Thoroughbred horses.

    Science.gov (United States)

    Bergmann, Tobias; Lindvall, Mikaela; Moore, Erin; Moore, Eugene; Sidney, John; Miller, Donald; Tallmadge, Rebecca L; Myers, Paisley T; Malaker, Stacy A; Shabanowitz, Jeffrey; Osterrieder, Nikolaus; Peters, Bjoern; Hunt, Donald F; Antczak, Douglas F; Sette, Alessandro

    2017-05-01

    Quantitative peptide-binding motifs of MHC class I alleles provide a valuable tool to efficiently identify putative T cell epitopes. Detailed information on equine MHC class I alleles is still very limited, and to date, only a single equine MHC class I allele, Eqca-1*00101 (ELA-A3 haplotype), has been characterized. The present study extends the number of characterized ELA class I specificities in two additional haplotypes found commonly in the Thoroughbred breed. Accordingly, we here report quantitative binding motifs for the ELA-A2 allele Eqca-16*00101 and the ELA-A9 allele Eqca-1*00201. Utilizing analyses of endogenously bound and eluted ligands and the screening of positional scanning combinatorial libraries, detailed and quantitative peptide-binding motifs were derived for both alleles. Eqca-16*00101 preferentially binds peptides with aliphatic/hydrophobic residues in position 2 and at the C-terminus, and Eqca-1*00201 has a preference for peptides with arginine in position 2 and hydrophobic/aliphatic residues at the C-terminus. Interestingly, the Eqca-16*00101 motif resembles that of the human HLA A02-supertype, while the Eqca-1*00201 motif resembles that of the HLA B27-supertype and two macaque class I alleles. It is expected that the identified motifs will facilitate the selection of candidate epitopes for the study of immune responses in horses.

  9. High affinity recognition of a Phytophthora protein by Arabidopsis via an RGD motif

    NARCIS (Netherlands)

    Senchou, V.; Weide, R.L.; Carrasco, A.; Bouyssou, H.; Pont-Lezica, R.; Govers, F.; Canut, H.

    2004-01-01

    The RGD tripeptide sequence, a cell adhesion motif present in several extracellular matrix proteins of mammalians, is involved in numerous plant processes. In plant-pathogen interactions, the RGD motif is believed to reduce plant defence responses by disrupting adhesions between the cell wall and

  10. DXD Motif-Dependent and -Independent Effects of the Chlamydia trachomatis Cytotoxin CT166

    Directory of Open Access Journals (Sweden)

    Miriam Bothe

    2015-02-01

    Full Text Available The Gram-negative, intracellular bacterium Chlamydia trachomatis causes acute and chronic urogenital tract infection, potentially leading to infertility and ectopic pregnancy. The only partially characterized cytotoxin CT166 of serovar D exhibits a DXD motif, which is important for the enzymatic activity of many bacterial and mammalian type A glycosyltransferases, leading to the hypothesis that CT166 possess glycosyltransferase activity. CT166-expressing HeLa cells exhibit actin reorganization, including cell rounding, which has been attributed to the inhibition of the Rho-GTPases Rac/Cdc42. Exploiting the glycosylation-sensitive Ras(27H5 antibody, we here show that CT166 induces an epitope change in Ras, resulting in inhibited ERK and PI3K signaling and delayed cell cycle progression. Consistent with the hypothesis that these effects strictly depend on the DXD motif, CT166 with the mutated DXD motif causes neither Ras-ERK inhibition nor delayed cell cycle progression. In contrast, CT166 with the mutated DXD motif is still capable of inhibiting cell migration, suggesting that CT166 with the mutated DXD motif cannot be regarded as inactive in any case. Taken together, CT166 affects various fundamental cellular processes, strongly suggesting its importance for the intracellular survival of chlamydia.

  11. Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

    Science.gov (United States)

    Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

    2003-08-15

    DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

  12. Genome-Wide Identification and Analysis of Arabidopsis Sodium Proton Antiporter (NHX and Human Sodium Proton Exchanger (NHE Homologs in Sorghum bicolor

    Directory of Open Access Journals (Sweden)

    P. Hima Kumari

    2018-05-01

    Full Text Available Na+ transporters play an important role during salt stress and development. The present study is aimed at genome-wide identification, in silico analysis of sodium-proton antiporter (NHX and sodium-proton exchanger (NHE-type transporters in Sorghum bicolor and their expression patterns under varied abiotic stress conditions. In Sorghum, seven NHX and nine NHE homologs were identified. Amiloride (a known inhibitor of Na+/H+ exchanger activity binding motif was noticed in both types of the transporters. Chromosome 2 was found to be a hotspot region with five sodium transporters. Phylogenetic analysis inferred six ortholog and three paralog groups. To gain an insight into functional divergence of SbNHX/NHE transporters, real-time gene expression was performed under salt, drought, heat, and cold stresses in embryo, root, stem, and leaf tissues. Expression patterns revealed that both SbNHXs and SbNHEs are responsive either to single or multiple abiotic stresses. The predicted protein–protein interaction networks revealed that only SbNHX7 is involved in the calcineurin B-like proteins (CBL- CBL interacting protein kinases (CIPK pathway. The study provides insights into the functional divergence of SbNHX/NHE transporter genes with tissue specific expressions in Sorghum under different abiotic stress conditions.

  13. Alanine substitutions in the GXXXG motif alter C99 cleavage by γ-secretase but not its dimerization.

    Science.gov (United States)

    Higashide, Hidekazu; Ishihara, Seiko; Nobuhara, Mika; Ihara, Yasuo; Funamoto, Satoru

    2017-03-01

    The amyloid β (Aβ) protein is a major component of senile plaques, one of the neuropathological hallmarks of Alzheimer's disease. Amyloidogenic processing of amyloid precursor protein (APP) by β- and γ-secretases leads to production of Aβ. APP contains tandem triple repeats of the GXXXG motif in its extracellular juxtamembrane and transmembrane regions. It is reported that the GXXXG motif is related to protein-protein interactions, but it remains controversial whether the GXXXG motif in APP is involved in substrate dimerization and whether dimerization affects γ-secretase-dependent cleavage. Therefore, the relationship between the GXXXG motifs, substrate dimerization, and γ-secretase-dependent cleavage sites remains unclear. Here, we applied blue native poly acrylamide gel electrophoresis to examine the effect of alanine substitutions within the GXXXG motifs of APP carboxyl terminal fragment (C99) on its dimerization and Aβ production. Surprisingly, alanine substitutions in the motif failed to alter C99 dimerization in detergent soluble state. Cell-based and solubilized γ-secretase assays demonstrated that increasing alanine substitutions in the motif tended to decrease long Aβ species such as Aβ42 and Aβ43 and to increase in short Aβ species concomitantly. Our data suggest that the GXXXG motif is crucial for Aβ production, but not for C99 dimerization. © 2016 International Society for Neurochemistry.

  14. Identification and phylogenetic analysis of Tityus pachyurus and Tityus obscurus novel putative Na+-channel scorpion toxins.

    Directory of Open Access Journals (Sweden)

    Jimmy A Guerrero-Vargas

    Full Text Available Colombia and Brazil are affected by severe cases of scorpionism. In Colombia the most dangerous accidents are caused by Tityus pachyurus that is widely distributed around this country. In the Brazilian Amazonian region scorpion stings are a common event caused by Tityus obscurus. The main objective of this work was to perform the molecular cloning of the putative Na(+-channel scorpion toxins (NaScTxs from T. pachyurus and T. obscurus venom glands and to analyze their phylogenetic relationship with other known NaScTxs from Tityus species.cDNA libraries from venom glands of these two species were constructed and five nucleotide sequences from T. pachyurus were identified as putative modulators of Na(+-channels, and were named Tpa4, Tpa5, Tpa6, Tpa7 and Tpa8; the latter being the first anti-insect excitatory β-class NaScTx in Tityus scorpion venom to be described. Fifteen sequences from T. obscurus were identified as putative NaScTxs, among which three had been previously described, and the others were named To4 to To15. The peptides Tpa4, Tpa5, Tpa6, To6, To7, To9, To10 and To14 are closely related to the α-class NaScTxs, whereas Tpa7, Tpa8, To4, To8, To12 and To15 sequences are more related to the β-class NaScTxs. To5 is possibly an arthropod specific toxin. To11 and To13 share sequence similarities with both α and β NaScTxs. By means of phylogenetic analysis using the Maximum Parsimony method and the known NaScTxs from Tityus species, these toxins were clustered into 14 distinct groups.This communication describes new putative NaScTxs from T. pachyurus and T. obscurus and their phylogenetic analysis. The results indicate clear geographic separation between scorpions of Tityus genus inhabiting the Amazonian and Mountain Andes regions and those distributed over the Southern of the Amazonian rainforest. Based on the consensus sequences for the different clusters, a new nomenclature for the NaScTxs is proposed.

  15. Phylogenetic Position of Barbus lacerta Heckel, 1843

    Directory of Open Access Journals (Sweden)

    Mustafa Korkmaz

    2015-11-01

    As a result, five clades come out from phylogenetic reconstruction and in phylogenetic tree Barbus lacerta determined to be sister group of Barbus macedonicus, Barbus oligolepis and Barbus plebejus complex.

  16. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  17. Disparate requirements for the Walker A and B ATPase motifs of human RAD51D in homologous recombination.

    Science.gov (United States)

    Wiese, Claudia; Hinz, John M; Tebbs, Robert S; Nham, Peter B; Urbin, Salustra S; Collins, David W; Thompson, Larry H; Schild, David

    2006-01-01

    In vertebrates, homologous recombinational repair (HRR) requires RAD51 and five RAD51 paralogs (XRCC2, XRCC3, RAD51B, RAD51C and RAD51D) that all contain conserved Walker A and B ATPase motifs. In human RAD51D we examined the requirement for these motifs in interactions with XRCC2 and RAD51C, and for survival of cells in response to DNA interstrand crosslinks (ICLs). Ectopic expression of wild-type human RAD51D or mutants having a non-functional A or B motif was used to test for complementation of a rad51d knockout hamster CHO cell line. Although A-motif mutants complement very efficiently, B-motif mutants do not. Consistent with these results, experiments using the yeast two- and three-hybrid systems show that the interactions between RAD51D and its XRCC2 and RAD51C partners also require a functional RAD51D B motif, but not motif A. Similarly, hamster Xrcc2 is unable to bind to the non-complementing human RAD51D B-motif mutants in co-immunoprecipitation assays. We conclude that a functional Walker B motif, but not A motif, is necessary for RAD51D's interactions with other paralogs and for efficient HRR. We present a model in which ATPase sites are formed in a bipartite manner between RAD51D and other RAD51 paralogs.

  18. Effects of Phylogenetic Tree Style on Student Comprehension

    Science.gov (United States)

    Dees, Jonathan Andrew

    Phylogenetic trees are powerful tools of evolutionary biology that have become prominent across the life sciences. Consequently, learning to interpret and reason from phylogenetic trees is now an essential component of biology education. However, students often struggle to understand these diagrams, even after explicit instruction. One factor that has been observed to affect student understanding of phylogenetic trees is style (i.e., diagonal or bracket). The goal of this dissertation research was to systematically explore effects of style on student interpretations and construction of phylogenetic trees in the context of an introductory biology course. Before instruction, students were significantly more accurate with bracket phylogenetic trees for a variety of interpretation and construction tasks. Explicit instruction that balanced the use of diagonal and bracket phylogenetic trees mitigated some, but not all, style effects. After instruction, students were significantly more accurate for interpretation tasks involving taxa relatedness and construction exercises when using the bracket style. Based on this dissertation research and prior studies on style effects, I advocate for introductory biology instructors to use only the bracket style. Future research should examine causes of style effects and variables other than style to inform the development of research-based instruction that best supports student understanding of phylogenetic trees.

  19. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Directory of Open Access Journals (Sweden)

    Villemereuil Pierre de

    2012-06-01

    Full Text Available Abstract Background Uncertainty in comparative analyses can come from at least two sources: a phylogenetic uncertainty in the tree topology or branch lengths, and b uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow and inflated significance in hypothesis testing (e.g. p-values will be too small. Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible

  20. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Science.gov (United States)

    2012-01-01

    Background Uncertainty in comparative analyses can come from at least two sources: a) phylogenetic uncertainty in the tree topology or branch lengths, and b) uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow) and inflated significance in hypothesis testing (e.g. p-values will be too small). Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible general purpose tool for

  1. Molecular phylogenetic analysis of fleshy pored mushrooms: Neoboletus luridiformis and Hortiboletus rubellus from western Himalayan range of Pakistan

    International Nuclear Information System (INIS)

    Sarwar, S.; Khalid, N.; Dentinger, B.M.

    2016-01-01

    Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)

  2. The Diaporthe sojae species complex: Phylogenetic re-assessment of pathogens associated with soybean, cucurbits and other field crops.

    Science.gov (United States)

    Udayanga, Dhanushka; Castlebury, Lisa A; Rossman, Amy Y; Chukeatirote, Ekachai; Hyde, Kevin D

    2015-05-01

    Phytopathogenic species of Diaporthe are associated with a number of soybean diseases including seed decay, pod and stem blight and stem canker and lead to considerable crop production losses worldwide. Accurate morphological identification of the species that cause these diseases has been difficult. In this study, we determined the phylogenetic relationships and species boundaries of Diaporthe longicolla, Diaporthe phaseolorum, Diaporthe sojae and closely related taxa. Species boundaries for this complex were determined based on combined phylogenetic analysis of five gene regions: partial sequences of calmodulin (CAL), beta-tubulin (TUB), histone-3 (HIS), translation elongation factor 1-α (EF1-α), and the nuclear ribosomal internal transcribed spacers (ITS). Phylogenetic analyses revealed that this large complex of taxa is comprised of soybean pathogens as well as species associated with herbaceous field crops and weeds. Diaporthe arctii, Diaporthe batatas, D. phaseolorum and D. sojae are epitypified. The seed decay pathogen D. longicolla was determined to be distinct from D. sojae. D. phaseolorum, originally associated with stem and leaf blight of Lima bean, was not found to be associated with soybean. A new species, Diaporthe ueckerae on Cucumis melo, is introduced with description and illustrations. Published by Elsevier Ltd.

  3. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  4. Point estimates in phylogenetic reconstructions

    OpenAIRE

    Benner, Philipp; Bacak, Miroslav; Bourguignon, Pierre-Yves

    2013-01-01

    Motivation: The construction of statistics for summarizing posterior samples returned by a Bayesian phylogenetic study has so far been hindered by the poor geometric insights available into the space of phylogenetic trees, and ad hoc methods such as the derivation of a consensus tree makeup for the ill-definition of the usual concepts of posterior mean, while bootstrap methods mitigate the absence of a sound concept of variance. Yielding satisfactory results with sufficiently concentrated pos...

  5. Proteome-level assessment of origin, prevalence and function of Leucine-Aspartic Acid (LD) motifs

    KAUST Repository

    Alam, Tanvir; Alazmi, Meshari; Naser, Rayan Mohammad Mahmoud; Huser, Franceline; Momin, Afaque Ahmad Imtiyaz; Walkiewicz, Katarzyna Wiktoria; Canlas, Christian; Huser, Raphaë l; Ali, Amal J.; Merzaban, Jasmeen; Bajic, Vladimir B.; Gao, Xin; Arold, Stefan T.

    2018-01-01

    and migration, and revealed a new type of inverse LD motif consensus. Our evolutionary analysis suggested that LD motif signalling originated in the common unicellular ancestor of opisthokonts and amoebozoa by co-opting nuclear export sequences. Inter

  6. TOPDOM: database of conservatively located domains and motifs in proteins.

    Science.gov (United States)

    Varga, Julia; Dobson, László; Tusnády, Gábor E

    2016-09-01

    The TOPDOM database-originally created as a collection of domains and motifs located consistently on the same side of the membranes in α-helical transmembrane proteins-has been updated and extended by taking into consideration consistently localized domains and motifs in globular proteins, too. By taking advantage of the recently developed CCTOP algorithm to determine the type of a protein and predict topology in case of transmembrane proteins, and by applying a thorough search for domains and motifs as well as utilizing the most up-to-date version of all source databases, we managed to reach a 6-fold increase in the size of the whole database and a 2-fold increase in the number of transmembrane proteins. TOPDOM database is available at http://topdom.enzim.hu The webpage utilizes the common Apache, PHP5 and MySQL software to provide the user interface for accessing and searching the database. The database itself is generated on a high performance computer. tusnady.gabor@ttk.mta.hu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  7. Disturbance by an endemic rodent in an arid shrubland is a habitat filter: effects on plant invasion and taxonomical, functional and phylogenetic community structure.