Phylogenetic diversity and biodiversity indices on phylogenetic networks.
Wicke, Kristina; Fischer, Mareike
2018-04-01
In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.
Functional & phylogenetic diversity of copepod communities
Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.
2016-02-01
The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
NIRAJ SINGH
for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.
Global patterns of amphibian phylogenetic diversity
DEFF Research Database (Denmark)
Fritz, Susanne; Rahbek, Carsten
2012-01-01
Aim Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location Global; equal-area grid cells of approximately 10,000 km2. Methods We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...
Phylogenetic and Diversity Analysis of Dactylis glomerata Subspecies Using SSR and IT-ISJ Markers.
Yan, Defei; Zhao, Xinxin; Cheng, Yajuan; Ma, Xiao; Huang, Linkai; Zhang, Xinquan
2016-10-31
The genus Dactylis , an important forage crop, has a wide geographical distribution in temperate regions. While this genus is thought to include a single species, Dactylis glomerata , this species encompasses many subspecies whose relationships have not been fully characterized. In this study, the genetic diversity and phylogenetic relationships of nine representative Dactylis subspecies were examined using SSR and IT-ISJ markers. In total, 21 pairs of SSR primers and 15 pairs of IT-ISJ primers were used to amplify 295 polymorphic bands with polymorphic rates of 100%. The average polymorphic information contents (PICs) of SSR and IT-ISJ markers were 0.909 and 0.780, respectively. The combined data of the two markers indicated a high level of genetic diversity among the nine D. glomerata subspecies, with a Nei's gene diversity index value of 0.283 and Shannon's diversity of 0.448. Preliminarily phylogenetic analysis results revealed that the 20 accessions could be divided into three groups (A, B, C). Furthermore, they could be divided into five clusters, which is similar to the structure analysis with K = 5. Phylogenetic placement in these three groups may be related to the distribution ranges and the climate types of the subspecies in each group. Group A contained eight accessions of four subspecies, originating from the west Mediterranean, while Group B contained seven accessions of three subspecies, originating from the east Mediterranean.
Barberán, Albert; Casamayor, Emilio O
2014-12-01
There is an increasing interest to combine phylogenetic data with distributional and ecological records to assess how natural communities arrange under an evolutionary perspective. In the microbial world, there is also a need to go beyond the problematic species definition to deeply explore ecological patterns using genetic data. We explored links between evolution/phylogeny and community ecology using bacterial 16S rRNA gene information from a high-altitude lakes district data set. We described phylogenetic community composition, spatial distribution, and β-diversity and biogeographical patterns applying evolutionary relatedness without relying on any particular operational taxonomic unit definition. High-altitude lakes districts usually contain a large mosaic of highly diverse small water bodies and conform a fine biogeographical model of spatially close but environmentally heterogeneous ecosystems. We sampled 18 lakes in the Pyrenees with a selection criteria focused on capturing the maximum environmental variation within the smallest geographical area. The results showed highly diverse communities nonrandomly distributed with phylogenetic β-diversity patterns mainly shaped by the environment and not by the spatial distance. Community similarity based on both bacterial taxonomic composition and phylogenetic β-diversity shared similar patterns and was primarily structured by similar environmental drivers. We observed a positive relationship between lake area and phylogenetic diversity with a slope consistent with highly dispersive planktonic organisms. The phylogenetic approach incorporated patterns of common ancestry into bacterial community analysis and emerged as a very convenient analytical tool for direct inter- and intrabiome biodiversity comparisons and sorting out microbial habitats with potential application in conservation studies. © 2014 John Wiley & Sons Ltd.
Nakamoto, Kenta; Hayakawa, Jun; Kawamura, Tomohiko; Kodama, Masafumi; Yamada, Hideaki; Kitagawa, Takashi; Watanabe, Yoshiro
2018-07-01
Various aspects of plant diversity such as species diversity and phylogenetic diversity enhance the species diversity of associated animals in terrestrial systems. In marine systems, however, the effects of macrophyte diversity on the species diversity of associated animals have received little attention. Here, we sampled in a subtropical seagrass-seaweed mixed bed to elucidate the effect of the macrophyte phylogenetic diversity based on the taxonomic relatedness as well as the macrophyte species diversity on species diversity of mobile epi-benthic invertebrates. Using regression analyses for each macrophyte parameter as well as multiple regression analyses, we found that the macrophyte phylogenetic diversity (taxonomic diversity index: Delta) positively influenced the invertebrate species richness and diversity index (H‧). Although the macrophyte species richness and H‧ also positively influenced the invertebrate species richness, the best fit model for invertebrate species richness did not include them, suggesting that the macrophyte species diversity indirectly influenced invertebrate species diversity. Possible explanations of the effects of macrophyte Delta on the invertebrate species diversity were the niche complementarity effect and the selection effect. This is the first study which demonstrates that macrophyte phylogenetic diversity has a strong effect on the species diversity of mobile epi-benthic invertebrates.
Maximizing the phylogenetic diversity of seed banks.
Griffiths, Kate E; Balding, Sharon T; Dickie, John B; Lewis, Gwilym P; Pearce, Tim R; Grenyer, Richard
2015-04-01
Ex situ conservation efforts such as those of zoos, botanical gardens, and seed banks will form a vital complement to in situ conservation actions over the coming decades. It is therefore necessary to pay the same attention to the biological diversity represented in ex situ conservation facilities as is often paid to protected-area networks. Building the phylogenetic diversity of ex situ collections will strengthen our capacity to respond to biodiversity loss. Since 2000, the Millennium Seed Bank Partnership has banked seed from 14% of the world's plant species. We assessed the taxonomic, geographic, and phylogenetic diversity of the Millennium Seed Bank collection of legumes (Leguminosae). We compared the collection with all known legume genera, their known geographic range (at country and regional levels), and a genus-level phylogeny of the legume family constructed for this study. Over half the phylogenetic diversity of legumes at the genus level was represented in the Millennium Seed Bank. However, pragmatic prioritization of species of economic importance and endangerment has led to the banking of a less-than-optimal phylogenetic diversity and prioritization of range-restricted species risks an underdispersed collection. The current state of the phylogenetic diversity of legumes in the Millennium Seed Bank could be substantially improved through the strategic banking of relatively few additional taxa. Our method draws on tools that are widely applied to in situ conservation planning, and it can be used to evaluate and improve the phylogenetic diversity of ex situ collections. © 2014 Society for Conservation Biology.
Fast Computations for Measures of Phylogenetic Beta Diversity.
Directory of Open Access Journals (Sweden)
Constantinos Tsirogiannis
Full Text Available For many applications in ecology, it is important to examine the phylogenetic relations between two communities of species. More formally, let [Formula: see text] be a phylogenetic tree and let A and B be two samples of its tips, representing the examined communities. We want to compute a value that expresses the phylogenetic diversity between A and B in [Formula: see text]. There exist several measures that can do this; these are the so-called phylogenetic beta diversity (β-diversity measures. Two popular measures of this kind are the Community Distance (CD and the Common Branch Length (CBL. In most applications, it is not sufficient to compute the value of a beta diversity measure for two communities A and B; we also want to know if this value is relatively large or small compared to all possible pairs of communities in [Formula: see text] that have the same size. To decide this, the ideal approach is to compute a standardised index that involves the mean and the standard deviation of this measure among all pairs of species samples that have the same number of elements as A and B. However, no method exists for computing exactly and efficiently this index for CD and CBL. We present analytical expressions for computing the expectation and the standard deviation of CD and CBL. Based on these expressions, we describe efficient algorithms for computing the standardised indices of the two measures. Using standard algorithmic analysis, we provide guarantees on the theoretical efficiency of our algorithms. We implemented our algorithms and measured their efficiency in practice. Our implementations compute the standardised indices of CD and CBL in less than twenty seconds for a hundred pairs of samples on trees with 7 ⋅ 10(4 tips. Our implementations are available through the R package PhyloMeasures.
González-Rocha, Gerardo; Muñoz-Cartes, Gabriel; Canales-Aguirre, Cristian B; Lima, Celia A; Domínguez-Yévenes, Mariana; Bello-Toledo, Helia; Hernández, Cristián E
2017-01-01
It has been proposed that Antarctic environments select microorganisms with unique biochemical adaptations, based on the tenet 'Everything is everywhere, but, the environment selects' by Baas-Becking. However, this is a hypothesis that has not been extensively evaluated. This study evaluated the fundamental prediction contained in this hypothesis-in the sense that species are structured in the landscape according to their local habitats-, using as study model the phylogenetic diversity of the culturable bacteria of Fildes Peninsula (King George Island, Antarctica). Eighty bacterial strains isolated from 10 different locations in the area, were recovered. Based on phylogenetic analysis of 16S rRNA gene sequences, the isolates were grouped into twenty-six phylotypes distributed in three main clades, of which only six are exclusive to Antarctica. Results showed that phylotypes do not group significantly by habitat type; however, local habitat types had phylogenetic signal, which support the phylogenetic niche conservatism hypothesis and not a selective role of the environment like the Baas-Becking hypothesis suggests. We propose that, more than habitat selection resulting in new local adaptations and diversity, local historical colonization and species sorting (i.e. differences in speciation and extinction rates that arise by interaction of species level traits with the environment) play a fundamental role on the culturable bacterial diversity in Antarctica.
Continental scale patterns and predictors of fern richness and phylogenetic diversity
Directory of Open Access Journals (Sweden)
Nathalie eNagalingum
2015-04-01
Full Text Available Because ferns have a wide range of habitat preferences and are widely distributed, they are an ideal group for understanding how diversity is distributed. Here we examine fern diversity on a broad-scale using standard and corrected richness measures as well as phylogenetic indices; in addition we determine the environmental predictors of each diversity metric. Using the combined records of Australian herbaria, a dataset of over 60,000 records was obtained for 89 genera to infer richness. A phylogenetic tree of all the genera was constructed and combined with the herbarium records to obtain phylogenetic diversity patterns. A hotspot of both taxic and phylogenetic diversity occurs in the Wet Tropics of northeastern Australia. Although considerable diversity is distributed along the eastern coast, some important regions of diversity are identified only after sample-standardization of richness and through the phylogenetic metric. Of all of the metrics, annual precipitation was identified as the most explanatory variable, in part, in agreement with global and regional fern studies. Precipitation was combined with a different variable for each different metric. For corrected richness, precipitation is combined with temperature seasonality, while correlation of phylogenetic diversity to precipitation plus radiation indicates support for the species-energy hypothesis. Significantly high and significantly low phylogenetic diversity were found in geographically separate areas. These areas are correlated with different climatic conditions such as seasonality in precipitation. The use of phylogenetic metrics identifies additional areas of significant diversity, some of which have not been revealed using traditional taxonomic analyses, suggesting that different ecological and evolutionary processes have operated over the continent. Our study demonstrates that it is possible and vital to incorporate evolutionary metrics when inferring biodiversity hotspots
Turnover of plant lineages shapes herbivore phylogenetic beta diversity along ecological gradients.
Pellissier, Loïc; Ndiribe, Charlotte; Dubuis, Anne; Pradervand, Jean-Nicolas; Salamin, Nicolas; Guisan, Antoine; Rasmann, Sergio
2013-05-01
Understanding drivers of biodiversity patterns is of prime importance in this era of severe environmental crisis. More diverse plant communities have been postulated to represent a larger functional trait-space, more likely to sustain a diverse assembly of herbivore species. Here, we expand this hypothesis to integrate environmental, functional and phylogenetic variation of plant communities as factors explaining the diversity of lepidopteran assemblages along elevation gradients in the Swiss Western Alps. According to expectations, we found that the association between butterflies and their host plants is highly phylogenetically structured. Multiple regression analyses showed the combined effect of climate, functional traits and phylogenetic diversity in structuring butterfly communities. Furthermore, we provide the first evidence that plant phylogenetic beta diversity is the major driver explaining butterfly phylogenetic beta diversity. Along ecological gradients, the bottom up control of herbivore diversity is thus driven by phylogenetically structured turnover of plant traits as well as environmental variables. © 2013 Blackwell Publishing Ltd/CNRS.
Ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses.
Fouquier, Jennifer; Rideout, Jai Ram; Bolyen, Evan; Chase, John; Shiffer, Arron; McDonald, Daniel; Knight, Rob; Caporaso, J Gregory; Kelley, Scott T
2016-02-24
Fungi play critical roles in many ecosystems, cause serious diseases in plants and animals, and pose significant threats to human health and structural integrity problems in built environments. While most fungal diversity remains unknown, the development of PCR primers for the internal transcribed spacer (ITS) combined with next-generation sequencing has substantially improved our ability to profile fungal microbial diversity. Although the high sequence variability in the ITS region facilitates more accurate species identification, it also makes multiple sequence alignment and phylogenetic analysis unreliable across evolutionarily distant fungi because the sequences are hard to align accurately. To address this issue, we created ghost-tree, a bioinformatics tool that integrates sequence data from two genetic markers into a single phylogenetic tree that can be used for diversity analyses. Our approach starts with a "foundation" phylogeny based on one genetic marker whose sequences can be aligned across organisms spanning divergent taxonomic groups (e.g., fungal families). Then, "extension" phylogenies are built for more closely related organisms (e.g., fungal species or strains) using a second more rapidly evolving genetic marker. These smaller phylogenies are then grafted onto the foundation tree by mapping taxonomic names such that each corresponding foundation-tree tip would branch into its new "extension tree" child. We applied ghost-tree to graft fungal extension phylogenies derived from ITS sequences onto a foundation phylogeny derived from fungal 18S sequences. Our analysis of simulated and real fungal ITS data sets found that phylogenetic distances between fungal communities computed using ghost-tree phylogenies explained significantly more variance than non-phylogenetic distances. The phylogenetic metrics also improved our ability to distinguish small differences (effect sizes) between microbial communities, though results were similar to non-phylogenetic
Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu
2011-09-01
In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
2017-03-03
Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.
Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah
2017-08-01
Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.
Phylogenetic diversity analysis of Trichoderma species based on ...
African Journals Online (AJOL)
vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...
AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.
El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee
2016-01-01
Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Phenotypic diversity and phylogenetic relationship between the ...
African Journals Online (AJOL)
Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.
A comparative test of phylogenetic diversity indices.
Schweiger, Oliver; Klotz, Stefan; Durka, Walter; Kühn, Ingolf
2008-09-01
Traditional measures of biodiversity, such as species richness, usually treat species as being equal. As this is obviously not the case, measuring diversity in terms of features accumulated over evolutionary history provides additional value to theoretical and applied ecology. Several phylogenetic diversity indices exist, but their behaviour has not yet been tested in a comparative framework. We provide a test of ten commonly used phylogenetic diversity indices based on 40 simulated phylogenies of varying topology. We restrict our analysis to a topological fully resolved tree without information on branch lengths and species lists with presence-absence data. A total of 38,000 artificial communities varying in species richness covering 5-95% of the phylogenies were created by random resampling. The indices were evaluated based on their ability to meet a priori defined requirements. No index meets all requirements, but three indices turned out to be more suitable than others under particular conditions. Average taxonomic distinctness (AvTD) and intensive quadratic entropy (J) are calculated by averaging and are, therefore, unbiased by species richness while reflecting phylogeny per se well. However, averaging leads to the violation of set monotonicity, which requires that species extinction cannot increase the index. Total taxonomic distinctness (TTD) sums up distinctiveness values for particular species across the community. It is therefore strongly linked to species richness and reflects phylogeny per se weakly but satisfies set monotonicity. We suggest that AvTD and J are best applied to studies that compare spatially or temporally rather independent communities that potentially vary strongly in their phylogenetic composition-i.e. where set monotonicity is a more negligible issue, but independence of species richness is desired. In contrast, we suggest that TTD be used in studies that compare rather interdependent communities where changes occur more gradually by
Directory of Open Access Journals (Sweden)
Marcia C. Muñoz
2017-08-01
Full Text Available Mutualistic interactions between plants and animals can affect both plant and animal communities, and potentially leave imprints on plant demography. Yet, no study has simultaneously tested how trait variation in plant resources shapes the diversity of animal consumers, and how these interactions influence seedling recruitment. Here, we analyzed whether (i phylogenetic diversity and functional diversity of fruiting plants were correlated with the corresponding diversity of frugivorous birds, and (ii whether phylogenetic diversity and functional identity of plant and bird communities influenced the corresponding diversity and identity of seedling communities. We recorded mutualistic interactions between fleshy-fruited plants and frugivorous birds and seedling communities in 10 plots along an elevational gradient in the Colombian Andes. We built a phylogeny for plants/seedlings and birds and measured relevant morphological plant and bird traits that influence plant-bird interactions and seedling recruitment. We found that phylogenetic diversity and functional diversity of frugivorous birds were positively associated with the corresponding diversities of fruiting plants, consistent with a bottom-up effect of plants on birds. Moreover, the phylogenetic diversity of seedlings was related to the phylogenetic diversity of plants, but was unrelated to the phylogenetic diversity of frugivorous birds, suggesting that top-down effects of animals on seedlings were weak. Mean seed mass of seedling communities was positively associated with the mean fruit mass of plants, but was not associated with the mean avian body mass in the frugivore communities. Our study shows that variation in the traits of fleshy-fruited plants was associated with the diversity of frugivorous birds and affected the future trajectory of seedling recruitment, whereas the morphological traits of animal seed dispersers were unrelated to the phylogenetic and functional structure of
Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity
Thompson, Patrick L.; Davies, T. Jonathan; Gonzalez, Andrew
2015-01-01
In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures. PMID:25693188
Santos, Bráulio A; Arroyo-Rodríguez, Víctor; Moreno, Claudia E; Tabarelli, Marcelo
2010-09-08
Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.
Host specialization and phylogenetic diversity of Corynespora cassiicola.
Dixon, L J; Schlub, R L; Pernezny, K; Datnoff, L E
2009-09-01
The fungus Corynespora cassiicola is primarily found in the tropics and subtropics, and is widely diverse in substrate utilization and host association. Isolate characterization within C. cassiicola was undertaken to investigate how genetic diversity correlates with host specificity, growth rate, and geographic distribution. C. cassiicola isolates were collected from 68 different plant species in American Samoa, Brazil, Malaysia, and Micronesia, and Florida, Mississippi, and Tennessee within the United States. Phylogenetic analyses using four loci were performed with 143 Corynespora spp. isolates, including outgroup taxa obtained from culture collections: C. citricola, C. melongenae, C. olivacea, C. proliferata, C. sesamum, and C. smithii. Phylogenetic trees were congruent from the ribosomal DNA internal transcribed spacer region, two random hypervariable loci (caa5 and ga4), and the actin-encoding locus act1, indicating a lack of recombination within the species and asexual propagation. Fifty isolates were tested for pathogenicity on eight known C. cassiicola crop hosts: basil, bean, cowpea, cucumber, papaya, soybean, sweet potato, and tomato. Pathogenicity profiles ranged from one to four hosts, with cucumber appearing in 14 of the 16 profiles. Bootstrap analyses and Bayesian posterior probability values identified six statistically significant phylogenetic lineages. The six phylogenetic lineages correlated with host of origin, pathogenicity, and growth rate but not with geographic location. Common fungal genotypes were widely distributed geographically, indicating long-distance and global dispersal of clonal lineages. This research reveals an abundance of previously unrecognized genetic diversity within the species and provides evidence for host specialization on papaya.
Directory of Open Access Journals (Sweden)
Anthony Stuart Amend
2015-02-01
Full Text Available Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity. This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between phylogenetic diversity and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial phylogenetic diversity, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of sixty-six days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial phylogenetic diversity failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which phylogenetic diversity predicts ecosystem function will depend on environmental context.
Yang, Jie; Swenson, Nathan G; Zhang, Guocheng; Ci, Xiuqin; Cao, Min; Sha, Liqing; Li, Jie; Ferry Slik, J W; Lin, Luxiang
2015-08-03
The relative degree to which stochastic and deterministic processes underpin community assembly is a central problem in ecology. Quantifying local-scale phylogenetic and functional beta diversity may shed new light on this problem. We used species distribution, soil, trait and phylogenetic data to quantify whether environmental distance, geographic distance or their combination are the strongest predictors of phylogenetic and functional beta diversity on local scales in a 20-ha tropical seasonal rainforest dynamics plot in southwest China. The patterns of phylogenetic and functional beta diversity were generally consistent. The phylogenetic and functional dissimilarity between subplots (10 × 10 m, 20 × 20 m, 50 × 50 m and 100 × 100 m) was often higher than that expected by chance. The turnover of lineages and species function within habitats was generally slower than that across habitats. Partitioning the variation in phylogenetic and functional beta diversity showed that environmental distance was generally a better predictor of beta diversity than geographic distance thereby lending relatively more support for deterministic environmental filtering over stochastic processes. Overall, our results highlight that deterministic processes play a stronger role than stochastic processes in structuring community composition in this diverse assemblage of tropical trees.
Directory of Open Access Journals (Sweden)
Marie Florence Sandrine Ngo Ngwe
Full Text Available Yams (Dioscorea spp. consist of approximately 600 species. Presently, these species are threatened by genetic erosion due to many factors such as pest attacks and farming practices. In parallel, complex taxonomic boundaries in this genus makes it more challenging to properly address the genetic diversity of yam and manage its germplasm. As a first step toward evaluating and preserving the genetic diversity yam species, we use a phylogenetic diversity (PD approach that has the advantage to investigate phylogenetic relationships and test hypotheses of species monophyly while alleviating to the problem of ploidy variation within and among species. The Bayesian phylogenetic analysis of 62 accessions from 7 species from three regions of Cameroon showed that most Dioscorea sections were monophyletic, but species within sections were generally non-monophyletic. The wild species D. praehensilis and cultivated D. cayenensis were the species with the highest PD. At the opposite, D. esculenta has a low PD and future studies should focus on this species to properly address its conservation status. We also show that wild species show a stronger genetic structure than cultivated species, which potentially reflects the management of the yam germplasm by farmers. These findings show that phylogenetic diversity is a promising approach for an initial investigation of genetic diversity in a crop consisting of closely related species.
Directory of Open Access Journals (Sweden)
Koen Illeghems
Full Text Available This is the first report on the phylogenetic analysis of the community diversity of a single spontaneous cocoa bean box fermentation sample through a metagenomic approach involving 454 pyrosequencing. Several sequence-based and composition-based taxonomic profiling tools were used and evaluated to avoid software-dependent results and their outcome was validated by comparison with previously obtained culture-dependent and culture-independent data. Overall, this approach revealed a wider bacterial (mainly γ-Proteobacteria and fungal diversity than previously found. Further, the use of a combination of different classification methods, in a software-independent way, helped to understand the actual composition of the microbial ecosystem under study. In addition, bacteriophage-related sequences were found. The bacterial diversity depended partially on the methods used, as composition-based methods predicted a wider diversity than sequence-based methods, and as classification methods based solely on phylogenetic marker genes predicted a more restricted diversity compared with methods that took all reads into account. The metagenomic sequencing analysis identified Hanseniaspora uvarum, Hanseniaspora opuntiae, Saccharomyces cerevisiae, Lactobacillus fermentum, and Acetobacter pasteurianus as the prevailing species. Also, the presence of occasional members of the cocoa bean fermentation process was revealed (such as Erwinia tasmaniensis, Lactobacillus brevis, Lactobacillus casei, Lactobacillus rhamnosus, Lactococcus lactis, Leuconostoc mesenteroides, and Oenococcus oeni. Furthermore, the sequence reads associated with viral communities were of a restricted diversity, dominated by Myoviridae and Siphoviridae, and reflecting Lactobacillus as the dominant host. To conclude, an accurate overview of all members of a cocoa bean fermentation process sample was revealed, indicating the superiority of metagenomic sequencing over previously used techniques.
Howard, Marion G; McDonald, William J F; Forster, Paul I; Kress, W John; Erickson, David; Faith, Daniel P; Shapcott, Alison
2016-01-01
Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ), Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD) measures as well as species richness (SR) for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD). Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness and higher than
Directory of Open Access Journals (Sweden)
Marion G Howard
Full Text Available Australia's Great Sandy Region is of international significance containing two World Heritage areas and patches of rainforest growing on white sand. Previous broad-scale analysis found the Great Sandy biogeographic subregion contained a significantly more phylogenetically even subset of species than expected by chance contrasting with rainforest on white sand in Peru. This study aimed to test the patterns of rainforest diversity and relatedness at a finer scale and to investigate why we may find different patterns of phylogenetic evenness compared with rainforests on white sands in other parts of the world. This study focussed on rainforest sites within the Great Sandy and surrounding areas in South East Queensland (SEQ, Australia. We undertook field collections, expanded our three-marker DNA barcode library of SEQ rainforest plants and updated the phylogeny to 95% of the SEQ rainforest flora. We sampled species composition of rainforest in fixed area plots from 100 sites. We calculated phylogenetic diversity (PD measures as well as species richness (SR for each rainforest community. These combined with site variables such as geology, were used to evaluate patterns and relatedness. We found that many rainforest communities in the Great Sandy area were significantly phylogenetically even at the individual site level consistent with a broader subregion analysis. Sites from adjacent areas were either not significant or were significantly phylogenetically clustered. Some results in the neighbouring areas were consistent with historic range expansions. In contrast with expectations, sites located on the oldest substrates had significantly lower phylogenetic diversity (PD. Fraser Island was once connected to mainland Australia, our results are consistent with a region geologically old enough to have continuously supported rainforest in refugia. The interface of tropical and temperate floras in part also explains the significant phylogenetic evenness
Directory of Open Access Journals (Sweden)
Bráulio A Santos
Full Text Available Deforestation and forest fragmentation are known major causes of nonrandom extinction, but there is no information about their impact on the phylogenetic diversity of the remaining species assemblages. Using a large vegetation dataset from an old hyper-fragmented landscape in the Brazilian Atlantic rainforest we assess whether the local extirpation of tree species and functional impoverishment of tree assemblages reduce the phylogenetic diversity of the remaining tree assemblages. We detected a significant loss of tree phylogenetic diversity in forest edges, but not in core areas of small (<80 ha forest fragments. This was attributed to a reduction of 11% in the average phylogenetic distance between any two randomly chosen individuals from forest edges; an increase of 17% in the average phylogenetic distance to closest non-conspecific relative for each individual in forest edges; and to the potential manifestation of late edge effects in the core areas of small forest remnants. We found no evidence supporting fragmentation-induced phylogenetic clustering or evenness. This could be explained by the low phylogenetic conservatism of key life-history traits corresponding to vulnerable species. Edge effects must be reduced to effectively protect tree phylogenetic diversity in the severely fragmented Brazilian Atlantic forest.
Directory of Open Access Journals (Sweden)
Mark A. Genung
2014-03-01
Full Text Available The relationship between biodiversity and ecosystem function has received a great deal of attention in ecological research and recent results, from re-analyses, suggest that ecosystem function improves with increases in phylogenetic diversity. However, many of these results have been generalized across a range of different species and clades, and plants with different evolutionary histories could display different relationships between biodiversity and ecosystem function. To experimentally test this hypothesis, we manipulated species richness and phylogenetic diversity using 26 species from two subgenera of the genus Eucalyptus (subgenus Eucalyptus and subgenus Symphyomyrtus. We found that plant biomass (a measurement of ecosystem function sometimes, but not always, responded to increases in species richness and phylogenetic diversity. Specifically, Symphyomyrtus plants showed a positive response while no comparable effect was observed for Eucalyptus plants, showing that responses to biodiversity can vary across different phylogenetic groups. Our results show that the impacts of evolutionary history may complicate the relationship between the diversity of plant communities and plant biomass.
Directory of Open Access Journals (Sweden)
Guoying Dong
Full Text Available H9N2 influenza A viruses have become established worldwide in terrestrial poultry and wild birds, and are occasionally transmitted to mammals including humans and pigs. To comprehensively elucidate the genetic and evolutionary characteristics of H9N2 influenza viruses, we performed a large-scale sequence analysis of 571 viral genomes from the NCBI Influenza Virus Resource Database, representing the spectrum of H9N2 influenza viruses isolated from 1966 to 2009. Our study provides a panoramic framework for better understanding the genesis and evolution of H9N2 influenza viruses, and for describing the history of H9N2 viruses circulating in diverse hosts. Panorama phylogenetic analysis of the eight viral gene segments revealed the complexity and diversity of H9N2 influenza viruses. The 571 H9N2 viral genomes were classified into 74 separate lineages, which had marked host and geographical differences in phylogeny. Panorama genotypical analysis also revealed that H9N2 viruses include at least 98 genotypes, which were further divided according to their HA lineages into seven series (A-G. Phylogenetic analysis of the internal genes showed that H9N2 viruses are closely related to H3, H4, H5, H7, H10, and H14 subtype influenza viruses. Our results indicate that H9N2 viruses have undergone extensive reassortments to generate multiple reassortants and genotypes, suggesting that the continued circulation of multiple genotypical H9N2 viruses throughout the world in diverse hosts has the potential to cause future influenza outbreaks in poultry and epidemics in humans. We propose a nomenclature system for identifying and unifying all lineages and genotypes of H9N2 influenza viruses in order to facilitate international communication on the evolution, ecology and epidemiology of H9N2 influenza viruses.
Miyake, Sou
2016-03-14
Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments
Miyake, Sou; Ngugi, David K.; Stingl, Ulrich
2016-01-01
Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments
Miyake, Sou; Ngugi, David; Stingl, Ulrich
2016-01-01
Epulopiscium is a group of giant bacteria found in high abundance in intestinal tracts of herbivorous surgeonfish. Despite their peculiarly large cell size (can be up to 600 μm), extreme polyploidy (some with over 100,000 genome copies per cell) and viviparity (whereby mother cells produce live offspring), details about their diversity, distribution or their role in the host gut are lacking. Previous studies have highlighted the existence of morphologically distinct Epulopiscium cell types (defined as morphotypes A to J) in some surgeonfish genera, but the corresponding genetic diversity and distribution among other surgeonfishes remain mostly unknown. Therefore, we investigated the phylogenetic diversity of Epulopiscium, distribution and co-occurrence in multiple hosts. Here, we identified eleven new phylogenetic clades, six of which were also morphologically characterized. Three of these novel clades were phylogenetically and morphologically similar to cigar-shaped type A1 cells, found in a wide range of surgeonfishes including Acanthurus nigrofuscus, while three were similar to smaller, rod-shaped type E that has not been phylogenetically classified thus far. Our results also confirmed that biogeography appears to have relatively little influence on Epulopiscium diversity, as clades found in the Great Barrier Reef and Hawaii were also recovered from the Red Sea. Although multiple symbiont clades inhabited a given species of host surgeonfish and multiple host species possessed a given symbiont clade, statistical analysis of host and symbiont phylogenies indicated significant cophylogeny, which in turn suggests co-evolutionary relationships. A cluster analysis of Epulopiscium sequences from previously published amplicon sequencing dataset revealed a similar pattern, where specific clades were consistently found in high abundance amongst closely related surgeonfishes. Differences in abundance may indicate specialization of clades to certain gut environments
Jami, Mansooreh; Ghanbari, Mahdi; Kneifel, Wolfgang; Domig, Konrad J
2015-06-01
The diversity of Actinobacteria isolated from the gut microbiota of two freshwater fish species namely Schizothorax zarudnyi and Schizocypris altidorsalis was investigated employing classical cultivation techniques, repetitive sequence-based PCR (rep-PCR), partial and full 16S rDNA sequencing followed by phylogenetic analysis. A total of 277 isolates were cultured by applying three different agar media. Based on rep-PCR profile analysis a subset of 33 strains was selected for further phylogenetic investigations, antimicrobial activity testing and diversity analysis of secondary-metabolite biosynthetic genes. The identification based on 16S rRNA gene sequencing revealed that the isolates belong to eight genera distributed among six families. At the family level, 72% of the 277 isolates belong to the family Streptomycetaceae. Among the non-streptomycetes group, the most dominant group could be allocated to the family of Pseudonocardiaceae followed by the members of Micromonosporaceae. Phylogenetic analysis clearly showed that many of the isolates in the genera Streptomyces, Saccharomonospora, Micromonospora, Nocardiopsis, Arthrobacter, Kocuria, Microbacterium and Agromyces formed a single and distinct cluster with the type strains. Notably, there is no report so far about the occurrence of these Actinobacteria in the microbiota of freshwater fish. Of the 33 isolates, all the strains exhibited antibacterial activity against a set of tested human and fish pathogenic bacteria. Then, to study their associated potential capacity to synthesize diverse bioactive natural products, diversity of genes associated with secondary-metabolite biosynthesis including PKS I, PKS II, NRPS, the enzyme PhzE of the phenazine pathways, the enzyme dTGD of 6-deoxyhexoses glycosylation pathway, the enzyme Halo of halogenation pathway and the enzyme CYP in polyene polyketide biosynthesis were investigated among the isolates. All the strains possess at least two types of the investigated
Phylogenetic diversity and relationships among species of genus ...
African Journals Online (AJOL)
Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...
Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding
Directory of Open Access Journals (Sweden)
Jehan
2017-11-01
Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.
Cao, Huiluo; Hong, Yiguo; Li, Meng; Gu, Ji-Dong
2011-11-01
The phylogenetic diversity of ammonia-oxidizing archaea (AOA) was surveyed in the surface sediments from the northern part of the South China Sea (SCS). The distribution pattern of AOA in the western Pacific was discussed through comparing the SCS with other areas in the western Pacific including Changjiang Estuary and the adjacent East China Sea where high input of anthropogenic nitrogen was evident, the tropical West Pacific Continental Margins close to the Philippines, the deep-sea methane seep sediments in the Okhotsk Sea, the cold deep sea of Northeastern Japan Sea, and the hydrothermal field in the Southern Okinawa Trough. These various environments provide a wide spectrum of physical and chemical conditions for a better understanding of the distribution pattern and diversities of AOA in the western Pacific. Under these different conditions, the distinct community composition between shallow and deep-sea sediments was clearly delineated based on the UniFrac PCoA and Jackknife Environmental Cluster analyses. Phylogenetic analyses showed that a few ammonia-oxidizing archaeal subclades in the marine water column/sediment clade and endemic lineages were indicative phylotypes for some environments. Higher phylogenetic diversity was observed in the Philippines while lower diversity in the hydrothermal vent habitat. Water depth and possibly with other environmental factors could be the main driving forces to shape the phylogenetic diversity of AOA observed, not only in the SCS but also in the whole western Pacific. The multivariate regression tree analysis also supported this observation consistently. Moreover, the functions of current and other climate factors were also discussed in comparison of phylogenetic diversity. The information collectively provides important insights into the ecophysiological requirements of uncultured ammonia-oxidizing archaeal lineages in the western Pacific Ocean.
Guevara, J.E.; Pitman, N.C.A.; ter Steege, H.; Mogollón, H.; Ceron, C.; Palacios, W.; Oleas, N.; Fine, P.V.A.
2017-01-01
Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the
PhyloSift: phylogenetic analysis of genomes and metagenomes.
Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A
2014-01-01
Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).
PhyloSift: phylogenetic analysis of genomes and metagenomes
Directory of Open Access Journals (Sweden)
Aaron E. Darling
2014-01-01
Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.
Using tree diversity to compare phylogenetic heuristics.
Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L
2009-04-29
Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.
Phylogenetic analysis of anemone fishes of the Persian Gulf using ...
African Journals Online (AJOL)
STORAGESEVER
2008-06-17
Jun 17, 2008 ... genetic diversity among samples was investigated by phylogenetic analysis. Results show that there is ... more about the living organisms found in this region. Many marine ... Kish (modified from Pous et al., 2004). Table 2.
Jing, Hongmei; Lacap, Donnabella C; Lau, Chui Yim; Pointing, Stephen B
2006-04-01
The 16S rRNA gene-defined bacterial diversity of tropical intertidal geothermal vents subject to varying degrees of seawater inundation was investigated. Shannon-Weaver diversity estimates of clone library-derived sequences revealed that the hottest pools located above the mean high-water mark that did not experience seawater inundation were most diverse, followed by those that were permanently submerged below the mean low-water mark. Pools located in the intertidal were the least biodiverse, and this is attributed to the fluctuating conditions caused by periodic seawater inundation rather than physicochemical conditions per se. Phylogenetic analysis revealed that a ubiquitous Oscillatoria-like phylotype accounted for 83% of clones. Synechococcus-like phylotypes were also encountered at each location, whilst others belonging to the Chroococcales, Oscillatoriales, and other non-phototrophic bacteria occurred only at specific locations along the gradient. All cyanobacterial phylotypes displayed highest phylogenetic affinity to terrestrial thermophilic counterparts rather than marine taxa.
Directory of Open Access Journals (Sweden)
Hannah L. Buckley
2014-09-01
Full Text Available The role of species’ interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran’s eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners’ genetic variation. Different lichen taxa showed some variation in
Buckley, Hannah L; Rafat, Arash; Ridden, Johnathon D; Cruickshank, Robert H; Ridgway, Hayley J; Paterson, Adrian M
2014-01-01
The role of species' interactions in structuring biological communities remains unclear. Mutualistic symbioses, involving close positive interactions between two distinct organismal lineages, provide an excellent means to explore the roles of both evolutionary and ecological processes in determining how positive interactions affect community structure. In this study, we investigate patterns of co-diversification between fungi and algae for a range of New Zealand lichens at the community, genus, and species levels and explore explanations for possible patterns related to spatial scale and pattern, taxonomic diversity of the lichens considered, and the level sampling replication. We assembled six independent datasets to compare patterns in phylogenetic congruence with varied spatial extent of sampling, taxonomic diversity and level of specimen replication. For each dataset, we used the DNA sequences from the ITS regions of both the fungal and algal genomes from lichen specimens to produce genetic distance matrices. Phylogenetic congruence between fungi and algae was quantified using distance-based redundancy analysis and we used geographic distance matrices in Moran's eigenvector mapping and variance partitioning to evaluate the effects of spatial variation on the quantification of phylogenetic congruence. Phylogenetic congruence was highly significant for all datasets and a large proportion of variance in both algal and fungal genetic distances was explained by partner genetic variation. Spatial variables, primarily at large and intermediate scales, were also important for explaining genetic diversity patterns in all datasets. Interestingly, spatial structuring was stronger for fungal than algal genetic variation. As the spatial extent of the samples increased, so too did the proportion of explained variation that was shared between the spatial variables and the partners' genetic variation. Different lichen taxa showed some variation in their phylogenetic congruence
Xu, Wumei; Ci, Xiuqin; Song, Caiyun; He, Tianhua; Zhang, Wenfu; Li, Qiaoming; Li, Jie
2016-12-01
The niche theory predicts that environmental heterogeneity and species diversity are positively correlated in tropical forests, whereas the neutral theory suggests that stochastic processes are more important in determining species diversity. This study sought to investigate the effects of soil nutrient (nitrogen and phosphorus) heterogeneity on tree species diversity in the Xishuangbanna tropical seasonal rainforest in southwestern China. Thirty-nine plots of 400 m 2 (20 × 20 m) were randomly located in the Xishuangbanna tropical seasonal rainforest. Within each plot, soil nutrient (nitrogen and phosphorus) availability and heterogeneity, tree species diversity, and community phylogenetic structure were measured. Soil phosphorus heterogeneity and tree species diversity in each plot were positively correlated, while phosphorus availability and tree species diversity were not. The trees in plots with low soil phosphorus heterogeneity were phylogenetically overdispersed, while the phylogenetic structure of trees within the plots became clustered as heterogeneity increased. Neither nitrogen availability nor its heterogeneity was correlated to tree species diversity or the phylogenetic structure of trees within the plots. The interspecific competition in the forest plots with low soil phosphorus heterogeneity could lead to an overdispersed community. However, as heterogeneity increase, more closely related species may be able to coexist together and lead to a clustered community. Our results indicate that soil phosphorus heterogeneity significantly affects tree diversity in the Xishuangbanna tropical seasonal rainforest, suggesting that deterministic processes are dominant in this tropical forest assembly.
The mean and variance of phylogenetic diversity under rarefaction
Nipperess, David A.; Matsen, Frederick A.
2013-01-01
Phylogenetic diversity (PD) depends on sampling intensity, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD. We have derived exact formulae for t...
Genetic Diversity and Phylogenetic Evolution of Tibetan Sheep Based on mtDNA D-Loop Sequences.
Directory of Open Access Journals (Sweden)
Jianbin Liu
Full Text Available The molecular and population genetic evidence of the phylogenetic status of the Tibetan sheep (Ovis aries is not well understood, and little is known about this species' genetic diversity. This knowledge gap is partly due to the difficulty of sample collection. This is the first work to address this question. Here, the genetic diversity and phylogenetic relationship of 636 individual Tibetan sheep from fifteen populations were assessed using 642 complete sequences of the mitochondrial DNA D-loop. Samples were collected from the Qinghai-Tibetan Plateau area in China, and reference data were obtained from the six reference breed sequences available in GenBank. The length of the sequences varied considerably, between 1031 and 1259 bp. The haplotype diversity and nucleotide diversity were 0.992±0.010 and 0.019±0.001, respectively. The average number of nucleotide differences was 19.635. The mean nucleotide composition of the 350 haplotypes was 32.961% A, 29.708% T, 22.892% C, 14.439% G, 62.669% A+T, and 37.331% G+C. Phylogenetic analysis showed that all four previously defined haplogroups (A, B, C, and D were found in the 636 individuals of the fifteen Tibetan sheep populations but that only the D haplogroup was found in Linzhou sheep. Further, the clustering analysis divided the fifteen Tibetan sheep populations into at least two clusters. The estimation of the demographic parameters from the mismatch analyses showed that haplogroups A, B, and C had at least one demographic expansion in Tibetan sheep. These results contribute to the knowledge of Tibetan sheep populations and will help inform future conservation programs about the Tibetan sheep native to the Qinghai-Tibetan Plateau.
Li, Rong; Kraft, Nathan J B; Yu, Haiying; Li, Heng
2015-12-01
One of the main goals of conservation biology is to understand the factors shaping variation in biodiversity across the planet. This understanding is critical for conservation planners to be able to develop effective conservation strategies. Although many studies have focused on species richness and the protection of rare and endemic species, less attention has been paid to the protection of the phylogenetic dimension of biodiversity. We explored how phylogenetic diversity, species richness, and phylogenetic community structure vary in seed plant communities along an elevational gradient in a relatively understudied high mountain region, the Dulong Valley, in southeastern Tibet, China. As expected, phylogenetic diversity was well correlated with species richness among the elevational bands and among communities. At the community level, evergreen broad-leaved forests had the highest levels of species richness and phylogenetic diversity. Using null model analyses, we found evidence of nonrandom phylogenetic structure across the region. Evergreen broad-leaved forests were phylogenetically overdispersed, whereas other vegetation types tended to be phylogenetically clustered. We suggest that communities with high species richness or overdispersed phylogenetic structure should be a focus for biodiversity conservation within the Dulong Valley because these areas may help maximize the potential of this flora to respond to future global change. In biodiversity hotspots worldwide, we suggest that the phylogenetic structure of a community may serve as a useful measure of phylogenetic diversity in the context of conservation planning. © 2015 Society for Conservation Biology.
Kuhar, U; Malovrh, T
2016-03-01
The equine infectious anaemia virus (EIAV), which belongs to the Retroviridae family, infects equids almost worldwide. Every year, sporadic EIAV cases are detected in Slovenia. To characterise the Slovenian EIAV strains in the p15 gag gene region phylogenetically in order to compare the Slovenian EIAV strains with EIAV strains from abroad, especially with the recently published European strains. Cross-sectional study using material derived from post mortem examination. In total, 29 EIAV serologically positive horses from 18 different farms were examined in this study. Primers were designed to amplify the p15 gag gene region. Amplicons of 28 PCRs were subjected to direct DNA sequencing and phylogenetic analysis. Altogether, 28 EIAV sequences were obtained from 17 different farms and were distributed between 4 separate monophyletic groups and 9 branches upon phylogenetic analysis. Among EIAV strains from abroad, the closest relatives to Slovenian EIAV strains were European EIAV strains from Italy. Phylogenetic analysis also showed that some animals from distantly located farms were most probably infected with the same EIAV strains, as well as animals from the same farm and animals from farms located in the same geographical region. This is the first report of such high genetic diversity of EIAV strains from one country. This led to speculation that there is a potential virus reservoir among the populations of riding horses, horses kept for pleasure and horses for meat production, with some farmers or horse-owners not following legislation, thus enabling the spread of infection with EIAV. The low sensitivity of the agar gel immunodiffusion test may also contribute to the spread of infection with EIAV, because some infected horses might have escaped detection. The results of the phylogenetic analysis also provide additional knowledge about the highly heterogeneous nature of the EIAV genome. © 2015 EVJ Ltd.
Wang, Jiay; Yang, Xianyong; Wang, Yuge; Jing, Zhihong; Meng, Kai; Liu, Jianzhu; Guo, Huijun; Xu, Ruixue; Cheng, Ziqiang
2014-01-01
Theileria annulata, which is part of the Theileria sergenti/Theileria buffeli/Theileria orientalis group, preferentially infects cattle and results in high mortality and morbidity in the Mediterranean, Middle East, and Central Asia. The polypeptide Tams1 is an immunodominant major merozoite piroplasm surface antigen of T. annulata that could be used as a marker for epidemiological studies and phylogenetic analysis. In the present study, a total of 155 Tams1 sequences were investigated for genetic diversity and phylogenetic relationships through phylogenetic analysis. Results showed that the Tams1 sequences were divided into two major groups and that distribution for some isolates also exhibited geographic specificity. As targeting polymorphic genes for parasite detection may result in underestimation of infection, polymerase chain reaction (PCR) assay using two different probes targeting tams-1 genes of these two groups can be more credible. In addition, the direction of the spread of the disease was discovered to be from the Mediterranean or the tropical zone to the Eurasian peninsula, Middle East, Southern Asia, and Africa, particularly for Group 2. A similar occurrence was also found between the Ms1 gene of Theileria lestoquardi and the Tams1 gene of T. annulata, which explains cross-immunogenicity to a certain extent. However, no potential glycosylation site in the Tams1 of T. annulata was found in this study, which illustrated that instead of N-glycosylation, other modifications have more significant effects on the immunogenicity of the Tams1 protein.
High phylogenetic diversity is preserved in species-poor high-elevation temperate moth assemblages
Zou, Yi; Sang, Weiguo; Hausmann, Axel; Axmacher, Jan Christoph
2016-01-01
Understanding the diversity and composition of species assemblages and identifying underlying biotic and abiotic determinants represent great ecological challenges. Addressing some of these issues, we investigated the α-diversity and phylogenetic composition of species-rich geometrid moth
Boras, Julia A.; Vaqué, Dolors; Maynou, Francesc; Sà, Elisabet L.; Weinbauer, Markus G.; Sala, Maria Montserrat
2015-03-01
To evaluate the main factors shaping bacterioplankton phylogenetic and functional diversity in marine coastal waters, we carried out a two-year study based on a monthly sampling in Blanes Bay (NW Mediterranean). We expected the key factors driving bacterial diversity to be (1) temperature and nutrient concentration, together with chlorophyll a concentration as an indicator of phytoplankton biomass and, hence, a carbon source for bacteria (here called bottom-up factors), and (2) top-down pressure (virus- and protist-mediated mortality of bacteria). Phylogenetic diversity was analyzed by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA. Functional diversity was assessed by using monomeric carbon sources in Biolog EcoPlates and by determining the activity of six extracellular enzymes. Our results indicate that the bacterial phylogenetic and functional diversity in this coastal system is shaped mainly by bottom-up factors. A dendrogram analysis of the DGGE banding patterns revealed three main sample clusters. Two clusters differed significantly in temperature, nitrate and chlorophyll a concentration, and the third was characterized by the highest losses of bacterial production due to viral lysis detected over the whole study period. Protistan grazing had no effect on bacterial functional diversity, since there were no correlations between protist-mediated mortality (PMM) and extracellular enzyme activities, and utilization of only two out of the 31 carbon sources (N-acetyl-D-glucosamine and α-cyclodextrin) was correlated with PMM. In contrast, virus-mediated mortality correlated with changes in the percentage of use of four carbon sources, and also with specific leu-aminopeptidase and β-glucosidase activity. This suggests that viral lysate provides a pool of labile carbon sources, presumably including amino acids and glucose, which may inhibit proteolytic and glucosidic activity. Our results indicate that bottom-up factors play a more important role than
Phylogenetic analysis of fungal ABC transporters.
Kovalchuk, Andriy; Driessen, Arnold J M
2010-03-16
The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.
Marko Gomez-Hernandez; Guadalupe Williams-Linera; D. Jean Lodge; Roger Guevara; Eduardo Ruiz-Sanchez; Etelvina Gandara
2016-01-01
Phylogenetic information provides insight into the ecological and evolutionary processes that organize species assemblages. We compared patterns of phylogenetic diversity among macromycete and woody plant communities along a steep elevational gradient in eastern Mexico to better understand the evolutionary processes that structure their communities. Macrofungi and...
Kalyzhnaya, O V; Itskovich, V B
2014-07-01
The diversity of bacteria associated with deep-water sponge Baikalospongia intermedia was evaluated by sequence analysis of 16S rRNA genes from two sponge samples collected in Lake Baikal from depths of 550 and 1204 m. A total of 64 operational taxonomic units, belonging to nine bacterial phyla, Proteobacteria (classes Alphaproteobacteria,. Betaproteobacteria, Gammaproteobacteria, and Deltaproteobacteria), Actinobacteria, Planctomycetes, Cloroflexi, Verrucomicrobia, Acidobacteria, Chlorobi, and Nitrospirae, including candidate phylum WS5, were identified. Phylogenetic analysis showed that the examined communities contained phylotypes exhibiting homology to uncultured bacteria from different lake ecosystems, freshwater sediments, soil and geological formations. Moreover, a number of phylotypes were relative to psychrophilic, methane-oxidizing, sulfate-reducing bacteria, and to microorganisms resistant to the influence of heavy metals. It seems likely that the unusual habitation conditions of deep-water sponges contribute to the taxonomic diversity of associated bacteria and have an influence on the presence of functionally important microorganisms in bacterial communities.
Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito
2003-01-01
A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.
Chun, Jung-Hwa; Lee, Chang-Bae
2018-02-12
Species-centric approaches to biodiversity in ecological research are limited in their ability to reflect the evolutionary history and functional diversity of community assembly. Recently, the introduction of alternative facets of biodiversity, such as phylogenetic and functional diversity, has shed light on this problem and improved our understanding of the processes underlying biodiversity patterns. Here, we investigated the phylogenetic and functional diversity patterns of α, β and γ components in woody plant assemblages along regional and local elevational gradients in South Korea. Although the patterns of phylogenetic and functional diversity varied along regional and local elevational transects, the main drivers were partitioned into two categories: regional area or climate for phylogenetic diversity, depending on whether the transect was at a regional or local scale; and habitat heterogeneity for functional diversity, which was derived in elevational bands. Moreover, environmental distance was more important than was geographic distance for phylogenetic and functional β diversity between paired elevational bands. These results support the hypothesis that niche-based deterministic processes such as environmental filtering and competitive exclusion are fundamental in structuring woody plant assemblages along temperate elevational gradients regardless of scale (regional vs. local) in our study areas.
Phylogenetic diversity of bacteria associated with toxic and non-toxic ...
African Journals Online (AJOL)
Phylogenetic diversity of bacteria associated with toxic and non-toxic strains of Alexandrium minutum. L Palacios, B Reguera, J Franco, I Marín. Abstract. Marine planktonic dinoflagellates are usually associated with bacteria, some of which seem to have a symbiotic relation with the dinoflagellate cells. The role of bacteria in ...
Monier, Adam; Worden, Alexandra Z; Richards, Thomas A
2016-08-01
High-throughput diversity amplicon sequencing of marine microbial samples has revealed that members of the Mamiellophyceae lineage are successful phytoplankton in many oceanic habitats. Indeed, these eukaryotic green algae can dominate the picoplanktonic biomass, however, given the broad expanses of the oceans, their geographical distributions and the phylogenetic diversity of some groups remain poorly characterized. As these algae play a foundational role in marine food webs, it is crucial to assess their global distribution in order to better predict potential changes in abundance and community structure. To this end, we analyzed the V9-18S small subunit rDNA sequences deposited from the Tara Oceans expedition to evaluate the diversity and biogeography of these phytoplankton. Our results show that the phylogenetic composition of Mamiellophyceae communities is in part determined by geographical provenance, and do not appear to be influenced - in the samples recovered - by water depth, at least at the resolution possible with the V9-18S. Phylogenetic classification of Mamiellophyceae sequences revealed that the Dolichomastigales order encompasses more sequence diversity than other orders in this lineage. These results indicate that a large fraction of the Mamiellophyceae diversity has been hitherto overlooked, likely because of a combination of size fraction, sequencing and geographical limitations. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Phylogenetic and recombination analysis of tomato spotted wilt virus.
Directory of Open Access Journals (Sweden)
Sen Lian
Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.
Decoupling phylogenetic and functional diversity to reveal hidden signals in community assembly
Czech Academy of Sciences Publication Activity Database
de Bello, Francesco; Šmilauer, P.; Diniz-Filho, J. A. F.; Carmona, C. P.; Lososová, Z.; Herben, Tomáš; Götzenberger, Lars
2017-01-01
Roč. 8, č. 10 (2017), s. 1200-1211 ISSN 2041-210X R&D Projects: GA ČR(CZ) GA16-15012S; GA ČR GB14-36079G EU Projects: European Commission(XE) 267243 Institutional support: RVO:67985939 Keywords : community ecology * phylogenetic diversity * functional diversity Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 5.708, year: 2016
DEFF Research Database (Denmark)
Feng, Gang; Mi, Xiangcheng; Bøcher, Peder Klith
2014-01-01
their relative roles in determining woody plant phylogenetic and functional diversity in this important hotspot for woody plant diversity. Local disturbance was the best predictor of functional diversity as represented by maximum canopy height (Hmax), probably reflecting the dominant role of competition...... studied, their relative importance for other aspects of diversity, notably phylogenetic and functional diversity is so far little studied. Here, we link data from large Chinese forest plots to data on current and Last Glacial Maximum (LGM) climate as well as local disturbance regimes to study...
Čapková, Kateřina; Hauer, Tomáš; Řeháková, Klára; Doležal, Jiří
2016-01-01
The environment of high-altitudinal cold deserts of Western Himalaya is characterized by extensive development of biological soil crusts, with cyanobacteria as dominant component. The knowledge of their taxonomic composition and dependency on soil chemistry and elevation is still fragmentary. We studied the abundance and the phylogenetic diversity of the culturable cyanobacteria and eukaryotic microalgae in soil crusts along altitudinal gradients (4600-5900 m) at two sites in the dry mountains of Ladakh (SW Tibetan Plateau and Eastern Karakoram), using both microscopic and molecular approaches. The effects of environmental factors (altitude, mountain range, and soil physico-chemical parameters) on the composition and biovolume of phototrophs were tested by multivariate redundancy analysis and variance partitioning. Both phylogenetic diversity and composition of morphotypes were similar between Karakorum and Tibetan Plateau. Phylogenetic analysis of 16S rRNA gene revealed strains belonging to at least five genera. Besides clusters of common soil genera, e.g., Microcoleus, Nodosilinea, or Nostoc, two distinct clades of simple trichal taxa were newly discovered. The most abundant cyanobacterial orders were Oscillatoriales and Nostacales, whose biovolume increased with increasing elevation, while that of Chroococales decreased. Cyanobacterial species richness was low in that only 15 morphotypes were detected. The environmental factors accounted for 52 % of the total variability in microbial data, 38.7 % of which was explained solely by soil chemical properties, 14.5 % by altitude, and 8.4 % by mountain range. The elevation, soil phosphate, and magnesium were the most important predictors of soil phototrophic communities in both mountain ranges despite their different bedrocks and origin. The present investigation represents a first record on phylogenetic diversity of the cyanobacterial community of biological soil crusts from Western Himalayas and first record
Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.
Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian
2005-10-01
Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.
Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.
2004-01-01
We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.
Staggemeier, Vanessa Graziele; Diniz-Filho, José Alexandre Felizola; Forest, Félix; Lucas, Eve
2015-04-01
Myrcia section Aulomyrcia includes ∼120 species that are endemic to the Neotropics and disjunctly distributed in the moist Amazon and Atlantic coastal forests of Brazil. This paper presents the first comprehensive phylogenetic study of this group and this phylogeny is used as a basis to evaluate recent classification systems and to test alternative hypotheses associated with the history of this clade. Fifty-three taxa were sampled out of the 120 species currently recognized, plus 40 outgroup taxa, for one nuclear marker (ribosomal internal transcribed spacer) and four plastid markers (psbA-trnH, trnL-trnF, trnQ-rpS16 and ndhF). The relationships were reconstructed based on Bayesian and maximum likelihood analyses. Additionally, a likelihood approach, 'geographic state speciation and extinction', was used to estimate region- dependent rates of speciation, extinction and dispersal, comparing historically climatic stable areas (refugia) and unstable areas. Maximum likelihood and Bayesian inferences indicate that Myrcia and Marlierea are polyphyletic, and the internal groupings recovered are characterized by combinations of morphological characters. Phylogenetic relationships support a link between Amazonian and north-eastern species and between north-eastern and south-eastern species. Lower extinction rates within glacial refugia suggest that these areas were important in maintaining diversity in the Atlantic forest biodiversity hotspot. This study provides a robust phylogenetic framework to address important ecological questions for Myrcia s.l. within an evolutionary context, and supports the need to unite taxonomically the two traditional genera Myrcia and Marlierea in an expanded Myrcia s.l. Furthermore, this study offers valuable insights into the diversification of plant species in the highly impacted Atlantic forest of South America; evidence is presented that the lowest extinction rates are found inside refugia and that range expansion from unstable areas
Begley-Miller, Danielle R; Hipp, Andrew L; Brown, Bethany H; Hahn, Marlene; Rooney, Thomas P
2014-06-09
Community assembly entails a filtering process, where species found in a local community are those that can pass through environmental (abiotic) and biotic filters and successfully compete. Previous research has demonstrated the ability of white-tailed deer (Odocoileus virginianus) to reduce species diversity and favour browse-tolerant plant communities. In this study, we expand on our previous work by investigating deer as a possible biotic filter altering local plant community assembly. We used replicated 23-year-old deer exclosures to experimentally assess the effects of deer on species diversity (H'), richness (SR), phylogenetic community structure and phylogenetic diversity in paired browsed (control) and unbrowsed (exclosed) plots. Additionally, we developed a deer-browsing susceptibility index (DBSI) to assess the vulnerability of local species to deer. Deer browsing caused a 12 % reduction in H' and 17 % reduction in SR, consistent with previous studies. Furthermore, browsing reduced phylogenetic diversity by 63 %, causing significant phylogenetic clustering. Overall, graminoids were the least vulnerable to deer browsing based on DBSI calculations. These findings demonstrate that deer are a significant driver of plant community assembly due to their role as a selective browser, or more generally, as a biotic filter. This study highlights the importance of knowledge about the plant tree of life in assessing the effects of biotic filters on plant communities. Application of such knowledge has considerable potential to advance our understanding of plant community assembly. Published by Oxford University Press on behalf of the Annals of Botany Company.
Phylogenetic Analysis Using Protein Mass Spectrometry.
Ma, Shiyong; Downard, Kevin M; Wong, Jason W H
2017-01-01
Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.
Choi, Seon Young; Rashed, Shah M; Hasan, Nur A; Alam, Munirul; Islam, Tarequl; Sadique, Abdus; Johura, Fatema-Tuz; Eppinger, Mark; Ravel, Jacques; Huq, Anwar; Cravioto, Alejandro; Colwell, Rita R
2016-03-15
An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997). Nontoxigenic (CTX(-)) V. cholerae El Tor dominated toxigenic (CTX(+)) strains (2001 to 2003), but V. cholerae CTX(+) variant El Tor was isolated during 2004 to 2008, outcompeting CTX(-) V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX(+) El Tor, two were CTX(-) El Tor, and the remaining strain was a CTX(+) classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX(-) isolate is ancestral to the 6th and 7th pandemic CTX(+) V. cholerae isolates. The other CTX(-) isolate joined with CTX(-) non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX(+) isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX(+) El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II) are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX(+) El Tor isolate contained West African-South American (WASA) recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs) and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity. Sequencing of genomes of V. cholerae is critical if genetic changes occurring over time in the circulating population of an area of endemicity are to be understood. Although cholera outbreaks occurred rarely
DEFF Research Database (Denmark)
Eiserhardt, Wolf L.; Borchsenius, Finn; Sandel, Brody Steven
-environmental models are important elements in this framework. Here, we integrate both types of data in order to explore the determinants of forest tree diversity using the conifers as a model group. Conifers are an old, diverse (ca. 650 spp. in 6 families) and widespread group of woody plants of high ecological...... and economic importance. They are better studied than most other globally distributed groups of forest trees, allowing integrative studies with high phylogenetic and spatial resolution. We analyse phylogenetic diversity, assemblage structure, and diversification rates for regional conifer assemblages...
Zhang, Zhenjia; Wang, Deya; Yu, Chengming; Wang, Zenghui; Dong, Jiahong; Shi, Kerong; Yuan, Xuefeng
2016-01-14
Destructive diseases caused by Tomato spotted wilt virus (TSWV) have been reported associated with many important plants worldwide. Recently, TSWV was reported to infect different hosts in China. It is of value to clone TSWV isolates from different hosts and examine diversity and evolution among different TSWV isolates in China as well as worldwide. RT-PCR was used to clone the full-length genome (L, M and S segments) of three new isolates of TSWV that infected different hosts (tobacco, red pepper and green pepper) in China. Identity of nucleotide and amino acid sequences among TSWV isolates were analyzed by DNAMAN. MEGA 5.0 was used to construct phylogenetic trees. RDP4 was used to detect recombination events during evolution of these isolates. Whole-genome sequences of three new TSWV isolates in China were determined. Together with other available isolates, 29 RNA L, 62 RNA M and 66 RNA S of TSWV isolates were analyzed for molecular diversity, phylogenetic and recombination events. This analysis revealed that the entire TSWV genome, especially the M and S RNAs, had major variations in genomic size that mainly involve the A-U rich intergenic region (IGR). Phylogenetic analyses on TSWV isolates worldwide revealed evidence for frequent reassortments in the evolution of tripartite negative-sense RNA genome. Significant numbers of recombination events with apparent 5' regional preference were detected among TSWV isolates worldwide. Moreover, TSWV isolates with similar recombination events usually had closer relationships in phylogenetic trees. All five Chinese TSWV isolates including three TSWV isolates of this study and previously reported two isolates can be divided into two groups with different origins based on molecular diversity and phylogenetic analysis. During their evolution, both reassortment and recombination played roles. These results suggest that recombination could be an important mechanism in the evolution of multipartite RNA viruses, even negative
Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D
2011-12-01
Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.
Potter, Kevin M; Woodall, Christopher W
2012-03-01
Changing climate conditions may impact the short-term ability of forest tree species to regenerate in many locations. In the longer term, tree species may be unable to persist in some locations while they become established in new places. Over both time frames, forest tree biodiversity may change in unexpected ways. Using repeated inventory measurements five years apart from more than 7000 forested plots in the eastern United States, we tested three hypotheses: phylogenetic diversity is substantially different from species richness as a measure of biodiversity; forest communities have undergone recent changes in phylogenetic diversity that differ by size class, region, and seed dispersal strategy; and these patterns are consistent with expected early effects of climate change. Specifically, the magnitude of diversity change across broad regions should be greater among seedlings than in trees, should be associated with latitude and elevation, and should be greater among species with high dispersal capacity. Our analyses demonstrated that phylogenetic diversity and species richness are decoupled at small and medium scales and are imperfectly associated at large scales. This suggests that it is appropriate to apply indicators of biodiversity change based on phylogenetic diversity, which account for evolutionary relationships among species and may better represent community functional diversity. Our results also detected broadscale patterns of forest biodiversity change that are consistent with expected early effects of climate change. First, the statistically significant increase over time in seedling diversity in the South suggests that conditions there have become more favorable for the reproduction and dispersal of a wider variety of species, whereas the significant decrease in northern seedling diversity indicates that northern conditions have become less favorable. Second, we found weak correlations between seedling diversity change and latitude in both zones
Tree phylogenetic diversity promotes host-parasitoid interactions.
Staab, Michael; Bruelheide, Helge; Durka, Walter; Michalski, Stefan; Purschke, Oliver; Zhu, Chao-Dong; Klein, Alexandra-Maria
2016-07-13
Evidence from grassland experiments suggests that a plant community's phylogenetic diversity (PD) is a strong predictor of ecosystem processes, even stronger than species richness per se This has, however, never been extended to species-rich forests and host-parasitoid interactions. We used cavity-nesting Hymenoptera and their parasitoids collected in a subtropical forest as a model system to test whether hosts, parasitoids, and their interactions are influenced by tree PD and a comprehensive set of environmental variables, including tree species richness. Parasitism rate and parasitoid abundance were positively correlated with tree PD. All variables describing parasitoids decreased with elevation, and were, except parasitism rate, dependent on host abundance. Quantitative descriptors of host-parasitoid networks were independent of the environment. Our study indicates that host-parasitoid interactions in species-rich forests are related to the PD of the tree community, which influences parasitism rates through parasitoid abundance. We show that effects of tree community PD are much stronger than effects of tree species richness, can cascade to high trophic levels, and promote trophic interactions. As during habitat modification phylogenetic information is usually lost non-randomly, even species-rich habitats may not be able to continuously provide the ecosystem process parasitism if the evolutionarily most distinct plant lineages vanish. © 2016 The Author(s).
Mondav, Rhiannon; McCalley, Carmody K; Hodgkins, Suzanne B; Frolking, Steve; Saleska, Scott R; Rich, Virginia I; Chanton, Jeff P; Crill, Patrick M
2017-08-01
Biogenic production and release of methane (CH 4 ) from thawing permafrost has the potential to be a strong source of radiative forcing. We investigated changes in the active layer microbial community of three sites representative of distinct permafrost thaw stages at a palsa mire in northern Sweden. The palsa site (intact permafrost and low radiative forcing signature) had a phylogenetically clustered community dominated by Acidobacteria and Proteobacteria. The bog (thawing permafrost and low radiative forcing signature) had lower alpha diversity and midrange phylogenetic clustering, characteristic of ecosystem disturbance affecting habitat filtering. Hydrogenotrophic methanogens and Acidobacteria dominated the bog shifting from palsa-like to fen-like at the waterline. The fen (no underlying permafrost, high radiative forcing signature) had the highest alpha, beta and phylogenetic diversity, was dominated by Proteobacteria and Euryarchaeota and was significantly enriched in methanogens. The Mire microbial network was modular with module cores consisting of clusters of Acidobacteria, Euryarchaeota or Xanthomonodales. Loss of underlying permafrost with associated hydrological shifts correlated to changes in microbial composition, alpha, beta and phylogenetic diversity associated with a higher radiative forcing signature. These results support the complex role of microbial interactions in mediating carbon budget changes and climate feedback in response to climate forcing. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Phylogenetic analysis of Tibetan mastiffs based on mitochondrial hypervariable region I.
Ren, Zhanjun; Chen, Huiling; Yang, Xuejiao; Zhang, Chengdong
2017-03-01
Recently, the number of Tibetan mastiffs, which is a precious germplasm resource and cultural heritage, is decreasing sharply. Therefore, the genetic diversity of Tibetan mastiffs needs to be studied to clarify its phylogenetics relationships and lay the foundation for resource protection, rational development and utilization of Tibetan mastiffs. We sequenced hypervariable region I of mitochondrial DNA (mtDNA) of 110 individuals from Tibet region and Gansu province. A total of 12 polymorphic sites were identified which defined eight haplotypes of which H4 and H8 were unique to Tibetan population with H8 being identified first. The haplotype diversity (Hd: 0.808), nucleotide diversity (Pi: 0.603%), the average number of nucleotide difference (K: 3.917) of Tibetan mastiffs from Gansu were higher than those from Tibet region (Hd: 0.794; Pi: 0.589%; K: 3.831), which revealed higher genetic diversity in Gansu. In terms of total population, the genetic variation was low. The median-joining network and phylogenetic tree based on the mtDNA hypervariable region I showed that Tibetan mastiffs originated from grey wolves, as the other domestic dogs and had different history of maternal origin. The mismatch distribution analysis and neutrality tests indicated that Tibetan mastiffs were in genetic equilibrium or in a population decline.
Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du
2015-11-01
The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Buckley, Thomas R; James, Sam; Allwood, Julia; Bartlam, Scott; Howitt, Robyn; Prada, Diana
2011-01-01
We have constructed the first ever phylogeny for the New Zealand earthworm fauna (Megascolecinae and Acanthodrilinae) including representatives from other major continental regions. Bayesian and maximum likelihood phylogenetic trees were constructed from 427 base pairs from the mitochondrial large subunit (16S) rRNA gene and 661 base pairs from the nuclear large subunit (28S) rRNA gene. Within the Acanthodrilinae we were able to identify a number of well-supported clades that were restricted to continental landmasses. Estimates of nodal support for these major clades were generally high, but relationships among clades were poorly resolved. The phylogenetic analyses revealed several independent lineages in New Zealand, some of which had a comparable phylogenetic depth to monophyletic groups sampled from Madagascar, Africa, North America and Australia. These results are consistent with at least some of these clades having inhabited New Zealand since rifting from Gondwana in the Late Cretaceous. Within the New Zealand Acanthodrilinae, major clades tended to be restricted to specific regions of New Zealand, with the central North Island and Cook Strait representing major biogeographic boundaries. Our field surveys of New Zealand and subsequent identification has also revealed extensive cryptic taxonomic diversity with approximately 48 new species sampled in addition to the 199 species recognized by previous authors. Our results indicate that further survey and taxonomic work is required to establish a foundation for future biogeographic and ecological research on this vitally important component of the New Zealand biota. Copyright © 2010 Elsevier Inc. All rights reserved.
Arnan, Xavier; Cerdá, Xim; Retana, Javier
2015-01-01
We analyze the relative contribution of environmental and spatial variables to the alpha and beta components of taxonomic (TD), phylogenetic (PD), and functional (FD) diversity in ant communities found along different climate and anthropogenic disturbance gradients across western and central Europe, in order to assess the mechanisms structuring ant biodiversity. To this aim we calculated alpha and beta TD, PD, and FD for 349 ant communities, which included a total of 155 ant species; we examined 10 functional traits and phylogenetic relatedness. Variation partitioning was used to examine how much variation in ant diversity was explained by environmental and spatial variables. Autocorrelation in diversity measures and each trait's phylogenetic signal were also analyzed. We found strong autocorrelation in diversity measures. Both environmental and spatial variables significantly contributed to variation in TD, PD, and FD at both alpha and beta scales; spatial structure had the larger influence. The different facets of diversity showed similar patterns along environmental gradients. Environment explained a much larger percentage of variation in FD than in TD or PD. All traits demonstrated strong phylogenetic signals. Our results indicate that environmental filtering and dispersal limitations structure all types of diversity in ant communities. Strong dispersal limitations appear to have led to clustering of TD, PD, and FD in western and central Europe, probably because different historical and evolutionary processes generated different pools of species. Remarkably, these three facets of diversity showed parallel patterns along environmental gradients. Trait-mediated species sorting and niche conservatism appear to structure ant diversity, as evidenced by the fact that more variation was explained for FD and that all traits had strong phylogenetic signals. Since environmental variables explained much more variation in FD than in PD, functional diversity should be a
Structure and phylogenetic diversity of post-fire ectomycorrhizal communities of maritime pine.
Rincón, A; Santamaría, B P; Ocaña, L; Verdú, M
2014-02-01
Environmental disturbances define the diversity and assemblage of species, affecting the functioning of ecosystems. Fire is a major disturbance of Mediterranean pine forests. Pines are highly dependent on the ectomycorrhizal (EM) fungal symbiosis, which is critical for tree recruitment under primary succession. To determine the effects of time since fire on the structure and recovery of EM fungal communities, we surveyed the young Pinus pinaster regenerate in three sites differing in the elapsed time after the last fire event. Pine roots were collected, and EM fungi characterized by sequencing the internal transcribed spacer (ITS) and the large subunit (LSU) regions of the nuclear ribosomal (nr)-DNA. The effects of the elapsed time after fire on the EM community structure (richness, presence/absence of fungi, phylogenetic diversity) and on soil properties were analysed.Fungal richness decreased with the elapsed time since the fire; although, the phylogenetic diversity of the EM community increased. Soil properties were different depending on the elapsed time after fire and particularly, the organic matter, carbon-to-nitrogen (C/N) ratio, nitrogen and iron significantly correlated with the assemblage of fungal species. Ascomycetes, particularly Tuberaceae and Pezizales, were significantly over-represented on saplings in the burned site. On seedlings, a significant over-representation of Rhizopogonaceae and Atheliaceae was observed in the most recently burned site, while other fungi (i.e. Cortinariaceae) were significantly under-represented. Our results are consistent with the hypothesis that fire can act as a selective agent by printing a phylogenetic signal on the EM fungal communities associated with naturally regenerated pines, pointing out to some groups as potential fire-adapted fungi.
De Palma, Adriana; Kuhlmann, Michael; Bugter, Rob; Ferrier, Simon; Hoskins, Andrew J; Potts, Simon G; Roberts, Stuart P M; Schweiger, Oliver; Purvis, Andy
2017-12-01
Agricultural intensification and urbanization are important drivers of biodiversity change in Europe. Different aspects of bee community diversity vary in their sensitivity to these pressures, as well as independently influencing ecosystem service provision (pollination). To obtain a more comprehensive understanding of human impacts on bee diversity across Europe, we assess multiple, complementary indices of diversity. One Thousand four hundred and forty six sites across Europe. We collated data on bee occurrence and abundance from the published literature and supplemented them with the PREDICTS database. Using Rao's Quadratic Entropy, we assessed how species, functional and phylogenetic diversity of 1,446 bee communities respond to land-use characteristics including land-use class, cropland intensity, human population density and distance to roads. We combined these models with statistically downscaled estimates of land use in 2005 to estimate and map-at a scale of approximately 1 km 2 -the losses in diversity relative to semi-natural/natural baseline (the predicted diversity of an uninhabited grid square, consisting only of semi-natural/natural vegetation). We show that-relative to the predicted local diversity in uninhabited semi-natural/natural habitat-half of all EU27 countries have lost over 10% of their average local species diversity and two-thirds of countries have lost over 5% of their average local functional and phylogenetic diversity. All diversity measures were generally lower in pasture and higher-intensity cropland than in semi-natural/natural vegetation, but facets of diversity showed less consistent responses to human population density. These differences have led to marked spatial mismatches in losses: losses in phylogenetic diversity were in some areas almost 20 percentage points (pp.) more severe than losses in species diversity, but in other areas losses were almost 40 pp. less severe. These results highlight the importance of exploring
Pagaling, Eulyn; Gatica, Joao; Yang, Kun; Cytryn, Eddie; Yan, Tao
2016-09-01
The aim of this study was to determine the phylogenetic diversity of ceftriaxone resistance and the presence of known extended-spectrum β-lactamase (ESBL) genes in culturable soil resistomes. Libraries of soil bacterial isolates resistant to ceftriaxone were established from six physicochemically diverse soils collected in Hawaii (USA) and Israel. The phylogenetic affiliation, ceftriaxone and multidrug resistance levels, and presence of known ESBL genes of the isolates were determined. The soil bacterial isolates were phylogenetically grouped with the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes and Bacteroidetes. Ceftriaxone minimum inhibitory concentrations (MICs) largely followed the phylogeny structure and higher levels of ceftriaxone resistance corresponded to higher multidrug resistance. Three distinct blaTEM variants were detected in soil bacterial isolates belonging to nine different genera. In conclusion, the culturable soil resistomes for ceftriaxone exhibited high phylogenetic diversity and multidrug resistance. blaTEM was the only known ESBL detected in the soil resistomes, and its distribution in different phylogenetic groups suggests its ubiquitous presence and/or possible horizontal gene transfer within the soil microbiomes. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T
2015-04-01
Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid
Estimating phylogenetic trees from genome-scale data.
Liu, Liang; Xi, Zhenxiang; Wu, Shaoyuan; Davis, Charles C; Edwards, Scott V
2015-12-01
The heterogeneity of signals in the genomes of diverse organisms poses challenges for traditional phylogenetic analysis. Phylogenetic methods known as "species tree" methods have been proposed to directly address one important source of gene tree heterogeneity, namely the incomplete lineage sorting that occurs when evolving lineages radiate rapidly, resulting in a diversity of gene trees from a single underlying species tree. Here we review theory and empirical examples that help clarify conflicts between species tree and concatenation methods, and misconceptions in the literature about the performance of species tree methods. Considering concatenation as a special case of the multispecies coalescent model helps explain differences in the behavior of the two methods on phylogenomic data sets. Recent work suggests that species tree methods are more robust than concatenation approaches to some of the classic challenges of phylogenetic analysis, including rapidly evolving sites in DNA sequences and long-branch attraction. We show that approaches, such as binning, designed to augment the signal in species tree analyses can distort the distribution of gene trees and are inconsistent. Computationally efficient species tree methods incorporating biological realism are a key to phylogenetic analysis of whole-genome data. © 2015 New York Academy of Sciences.
Directory of Open Access Journals (Sweden)
Joo Hee Seo
2017-10-01
Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.
Parks, Donovan H; Beiko, Robert G
2013-01-01
High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.
Silva, Cynthia C; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; Kruger, Ricardo H; Rodrigues, Marili Vn; Costa, Gustavo Gl; Vidal, Ramon O; Sousa, Maíra P; Torres, Ana Paula R; Santiago, Vânia Mj; Oliveira, Valéria M
2012-03-27
In petrochemical refinery wastewater treatment plants (WWTP), different concentrations of pollutant compounds are received daily in the influent stream, including significant amounts of phenolic compounds, creating propitious conditions for the development of particular microorganisms that can rapidly adapt to such environment. In the present work, the microbial sludge from a refinery WWTP was enriched for phenol, cloned into fosmid vectors and pyrosequenced. The fosmid libraries yielded 13,200 clones and a comprehensive bioinformatic analysis of the sequence data set revealed a complex and diverse bacterial community in the phenol degrading sludge. The phylogenetic analyses using MEGAN in combination with RDP classifier showed a massive predominance of Proteobacteria, represented mostly by the genera Diaphorobacter, Pseudomonas, Thauera and Comamonas. The functional classification of phenol degrading sludge sequence data set generated by MG-RAST showed the wide metabolic diversity of the microbial sludge, with a high percentage of genes involved in the aerobic and anaerobic degradation of phenol and derivatives. In addition, genes related to the metabolism of many other organic and xenobiotic compounds, such as toluene, biphenyl, naphthalene and benzoate, were found. Results gathered herein demonstrated that the phenol degrading sludge has complex phylogenetic and functional diversities, showing the potential of such community to degrade several pollutant compounds. This microbiota is likely to represent a rich resource of versatile and unknown enzymes which may be exploited for biotechnological processes such as bioremediation.
Zhou, Chan; Mao, Fenglou; Yin, Yanbin; Huang, Jinling; Gogarten, Johann Peter; Xu, Ying
2014-01-01
A challenge in phylogenetic inference of gene trees is how to properly sample a large pool of homologous sequences to derive a good representative subset of sequences. Such a need arises in various applications, e.g. when (1) accuracy-oriented phylogenetic reconstruction methods may not be able to deal with a large pool of sequences due to their high demand in computing resources; (2) applications analyzing a collection of gene trees may prefer to use trees with fewer operational taxonomic units (OTUs), for instance for the detection of horizontal gene transfer events by identifying phylogenetic conflicts; and (3) the pool of available sequences is biased towards extensively studied species. In the past, the creation of subsamples often relied on manual selection. Here we present an Automated sequence-Sampling method for improving the Taxonomic diversity of gene phylogenetic trees, AST, to obtain representative sequences that maximize the taxonomic diversity of the sampled sequences. To demonstrate the effectiveness of AST, we have tested it to solve four problems, namely, inference of the evolutionary histories of the small ribosomal subunit protein S5 of E. coli, 16 S ribosomal RNAs and glycosyl-transferase gene family 8, and a study of ancient horizontal gene transfers from bacteria to plants. Our results show that the resolution of our computational results is almost as good as that of manual inference by domain experts, hence making the tool generally useful to phylogenetic studies by non-phylogeny specialists. The program is available at http://csbl.bmb.uga.edu/~zhouchan/AST.php.
Directory of Open Access Journals (Sweden)
Mikihiko eKawai
2014-03-01
Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.
Portik, Daniel M.; Blackburn, David C.
2016-01-01
The reproductive modes of anurans (frogs and toads) are the most diverse of terrestrial vertebrates, and a major challenge is identifying selective factors that promote the evolution or retention of reproductive modes across clades. Terrestrialized anuran breeding strategies have evolved repeatedly from the plesiomorphic fully aquatic reproductive mode, a process thought to occur through intermediate reproductive stages. Several selective forces have been proposed for the evolution of terrestrialized reproductive traits, but factors such as water systems and co‐evolution with ecomorphologies have not been investigated. We examined these topics in a comparative phylogenetic framework using Afrobatrachian frogs, an ecologically and reproductively diverse clade representing more than half of the total frog diversity found in Africa (∼400 species). We infer direct development has evolved twice independently from terrestrialized reproductive modes involving subterranean or terrestrial oviposition, supporting evolution through intermediate stages. We also detect associations between specific ecomorphologies and oviposition sites, and demonstrate arboreal species exhibit an overall shift toward using lentic water systems for breeding. These results indicate that changes in microhabitat use associated with ecomorphology, which allow access to novel sites for reproductive behavior, oviposition, or larval development, may also promote reproductive mode diversity in anurans. PMID:27402182
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
Navya
2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...
Characteristics of phylogenetic diversity in airborne bacterial populations in China
Chaudhry, Zahra; Santarpia, Joshua L.; Martins, J. V.
2011-05-01
Considering their potential implications for human health, agricultural productivity, and ecosystem stability, surprisingly little is known about the composition or dynamics of the atmosphere's biological aerosols. The few studies that have examined phylogenetic diversity in China focused on a single sampling period, whereas this study spans 3 months and includes over 300 samples. The 300+ samples were categorized by month and direction of their back-trajectory. DNA extraction was carried out on the pooled samples in a quantitative manner to allow for comparison between the amount of extracted material and the amount of initial total aerosol mass. Within an individual month, samples originating from similar land types and approximately equidistant to the sampling location exhibited similar diversity, whereas samples originating from much greater distances and from different land types included phyla unique to that location. Phyla from the same origin also varied from one month to the next. The biological diversity found from the Phylochips reinforces the hypothesis that air samples carry a biological record of their history.
phangorn: phylogenetic analysis in R.
Schliep, Klaus Peter
2011-02-15
phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.
Phylogenetic and structural diversity in the feline leukemia virus env gene.
Directory of Open Access Journals (Sweden)
Shinya Watanabe
Full Text Available Feline leukemia virus (FeLV belongs to the genus Gammaretrovirus, and causes a variety of neoplastic and non-neoplastic diseases in cats. Alteration of viral env sequences is thought to be associated with disease specificity, but the way in which genetic diversity of FeLV contributes to the generation of such variants in nature is poorly understood. We isolated FeLV env genes from naturally infected cats in Japan and analyzed the evolutionary dynamics of these genes. Phylogenetic reconstructions separated our FeLV samples into three distinct genetic clusters, termed Genotypes I, II, and III. Genotype I is a major genetic cluster and can be further classified into Clades 1-7 in Japan. Genotypes were correlated with geographical distribution; Genotypes I and II were distributed within Japan, whilst FeLV samples from outside Japan belonged to Genotype III. These results may be due to geographical isolation of FeLVs in Japan. The observed structural diversity of the FeLV env gene appears to be caused primarily by mutation, deletion, insertion and recombination, and these variants may be generated de novo in individual cats. FeLV interference assay revealed that FeLV genotypes did not correlate with known FeLV receptor subgroups. We have identified the genotypes which we consider to be reliable for evaluating phylogenetic relationships of FeLV, which embrace the high structural diversity observed in our sample. Overall, these findings extend our understanding of Gammaretrovirus evolutionary patterns in the field, and may provide a useful basis for assessing the emergence of novel strains and understanding the molecular mechanisms of FeLV transmission in cats.
Open Reading Frame Phylogenetic Analysis on the Cloud
Directory of Open Access Journals (Sweden)
Che-Lun Hung
2013-01-01
Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.
[A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].
Shulakov, A A; Egorov, A V; Onipchenko, V G
2016-01-01
Phylogenetic analysis of communities is based on the comparison of distances on the phylogenetic tree between species of a community under study and those distances in random samples taken out of local flora. It makes it possible to determine to what extent a community composition is formed by more closely related species (i.e., "clustered") or, on the opposite, it is more even and includes species that are less related with each other. The first case is usually interpreted as a result of strong influence caused by abiotic factors, due to which species with similar ecology, a priori more closely related, would remain: In the second case, biotic factors, such as competition, may come to the fore and lead to forming a community out of distant clades due to divergence of their ecological niches: The aim of this' study Was Ad explore the phylogenetic structure in communities of the northwestern Caucasus at two spatial scales - the scale of area from 4 to 100 m2 and the smaller scale within a community. The list of local flora of the alpine belt has been composed using the database of geobotanic descriptions carried out in Teberda Biosphere Reserve at true altitudes exceeding.1800 m. It includes 585 species of flowering plants belonging to 57 families. Basal groups of flowering plants are.not represented in the list. At the scale of communities of three classes, namely Thlaspietea rotundifolii - commumties formed on screes and pebbles, Calluno-Ulicetea - alpine meadow, and Mulgedio-Aconitetea subalpine meadows, have not demonstrated significant distinction of phylogenetic structure. At intra level, for alpine meadows the larger share of closely related species. (clustered community) is detected. Significantly clustered happen to be those communities developing on rocks (class Asplenietea trichomanis) and alpine (class Juncetea trifidi). At the same time, alpine lichen proved to have even phylogenetic structure at the small scale. Alpine (class Salicetea herbaceae) that
Erwin, Patrick M; Olson, Julie B; Thacker, Robert W
2011-01-01
Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP), might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods. We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6%) of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil). The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the ambient
Sequence comparison and phylogenetic analysis of core gene of ...
African Journals Online (AJOL)
Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...
Peña, Carlos; Espeland, Marianne
2015-01-01
The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC) is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE) and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution. PMID:25830910
Directory of Open Access Journals (Sweden)
Carlos Peña
Full Text Available The species rich butterfly family Nymphalidae has been used to study evolutionary interactions between plants and insects. Theories of insect-hostplant dynamics predict accelerated diversification due to key innovations. In evolutionary biology, analysis of maximum credibility trees in the software MEDUSA (modelling evolutionary diversity using stepwise AIC is a popular method for estimation of shifts in diversification rates. We investigated whether phylogenetic uncertainty can produce different results by extending the method across a random sample of trees from the posterior distribution of a Bayesian run. Using the MultiMEDUSA approach, we found that phylogenetic uncertainty greatly affects diversification rate estimates. Different trees produced diversification rates ranging from high values to almost zero for the same clade, and both significant rate increase and decrease in some clades. Only four out of 18 significant shifts found on the maximum clade credibility tree were consistent across most of the sampled trees. Among these, we found accelerated diversification for Ithomiini butterflies. We used the binary speciation and extinction model (BiSSE and found that a hostplant shift to Solanaceae is correlated with increased net diversification rates in Ithomiini, congruent with the diffuse cospeciation hypothesis. Our results show that taking phylogenetic uncertainty into account when estimating net diversification rate shifts is of great importance, as very different results can be obtained when using the maximum clade credibility tree and other trees from the posterior distribution.
Directory of Open Access Journals (Sweden)
Rob Knight
2009-11-01
Full Text Available The PD measure of phylogenetic diversity interprets branch lengths cladistically to make inferences about feature diversity. PD calculations extend conventional specieslevel ecological indices to the features level. The “phylogenetic beta diversity” framework developed by microbial ecologists calculates PD-dissimilarities between community localities. Interpretation of these PD-dissimilarities at the feature level explains the framework’s success in producing ordinations revealing environmental gradients. An example gradients space using PD-dissimilarities illustrates how evolutionary features form unimodal response patterns to gradients. This features model supports new application of existing species-level methods that are robust to unimodal responses, plus novel applications relating to climate change, commercial products discovery, and community assembly.
Directory of Open Access Journals (Sweden)
Carine Makendi
2016-02-01
Full Text Available Salmonella enterica serovar Weltevreden (S. Weltevreden is an emerging cause of diarrheal and invasive disease in humans residing in tropical regions. Despite the regional and international emergence of this Salmonella serovar, relatively little is known about its genetic diversity, genomics or virulence potential in model systems. Here we used whole genome sequencing and bioinformatics analyses to define the phylogenetic structure of a diverse global selection of S. Weltevreden. Phylogenetic analysis of more than 100 isolates demonstrated that the population of S. Weltevreden can be segregated into two main phylogenetic clusters, one associated predominantly with continental Southeast Asia and the other more internationally dispersed. Subcluster analysis suggested the local evolution of S. Weltevreden within specific geographical regions. Four of the isolates were sequenced using long read sequencing to produce high quality reference genomes. Phenotypic analysis in Hep-2 cells and in a murine infection model indicated that S. Weltevreden were significantly attenuated in these models compared to the classical S. Typhimurium reference strain SL1344. Our work outlines novel insights into this important emerging pathogen and provides a baseline understanding for future research studies.
Erickson, David L.; Jones, Frank A.; Swenson, Nathan G.; Pei, Nancai; Bourg, Norman A.; Chen, Wenna; Davies, Stuart J.; Ge, Xue-jun; Hao, Zhanqing; Howe, Robert W.; Huang, Chun-Lin; Larson, Andrew J.; Lum, Shawn K. Y.; Lutz, James A.; Ma, Keping; Meegaskumbura, Madhava; Mi, Xiangcheng; Parker, John D.; Fang-Sun, I.; Wright, S. Joseph; Wolf, Amy T.; Ye, W.; Xing, Dingliang; Zimmerman, Jess K.; Kress, W. John
2014-01-01
Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK, and psbA-trnH) and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance (PD) metrics that are commonly used to infer assembly processes were estimated for each plot [PD, Mean Phylogenetic Distance (MPD), and Mean Nearest Taxon Distance (MNTD)]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for individual plots, estimates of
J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor
2011-01-01
Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...
Directory of Open Access Journals (Sweden)
Koperski Paweł
2017-01-01
Full Text Available Different indices of taxonomic diversity (TD and phylogenetic diversity (PD of the macrobenthos were compared to determine the efficient predictors of environmental quality (EQ in different types of watercourses in Poland. Archived data of 864 samples of benthic invertebrates identified to the family level were analysed on the basis of linear and non-linear multiply regression. The strengths of the correlations between two measures of EQ:BMWPpl (British Monitoring Working Party score system, Polish modification and MMI (Multimetric Macroinvertebrate Index and the values of taxonomic richness and three well-known TD indices: Shannon, Margalef and J' Evenness were compared to those for values of three PD indices, based on taxonomic distinctness. Taxonomic richness and all PD indices correlated more strongly with both measures of EQ than all TD indices. Correlations with both types of diversity indices were visibly stronger for BMWPpl when compared with MMI. We suggest that analysed indices of PD, especially MDis (mean phylogenetic distance between families in a sample, are related with EQ strongly enough to be taken into account as potential metrics in selection procedures of biological assessment.
Genetic characterization and phylogenetic analysis of porcine circovirus type 2 (PCV2) in Serbia.
Savic, Bozidar; Milicevic, Vesna; Jakic-Dimic, Dobrila; Bojkovski, Jovan; Prodanovic, Radisa; Kureljusic, Branislav; Potkonjak, Aleksandar; Savic, Borivoje
2012-01-01
Porcine circovirus type 2 (PCV2) is the main causative agent of postweaning multisystemic wasting syndrome (PMWS). To characterize and determine the genetic diversity of PCV2 in the porcine population of Serbia, nucleotide and deduced amino acid sequences of the open reading frame 2 (ORF2) of PCV2 collected from the tissues of pigs that either had died as a result of PMWS or did not exhibit disease symptoms were analyzed. Sequencing and phylogenetic analysis showed considerable diversity among PCV2 ORF2 sequences and the existence of two main PCV2 genotypes, PCV2b and PCV2a, with at least three clusters, 1A/B, 1C and 2D. In order to provide further proof that the 1C strain is circulating in the porcine population, the whole viral genome of one PCV2 isolate was sequenced. Genotyping and phylogenetic analysis using the entire viral genome sequences confirmed that there was a PMWS-associated 1C strain emerging in Serbia. Our analysis also showed that PCV2b is dominant in the porcine population, and that it is exclusively associated with PMWS occurrences in the country. These data constitute a useful basis for further epidemiological studies regarding the heterogeneity of PCV2 strains on the European continent.
Phylogenetic diversity does not capture body size variation at risk in the world's mammals
DEFF Research Database (Denmark)
Fritz, Susanne A; Purvis, Andy
2010-01-01
Mammals contribute to important ecosystem processes and services, but many mammalian species are threatened with extinction. We compare how global patterns in three measures of mammalian diversity--species richness, phylogenetic diversity (PD) and body mass variance (BMV)--would change if all...... currently threatened species were lost. Given that many facets of species' ecology and life history scale predictably with body mass, the BMV in a region roughly reflects the diversity of species' roles within ecosystems and so is a simple proxy for functional diversity (FD). PD is also often considered...... more BMV than under random extinction, while only 11 per cent would lose significantly more PD. Ecosystem consequences of these selective losses may be profound, especially throughout the tropics, but are not captured by PD. This low surrogacy stresses a need for conservation prioritization based...
Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel
2015-01-01
The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.
Corbelli, Julian Martin; Zurita, Gustavo Andres; Filloy, Julieta; Galvis, Juan Pablo; Vespa, Natalia Isabel; Bellocq, Isabel
2015-01-01
The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD), functional (FBD) and phylogenetic (PBD) facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools) and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants) from two contrasting biomes (subtropical forest and grassland) and land uses (tree plantations and cropfields) in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland), and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation. PMID:25978319
Directory of Open Access Journals (Sweden)
Julian Martin Corbelli
Full Text Available The spatial distribution of species, functional traits and phylogenetic relationships at both the regional and local scales provide complementary approaches to study patterns of biodiversity and help to untangle the mechanisms driving community assembly. Few studies have simultaneously considered the taxonomic (TBD, functional (FBD and phylogenetic (PBD facets of beta diversity. Here we analyze the associations between TBD, FBD, and PBD with the biome (representing different regional species pools and land use, and investigate whether TBD, FBD and PBD were correlated. In the study design we considered two widely used indicator taxa (birds and ants from two contrasting biomes (subtropical forest and grassland and land uses (tree plantations and cropfields in the southern Neotropics. Non-metric multidimensional scaling showed that taxonomic, functional and phylogenetic distances were associated to biome and land use; study sites grouped into four groups on the bi-dimensional space (cropfields in forest and grassland, and tree plantations in forest and grassland, and that was consistent across beta diversity facets and taxa. Mantel and PERMANOVA tests showed that TBD, FBD and PBD were positively correlated for both bird and ant assemblages; in general, partial correlations were also significant. Some of the functional traits considered here were conserved along phylogeny. Our results will contribute to the development of sound land use planning and beta diversity conservation.
Brooks, T M; Cuttelod, A; Faith, D P; Garcia-Moreno, J; Langhammer, P; Pérez-Espona, S
2015-02-19
'Key biodiversity areas' are defined as sites contributing significantly to the global persistence of biodiversity. The identification of these sites builds from existing approaches based on measures of species and ecosystem diversity and process. Here, we therefore build from the work of Sgró et al. (2011 Evol. Appl. 4, 326-337. (doi:10.1111/j.1752-4571.2010.00157.x)) to extend a framework for how components of genetic diversity might be considered in the identification of key biodiversity areas. We make three recommendations to inform the ongoing process of consolidating a key biodiversity areas standard: (i) thresholds for the threatened species criterion currently consider a site's share of a threatened species' population; expand these to include the proportion of the species' genetic diversity unique to a site; (ii) expand criterion for 'threatened species' to consider 'threatened taxa' and (iii) expand the centre of endemism criterion to identify as key biodiversity areas those sites holding a threshold proportion of the compositional or phylogenetic diversity of species (within a taxonomic group) whose restricted ranges collectively define a centre of endemism. We also recommend consideration of occurrence of EDGE species (i.e. threatened phylogenetic diversity) in key biodiversity areas to prioritize species-specific conservation actions among sites.
Comparative phylogenetic analysis of intergenic spacers and small ...
African Journals Online (AJOL)
The phylogenetic analysis of test isolates included assessment of variation in sequences and length of IGS and SSU-rRNA genes with reference to 16 different microsporidian sequences. The results proved that IGS sequences have more variation than SSU-rRNA gene sequences. Analysis of phylogenetic trees reveal that ...
Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk
2016-04-27
Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.
Directory of Open Access Journals (Sweden)
Patrick M Erwin
Full Text Available Marine sponges can associate with abundant and diverse consortia of microbial symbionts. However, associated bacteria remain unexamined for the majority of host sponges and few studies use phylogenetic metrics to quantify symbiont community diversity. DNA fingerprinting techniques, such as terminal restriction fragment length polymorphisms (T-RFLP, might provide rapid profiling of these communities, but have not been explicitly compared to traditional methods.We investigated the bacterial communities associated with the marine sponges Hymeniacidon heliophila and Haliclona tubifera, a sympatric tunicate, Didemnum sp., and ambient seawater from the northern Gulf of Mexico by combining replicated clone libraries with T-RFLP analyses of 16S rRNA gene sequences. Clone libraries revealed that bacterial communities associated with the two sponges exhibited lower species richness and lower species diversity than seawater and tunicate assemblages, with differences in species composition among all four source groups. T-RFLP profiles clustered microbial communities by source; individual T-RFs were matched to the majority (80.6% of clone library sequences, indicating that T-RFLP analysis can be used to rapidly profile these communities. Phylogenetic metrics of community diversity indicated that the two sponge-associated bacterial communities include dominant and host-specific bacterial lineages that are distinct from bacteria recovered from seawater, tunicates, and unrelated sponge hosts. In addition, a large proportion of the symbionts associated with H. heliophila were shared with distant, conspecific host populations in the southwestern Atlantic (Brazil.The low diversity and species-specific nature of bacterial communities associated with H. heliophila and H. tubifera represent a distinctly different pattern from other, reportedly universal, sponge-associated bacterial communities. Our replicated sampling strategy, which included samples that reflect the
Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis
Young, Douglas B.; Comas, I?aki; de Carvalho, Luiz P. S.
2015-01-01
Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii, and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms (SNPs) with predicted impact on protein function and transcriptional regulation...
Directory of Open Access Journals (Sweden)
Kazem Baesi
2014-09-01
Full Text Available Objective: To identify the dominant subtype among the HIV-1 strains circulation in Iran. Methods: In this cross sectional study 100 HIV positive patients participated. HIV-1 RNA was extracted from plasma. RT nested-PCR was performed and the final products were sequenced and phylogenetically analyzed; reference sequences were downloaded from Los Alamos, aligned with Iranian pol sequences in the study and analyzed by neighbor-joining method. Results: The results of the phylogenetic analysis showed that HIV-1 subtype CRF-35AD was the dominant subtype among HIV-1 infected patients in Iran; this analysis also suggested a new circulating recombinant form that had not previously been identified in Iran: CRF-29BF. Conclusions: The impact of HIV diversity on pathogenesis, transmission and clinical management have been discussed in different studies; therefore, analyses of HIV genetic diversity is required to design effective antiretroviral strategies for different HIV subtypes.
PhyDesign: an online application for profiling phylogenetic informativeness
Directory of Open Access Journals (Sweden)
Townsend Jeffrey P
2011-05-01
Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.
Aust, Shelly K; Ahrendsen, Dakota L; Kellar, P Roxanne
2015-01-01
Conservation of the evolutionary diversity among organisms should be included in the selection of priority regions for preservation of Earth's biodiversity. Traditionally, biodiversity has been determined from an assessment of species richness (S), abundance, evenness, rarity, etc. of organisms but not from variation in species' evolutionary histories. Phylogenetic diversity (PD) measures evolutionary differences between taxa in a community and is gaining acceptance as a biodiversity assessment tool. However, with the increase in the number of ways to calculate PD, end-users and decision-makers are left wondering how metrics compare and what data are needed to calculate various metrics. In this study, we used massively parallel sequencing to generate over 65,000 DNA characters from three cellular compartments for over 60 species in the asterid clade of flowering plants. We estimated asterid phylogenies from character datasets of varying nucleotide quantities, and then assessed the effect of varying character datasets on resulting PD metric values. We also compared multiple PD metrics with traditional diversity indices (including S) among two endangered grassland prairies in Nebraska (U.S.A.). Our results revealed that PD metrics varied based on the quantity of genes used to infer the phylogenies; therefore, when comparing PD metrics between sites, it is vital to use comparable datasets. Additionally, various PD metrics and traditional diversity indices characterize biodiversity differently and should be chosen depending on the research question. Our study provides empirical results that reveal the value of measuring PD when considering sites for conservation, and it highlights the usefulness of using PD metrics in combination with other diversity indices when studying community assembly and ecosystem functioning. Ours is just one example of the types of investigations that need to be conducted across the tree of life and across varying ecosystems in order to build
Tang, Yueqin; Shigematsu, Toru; Ikbal; Morimura, Shigeru; Kida, Kenji
2004-05-01
We demonstrated previously that micro-aeration allows construction of an effective thermophilic methane-fermentation system for treatment of municipal solid waste (MSW) without production of H(2)S. In the present study, we compared the microbial communities in a thermophilic MSW digester without aeration and with micro-aeration by fluorescence in situ hybridization (FISH), denaturing gradient gel electrophoresis (DGGE), phylogenetic analysis of libraries of 16S rRNA gene clones and quantitative real-time PCR. Moreover, we studied the activity of sulfate-reducing bacteria (SRB) by analysis of the transcription of the gene for dissimilatory sulfite reductase (dsr). Experiments using FISH revealed that microorganisms belonging to the domain Bacteria dominated in the digester both without aeration and with micro-aeration. Phylogenetic analysis based on 16S rRNA gene and analysis of bacteria by DGGE did not reveal any obvious difference within the microbial communities under the two aeration conditions, and bacteria affiliated with the phylum Firmicutes were dominant. In Archaea, the population of Methanosarcina decreased while the population of Methanoculleus increased as a result of micro-aerations as revealed by the analysis of 16S rRNA gene clones and quantitative real-time PCR. Reverse transcription and PCR (RT-PCR) demonstrated the transcription of dsrA not only in the absence of aeration but also in the presence of micro-aeration, even under conditions where no H(2)S was detected in the biogas. In conclusion, micro-aeration has no obvious effects on the phylogenetic diversity of microorganisms. Furthermore, the activity of SRBs in the digester was not repressed even though the concentration of H(2)S in the biogas was very low under the micro-aeration conditions.
Cachera, Marie; Le Loc'h, François
2017-08-01
The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.
Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology
DEFF Research Database (Denmark)
Hansen, K.; Læssøe, Thomas; Pfister, D.H.
2002-01-01
Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....
The mean and variance of phylogenetic diversity under rarefaction.
Nipperess, David A; Matsen, Frederick A
2013-06-01
Phylogenetic diversity (PD) depends on sampling depth, which complicates the comparison of PD between samples of different depth. One approach to dealing with differing sample depth for a given diversity statistic is to rarefy, which means to take a random subset of a given size of the original sample. Exact analytical formulae for the mean and variance of species richness under rarefaction have existed for some time but no such solution exists for PD.We have derived exact formulae for the mean and variance of PD under rarefaction. We confirm that these formulae are correct by comparing exact solution mean and variance to that calculated by repeated random (Monte Carlo) subsampling of a dataset of stem counts of woody shrubs of Toohey Forest, Queensland, Australia. We also demonstrate the application of the method using two examples: identifying hotspots of mammalian diversity in Australasian ecoregions, and characterising the human vaginal microbiome.There is a very high degree of correspondence between the analytical and random subsampling methods for calculating mean and variance of PD under rarefaction, although the Monte Carlo method requires a large number of random draws to converge on the exact solution for the variance.Rarefaction of mammalian PD of ecoregions in Australasia to a common standard of 25 species reveals very different rank orderings of ecoregions, indicating quite different hotspots of diversity than those obtained for unrarefied PD. The application of these methods to the vaginal microbiome shows that a classical score used to quantify bacterial vaginosis is correlated with the shape of the rarefaction curve.The analytical formulae for the mean and variance of PD under rarefaction are both exact and more efficient than repeated subsampling. Rarefaction of PD allows for many applications where comparisons of samples of different depth is required.
Knowles, Lacey L; Klimov, Pavel B
2011-11-01
With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.
Phylogenetic diversity of dissimilatory ferric iron reducers in paddy soil of Hunan, South China
Energy Technology Data Exchange (ETDEWEB)
Wang Xin-Jun [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Graduate Univ., Chinese Academy of Sciences, BJ (China); Yang Jing; Chen Xue-Ping; Sun Guo-Xin [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Zhu Yong-Guan [State Key Lab. of Urban and Regional Ecology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, BJ (China); Key Lab. of Urban Environment and Health, Inst. of Urban Environment, Chinese Academy of Sciences, Xiamen (China)
2009-12-15
Purpose: Dissimilatory iron-reducing bacteria have been described by both culture-dependent and -independent methods in various environments, including freshwater, marine sediments, natural wetlands, and contaminated aquifers. However, little is known about iron-reducing microbial communities in paddy soils. The goal of this study was to characterize iron-reducing microbial communities in paddy soil. Moreover, the effect of dissolved and solid-phase iron (III) species on the iron-reducing microbial communities was also investigated by enrichment cultures. Methods: Ferric citrate and ferrihydrite were used respectively to set up enrichment cultures of dissimilatory ironreducing microorganisms using 1% inoculum of soil samples, and the iron reduction was measured. Moreover, bacterial DNA was extracted and 16S rRNA genes were PCR-amplified, and subsequently analyzed by the clone library and terminal restriction fragment length polymorphism (T-RFLP). Results: Phylogenetic analysis of 16S rRNA gene sequences extracted from the enrichment cultures revealed that Bradyrhizobium, Bacteroides, Clostridium and Ralstonia species were the dominant bacteria in the ferric citrate enrichment. However, members of the genera Clostridium, Bacteroides, and Geobacter were the dominant micro-organisms in the ferrihydrite enrichment. Analysis of enrichment cultures by T-RFLP strongly supported the cloning and sequencing results. Conclusions: The present study demonstrated that dissimilatory iron-reducing consortia in As-contaminated paddy soil are phylogenetically diverse. Moreover, iron (III) sources as a key factor have a strong effect on the iron (III)-reducing microbial community structure and relative abundance in the enrichments. In addition, Geobacter species are selectively enriched by ferrihydrite enrichment cultures. (orig.)
Directory of Open Access Journals (Sweden)
Hong-Xiang Zhang
2017-12-01
Full Text Available The Tianshan Mountains, located in arid Central Asia, have a humid climate and are biodiversity hotspots. Here, we aimed to clarify whether the pattern of species diversity and the phylogenetic structure of plant communities is affected by environmental variables and glacial refugia. In this study, plant community assemblies of 17 research sites with a total of 35 sample plots were investigated at the grassland/woodland boundaries on the Tianshan Mountains. Community phylogeny of these plant communities was constructed based on two plant DNA barcode regions. The indices of phylogenetic diversity and phylogenetic community structure were calculated for these sample plots. We first estimated the correlation coefficients between species richness (SR and environmental variables as well as the presence of glacial refugia. We then mapped the significant values of indices of community phylogeny (PD, RPD, NRI, and NTI to investigate the correlation between community phylogeny and environmental structure or macrozones in the study area. The results showed that a significantly higher value of SR was obtained for the refugial groups than for the colonizing groups (P < 0.05; presence of refugia and environmental variables were highly correlated to the pattern of variation in SR. Indices of community phylogeny were not significantly different between refugial and colonizing regions. Comparison with the humid western part showed that plant communities in the arid eastern part of the Tianshan Mountains tended to display more significant phylogenetic overdispersion. The variation tendency of the PhyloSor index showed that the increase in macro-geographical and environmental distance did not influence obvious phylogenetic dissimilarities between different sample plots. In conclusion, glacial refugia and environmental factors profoundly influenced the pattern of SR, but community phylogenetic structure was not affected by glacial refugia among different plant
Diversity of heavy metal resistant bacteria from Kalimas Surabaya: A phylogenetic taxonomy approach
Zulaika, Enny; Utomo, Andry Prio; Prima, Adisya; Alami, Nur Hidayatul; Kuswytasari, Nengah Dwianita; Shovitri, Maya; Sembiring, Langkah
2017-06-01
Bacterial resistance to heavy metal is a genetic and physiological adaptation to the environment which contaminated by heavy metal. Kalimas is an important river in Surabaya that is contaminated by some heavy metals and probably as a habitat for heavy metal resistance bacteria. Bacterial resistance to heavy metals are different for each species, and their diversity can be studied by phylogenetic taxonomy approach. Isolates screening was done using nutrient agar which contained 1 mg/L HgCl2, CdCl2 and K2Cr2O7. Bacterial viability were observed by nutrient broth which contained 10 mg/L HgCl2, 30 mg/L CdCl2 and 50 mg/L K2Cr2O7. Isolates that resistant to heavy metal and viable after exposure to heavy metal were identified using 16S rRNA gene marker by Polymerase Chain Reaction (PCR). Phylogenetic tree reconstruction was done by the neighbor-joining algorithm. Genetic assignment showed isolates that resist and viable after exposure of Hg, Cd and Cr are Bacillus S1, SS19 and DA11. Based on BLAST analysis from NCBI gene bank, 16S rRNA sequences, those isolates were similar with the member of Bacillus cereus. Depend on 16S rRNA nucleotide alignment by the neighbor-joining algorithm, Bacillus S1, SS19 and DA11 were belong to Bacillus cereus sensu-lato group.
Sydenham, Markus A K; Moe, Stein R; Stanescu-Yadav, Diana N; Totland, Ørjan; Eldegard, Katrine
2016-02-01
Anthropogenic landscape elements, such as roadsides, hedgerows, field edges, and power line clearings, can be managed to provide important habitats for wild bees. However, the effects of habitat improvement schemes in power line clearings on components of diversity are poorly studied. We conducted a large-scale experiment to test the effects of different management practices on the species, phylogenetic, and functional diversity of wild bees in power line clearings (n = 19 sites across southeastern Norway) and explored whether any treatment effects were modified by the environmental context. At each site, we conducted the following treatments: (1) Cut: all trees cut and left to decay in the clearing; (2) Cut + Remove: all trees cut and removed from the plot; and (3) Uncut: uncleared. The site-specific environmental context (i.e., elevation and floral diversity) influenced the species, phylogenetic, and functional diversity within bee species assemblages. The largest number of species was found in the Cut + Remove treatment in plots with a high forb species richness, indicating that the outcome of management practices depends on the environmental context. Clearing of treatment plots with many forb species also appeared to alter the phylogenetic composition of bee species assemblages, that is, more closely related species were found in the Cut and the Cut + Remove plots than in the Uncut plots. Synthesis and applications: Our experimental simulation of management practices in power line clearings influenced the species, phylogenetic, and functional diversity of bee species assemblages. Frequent clearing and removal of the woody debris at low elevations with a high forb species richness can increase the value of power line clearings for solitary bees. It is therefore important for managers to consider the environmental context when designing habitat improvement schemes for solitary bees.
Andre, Thiago; Specht, Chelsea; Salzman, Shayla; Palma-Silva, Clarisse [UNESP; Wendt, Tania
2015-01-01
While most species within the genus Chamaecostus (Costaceae) are well defined, the broad geographic range and long list of synonyms associated with Chamaecostus subsessilis led us to believe there may be some cryptic species within the complex. We thus investigate the phylogenetic relationships of species in the Chamaecostus lineage and specifically test the monophyly and diversity of the Chamaecostus subsessilis species complex from a population perspective by analyzing molecular sequence da...
Directory of Open Access Journals (Sweden)
David Lee Erickson
2014-11-01
Full Text Available Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1,347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK and psbA-trnH and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance metrics that are commonly used to infer assembly processes were estimated for each plot (Phylogenetic Distance [PD], Mean Phylogenetic Distance [MPD], and Mean Nearest Taxon Distance [MNTD]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for
Phylogenetic analysis of methanogens from the bovine rumen
Directory of Open Access Journals (Sweden)
Forster Robert J
2001-05-01
Full Text Available Abstract Background Interest in methanogens from ruminants has resulted from the role of methane in global warming and from the fact that cattle typically lose 6 % of ingested energy as methane. Several species of methanogens have been isolated from ruminants. However they are difficult to culture, few have been consistently found in high numbers, and it is likely that major species of rumen methanogens are yet to be identified. Results Total DNA from clarified bovine rumen fluid was amplified using primers specific for Archaeal 16S rRNA gene sequences (rDNA. Phylogenetic analysis of 41 rDNA sequences identified three clusters of methanogens. The largest cluster contained two distinct subclusters with rDNA sequences similar to Methanobrevibacter ruminantium 16S rDNA. A second cluster contained sequences related to 16S rDNA from Methanosphaera stadtmanae, an organism not previously described in the rumen. The third cluster contained rDNA sequences that may form a novel group of rumen methanogens. Conclusions The current set of 16S rRNA hybridization probes targeting methanogenic Archaea does not cover the phylogenetic diversity present in the rumen and possibly other gastro-intestinal tract environments. New probes and quantitative PCR assays are needed to determine the distribution of the newly identified methanogen clusters in rumen microbial communities.
Phylogenetic structure in tropical hummingbird communities
DEFF Research Database (Denmark)
Graham, Catherine H; Parra, Juan L; Rahbek, Carsten
2009-01-01
How biotic interactions, current and historical environment, and biogeographic barriers determine community structure is a fundamental question in ecology and evolution, especially in diverse tropical regions. To evaluate patterns of local and regional diversity, we quantified the phylogenetic...... composition of 189 hummingbird communities in Ecuador. We assessed how species and phylogenetic composition changed along environmental gradients and across biogeographic barriers. We show that humid, low-elevation communities are phylogenetically overdispersed (coexistence of distant relatives), a pattern...... that is consistent with the idea that competition influences the local composition of hummingbirds. At higher elevations communities are phylogenetically clustered (coexistence of close relatives), consistent with the expectation of environmental filtering, which may result from the challenge of sustaining...
Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.
Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K
2014-09-01
Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.
Genome-wide analysis of SINA family in plants and their phylogenetic relationships.
Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying
2008-06-01
SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.
Analysis of Domain Architecture and Phylogenetics of Family 2 Glycoside Hydrolases (GH2.
Directory of Open Access Journals (Sweden)
David Talens-Perales
Full Text Available In this work we report a detailed analysis of the topology and phylogenetics of family 2 glycoside hydrolases (GH2. We distinguish five topologies or domain architectures based on the presence and distribution of protein domains defined in Pfam and Interpro databases. All of them share a central TIM barrel (catalytic module with two β-sandwich domains (non-catalytic at the N-terminal end, but differ in the occurrence and nature of additional non-catalytic modules at the C-terminal region. Phylogenetic analysis was based on the sequence of the Pfam Glyco_hydro_2_C catalytic module present in most GH2 proteins. Our results led us to propose a model in which evolutionary diversity of GH2 enzymes is driven by the addition of different non-catalytic domains at the C-terminal region. This model accounts for the divergence of β-galactosidases from β-glucuronidases, the diversification of β-galactosidases with different transglycosylation specificities, and the emergence of bicistronic β-galactosidases. This study also allows the identification of groups of functionally uncharacterized protein sequences with potential biotechnological interest.
Aoki, Masataka; Kakiuchi, Ryota; Yamaguchi, Takashi; Takai, Ken; Inagaki, Fumio; Imachi, Hiroyuki
2015-01-01
Markedly diverse sequences of the adenosine-5'-phosphosulfate reductase alpha subunit gene (aprA), which encodes a key enzyme in microbial sulfate reduction and sulfur oxidation, were detected in subseafloor sediments on the northwestern Pacific off Japan. The aprA gene sequences were grouped into 135 operational taxonomic units (90% sequence identity), including genes related to putative sulfur-oxidizing bacteria predominantly detected in sulfate-depleted deep sediments. Our results suggest that microbial ecosystems in the subseafloor biosphere have phylogenetically diverse genetic potentials to mediate cryptic sulfur cycles in sediments, even where sulfate is rarely present.
Izedin Goga; Kristaq Berxholi; Beqe Hulaj; Driton Sylejmani; Boris Yakobson; Yehuda Stram
2014-01-01
Three serum samples positive in Antigen ELISA BVDV have been tested to characterise genetic diversity of bovine viral diarrhea virus (BVDV) in Kosovo. Samples were obtained in 2011 from heifers and were amplified by reverse transcription-polymerase chain reaction, sequenced and analysed by computer-assisted phylogenetic analysis. Amplified products and nucleotide sequence showed that all 3 isolates belonged to BVDV 1 genotype and 1b sub genotype. These results enrich the extant knowledge of B...
The Role of the Phylogenetic Diversity Measure, PD, in Bio-informatics: Getting the Definition Right
Directory of Open Access Journals (Sweden)
Daniel P. Faith
2006-01-01
Full Text Available A recent paper in this journal (Faith and Baker, 2006 described bio-informatics challenges in the application of the PD (phylogenetic diversity measure of Faith (1992a, and highlighted the use of the root of the phylogenetic tree, as implied by the original definition of PD. A response paper (Crozier et al. 2006 stated that 1 the (Faith, 1992a PD definition did not include the use of the root of the tree, and 2 Moritz and Faith (1998 changed the PD definition to include the root. Both characterizations are here refuted. Examples from Faith (1992a,b document the link from the definition to the use of the root of the overall tree, and a survey of papers over the past 15 years by Faith and colleagues demonstrate that the stated PD definition has remained the same as that in the original 1992 study. PD’s estimation of biodiversity at the level of “feature diversity” is seen to have provided the original rationale for the measure’s consideration of the root of the phylogenetic tree.
Venail, P.; Gross, K.; Oakley, T.H.; Narwani, A.; Allan, E.; Flombaum, P.; Isbell, F.; Joshi, J.; Reich, P.B.; Tilman, D.; Ruijven, van J.; Cardinale, B.J.
2015-01-01
1.Hundreds of experiments have now manipulated species richness of various groups of organisms and examined how this aspect of biological diversity influences ecosystem functioning. Ecologists have recently expanded this field to look at whether phylogenetic diversity among species, often quantified
Directory of Open Access Journals (Sweden)
Panca J. Santoso
2013-07-01
Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.
Morinière, Jérôme; van Dam, Matthew H.; Hawlitschek, Oliver; Bergsten, Johannes; Michat, Mariano C.; Hendrich, Lars; Ribera, Ignacio; Toussaint, Emmanuel F. A.; Balke, Michael
2016-05-01
The underlying mechanisms responsible for the general increase in species richness from temperate regions to the tropics remain equivocal. Many hypotheses have been proposed to explain this astonishing pattern but additional empirical studies are needed to shed light on the drivers at work. Here we reconstruct the evolutionary history of the cosmopolitan diving beetle subfamily Colymbetinae, the majority of which are found in the Northern hemisphere, hence exhibiting an inversed latitudinal diversity gradient. We reconstructed a dated phylogeny using 12 genes, to investigate the biogeographical history and diversification dynamics in the Colymbetinae. We aimed to identify the role that phylogenetic niche conservatism plays in the inversed diversification pattern seen in this group. Our results suggest that Colymbetinae originated in temperate climates, which supports the hypothesis that their distribution is the result of an ancestral adaptation to temperate environmental conditions rather than tropical origins, and that temperate niche conservatism can generate and/or maintain inverse latitudinal diversity gradients.
Barik, Suvakanta; SarkarDas, Shabari; Singh, Archita; Gautam, Vibhav; Kumar, Pramod; Majee, Manoj; Sarkar, Ananda K
2014-01-01
Similar to the majority of the microRNAs, mature miR166s are derived from multiple members of MIR166 genes (precursors) and regulate various aspects of plant development by negatively regulating their target genes (Class III HD-ZIP). The evolutionary conservation or functional diversification of miRNA166 family members remains elusive. Here, we show the phylogenetic relationships among MIR166 precursor and mature sequences from three diverse model plant species. Despite strong conservation, some mature miR166 sequences, such as ppt-miR166m, have undergone sequence variation. Critical sequence variation in ppt-miR166m has led to functional diversification, as it targets non-HD-ZIPIII gene transcript (s). MIR166 precursor sequences have diverged in a lineage specific manner, and both precursors and mature osa-miR166i/j are highly conserved. Interestingly, polycistronic MIR166s were present in Physcomitrella and Oryza but not in Arabidopsis. The nature of cis-regulatory motifs on the upstream promoter sequences of MIR166 genes indicates their possible contribution to the functional variation observed among miR166 species. Copyright © 2013 Elsevier Inc. All rights reserved.
TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics
Directory of Open Access Journals (Sweden)
von Haeseler Arndt
2004-06-01
Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.
Directory of Open Access Journals (Sweden)
Seon Young Choi
2016-03-01
Full Text Available An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997. Nontoxigenic (CTX− V. cholerae El Tor dominated toxigenic (CTX+ strains (2001 to 2003, but V. cholerae CTX+ variant El Tor was isolated during 2004 to 2008, outcompeting CTX−V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX+ El Tor, two were CTX− El Tor, and the remaining strain was a CTX+ classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX− isolate is ancestral to the 6th and 7th pandemic CTX+V. cholerae isolates. The other CTX− isolate joined with CTX− non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX+ isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX+ El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX+ El Tor isolate contained West African-South American (WASA recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity.
Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing.
Olvera, Alex; Busquets, Núria; Cortey, Marti; de Deus, Nilsa; Ganges, Llilianne; Núñez, José Ignacio; Peralta, Bibiana; Toskano, Jennifer; Dolz, Roser
2010-05-01
Changes in livestock production systems in recent years have altered the presentation of many diseases resulting in the need for more sophisticated control measures. At the same time, new molecular assays have been developed to support the diagnosis of animal viral disease. Nucleotide sequences generated by these diagnostic techniques can be used in phylogenetic analysis to infer phenotypes by sequence homology and to perform molecular epidemiology studies. In this review, some key elements of phylogenetic analysis are highlighted, such as the selection of the appropriate neutral phylogenetic marker, the proper phylogenetic method and different techniques to test the reliability of the resulting tree. Examples are given of current and future applications of phylogenetic reconstructions in viral livestock diseases. Copyright 2009 Elsevier Ltd. All rights reserved.
Kelley, Scott T; Cassirer, E Frances; Weiser, Glen C; Safaee, Shirin
2007-01-01
Wild and domestic animal populations are known to be sources and reservoirs of emerging diseases. There is also a growing recognition that horizontal genetic transfer (HGT) plays an important role in bacterial pathogenesis. We used molecular phylogenetic methods to assess diversity and cross-transmission rates of Pasteurellaceae bacteria in populations of bighorn sheep, Dall's sheep, domestic sheep and domestic goats. Members of the Pasteurellaceae cause an array of deadly illnesses including bacterial pneumonia known as "pasteurellosis", a particularly devastating disease for bighorn sheep. A phylogenetic analysis of a combined dataset of two RNA genes (16S ribosomal RNA and RNAse P RNA) revealed remarkable evolutionary diversity among Pasteurella trehalosi and Mannheimia (Pasteurella) haemolytica bacteria isolated from sheep and goats. Several phylotypes appeared to associate with particular host species, though we found numerous instances of apparent cross-transmission among species and populations. Statistical analyses revealed that host species, geographic locale and biovariant classification, but not virulence, correlated strongly with Pasteurellaceae phylogeny. Sheep host species correlated with P. trehalosi isolates phylogeny (PTP test; P=0.002), but not with the phylogeny of M. haemolytica isolates, suggesting that P. trehalosi bacteria may be more host specific. With regards to populations within species, we also discovered a strong correlation between geographic locale and isolate phylogeny in the Rocky Mountain bighorn sheep (PTP test; P=0.001). We also investigated the potential for HGT of the leukotoxin A (lktA) gene, which produces a toxin that plays an integral role in causing disease. Comparative analysis of the combined RNA gene phylogeny and the lktA phylogenies revealed considerable incongruence between the phylogenies, suggestive of HGT. Furthermore, we found identical lktA alleles in unrelated bacterial species, some of which had been isolated
Longnecker, K; Sherr, B F; Sherr, E B
2005-12-01
We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea.
A molecular phylogenetic analysis of the Scarabaeinae (dung beetles).
Monaghan, Michael T; Inward, Daegan J G; Hunt, Toby; Vogler, Alfried P
2007-11-01
The dung beetles (Scarabaeinae) include ca. 5000 species and exhibit a diverse array of morphologies and behaviors. This variation presumably reflects the adaptation to a diversity of food types and the different strategies used to avoid competition for vertebrate dung, which is the primary breeding environment for most species. The current classification gives great weight to the major behavioral types, separating the ball rollers and the tunnelers, but existing phylogenetic studies have been based on limited taxonomic or biogeographic sampling and have been contradictory. Here, we present a molecular phylogenetic analysis of 214 species of Scarabaeinae, representing all 12 traditionally recognized tribes and six biogeographical regions, using partial gene sequences from one nuclear (28S) and two mitochondrial (cox1, rrnL) genes. Length variation in 28S (588-621 bp) and rrnL (514-523 bp) was subjected to a thorough evaluation of alternative alignments, gap-coding methods, and tree searches using model-based (Bayesian and likelihood), maximum parsimony, and direct optimization analyses. The small-bodied, non-dung-feeding Sarophorus+Coptorhina were basal in all reconstructions. These were closely related to rolling Odontoloma+Dicranocara, suggesting an early acquisition of rolling behavior. Smaller tribes and most genera were monophyletic, while Canthonini and Dichotomiini each consisted of multiple paraphyletic lineages at hierarchical levels equivalent to the smaller tribes. Plasticity of rolling and tunneling was evidenced by a lack of monophyly (S-H test, p > 0.05) and several reversals within clades. The majority of previously unrecognized clades were geographical, including the well-supported Neotropical Phanaeini+Eucraniini, and a large Australian clade of rollers as well as tunneling Coptodactyla and Demarziella. Only three lineages, Gymnopleurini, Copris+Microcopris and Onthophagus, were widespread and therefore appear to be dispersive at a global scale. A
Liu, Shikai; Li, Qi; Liu, Zhanjiang
2013-01-01
Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.
Phylogenetic insights into the diversity of homocytous cyanobacteria from Amazonian rivers.
Genuário, Diego Bonaldo; Vaz, Marcelo Gomes Marçal Vieira; Melo, Itamar Soares de
2017-11-01
The Amazon Rainforest holds great tropical biodiversity, mainly because of its favourable climatic conditions. The high temperatures, luminosity and humidity coupled with the nutritional simplicity of cyanobacteria allow undiscovered diversity to flourish within this group of microorganisms. Some efforts to reveal this diversity have been attempted; however, most were focused on the microscopic observation of environmental samples without any genetic information. Very few studies focusing on morphological, ecological and molecular criteria have been conducted, and none have been devoted to homocytous cyanobacteria forms in Amazonia region. Therefore, the genetic relationships amongst strains retrieved from this ecosystem with regard to other environments from Brazil and the world have not been tested and, consequently, the Amazonian strains would naturally be assumed as novel to science. To examine these relationships, cultured homocytous cyanobacteria isolated from two Amazonian rivers (Amazonas and Solimões) were evaluated using a phylogenetic perspective, considering the 16S rRNA gene sequence. A total of eleven homocytous cyanobacterial strains were isolated. Morphologically, they were identified as Pseudanabaena, Leptolyngbya, Planktothrix and Phormidium, but genetically they were included in the typical clusters of Planktothrix, Pseudanabaena, Cephalothrix, Pantanalinema and Alkalinema. These three latter genera have been detected in other Brazilian ecosystems only (Pantanal, Atlantic Rainforest and Pampa), while those remaining have been extensively found in many parts of the world. The data provided here indicate that Amazonian rivers support a homocytous cyanobacterial diversity previously reported from other geographical and ecological environments. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Paula Nilda Fergnani
Full Text Available The extent to which the latitudinal gradient in species richness may be paralleled by a similar gradient of increasing functional or phylogenetic diversity is a matter of controversy. We evaluated whether taxonomic richness (TR is informative in terms of ecological diversity (ED, an approximation to functional diversity and phylogenetic diversity (AvPD using data on 531 mammal species representing South American old autochthonous (marsupials, xenarthrans, mid-Cenozoic immigrants (hystricognaths, primates and newcomers (carnivorans, artiodactyls. If closely related species are ecologically more similar than distantly related species, AvPD will be a strong predictor of ED; however, lower ED than predicted from AvPD may be due to species retaining most of their ancestral characters, suggesting niche conservatism. This pattern could occur in tropical rainforests for taxa of tropical affinity (old autochthonous and mid-Cenozoic immigrants and in open and arid habitats for newcomers. In contrast, higher ED than expected from AvPD could occur, possibly in association with niche evolution, in arid and open habitats for taxa of tropical affinity and in forested habitats for newcomers. We found that TR was a poor predictor of ED and AvPD. After controlling for TR, there was considerable variability in the extent to which AvPD accounted for ED. Taxa of tropical affinity did not support the prediction of ED deficit within tropical rainforests, rather, they showed a mosaic of regions with an excess of ED interspersed with zones of ED deficit within the tropics; newcomers showed ED deficit in arid and open regions. Some taxa of tropical affinity showed excess of ED in tropical desert areas (hystricognaths or temperate semideserts (xenarthrans; newcomers showed excess of ED at cold-temperate latitudes in the Northern Hemisphere. This result suggests that extreme climatic conditions at both temperate and tropical latitudes may have promoted niche evolution in
Phylogenetic signals in the climatic niches of the world's amphibians
DEFF Research Database (Denmark)
Hof, Christian; Rahbek, Carsten; Araújo, Miguel B.
2010-01-01
amphibian orders and across biogeographical regions. To our knowledge, this is the first study providing a comprehensive analysis of the phylogenetic signal in species climatic niches for an entire clade across the world. Even though our results do not provide a strong test of the niche conservatism......The question of whether closely related species share similar ecological requirements has attracted increasing attention, because of its importance for understanding global diversity gradients and the impacts of climate change on species distributions. In fact, the assumption that related species...... are also ecologically similar has often been made, although the prevalence of such a phylogenetic signal in ecological niches remains heavily debated. Here, we provide a global analysis of phylogenetic niche relatedness for the world's amphibians. In particular, we assess which proportion of the variance...
Roukaerts, Inge D M; Theuns, Sebastiaan; Taffin, Elien R L; Daminet, Sylvie; Nauwynck, Hans J
2015-01-22
Feline immunodeficiency virus (FIV) is a major pathogen in feline populations worldwide, with seroprevalences up to 26%. Virus strains circulating in domestic cats are subdivided into different phylogenetic clades (A-E), based on the genetic diversity of the V3-V4 region of the env gene. In this report, a phylogenetic analysis of the V3-V4 env region, and a variable region in the gag gene was made for 36 FIV strains isolated in Belgium and The Netherlands. All newly generated gag sequences clustered together with previously known clade A FIV viruses, confirming the dominance of clade A viruses in Northern Europe. The same was true for the obtained env sequences, with only one sample of an unknown env subtype. Overall, the genetic diversity of FIV strains sequenced in this report was low. This indicates a relatively recent introduction of FIV in Belgium and The Netherlands. However, the sample with an unknown env subtype indicates that new introductions of FIV from unknown origin do occur and this will likely increase genetic variability in time. Copyright © 2014 Elsevier B.V. All rights reserved.
DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.
Eernisse, D J
1992-04-01
DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.
Phylogenetic analysis of 23S rRNA gene sequences of some ...
African Journals Online (AJOL)
... glycol plus control. All isolates exhibited good drought-tolerant efficiencies at 10% PEG. While most of the isolates could not tolerate up to 20% PEG, isolates of Rlv6, Rlv9, Rlv12 and Rlv13 tolerated up to 20% PEG. Keywords: Rhizobium leguminosarum, 23S rRNA gene, phylogenetic tree, diversity and drought tolerance ...
phylo-node: A molecular phylogenetic toolkit using Node.js.
O'Halloran, Damien M
2017-01-01
Node.js is an open-source and cross-platform environment that provides a JavaScript codebase for back-end server-side applications. JavaScript has been used to develop very fast and user-friendly front-end tools for bioinformatic and phylogenetic analyses. However, no such toolkits are available using Node.js to conduct comprehensive molecular phylogenetic analysis. To address this problem, I have developed, phylo-node, which was developed using Node.js and provides a stable and scalable toolkit that allows the user to perform diverse molecular and phylogenetic tasks. phylo-node can execute the analysis and process the resulting outputs from a suite of software options that provides tools for read processing and genome alignment, sequence retrieval, multiple sequence alignment, primer design, evolutionary modeling, and phylogeny reconstruction. Furthermore, phylo-node enables the user to deploy server dependent applications, and also provides simple integration and interoperation with other Node modules and languages using Node inheritance patterns, and a customized piping module to support the production of diverse pipelines. phylo-node is open-source and freely available to all users without sign-up or login requirements. All source code and user guidelines are openly available at the GitHub repository: https://github.com/dohalloran/phylo-node.
Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum
Energy Technology Data Exchange (ETDEWEB)
Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.
2013-03-11
Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.
Directory of Open Access Journals (Sweden)
Izedin Goga
2014-03-01
Full Text Available Three serum samples positive in Antigen ELISA BVDV have been tested to characterise genetic diversity of bovine viral diarrhea virus (BVDV in Kosovo. Samples were obtained in 2011 from heifers and were amplified by reverse transcription-polymerase chain reaction, sequenced and analysed by computer-assisted phylogenetic analysis. Amplified products and nucleotide sequence showed that all 3 isolates belonged to BVDV 1 genotype and 1b sub genotype. These results enrich the extant knowledge of BVDV and represent the first documented data about Kosovo BVDV isolates.
Phylogenetic comparative methods complement discriminant function analysis in ecomorphology.
Barr, W Andrew; Scott, Robert S
2014-04-01
In ecomorphology, Discriminant Function Analysis (DFA) has been used as evidence for the presence of functional links between morphometric variables and ecological categories. Here we conduct simulations of characters containing phylogenetic signal to explore the performance of DFA under a variety of conditions. Characters were simulated using a phylogeny of extant antelope species from known habitats. Characters were modeled with no biomechanical relationship to the habitat category; the only sources of variation were body mass, phylogenetic signal, or random "noise." DFA on the discriminability of habitat categories was performed using subsets of the simulated characters, and Phylogenetic Generalized Least Squares (PGLS) was performed for each character. Analyses were repeated with randomized habitat assignments. When simulated characters lacked phylogenetic signal and/or habitat assignments were random, ecomorphology. Copyright © 2013 Wiley Periodicals, Inc.
Fraga, Aline Padilha de; Gräf, Tiago; Pereira, Cleiton Schneider; Ikuta, Nilo; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo
2018-03-21
Avian infectious bronchitis virus (IBV) is the etiological agent of a highly contagious disease, which results in severe economic losses to the poultry industry. The spike protein (S1 subunit) is responsible for the molecular diversity of the virus and many sero/genotypes are described around the world. Recently a new standardized classification of the IBV molecular diversity was conducted, based on phylogenetic analysis of the S1 gene sequences sampled worldwide. Brazil is one of the biggest poultry producers in the world and the present study aimed to review the molecular diversity and reconstruct the evolutionary history of IBV in the country. All IBV S1 gene sequences, with local and year of collection information available on GenBank, were retrieved. Phylogenetic analyses were carried out based on a maximum likelihood method for the classification of genotypes occurring in Brazil, according to the new classification. Bayesian phylogenetic analyses were performed with the Brazilian clade and related international sequences to determine the evolutionary history of IBV in Brazil. A total of 143 Brazilian sequences were classified as GI-11 and 46 as GI-1 (Mass). Within the GI-11 clade, we have identified a potential recombinant strain circulating in Brazil. Phylodynamic analysis demonstrated that IBV GI-11 lineage was introduced in Brazil in the 1950s (1951, 1917-1975 95% HPD) and population dynamics was mostly constant throughout the time. Despite the national vaccination protocols, our results show the widespread dissemination and maintenance of the IBV GI-11 lineage in Brazil and highlight the importance of continuous surveillance to evaluate the impact of currently used vaccine strains on the observed viral diversity of the country. Copyright © 2018 Elsevier B.V. All rights reserved.
Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences
Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.
2004-01-01
A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene
Genetic Diversity in Passiflora Species Assessed by Morphological and ITS Sequence Analysis
Directory of Open Access Journals (Sweden)
Shiamala Devi Ramaiya
2014-01-01
Full Text Available This study used morphological characterization and phylogenetic analysis of the internal transcribed spacer (ITS region of nuclear ribosomal DNA to investigate the phylogeny of Passiflora species. The samples were collected from various regions of East Malaysia, and discriminant function analysis based on linear combinations of morphological variables was used to classify the Passiflora species. The biplots generated five distinct groups discriminated by morphological variables. The group consisted of cultivars of P. edulis with high levels of genetic similarity; in contrast, P. foetida was highly divergent from other species in the morphological biplots. The final dataset of aligned sequences from nine studied Passiflora accessions and 30 other individuals obtained from GenBank database (NCBI yielded one most parsimonious tree with two strongly supported clades. Maximum parsimony (MP tree showed the phylogenetic relationships within this subgenus Passiflora support the classification at the series level. The constructed phylogenic tree also confirmed the divergence of P. foetida from all other species and the closeness of wild and cultivated species. The phylogenetic relationships were consistent with results of morphological assessments. The results of this study indicate that ITS region analysis represents a useful tool for evaluating genetic diversity in Passiflora at the species level.
Multilocus sequence analysis of Treponema denticola strains of diverse origin
Directory of Open Access Journals (Sweden)
Mo Sisu
2013-02-01
Full Text Available Abstract Background The oral spirochete bacterium Treponema denticola is associated with both the incidence and severity of periodontal disease. Although the biological or phenotypic properties of a significant number of T. denticola isolates have been reported in the literature, their genetic diversity or phylogeny has never been systematically investigated. Here, we describe a multilocus sequence analysis (MLSA of 20 of the most highly studied reference strains and clinical isolates of T. denticola; which were originally isolated from subgingival plaque samples taken from subjects from China, Japan, the Netherlands, Canada and the USA. Results The sequences of the 16S ribosomal RNA gene, and 7 conserved protein-encoding genes (flaA, recA, pyrH, ppnK, dnaN, era and radC were successfully determined for each strain. Sequence data was analyzed using a variety of bioinformatic and phylogenetic software tools. We found no evidence of positive selection or DNA recombination within the protein-encoding genes, where levels of intraspecific sequence polymorphism varied from 18.8% (flaA to 8.9% (dnaN. Phylogenetic analysis of the concatenated protein-encoding gene sequence data (ca. 6,513 nucleotides for each strain using Bayesian and maximum likelihood approaches indicated that the T. denticola strains were monophyletic, and formed 6 well-defined clades. All analyzed T. denticola strains appeared to have a genetic origin distinct from that of ‘Treponema vincentii’ or Treponema pallidum. No specific geographical relationships could be established; but several strains isolated from different continents appear to be closely related at the genetic level. Conclusions Our analyses indicate that previous biological and biophysical investigations have predominantly focused on a subset of T. denticola strains with a relatively narrow range of genetic diversity. Our methodology and results establish a genetic framework for the discrimination and phylogenetic
O'Donnell, K.; Humber, R.A.; Geiser, D.M.; Kang, S.; Robert, V.; Park, B.; Crous, P.W.; Johnston, P.; Aoki, T.; Rooney, A.P.; Rehner, S.A.
2012-01-01
We constructed several multilocus DNA sequence datasets to assess the phylogenetic diversity of insecticolous fusaria, especially focusing on those housed at the Agricultural Research Service Collection of Entomopathogenic Fungi (ARSEF), and to aid molecular identifications of unknowns via the
Amend, Anthony S; Matulich, Kristin L; Martiny, Jennifer B H
2015-01-01
Fungi play a critical role in the degradation of organic matter. Because different combinations of fungi result in different rates of decomposition, determining how climate change will affect microbial composition and function is fundamental to predicting future environments. Fungal response to global change is patterned by genetic relatedness, resulting in communities with comparatively low phylogenetic diversity (PD). This may have important implications for the functional capacity of disturbed communities if lineages sensitive to disturbance also contain unique traits important for litter decomposition. Here we tested the relationship between PD and decomposition rates. Leaf litter fungi were isolated from the field and deployed in microcosms as mock communities along a gradient of initial PD, while species richness was held constant. Replicate communities were subject to nitrogen fertilization comparable to anthropogenic deposition levels. Carbon mineralization rates were measured over the course of 66 days. We found that nitrogen fertilization increased cumulative respiration by 24.8%, and that differences in respiration between fertilized and ambient communities diminished over the course of the experiment. Initial PD failed to predict respiration rates or their change in response to nitrogen fertilization, and there was no correlation between community similarity and respiration rates. Last, we detected no phylogenetic signal in the contributions of individual isolates to respiration rates. Our results suggest that the degree to which PD predicts ecosystem function will depend on environmental context.
Xiang, Q Y; Soltis, D E; Soltis, P S
1998-10-01
One of the most remarkable examples of intercontinental disjunction of the North Temperate Flora involves eastern Asia and eastern and western North America. Although there has been considerable interest in this phytogeographic pattern for over 150 years (e.g., Gray, 1859; Li, 1952; Graham, 1972; Boufford and Spongberg, 1983; Wu, 1983; Tiffney, 1985a, 1985b), relationships among taxa displaying the disjunction remain obscure. Understanding phylogenetic relationships is, however, a prerequisite for historical biogeographic analyses of this distributional pattern. To understand better the relationships of taxa displaying this intercontinental disjunction, phylogenetic analyses were conducted using a variety of DNA data sets for species of four genera (Cornus, Boykinia, Tiarella, and Trautvetteria) that occur in eastern Asia, eastern North America, and western North America. An area cladogram was constructed for each of the four genera, all of which show a similar pattern of relationship: the eastern Asian species are sister to all North American species. An identical phylogenetic pattern is also found in three other taxa exhibiting this disjunction (Aralia sect. Aralia, Calycanthus, and Adiantum pedatum). The congruent phylogenetic pattern found in these seven diverse genera raises the possibility of a common origin of the eastern Asia, eastern and western North America disjunction. The data are in agreement with the long-standing hypothesis that this well-known floristic disjunction represents the fragmentation of a once continuous Mixed Mesophytic forest community and suggest that the disjunction may have involved only two major vicariance events: an initial split between Eurasia and North America, followed by the isolation of floras between eastern and western North America. However, congruence between phylogenies and geographic distributions does not necessarily indicate an identical phytogeographic history. Taxa exhibiting the same phylogenetic pattern may have
BLAST-EXPLORER helps you building datasets for phylogenetic analysis
Directory of Open Access Journals (Sweden)
Claverie Jean-Michel
2010-01-01
Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr
Phylogenetic and biogeographic analysis of sphaerexochine trilobites.
Directory of Open Access Journals (Sweden)
Curtis R Congreve
Full Text Available BACKGROUND: Sphaerexochinae is a speciose and widely distributed group of cheirurid trilobites. Their temporal range extends from the earliest Ordovician through the Silurian, and they survived the end Ordovician mass extinction event (the second largest mass extinction in Earth history. Prior to this study, the individual evolutionary relationships within the group had yet to be determined utilizing rigorous phylogenetic methods. Understanding these evolutionary relationships is important for producing a stable classification of the group, and will be useful in elucidating the effects the end Ordovician mass extinction had on the evolutionary and biogeographic history of the group. METHODOLOGY/PRINCIPAL FINDINGS: Cladistic parsimony analysis of cheirurid trilobites assigned to the subfamily Sphaerexochinae was conducted to evaluate phylogenetic patterns and produce a hypothesis of relationship for the group. This study utilized the program TNT, and the analysis included thirty-one taxa and thirty-nine characters. The results of this analysis were then used in a Lieberman-modified Brooks Parsimony Analysis to analyze biogeographic patterns during the Ordovician-Silurian. CONCLUSIONS/SIGNIFICANCE: The genus Sphaerexochus was found to be monophyletic, consisting of two smaller clades (one composed entirely of Ordovician species and another composed of Silurian and Ordovician species. By contrast, the genus Kawina was found to be paraphyletic. It is a basal grade that also contains taxa formerly assigned to Cydonocephalus. Phylogenetic patterns suggest Sphaerexochinae is a relatively distinctive trilobite clade because it appears to have been largely unaffected by the end Ordovician mass extinction. Finally, the biogeographic analysis yields two major conclusions about Sphaerexochus biogeography: Bohemia and Avalonia were close enough during the Silurian to exchange taxa; and during the Ordovician there was dispersal between Eastern Laurentia and
Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments
DEFF Research Database (Denmark)
Torti, Andrea
indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...
Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
Douglas B. Young
2015-03-01
Full Text Available Comparison of genome sequences from clinical isolates of Mycobacterium tuberculosis with phylogenetically-related pathogens Mycobacterium marinum, Mycobacterium kansasii and Mycobacterium leprae reveals diversity amongst genes associated with vitamin B12-related metabolism. Diversity is generated by gene deletion events, differential acquisition of genes by horizontal transfer, and single nucleotide polymorphisms with predicted impact on protein function and transcriptional regulation. Differences in the B12 synthesis pathway, methionine biosynthesis, fatty acid catabolism, and DNA repair and replication are consistent with adaptations to different environmental niches and pathogenic lifestyles. While there is no evidence of further gene acquisition during expansion of the M. tuberculosis complex, the emergence of other forms of genetic diversity provides insights into continuing host-pathogen co-evolution and has the potential to identify novel targets for disease intervention.
Genetic diversity of archaea in deep-sea hydrothermal vent environments.
Takai, K; Horikoshi, K
1999-08-01
Molecular phylogenetic analysis of naturally occurring archaeal communities in deep-sea hydrothermal vent environments was carried out by PCR-mediated small subunit rRNA gene (SSU rDNA) sequencing. As determined through partial sequencing of rDNA clones amplified with archaea-specific primers, the archaeal populations in deep-sea hydrothermal vent environments showed a great genetic diversity, and most members of these populations appeared to be uncultivated and unidentified organisms. In the phylogenetic analysis, a number of rDNA sequences obtained from deep-sea hydrothermal vents were placed in deep lineages of the crenarchaeotic phylum prior to the divergence of cultivated thermophilic members of the crenarchaeota or between thermophilic members of the euryarchaeota and members of the methanogen-halophile clade. Whole cell in situ hybridization analysis suggested that some microorganisms of novel phylotypes predicted by molecular phylogenetic analysis were likely present in deep-sea hydrothermal vent environments. These findings expand our view of the genetic diversity of archaea in deep-sea hydrothermal vent environments and of the phylogenetic organization of archaea.
Guevara Andino, Juan Ernesto; Pitman, Nigel C A; Ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V A
2017-11-01
Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one-hectare plots in terra firme forests of Ecuadorian Amazon. In these plots, we tagged, collected, and identified every single adult tree with dbh ≥10 cm. These data were combined with a regional community phylogenetic tree to calculate different phylogenetic diversity (PD) metrics in order to create spatial models. We used Loess regression to estimate the spatial variation of taxonomic and phylogenetic beta diversity as well as phylogenetic endemism and evolutionary distinctiveness. We found evidence for the definition of three floristic districts in the Ecuadorian Amazon, supported by both taxonomic and phylogenetic diversity data. Areas with high levels of phylogenetic endemism and evolutionary distinctiveness in Ecuadorian Amazon forests are unprotected. Furthermore, these areas are severely threatened by proposed plans of oil and mining extraction at large scales and should be prioritized in conservation planning for this region.
Plant traits determine the phylogenetic structure of arbuscular mycorrhizal fungal communities.
López-García, Álvaro; Varela-Cervero, Sara; Vasar, Martti; Öpik, Maarja; Barea, José M; Azcón-Aguilar, Concepción
2017-12-01
Functional diversity in ecosystems has traditionally been studied using aboveground plant traits. Despite the known effect of plant traits on the microbial community composition, their effects on the microbial functional diversity are only starting to be assessed. In this study, the phylogenetic structure of arbuscular mycorrhizal (AM) fungal communities associated with plant species differing in life cycle and growth form, that is, plant life forms, was determined to unravel the effect of plant traits on the functional diversity of this fungal group. The results of the 454 pyrosequencing showed that the AM fungal community composition differed across plant life forms and this effect was dependent on the soil collection date. Plants with ruderal characteristics tended to associate with phylogenetically clustered AM fungal communities. By contrast, plants with resource-conservative traits associated with phylogenetically overdispersed AM fungal communities. Additionally, the soil collected in different seasons yielded AM fungal communities with different phylogenetic dispersion. In summary, we found that the phylogenetic structure, and hence the functional diversity, of AM fungal communities is dependent on plant traits. This finding adds value to the use of plant traits for the evaluation of belowground ecosystem diversity, functions and processes. © 2017 John Wiley & Sons Ltd.
Takamiya, Tomoko; Wongsawad, Pheravut; Sathapattayanon, Apirada; Tajima, Natsuko; Suzuki, Shunichiro; Kitamura, Saki; Shioda, Nao; Handa, Takashi; Kitanaka, Susumu; Iijima, Hiroshi; Yukawa, Tomohisa
2014-01-01
It is always difficult to construct coherent classification systems for plant lineages having diverse morphological characters. The genus Dendrobium, one of the largest genera in the Orchidaceae, includes ∼1100 species, and enormous morphological diversification has hindered the establishment of consistent classification systems covering all major groups of this genus. Given the particular importance of species in Dendrobium section Dendrobium and allied groups as floriculture and crude drug genetic resources, there is an urgent need to establish a stable classification system. To clarify phylogenetic relationships in Dendrobium section Dendrobium and allied groups, we analysed the macromolecular characters of the group. Phylogenetic analyses of 210 taxa of Dendrobium were conducted on DNA sequences of internal transcribed spacer (ITS) regions of 18S–26S nuclear ribosomal DNA and the maturase-coding gene (matK) located in an intron of the plastid gene trnK using maximum parsimony and Bayesian methods. The parsimony and Bayesian analyses revealed 13 distinct clades in the group comprising section Dendrobium and its allied groups. Results also showed paraphyly or polyphyly of sections Amblyanthus, Aporum, Breviflores, Calcarifera, Crumenata, Dendrobium, Densiflora, Distichophyllae, Dolichocentrum, Holochrysa, Oxyglossum and Pedilonum. On the other hand, the monophyly of section Stachyobium was well supported. It was found that many of the morphological characters that have been believed to reflect phylogenetic relationships are, in fact, the result of convergence. As such, many of the sections that have been recognized up to this point were found to not be monophyletic, so recircumscription of sections is required. PMID:25107672
A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.
Takahashi, Tetsumi; Moreno, Edmundo
2015-12-01
The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.
József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor
2010-01-01
Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...
BioMatriX: Sequence analysis, structure visualization, phylogenetics ...
African Journals Online (AJOL)
bmx-biomatrix.blogspot.com) developed for biological science community to augment scientific research regarding genomics, proteomics, phylogenetics and linkage analysis in one platform. BioMatriX offers multi-functional services to perform ...
Phylogenetic relationships within and among Brassica species from ...
African Journals Online (AJOL)
Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...
A guide to phylogenetic metrics for conservation, community ecology and macroecology
Cadotte, Marc W.; Carvalho, Silvia B.; Davies, T. Jonathan; Ferrier, Simon; Fritz, Susanne A.; Grenyer, Rich; Helmus, Matthew R.; Jin, Lanna S.; Mooers, Arne O.; Pavoine, Sandrine; Purschke, Oliver; Redding, David W.; Rosauer, Dan F.; Winter, Marten; Mazel, Florent
2016-01-01
ABSTRACT The use of phylogenies in ecology is increasingly common and has broadened our understanding of biological diversity. Ecological sub‐disciplines, particularly conservation, community ecology and macroecology, all recognize the value of evolutionary relationships but the resulting development of phylogenetic approaches has led to a proliferation of phylogenetic diversity metrics. The use of many metrics across the sub‐disciplines hampers potential meta‐analyses, syntheses, and generalizations of existing results. Further, there is no guide for selecting the appropriate metric for a given question, and different metrics are frequently used to address similar questions. To improve the choice, application, and interpretation of phylo‐diversity metrics, we organize existing metrics by expanding on a unifying framework for phylogenetic information. Generally, questions about phylogenetic relationships within or between assemblages tend to ask three types of question: how much; how different; or how regular? We show that these questions reflect three dimensions of a phylogenetic tree: richness, divergence, and regularity. We classify 70 existing phylo‐diversity metrics based on their mathematical form within these three dimensions and identify ‘anchor’ representatives: for α‐diversity metrics these are PD (Faith's phylogenetic diversity), MPD (mean pairwise distance), and VPD (variation of pairwise distances). By analysing mathematical formulae and using simulations, we use this framework to identify metrics that mix dimensions, and we provide a guide to choosing and using the most appropriate metrics. We show that metric choice requires connecting the research question with the correct dimension of the framework and that there are logical approaches to selecting and interpreting metrics. The guide outlined herein will help researchers navigate the current jungle of indices. PMID:26785932
Phylogenetic and chemical diversity of MAR4 streptomycete lineage
Directory of Open Access Journals (Sweden)
Marisa Paulino
2014-06-01
To date, phylogenetic characterization of 6 representative isolates, based on partial sequence of gene encoding 16S rRNA, confirm that these strains belong to the specie Streptomyces aculeolatus. Figure 2. Neighbour-joining phylogenetic tree created from 6 partial 16S rRNA gene sequence from Streptomyces aculeolatus strains cultured from Madeira Archipelago, based on 1000 bootstrap replicates. BLAST matches (deposited in GenBank are included with species and strain name followed by accession number. Verrucosispora maris and Micromonospora aurantiaca were used as outgroups.
Increased phylogenetic resolution using target enrichment in Rubus
Phylogenetic analyses in Rubus L. have been challenging due to polyploidy, hybridization, and apomixis within the genus. Wide morphological diversity occurs within and between species, contributing to challenges at lower and higher systematic levels. Phylogenetic inferences to date have been based o...
Guo, Zhong-Long; Wang, Juan; Shen, Yu-Ying
2015-01-01
Insect mitochondrial genome (mitogenome) are the most extensively used genetic information for molecular evolution, phylogenetics and population genetics. Pentatomomorpha (>14,000 species) is the second largest infraorder of Heteroptera and of great economic importance. To better understand the diversity and phylogeny within Pentatomomorpha, we sequenced and annotated the complete mitogenome of Corizus tetraspilus (Hemiptera: Rhopalidae), an important pest of alfalfa in China. We analyzed the main features of the C. tetraspilus mitogenome, and provided a comparative analysis with four other Coreoidea species. Our results reveal that gene content, gene arrangement, nucleotide composition, codon usage, rRNA structures and sequences of mitochondrial transcription termination factor are conserved in Coreoidea. Comparative analysis shows that different protein-coding genes have been subject to different evolutionary rates correlated with the G+C content. All the transfer RNA genes found in Coreoidea have the typical clover leaf secondary structure, except for trnS1 (AGN) which lacks the dihydrouridine (DHU) arm and possesses a unusual anticodon stem (9 bp vs. the normal 5 bp). The control regions (CRs) among Coreoidea are highly variable in size, of which the CR of C. tetraspilus is the smallest (440 bp), making the C. tetraspilus mitogenome the smallest (14,989 bp) within all completely sequenced Coreoidea mitogenomes. No conserved motifs are found in the CRs of Coreoidea. In addition, the A+T content (60.68%) of the CR of C. tetraspilus is much lower than that of the entire mitogenome (74.88%), and is lowest among Coreoidea. Phylogenetic analyses based on mitogenomic data support the monophyly of each superfamily within Pentatomomorpha, and recognize a phylogenetic relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))). PMID:26042898
Directory of Open Access Journals (Sweden)
Benjamin R. LaFrentz
2018-03-01
Full Text Available Columnaris disease, caused by the Gram-negative bacterium Flavobacterium columnare, is one of the most prevalent fish diseases worldwide. An exceptionally high level of genetic diversity among isolates of F. columnare has long been recognized, whereby six established genomovars have been described to date. However, little has been done to quantify or characterize this diversity further in a systematic fashion. The objective of this research was to perform phylogenetic analyses of 16S rRNA and housekeeping gene sequences to decipher the genetic diversity of F. columnare. Fifty isolates and/or genomes of F. columnare, originating from diverse years, geographic locations, fish hosts, and representative of the six genomovars were analyzed in this study. A multilocus phylogenetic analysis (MLPA of the 16S rRNA and six housekeeping genes supported four distinct F. columnare genetic groups. There were associations between genomovar and genetic group, but these relationships were imperfect indicating that genomovar assignment does not accurately reflect F. columnare genetic diversity. To expand the dataset, an additional 90 16S rRNA gene sequences were retrieved from GenBank and a phylogenetic analysis of this larger dataset also supported the establishment of four genetic groups. Examination of isolate historical data indicated biological relevance to the identified genetic diversity, with some genetic groups isolated preferentially from specific fish species or families. It is proposed that F. columnare isolates be assigned to the four genetic groups defined in this study rather than genomovar in order to facilitate a standard nomenclature across the scientific community. An increased understanding of which genetic groups are most prevalent in different regions and/or aquaculture industries may allow for the development of improved targeted control and treatment measures for columnaris disease.
Chalmandrier, L; Münkemüller, T; Lavergne, S; Thuiller, W
2015-01-01
Different assembly processes drive the spatial structure of meta-communities (beta-diversity). Recently, functional and phylogenetic diversities have been suggested as indicators of these assembly processes. Assuming that diversity is a good proxy for niche overlap, high beta-diversity along environmental gradients should be the result of environmental filtering while low beta-diversity should stem from competitive interactions. So far, studies trying to disentangle the relative importance of these assembly processes have provided mixed results. One reason for this may be that these studies often rely on a single measure of diversity and thus implicitly make a choice on how they account for species relative abundances and how species similarities are captured by functional traits or phylogeny. Here, we tested the effect of gradually scaling the importance of dominance (the weight given to dominant vs. rare species) and species similarity (the weight given to small vs. large similarities) on resulting beta-diversity patterns of an alpine plant meta-community. To this end, we combined recent extensions of the Hill numbers framework with Pagel's phylogenetic tree transformation approach. We included functional (based on the leaf-height-seed spectrum) and phylogenetic facets of beta-diversity in our analysis and explicitly accounted for effects of environmental and spatial covariates. We found that functional beta-diversity, was high when the same weight was given to dominant vs. rare species and to large vs. small species' similarities. In contrast, phylogenetic beta-diversity was low when greater weight was given to dominant species and small species' similarities. Those results suggested that different environments along the gradients filtered different species according to their functional traits, while, the same competitive lineages dominated communities across the gradients. Our results highlight that functional vs. phylogenetic facets, presence-absence vs
Morphological characterization and phylogenetic distance among ...
African Journals Online (AJOL)
The genetic diversity was calculated with Nei and Li's index, and the phylogenetic tree (dendrogram) was generated with a neighbor-joining program. The dendrogram indicates the diversity of the genotypes, which are grouped into three distinctive large groups. The largest group includes species from the Mediolobivia and ...
Phylogenetic analysis of hepatitis B virus in pakistan
International Nuclear Information System (INIS)
Baig, S.; Hasnain, N.U.
2008-01-01
To identify the distribution pattern of Hepatitis B Virus (HBV) genotype in a group of patients and to study its phylogenetic divergence. Two hundred and one HBV infected patients were genotyped for this study. All HbsAg positive individuals, either healthy carriers or suffering from conditions such as acute or chronic hepatitis, cirrhosis and hepatocellular carcinoma were included. Hepatitis B patients co-infected with other hepatic viruses were excluded. Hepatitis B virus DNA was extracted from serum, and subjected to a nested PCR, using the primers type-specific for genotype detection. Phylogenetic analysis was performed in the pre-S1 through S genes of HBV. The divergence was studied through 15 sequences of 967bp submitted to the DBJ/EMBL/GenBank databases accessible under accession number EF584640 through EF584654. Out of 201 patients tested, 156 were males and 45 were females. Genotype D was the predominant type found in 128 (64%) patients followed by A in 47 (23%) and mixed A/D in 26 (13%). Phylogenetic analysis confirmed the dominance of genotype D and subtype ayw2. There was dominance of genotype D subtype ayw2. It had a close resemblance with HBV strains that circulate in Iran, India and Japan. (author)
Directory of Open Access Journals (Sweden)
R. Kann
2006-06-01
Full Text Available Feline immunodeficiency virus (FIV, a lentivirus, is an important pathogen of domestic cats around the world and has many similarities to human immunodeficiency virus (HIV. A characteristic of these lentiviruses is their extensive genetic diversity, which has been an obstacle in the development of successful vaccines. Of the FIV genes, the envelope gene is the most variable and sequence differences in a portion of this gene have been used to define 5 FIV subtypes (A, B, C, D and E. In this study, the proviral DNA sequence of the V3-V5 region of the envelope gene was determined in blood samples from 31 FIV positive cats from 4 different regions of South Africa. Phylogenetic analysis demonstrated the presence of both subtypes A and C, with subtype A predominating. These findings contribute to the understanding of the genetic diversity of FIV.
Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure.
Zappi, Daniela C; Moro, Marcelo F; Meagher, Thomas R; Nic Lughadha, Eimear
2017-01-01
Old, climate-buffered infertile landscapes (Ocbils) have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil's campos rupestres (rupestrian grasslands) are home to almost 15% of Brazil's native flora in less than 0.8% of Brazil's territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ) and on ironstone substrates, commonly termed canga . Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC), which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be effective
Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure
Directory of Open Access Journals (Sweden)
Daniela C. Zappi
2017-12-01
Full Text Available Old, climate-buffered infertile landscapes (Ocbils have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil’s campos rupestres (rupestrian grasslands are home to almost 15% of Brazil’s native flora in less than 0.8% of Brazil’s territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ and on ironstone substrates, commonly termed canga. Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC, which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be
International Nuclear Information System (INIS)
Sarwar, S.; Khalid, N.; Dentinger, B.M.
2016-01-01
Fleshy pored mushrooms is the name given to boletes due to their porous hymenium and fleshy nature. These are ectomycorrhizal basidiomycetes found in all continents except Antarctica. These mushrooms are important economically due to their edibility and medicinal value. This research work highlights the diversity of boletes in Pakistan and their correct identification by using molecular phylogenetic techniques. Western Himalayan range (WHR) of Pakistan is considered as diversity rich area. During present investigation regarding diversity of boletes in these areas, two bolete taxa viz. Hortiboletus rubellus and Neoboletus luridiformis were found under conifers. These mushrooms were collected and analyzed morphologically as well as phylogenetically by using Internal Transcribed Spacer (ITS) region of nrDNA sequences, and compared with their allies. All description and comparison with related taxa is provided in detail. These boletes are first time analyzed using molecular method from Pakistan. (author)
Directory of Open Access Journals (Sweden)
Johannes Asplund-Samuelsson
Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.
Santos, Bráulio A; Tabarelli, Marcelo; Melo, Felipe P L; Camargo, José L C; Andrade, Ana; Laurance, Susan G; Laurance, William F
2014-01-01
Amazonian rainforests sustain some of the richest tree communities on Earth, but their ecological and evolutionary responses to human threats remain poorly known. We used one of the largest experimental datasets currently available on tree dynamics in fragmented tropical forests and a recent phylogeny of angiosperms to test whether tree communities have lost phylogenetic diversity since their isolation about two decades previously. Our findings revealed an overall trend toward phylogenetic impoverishment across the experimentally fragmented landscape, irrespective of whether tree communities were in 1-ha, 10-ha, or 100-ha forest fragments, near forest edges, or in continuous forest. The magnitude of the phylogenetic diversity loss was low (phylogenetic diversity, we observed a significant decrease of 50% in phylogenetic dispersion since forest isolation, irrespective of plot location. Analyses based on tree genera that have significantly increased (28 genera) or declined (31 genera) in abundance and basal area in the landscape revealed that increasing genera are more phylogenetically related than decreasing ones. Also, the loss of phylogenetic diversity was greater in tree communities where increasing genera proliferated and decreasing genera reduced their importance values, suggesting that this taxonomic replacement is partially underlying the phylogenetic impoverishment at the landscape scale. This finding has clear implications for the current debate about the role human-modified landscapes play in sustaining biodiversity persistence and key ecosystem services, such as carbon storage. Although the generalization of our findings to other fragmented tropical forests is uncertain, it could negatively affect ecosystem productivity and stability and have broader impacts on coevolved organisms.
Directory of Open Access Journals (Sweden)
M Syamsul Arifin Zein
2012-03-01
Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.
RAPD analysis for genetic diversity of two populations of Mystus ...
African Journals Online (AJOL)
STORAGESEVER
2009-09-01
Sep 1, 2009 ... and other aquatic ecosystem and the ecological complexes. ... is a property at the population level while the functional diversity concept ... warm water fish species, which are distributed all over the world. ..... Phylogenetic.
galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.
Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M
2004-06-12
The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se
Longnecker, K.; Sherr, B. F.; Sherr, E. B.
2005-01-01
We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters...
Keeping All the PIECES: Phylogenetically Informed Ex Situ Conservation of Endangered Species.
Larkin, Daniel J; Jacobi, Sarah K; Hipp, Andrew L; Kramer, Andrea T
2016-01-01
Ex situ conservation in germplasm and living collections is a major focus of global plant conservation strategies. Prioritizing species for ex situ collection is a necessary component of this effort for which sound strategies are needed. Phylogenetic considerations can play an important role in prioritization. Collections that are more phylogenetically diverse are likely to encompass more ecological and trait variation, and thus provide stronger conservation insurance and richer resources for future restoration efforts. However, phylogenetic criteria need to be weighed against other, potentially competing objectives. We used ex situ collection and threat rank data for North American angiosperms to investigate gaps in ex situ coverage and phylogenetic diversity of collections and to develop a flexible framework for prioritizing species across multiple objectives. We found that ex situ coverage of 18,766 North American angiosperm taxa was low with respect to the most vulnerable taxa: just 43% of vulnerable to critically imperiled taxa were in ex situ collections, far short of a year-2020 goal of 75%. In addition, species held in ex situ collections were phylogenetically clustered (P species been drawn at random. These patterns support incorporating phylogenetic considerations into ex situ prioritization in a manner balanced with other criteria, such as vulnerability. To meet this need, we present the 'PIECES' index (Phylogenetically Informed Ex situ Conservation of Endangered Species). PIECES integrates phylogenetic considerations into a flexible framework for prioritizing species across competing objectives using multi-criteria decision analysis. Applying PIECES to prioritizing ex situ conservation of North American angiosperms, we show strong return on investment across multiple objectives, some of which are negatively correlated with each other. A spreadsheet-based decision support tool for North American angiosperms is provided; this tool can be customized to
The Fair Proportion is a Shapley Value on phylogenetic networks too
Coronado, Tomás M.; Riera, Gabriel; Rosselló, Francesc
2018-01-01
The Fair Proportion of a species in a phylogenetic tree is a very simple measure that has been used to assess its value relative to the overall phylogenetic diversity represented by the tree. It has recently been proved by Fuchs and Jin to be equal to the Shapley Value of the coallitional game that sends each subset of species to its rooted Phylogenetic Diversity in the tree. We prove in this paper that this result extends to the natural translations of the Fair Proportion and the rooted Phyl...
Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.
Directory of Open Access Journals (Sweden)
Luis F Aguirre
Full Text Available Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups. Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for
Taxonomic and Phylogenetic Determinants of Functional Composition of Bolivian Bat Assemblages.
Aguirre, Luis F; Montaño-Centellas, Flavia A; Gavilanez, M Mercedes; Stevens, Richard D
2016-01-01
Understanding diversity patterns and the potential mechanisms driving them is a fundamental goal in ecology. Examination of different dimensions of biodiversity can provide insights into the relative importance of different processes acting upon biotas to shape communities. Unfortunately, patterns of diversity are still poorly understood in hyper-diverse tropical countries. Here, we assess spatial variation of taxonomic, functional and phylogenetic diversity of bat assemblages in one of the least studied Neotropical countries, Bolivia, and determine whether changes in biodiversity are explained by the replacement of species or functional groups, or by differences in richness (i.e., gain or loss of species or functional groups). Further, we evaluate the contribution of phylogenetic and taxonomic changes in the resulting patterns of functional diversity of bats. Using well-sampled assemblages from published studies we examine noctilionoid bats at ten study sites across five ecoregions in Bolivia. Bat assemblages differed from each other in all dimensions of biodiversity considered; however, diversity patterns for each dimension were likely structured by different mechanisms. Within ecoregions, differences were largely explained by species richness, suggesting that the gain or loss of species or functional groups (as opposed to replacement) was driving dissimilarity patterns. Overall, our results suggest that whereas evolutionary processes (i.e., historical connection and dispersal routes across Bolivia) create a template of diversity patterns across the country, ecological mechanisms modify these templates, decoupling the observed patterns of functional, taxonomic and phylogenetic diversity in Bolivian bats. Our results suggests that elevation represents an important source of variability among diversity patterns for each dimension of diversity considered. Further, we found that neither phylogenetic nor taxonomic diversity can fully account for patterns of functional
Mendes, Lucas William; Taketani, Rodrigo Gouvêa; Navarrete, Acácio Aparecido; Tsai, Siu Mui
2012-06-01
This study focused on the structure and composition of archaeal communities in sediments of tropical mangroves in order to obtain sufficient insight into two Brazilian sites from different locations (one pristine and another located in an urban area) and at different depth levels from the surface. Terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene fragments was used to scan the archaeal community structure, and 16S rRNA gene clone libraries were used to determine the community composition. Redundancy analysis of T-RFLP patterns revealed differences in archaeal community structure according to location, depth and soil attributes. Parameters such as pH, organic matter, potassium and magnesium presented significant correlation with general community structure. Furthermore, phylogenetic analysis revealed a community composition distributed differently according to depth where, in shallow samples, 74.3% of sequences were affiliated with Euryarchaeota and 25.7% were shared between Crenarchaeota and Thaumarchaeota, while for the deeper samples, 24.3% of the sequences were affiliated with Euryarchaeota and 75.7% with Crenarchaeota and Thaumarchaeota. Archaeal diversity measurements based on 16S rRNA gene clone libraries decreased with increasing depth and there was a greater difference between depths (25% of sequences shared). Taken together, our findings indicate that mangrove ecosystems support a diverse archaeal community; it might possibly be involved in nutrient cycles and are affected by sediment properties, depth and distinct locations. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Kanchanaketu, T; Sangduen, N; Toojinda, T; Hongtrakul, V
2012-04-13
Genetic analysis of 56 samples of Jatropha curcas L. collected from Thailand and other countries was performed using the methylation-sensitive amplification polymorphism (MSAP) technique. Nine primer combinations were used to generate MSAP fingerprints. When the data were interpreted as amplified fragment length polymorphism (AFLP) markers, 471 markers were scored. All 56 samples were classified into three major groups: γ-irradiated, non-toxic and toxic accessions. Genetic similarity among the samples was extremely high, ranging from 0.95 to 1.00, which indicated very low genetic diversity in this species. The MSAP fingerprint was further analyzed for DNA methylation polymorphisms. The results revealed differences in the DNA methylation level among the samples. However, the samples collected from saline areas and some species hybrids showed specific DNA methylation patterns. AFLP data were used, together with methylation-sensitive AFLP (MS-AFLP) data, to construct a phylogenetic tree, resulting in higher efficiency to distinguish the samples. This combined analysis separated samples previously grouped in the AFLP analysis. This analysis also distinguished some hybrids. Principal component analysis was also performed; the results confirmed the separation in the phylogenetic tree. Some polymorphic bands, involving both nucleotide and DNA methylation polymorphism, that differed between toxic and non-toxic samples were identified, cloned and sequenced. BLAST analysis of these fragments revealed differences in DNA methylation in some known genes and nucleotide polymorphism in chloroplast DNA. We conclude that MSAP is a powerful technique for the study of genetic diversity for organisms that have a narrow genetic base.
Lehours, Anne-Catherine; Evans, Paul; Bardot, Corinne; Joblin, Keith; Gérard, Fonty
2007-01-01
The compositions of archaeal and bacterial populations at different depths (60 m [mixolimnion-chemocline interface], 70 m [chemocline-subchemocline interface], 90 m, and 92 m [the water-sediment interface]) in the anoxic zone of the water column in Lake Pavin, a freshwater permanently stratified mountain lake in France, were determined. Phylogenetic trees were constructed from sequences to assess archaeal and bacterial diversity at the four sites. PMID:17261512
Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata
2003-01-01
The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826
Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity
Abdelmohsen, Usama Ramadan
2014-05-12
The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.
Actinomycetes from red sea sponges: Sources for chemical and phylogenetic diversity
Abdelmohsen, Usama Ramadan; Yang, Chen; Horn, Hannes; Hajjar, Dina A.; Ravasi, Timothy; Hentschel, Ute
2014-01-01
The diversity of actinomycetes associated with marine sponges collected off Fsar Reef (Saudi Arabia) was investigated in the present study. Forty-seven actinomycetes were cultivated and phylogenetically identified based on 16S rRNA gene sequencing and were assigned to 10 different actinomycete genera. Eight putatively novel species belonging to genera Kocuria, Mycobacterium, Nocardia, and Rhodococcus were identified based on sequence similarity values below 98.2% to other 16S rRNA gene sequences available in the NCBI database. PCR-based screening for biosynthetic genes including type I and type II polyketide synthases (PKS-I, PKS-II) as well as nonribosomal peptide synthetases (NRPS) showed that 20 actinomycete isolates encoded each at least one type of biosynthetic gene. The organic extracts of nine isolates displayed bioactivity against at least one of the test pathogens, which were Gram-positive and Gram-negative bacteria, fungi, human parasites, as well as in a West Nile Virus protease enzymatic assay. These results emphasize that marine sponges are a prolific resource for novel bioactive actinomycetes with potential for drug discovery. 2014 by the authors; licensee MDPI.
Almeida, Sara Miranda; Juen, Leandro; Sobral, Fernando Landa; Santos, Marcos Pérsio Dantas
2018-04-01
Passeriformes is the largest and most diverse avian order in the world and comprises the Passeri and Tyranni suborders. These suborders constitute a monophyletic group, but differ in their ecology and history of occupation of South America. We investigated the influence of biogeographic history on functional and phylogenetic diversities of Passeri and Tyranni in forest and savanna habitats in the Brazilian Amazon. We compiled species composition data for 34 Passeriformes assemblages, 12 in savannas and 22 in forests. We calculated the functional (Rao's quadratic entropy, FD Q ) and phylogenetic diversities (mean pairwise distance, MPD, and mean nearest taxon distance, MNTD), and the functional beta diversity to investigate the potential role of biogeographic history in shaping ecological traits and species lineages of both suborders. The functional diversity of Passeri was higher than for Tyranni in both habitats. The MPD for Tyranni was higher than for Passeri in forests; however, there was no difference between the suborders in savannas. In savannas, Passeri presented higher MNTD than Tyranni, while in forest areas, Tyranni assemblages showed higher MNTD than Passeri. We found a high functional turnover (~75%) between Passeri and Tyranni in both habitats. The high functional diversity of Passeri in both habitats is due to the high diversity of ecological traits exhibited by species of this group, which enables the exploitation of a wide variety of resources and foraging strategies. The higher Tyranni MPD and MNTD in forests is likely due to Tyranni being older settlers in this habitat, resulting in the emergence and persistence of more lineages. The higher Passeri MNTD in savannas can be explained by the existence of a larger number of different Passeri lineages adapted to this severe habitat. The high functional turnover between the suborders in both habitats suggests an ecological strategy to avoid niche overlap.
Directory of Open Access Journals (Sweden)
Jeffrey Rosenfeld
2016-03-01
Full Text Available Twenty one fully sequenced and well annotated insect genomes were used to construct genome content matrices for phylogenetic analysis and functional annotation of insect genomes. To examine the role of e-value cutoff in ortholog determination we used scaled e-value cutoffs and a single linkage clustering approach.. The present communication includes (1 a list of the genomes used to construct the genome content phylogenetic matrices, (2 a nexus file with the data matrices used in phylogenetic analysis, (3 a nexus file with the Newick trees generated by phylogenetic analysis, (4 an excel file listing the Core (CORE genes and Unique (UNI genes found in five insect groups, and (5 a figure showing a plot of consistency index (CI versus percent of unannotated genes that are apomorphies in the data set for gene losses and gains and bar plots of gains and losses for four consistency index (CI cutoffs.
DEFF Research Database (Denmark)
Machac, Antonin; Janda, Milan; Dunn, Robert R.
2011-01-01
A central focus of ecology and biogeography is to determine the factors that govern spatial variation in biodiversity. Here, we examined patterns of ant diversity along climatic gradients in three temperate montane systems: Great Smoky Mountains National Park (USA), Chiricahua Mountains (USA......), and Vorarlberg (Austria). To identify the factors which potentially shape these elevational diversity gradients, we analyzed patterns of community phylogenetic structure (i.e. the evolutionary relationships among species coexisting in local communities). We found that species at low-elevation sites tended...... to be evenly dispersed across phylogeny, suggesting that these communities are structured by interspecific competition. In contrast, species occurring at high-elevation sites tended to be more closely related than expected by chance, implying that these communities are structured primarily by environmental...
Soft-tissue anatomy of the extant hominoids: a review and phylogenetic analysis
Gibbs, S; Collard, M; Wood, B
2002-01-01
This paper reports the results of a literature search for information about the soft-tissue anatomy of the extant non-human hominoid genera, Pan, Gorilla, Pongo and Hylobates, together with the results of a phylogenetic analysis of these data plus comparable data for Homo. Information on the four extant non-human hominoid genera was located for 240 out of the 1783 soft-tissue structures listed in the Nomina Anatomica. Numerically these data are biased so that information about some systems (e.g. muscles) and some regions (e.g. the forelimb) are over-represented, whereas other systems and regions (e.g. the veins and the lymphatics of the vascular system, the head region) are either under-represented or not represented at all. Screening to ensure that the data were suitable for use in a phylogenetic analysis reduced the number of eligible soft-tissue structures to 171. These data, together with comparable data for modern humans, were converted into discontinuous character states suitable for phylogenetic analysis and then used to construct a taxon-by-character matrix. This matrix was used in two tests of the hypothesis that soft-tissue characters can be relied upon to reconstruct hominoid phylogenetic relationships. In the first, parsimony analysis was used to identify cladograms requiring the smallest number of character state changes. In the second, the phylogenetic bootstrap was used to determine the confidence intervals of the most parsimonious clades. The parsimony analysis yielded a single most parsimonious cladogram that matched the molecular cladogram. Similarly the bootstrap analysis yielded clades that were compatible with the molecular cladogram; a (Homo, Pan) clade was supported by 95% of the replicates, and a (Gorilla, Pan, Homo) clade by 96%. These are the first hominoid morphological data to provide statistically significant support for the clades favoured by the molecular evidence. PMID:11833653
Molecular analysis of microbial diversity in advanced caries.
Chhour, Kim-Ly; Nadkarni, Mangala A; Byun, Roy; Martin, F Elizabeth; Jacques, Nicholas A; Hunter, Neil
2005-02-01
Real-time PCR analysis of the total bacterial load in advanced carious lesions has shown that the total load exceeds the number of cultivable bacteria. This suggests that an unresolved complexity exists in bacteria associated with advanced caries. In this report, the profile of the microflora of carious dentine was explored by using DNA extracted from 10 lesions selected on the basis of comparable total microbial load and on the relative abundance of Prevotella spp. Using universal primers for the 16S rRNA gene, PCR amplicons were cloned, and approximately 100 transformants were processed for each lesion. Phylogenetic analysis of 942 edited sequences demonstrated the presence of 75 species or phylotypes in the 10 carious lesions. Up to 31 taxa were represented in each sample. A diverse array of lactobacilli were found to comprise 50% of the species, with prevotellae also abundant, comprising 15% of the species. Other taxa present in a number of lesions or occurring with high abundance included Selenomonas spp., Dialister spp., Fusobacterium nucleatum, Eubacterium spp., members of the Lachnospiraceae family, Olsenella spp., Bifidobacterium spp., Propionibacterium sp., and Pseudoramibacter alactolyticus. The mechanisms by which such diverse patterns of bacteria extend carious lesions, including the aspect of infection of the vital dental pulp, remain unclear.
Kooyman, Robert M.; Rossetto, Maurizio; Sauquet, Hervé; Laffan, Shawn W.
2013-01-01
Objectives Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. Methods We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD), phylogenetic endemism (PE) and phylogenetic structure (net relatedness index; NRI). Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. Results Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance) in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. Conclusions/Significance Concentrations of rainforest evolutionary history (phylo-diversity) were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community distribution, our findings of
Directory of Open Access Journals (Sweden)
Robert M Kooyman
Full Text Available OBJECTIVES: Identify patterns of change in species distributions, diversity, concentrations of evolutionary history, and assembly of Australian rainforests. METHODS: We used the distribution records of all known rainforest woody species in Australia across their full continental extent. These were analysed using measures of species richness, phylogenetic diversity (PD, phylogenetic endemism (PE and phylogenetic structure (net relatedness index; NRI. Phylogenetic structure was assessed using both continental and regional species pools. To test the influence of growth-form, freestanding and climbing plants were analysed independently, and in combination. RESULTS: Species richness decreased along two generally orthogonal continental axes, corresponding with wet to seasonally dry and tropical to temperate habitats. The PE analyses identified four main areas of substantially restricted phylogenetic diversity, including parts of Cape York, Wet Tropics, Border Ranges, and Tasmania. The continental pool NRI results showed evenness (species less related than expected by chance in groups of grid cells in coastally aligned areas of species rich tropical and sub-tropical rainforest, and in low diversity moist forest areas in the south-east of the Great Dividing Range and in Tasmania. Monsoon and drier vine forests, and moist forests inland from upland refugia showed phylogenetic clustering, reflecting lower diversity and more relatedness. Signals for evenness in Tasmania and clustering in northern monsoon forests weakened in analyses using regional species pools. For climbing plants, values for NRI by grid cell showed strong spatial structuring, with high diversity and PE concentrated in moist tropical and subtropical regions. CONCLUSIONS/SIGNIFICANCE: Concentrations of rainforest evolutionary history (phylo-diversity were patchily distributed within a continuum of species distributions. Contrasting with previous concepts of rainforest community
Characterization and phylogenetic analysis of α-gliadin gene ...
Indian Academy of Sciences (India)
Supplementary data: Characterization and phylogenetic analysis of α-gliadin gene sequences reveals significant genomic divergence in Triticeae species. Guang-Rong Li, Tao Lang, En-Nian Yang, Cheng Liu ... The MITE insertion at the 3 UTR is boxed. Figure 2. The secondary structure of MITE insertion in HM452949.
Directory of Open Access Journals (Sweden)
Bertoni Giuseppe
2011-06-01
Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.
REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era
Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.
2009-01-01
The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722
Structural and regulatory diversity shape HLA-C protein expression levels
DEFF Research Database (Denmark)
Kaur, Gurman; Gras, Stephanie; Mobbs, Jesse I
2017-01-01
expression of HLA-C allomorphs at the cell surface by influencing the structure of the peptide-binding cleft and the diversity of peptides bound by the HLA-C molecules. Together with a phylogenetic analysis, these results highlight the diversity and long-term balancing selection of regulatory factors...
Ding, Bo; Yin, Ying; Zhang, Fengli; Li, Zhiyong
2011-08-01
Sponge-associated fungi represent an important source of marine natural products, but little is known about the fungal diversity and the relationship of sponge-fungal association, especially no research on the fungal diversity in the South China Sea sponge has been reported. In this study, a total of 111 cultivable fungi strains were isolated from two South China Sea sponges Clathrina luteoculcitella and Holoxea sp. using eight different media. Thirty-two independent representatives were selected for analysis of phylogenetic diversity according to ARDRA and morphological characteristics. The culturable fungal communities consisted of at least 17 genera within ten taxonomic orders of two phyla (nine orders of the phylum Ascomycota and one order of the phylum Basidiomycota) including some potential novel marine fungi. Particularly, eight genera of Apiospora, Botryosphaeria, Davidiella, Didymocrea, Lentomitella, Marasmius, Pestalotiopsis, and Rhizomucor were isolated from sponge for the first time. Sponge C. luteoculcitella has greater culturable fungal diversity than sponge Holoxea sp. Five genera of Aspergillus, Davidiella, Fusarium, Paecilomyces, and Penicillium were isolated from both sponges, while 12 genera of Apiospora, Botryosphaeria, Candida, Marasmius, Cladosporium, Didymocrea, Hypocrea, Lentomitella, Nigrospora, Pestalotiopsis, Rhizomucor, and Scopulariopsis were isolated from sponge C. luteoculcitella only. Order Eurotiales especially genera Penicillium, Aspergillus, and order Hypocreales represented the dominant culturable fungi in these two South China Sea sponges. Nigrospora oryzae strain PF18 isolated from sponge C. luteoculcitella showed a strong and broad spectrum antimicrobial activities suggesting the potential for antimicrobial compounds production.
Phylogenetic relationships among Maloideae species
The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...
Asakura, H; Makino, S; Kobori, H; Watarai, M; Shirahata, T; Ikeda, T; Takeshi, K
2001-08-01
Nucleotide sequences of Shiga toxin (Stx) genes in STEC from various origins were determined and characterized by phylogenetic analysis based on Shiga toxin (Stx) with those deposited in GenBank. The phylogenetic trees placed Stx1 and Stx2 into two and five groups respectively, and indicated that Stx1 in sheep-origin STEC were placed into a different group from those in other STEC, and that Stx2 of deer-origin STEC also belonged to the unique group and appeared to be distantly related to human-origin STEC. On the other hand, Stx of STEC isolated from cattle, seagulls and flies were closely related to those of human-origin STEC. Such a diversity of Stx suggested that STEC might be widely disseminated in many animal species, and be dependent on their host species or their habitat. In addition, the active sites in both toxins were compared; the active sites in both subunits of Stx in all the animal-origin STEC were identical to those in human-origin STEC, suggesting that all the toxin of STEC from animals might be also cytotoxic, and therefore, such animal-origin STEC might have potential pathogenicity for humans.
REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era
Directory of Open Access Journals (Sweden)
Guy Leonard
2009-01-01
Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.
Spatial phylogenetics of the vascular flora of Chile.
Scherson, Rosa A; Thornhill, Andrew H; Urbina-Casanova, Rafael; Freyman, William A; Pliscoff, Patricio A; Mishler, Brent D
2017-07-01
Current geographic patterns of biodiversity are a consequence of the evolutionary history of the lineages that comprise them. This study was aimed at exploring how evolutionary features of the vascular flora of Chile are distributed across the landscape. Using a phylogeny at the genus level for 87% of the Chilean vascular flora, and a geographic database of sample localities, we calculated phylogenetic diversity (PD), phylogenetic endemism (PE), relative PD (RPD), and relative PE (RPE). Categorical Analyses of Neo- and Paleo-Endemism (CANAPE) were also performed, using a spatial randomization to assess statistical significance. A cluster analysis using range-weighted phylogenetic turnover was used to compare among grid cells, and with known Chilean bioclimates. PD patterns were concordant with known centers of high taxon richness and the Chilean biodiversity hotspot. In addition, several other interesting areas of concentration of evolutionary history were revealed as potential conservation targets. The south of the country shows areas of significantly high RPD and a concentration of paleo-endemism, and the north shows areas of significantly low PD and RPD, and a concentration of neo-endemism. Range-weighted phylogenetic turnover shows high congruence with the main macrobioclimates of Chile. Even though the study was done at the genus level, the outcome provides an accurate outline of phylogenetic patterns that can be filled in as more fine-scaled information becomes available. Copyright © 2017 Elsevier Inc. All rights reserved.
Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad
2017-01-01
Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633
Directory of Open Access Journals (Sweden)
Marisa Skaljac
2017-10-01
Full Text Available Bemisia tabaci (Gennadius, Trialeurodes vaporariorum (Westwood, and Siphoninus phillyreae (Haliday are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia, which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.
Phylogenetic stratigraphy in the Guerrero Negro hypersaline microbial mat.
Harris, J Kirk; Caporaso, J Gregory; Walker, Jeffrey J; Spear, John R; Gold, Nicholas J; Robertson, Charles E; Hugenholtz, Philip; Goodrich, Julia; McDonald, Daniel; Knights, Dan; Marshall, Paul; Tufo, Henry; Knight, Rob; Pace, Norman R
2013-01-01
The microbial mats of Guerrero Negro (GN), Baja California Sur, Mexico historically were considered a simple environment, dominated by cyanobacteria and sulfate-reducing bacteria. Culture-independent rRNA community profiling instead revealed these microbial mats as among the most phylogenetically diverse environments known. A preliminary molecular survey of the GN mat based on only ∼1500 small subunit rRNA gene sequences discovered several new phylum-level groups in the bacterial phylogenetic domain and many previously undetected lower-level taxa. We determined an additional ∼119,000 nearly full-length sequences and 28,000 >200 nucleotide 454 reads from a 10-layer depth profile of the GN mat. With this unprecedented coverage of long sequences from one environment, we confirm the mat is phylogenetically stratified, presumably corresponding to light and geochemical gradients throughout the depth of the mat. Previous shotgun metagenomic data from the same depth profile show the same stratified pattern and suggest that metagenome properties may be predictable from rRNA gene sequences. We verify previously identified novel lineages and identify new phylogenetic diversity at lower taxonomic levels, for example, thousands of operational taxonomic units at the family-genus levels differ considerably from known sequences. The new sequences populate parts of the bacterial phylogenetic tree that previously were poorly described, but indicate that any comprehensive survey of GN diversity has only begun. Finally, we show that taxonomic conclusions are generally congruent between Sanger and 454 sequencing technologies, with the taxonomic resolution achieved dependent on the abundance of reference sequences in the relevant region of the rRNA tree of life.
International Nuclear Information System (INIS)
Siddique, Naila; Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul
2013-01-01
Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic 112 GRQGRL 117 and velogenic 112 RRQKRF 117 along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks
galaxieEST: addressing EST identity through automated phylogenetic analysis.
Nilsson, R Henrik; Rajashekar, Balaji; Larsson, Karl-Henrik; Ursing, Björn M
2004-07-05
Research involving expressed sequence tags (ESTs) is intricately coupled to the existence of large, well-annotated sequence repositories. Comparatively complete and satisfactory annotated public sequence libraries are, however, available only for a limited range of organisms, rendering the absence of sequences and gene structure information a tangible problem for those working with taxa lacking an EST or genome sequencing project. Paralogous genes belonging to the same gene family but distinguished by derived characteristics are particularly prone to misidentification and erroneous annotation; high but incomplete levels of sequence similarity are typically difficult to interpret and have formed the basis of many unsubstantiated assumptions of orthology. In these cases, a phylogenetic study of the query sequence together with the most similar sequences in the database may be of great value to the identification process. In order to facilitate this laborious procedure, a project to employ automated phylogenetic analysis in the identification of ESTs was initiated. galaxieEST is an open source Perl-CGI script package designed to complement traditional similarity-based identification of EST sequences through employment of automated phylogenetic analysis. It uses a series of BLAST runs as a sieve to retrieve nucleotide and protein sequences for inclusion in neighbour joining and parsimony analyses; the output includes the BLAST output, the results of the phylogenetic analyses, and the corresponding multiple alignments. galaxieEST is available as an on-line web service for identification of fungal ESTs and for download / local installation for use with any organism group at http://galaxie.cgb.ki.se/galaxieEST.html. By addressing sequence relatedness in addition to similarity, galaxieEST provides an integrative view on EST origin and identity, which may prove particularly useful in cases where similarity searches return one or more pertinent, but not full, matches and
Jun, Se-Ran; Wassenaar, Trudy M; Nookaew, Intawat; Hauser, Loren; Wanchai, Visanu; Land, Miriam; Timm, Collin M; Lu, Tse-Yuan S; Schadt, Christopher W; Doktycz, Mitchel J; Pelletier, Dale A; Ussery, David W
2016-01-01
The Pseudomonas genus contains a metabolically versatile group of organisms that are known to occupy numerous ecological niches, including the rhizosphere and endosphere of many plants. Their diversity influences the phylogenetic diversity and heterogeneity of these communities. On the basis of average amino acid identity, comparative genome analysis of >1,000 Pseudomonas genomes, including 21 Pseudomonas strains isolated from the roots of native Populus deltoides (eastern cottonwood) trees resulted in consistent and robust genomic clusters with phylogenetic homogeneity. All Pseudomonas aeruginosa genomes clustered together, and these were clearly distinct from other Pseudomonas species groups on the basis of pangenome and core genome analyses. In contrast, the genomes of Pseudomonas fluorescens were organized into 20 distinct genomic clusters, representing enormous diversity and heterogeneity. Most of our 21 Populus-associated isolates formed three distinct subgroups within the major P. fluorescens group, supported by pathway profile analysis, while two isolates were more closely related to Pseudomonas chlororaphis and Pseudomonas putida. Genes specific to Populus-associated subgroups were identified. Genes specific to subgroup 1 include several sensory systems that act in two-component signal transduction, a TonB-dependent receptor, and a phosphorelay sensor. Genes specific to subgroup 2 contain hypothetical genes, and genes specific to subgroup 3 were annotated with hydrolase activity. This study justifies the need to sequence multiple isolates, especially from P. fluorescens, which displays the most genetic variation, in order to study functional capabilities from a pangenomic perspective. This information will prove useful when choosing Pseudomonas strains for use to promote growth and increase disease resistance in plants. Copyright © 2015 Jun et al.
Fire modifies the phylogenetic structure of soil bacterial co-occurrence networks.
Pérez-Valera, Eduardo; Goberna, Marta; Faust, Karoline; Raes, Jeroen; García, Carlos; Verdú, Miguel
2017-01-01
Fire alters ecosystems by changing the composition and community structure of soil microbes. The phylogenetic structure of a community provides clues about its main assembling mechanisms. While environmental filtering tends to reduce the community phylogenetic diversity by selecting for functionally (and hence phylogenetically) similar species, processes like competitive exclusion by limiting similarity tend to increase it by preventing the coexistence of functionally (and phylogenetically) similar species. We used co-occurrence networks to detect co-presence (bacteria that co-occur) or exclusion (bacteria that do not co-occur) links indicative of the ecological interactions structuring the community. We propose that inspecting the phylogenetic structure of co-presence or exclusion links allows to detect the main processes simultaneously assembling the community. We monitored a soil bacterial community after an experimental fire and found that fire altered its composition, richness and phylogenetic diversity. Both co-presence and exclusion links were more phylogenetically related than expected by chance. We interpret such a phylogenetic clustering in co-presence links as a result of environmental filtering, while that in exclusion links reflects competitive exclusion by limiting similarity. This suggests that environmental filtering and limiting similarity operate simultaneously to assemble soil bacterial communities, widening the traditional view that only environmental filtering structures bacterial communities. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Environmental determinants and spatial mismatch of mammal diversity measures in Colombia
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Maya, J.F.; Arias-Alzate, A.; Granados-Peña, R.; Mancera-Rodriguez, N.J.; Ceballos, G.
2016-07-01
Including complementary diversity measures into ecological and conservation studies should improve our ability to link species assemblages to ecosystems. Recent measures such as phylogenetic and functional diversity have furthered our understanding of assemblage patterns of ecosystems and species, allowing improved inference of ecosystem function and conservation. We evaluated spatial patterns of taxonomic, phylogenetic and functional diversity of mammals in Colombia and identified their main environmental determinants, as well as interrelationships and spatial mismatch between the three measures. We found significant effects of elevation and precipitation on species richness, slope and species richness on phylogenetic diversity, and slope and phylogenetic diversity on functional diversity. We also identified a spatial mismatch of the three measures in some areas of the country: 12% of the country for species richness and 14% for phylogenetic and functional diversity. Our results highlight the importance of including species relationships within environmental drivers with biogeographical and distribution analyses and could facilitate selection of priority areas for conservation, especially when mismatch occurs between measures. (Author)
Genetic Diversity and Population Structure of Cowpea (Vigna unguiculata L. Walp).
Xiong, Haizheng; Shi, Ainong; Mou, Beiquan; Qin, Jun; Motes, Dennis; Lu, Weiguo; Ma, Jianbing; Weng, Yuejin; Yang, Wei; Wu, Dianxing
2016-01-01
The genetic diversity of cowpea was analyzed, and the population structure was estimated in a diverse set of 768 cultivated cowpea genotypes from the USDA GRIN cowpea collection, originally collected from 56 countries. Genotyping by sequencing was used to discover single nucleotide polymorphism (SNP) in cowpea and the identified SNP alleles were used to estimate the level of genetic diversity, population structure, and phylogenetic relationships. The aim of this study was to detect the gene pool structure of cowpea and to determine its relationship between different regions and countries. Based on the model-based ancestry analysis, the phylogenetic tree, and the principal component analysis, three well-differentiated genetic populations were postulated from 768 worldwide cowpea genotypes. According to the phylogenetic analyses between each individual, region, and country, we may trace the accession from off-original, back to the two candidate original areas (West and East of Africa) to predict the migration and domestication history during the cowpea dispersal and development. To our knowledge, this is the first report of the analysis of the genetic variation and relationship between globally cultivated cowpea genotypes. The results will help curators, researchers, and breeders to understand, utilize, conserve, and manage the collection for more efficient contribution to international cowpea research.
Rank, Leslie A; Walsh, Naomi M; Lim, Fang Yun; Gellman, Samuel H; Keller, Nancy P; Hull, Christina M
2018-01-01
Understanding the dimensions of fungal diversity has major implications for the control of diseases in humans, plants, and animals and in the overall health of ecosystems on the planet. One ancient evolutionary strategy organisms use to manage interactions with microbes, including fungi, is to produce host defense peptides (HDPs). HDPs and their synthetic analogs have been subjects of interest as potential therapeutic agents. Due to increases in fungal disease worldwide, there is great interest in developing novel antifungal agents. Here we describe activity of polymeric HDP analogs against fungi from 18 pathogenic genera composed of 41 species and 72 isolates. The synthetic polymers are members of the nylon-3 family (poly-β-amino acid materials). Three different nylon-3 polymers show high efficacy against surprisingly diverse fungi. Across the phylogenetic spectrum (with the exception of Aspergillus species), yeasts, dermatophytes, dimorphic fungi, and molds were all sensitive to the effects of these polymers. Even fungi intrinsically resistant to current antifungal drugs, such as the causative agents of mucormycosis ( Rhizopus spp.) and those with acquired resistance to azole drugs, showed nylon-3 polymer sensitivity. In addition, the emerging pathogens Pseudogymnoascus destructans (cause of white nose syndrome in bats) and Candida auris (cause of nosocomial infections of humans) were also sensitive. The three nylon-3 polymers exhibited relatively low toxicity toward mammalian cells. These findings raise the possibility that nylon-3 polymers could be useful against fungi for which there are only limited and/or no antifungal agents available at present. IMPORTANCE Fungi reside in all ecosystems on earth and impart both positive and negative effects on human, plant, and animal health. Fungal disease is on the rise worldwide, and there is a critical need for more effective and less toxic antifungal agents. Nylon-3 polymers are short, sequence random, poly
Guevara Andino, Juan Ernesto; Pitman, Nigel C. A.; ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V. A.
2017-01-01
Abstract Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one‐hectare plots in terra firme forests of Ecuadorian Amazon. In these plots...
Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu
2016-01-01
Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
William G. Parker
2016-01-01
Full Text Available Aetosauria is an early-diverging clade of pseudosuchians (crocodile-line archosaurs that had a global distribution and high species diversity as a key component of various Late Triassic terrestrial faunas. It is one of only two Late Triassic clades of large herbivorous archosaurs, and thus served a critical ecological role. Nonetheless, aetosaur phylogenetic relationships are still poorly understood, owing to an overreliance on osteoderm characters, which are often poorly constructed and suspected to be highly homoplastic. A new phylogenetic analysis of the Aetosauria, comprising 27 taxa and 83 characters, includes more than 40 new characters that focus on better sampling the cranial and endoskeletal regions, and represents the most comprenhensive phylogeny of the clade to date. Parsimony analysis recovered three most parsimonious trees; the strict consensus of these trees finds an Aetosauria that is divided into two main clades: Desmatosuchia, which includes the Desmatosuchinae and the Stagonolepidinae, and Aetosaurinae, which includes the Typothoracinae. As defined Desmatosuchinae now contains Neoaetosauroides engaeus and several taxa that were previously referred to the genus Stagonolepis, and a new clade, Desmatosuchini, is erected for taxa more closely related to Desmatosuchus. Overall support for some clades is still weak, and Partitioned Bremer Support (PBS is applied for the first time to a strictly morphological dataset demonstrating that this weak support is in part because of conflict in the phylogenetic signals of cranial versus postcranial characters. PBS helps identify homoplasy among characters from various body regions, presumably the result of convergent evolution within discrete anatomical modules. It is likely that at least some of this character conflict results from different body regions evolving at different rates, which may have been under different selective pressures.
Dornburg, Alex; Friedman, Matt; Near, Thomas J
2015-08-01
Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright
Bayesian models for comparative analysis integrating phylogenetic uncertainty
Directory of Open Access Journals (Sweden)
Villemereuil Pierre de
2012-06-01
Full Text Available Abstract Background Uncertainty in comparative analyses can come from at least two sources: a phylogenetic uncertainty in the tree topology or branch lengths, and b uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow and inflated significance in hypothesis testing (e.g. p-values will be too small. Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible
Bayesian models for comparative analysis integrating phylogenetic uncertainty
2012-01-01
Background Uncertainty in comparative analyses can come from at least two sources: a) phylogenetic uncertainty in the tree topology or branch lengths, and b) uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow) and inflated significance in hypothesis testing (e.g. p-values will be too small). Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible general purpose tool for
Ai, XianTao; Liang, YaJun; Wang, JunDuo; Zheng, JuYun; Gong, ZhaoLong; Guo, JiangPing; Li, XueYuan; Qu, YanYing
2017-10-01
Cotton (Gossypium spp.) is the most important natural textile fiber crop, and Gossypium hirsutum L. is responsible for 90% of the annual cotton crop in the world. Information on cotton genetic diversity and population structure is essential for new breeding lines. In this study, we analyzed population structure and genetic diversity of 288 elite Gossypium hirsutum cultivar accessions collected from around the world, and especially from China, using genome-wide single nucleotide polymorphisms (SNP) markers. The average polymorphsim information content (PIC) was 0.25, indicating a relatively low degree of genetic diversity. Population structure analysis revealed extensive admixture and identified three subgroups. Phylogenetic analysis supported the subgroups identified by STRUCTURE. The results from both population structure and phylogenetic analysis were, for the most part, in agreement with pedigree information. Analysis of molecular variance revealed a larger amount of variation was due to diversity within the groups. Establishment of genetic diversity and population structure from this study could be useful for genetic and genomic analysis and systematic utilization of the standing genetic variation in upland cotton.
Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios
2017-04-01
Cowpea (Vigna unguiculata) is a promiscuous grain legume, capable of establishing efficient symbiosis with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, little is known about the genetic and symbiotic diversity of indigenous cowpea rhizobia in European soils. In the present study, the genetic and symbiotic diversity of indigenous rhizobia isolated from field-grown cowpea nodules in three geographically different Greek regions were studied. Forty-five authenticated strains were subjected to a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into seven groups and representative strains of each group were further analyzed. The analysis of the rrs gene showed that the strains belong to different species of the genus Bradyrhizobium. The analysis of the 16S-23S IGS region showed that the strains from each geographic region were characterized by distinct IGS types which may represent novel phylogenetic lineages, closely related to the type species of Bradyrhizobium pachyrhizi, Bradyrhizobium ferriligni and Bradyrhizobium liaoningense. MLSA analysis of three housekeeping genes (recA, glnII, and gyrB) showed the close relatedness of our strains with B. pachyrhizi PAC48 T and B. liaoningense USDA 3622 T and confirmed that the B. liaoningense-related isolate VUEP21 may constitute a novel species within Bradyrhizobium. Moreover, symbiotic gene phylogenies, based on nodC and nifH genes, showed that the B. pachyrhizi-related isolates belonged to symbiovar vignae, whereas the B. liaoningense-related isolates may represent a novel symbiovar. Copyright © 2017 Elsevier GmbH. All rights reserved.
Delamuta, Jakeline Renata Marçon; Ribeiro, Renan Augusto; Menna, Pâmela; Bangel, Eliane Villamil; Hungria, Mariangela
2012-04-01
Symbiotic association of several genera of bacteria collectively called as rhizobia and plants belonging to the family Leguminosae (=Fabaceae) results in the process of biological nitrogen fixation, playing a key role in global N cycling, and also bringing relevant contributions to the agriculture. Bradyrhizobium is considered as the ancestral of all nitrogen-fixing rhizobial species, probably originated in the tropics. The genus encompasses a variety of diverse bacteria, but the diversity captured in the analysis of the 16S rRNA is often low. In this study, we analyzed twelve Bradyrhizobium strains selected from previous studies performed by our group for showing high genetic diversity in relation to the described species. In addition to the 16S rRNA, five housekeeping genes (recA, atpD, glnII, gyrB and rpoB) were analyzed in the MLSA (multilocus sequence analysis) approach. Analysis of each gene and of the concatenated housekeeping genes captured a considerably higher level of genetic diversity, with indication of putative new species. The results highlight the high genetic variability associated with Bradyrhizobium microsymbionts of a variety of legumes. In addition, the MLSA approach has proved to represent a rapid and reliable method to be employed in phylogenetic and taxonomic studies, speeding the identification of the still poorly known diversity of nitrogen-fixing rhizobia in the tropics.
Genome-wide analysis of the diversity and ancestry of Korean dogs.
Choi, Bong Hwan; Wijayananda, Hasini I; Lee, Soo Hyun; Lee, Doo Ho; Kim, Jong Seok; Oh, Seok Il; Park, Eung Woo; Lee, Cheul Koo; Lee, Seung Hwan
2017-01-01
There are various hypotheses on dog domestication based on archeological and genetic studies. Although many studies have been conducted on the origin of dogs, the existing literature about the ancestry, diversity, and population structure of Korean dogs is sparse. Therefore, this study is focused on the origin, diversity and population structure of Korean dogs. The study sample comprised four major categories, including non-dogs (coyotes and wolves), ancient, modern and Korean dogs. Selected samples were genotyped using an Illumina CanineHD array containing 173,662 single nucleotide polymorphisms. The genome-wide data were filtered using quality control parameters in PLINK 1.9. Only autosomal chromosomes were used for further analysis. The negative off-diagonal variance of the genetic relationship matrix analysis depicted, the variability of samples in each population. FIS (inbreeding rate within a population) values indicated, a low level of inbreeding within populations, and the patterns were in concordance with the results of Nei's genetic distance analysis. The lowest FST (inbreeding rate between populations) values among Korean and Chinese breeds, using a phylogenetic tree, multi-dimensional scaling, and a TreeMix likelihood tree showed Korean breeds are highly related to Chinese breeds. The Korean breeds possessed a unique and large diversity of admixtures compared with other breeds. The highest and lowest effective population sizes were observed in Korean Jindo Black (485) and Korean Donggyeong White (109), respectively. The historical effective population size of all Korean dogs showed declining trend from the past to present. It is important to take immediate action to protect the Korean dog population while conserving their diversity. Furthermore, this study suggests that Korean dogs have unique diversity and are one of the basal lineages of East Asian dogs, originating from China.
Genome-wide analysis of the diversity and ancestry of Korean dogs.
Directory of Open Access Journals (Sweden)
Bong Hwan Choi
Full Text Available There are various hypotheses on dog domestication based on archeological and genetic studies. Although many studies have been conducted on the origin of dogs, the existing literature about the ancestry, diversity, and population structure of Korean dogs is sparse. Therefore, this study is focused on the origin, diversity and population structure of Korean dogs. The study sample comprised four major categories, including non-dogs (coyotes and wolves, ancient, modern and Korean dogs. Selected samples were genotyped using an Illumina CanineHD array containing 173,662 single nucleotide polymorphisms. The genome-wide data were filtered using quality control parameters in PLINK 1.9. Only autosomal chromosomes were used for further analysis. The negative off-diagonal variance of the genetic relationship matrix analysis depicted, the variability of samples in each population. FIS (inbreeding rate within a population values indicated, a low level of inbreeding within populations, and the patterns were in concordance with the results of Nei's genetic distance analysis. The lowest FST (inbreeding rate between populations values among Korean and Chinese breeds, using a phylogenetic tree, multi-dimensional scaling, and a TreeMix likelihood tree showed Korean breeds are highly related to Chinese breeds. The Korean breeds possessed a unique and large diversity of admixtures compared with other breeds. The highest and lowest effective population sizes were observed in Korean Jindo Black (485 and Korean Donggyeong White (109, respectively. The historical effective population size of all Korean dogs showed declining trend from the past to present. It is important to take immediate action to protect the Korean dog population while conserving their diversity. Furthermore, this study suggests that Korean dogs have unique diversity and are one of the basal lineages of East Asian dogs, originating from China.
Phylogenetic structure of arbuscular mycorrhizal fungal communities along an elevation gradient.
Egan, Cameron P; Callaway, Ragan M; Hart, Miranda M; Pither, Jason; Klironomos, John
2017-04-01
Despite the importance of arbuscular mycorrhizal (AM) fungi within terrestrial ecosystems, we know little about how natural AM fungal communities are structured. To date, the majority of studies examining AM fungal community diversity have focused on single habitats with similar environmental conditions, with relatively few studies having assessed the diversity of AM fungi over large-scale environmental gradients. In this study, we characterized AM fungal communities in the soil along a high-elevation gradient in the North American Rocky Mountains. We focused on phylogenetic patterns of AM fungal communities to gain insight into how AM fungal communities are naturally assembled. We found that alpine AM fungal communities had lower phylogenetic diversity relative to lower elevation communities, as well as being more heterogeneous in composition than either treeline or subalpine communities. AM fungal communities were phylogenetically clustered at all elevations sampled, suggesting that environmental filtering, either selection by host plants or fungal niches, is the primary ecological process structuring communities along the gradient.
Ni, Xuejiao; Qi, Xing'e; Gu, Yanling; Zheng, Xiaoji; Dong, Juan; Ni, Yongqing; Cheng, Guodong
2014-11-04
The purpose of this study is to characterize the community composition and phylogenetic analysis of cyanobacteria from supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains, China. We amplified 16S rRNA genes from the extracted cryoconite DNA by PCR with 2 pairs of cyanobacteria-specific primers. Amplificon was used to construct 16S rRNA genes clone library. The estimation of species richness, diversity indices, and rarefaction curve of the 16S rRNA genes library were determined based on representative phylotypes (OTUs). Analysis of 16S rRNA gene sequences allowed grouping of 101 clones into 12 phylotypes (OTUs) using a cut-off of 97% identity. The phylogenetic analysis revealed that most of sequences affiliated to the order Oscillatoriales and Chroococcales except that three were unclassified. The clone library was dominated by representatives of the order Oscillatoriales (81% of the total clones), and the most abundant organisms within this order were in the genus Phormidium (68 clones) including clones grouping into four phylotypes. The only clone of Chroococcales was closely related to the genus Chamaesiphon with 97% similarity. In addition, comparison of soil chemical properties between different habitats indicated that supraglacial cryoconite supported significantly higher the content of available phosphorus and potassium, nitrate nitrogen and organic matter compared with the forefield of the Glacier No. 1. The diversity index of cyanobacteria were relatively high in supraglacial cryoconite of the Glacier No. 1 in the Tianshan Mountains. The community structure was dominated by members of the genus Phormidium. This study may enrich our knowledge on biogeochemical processes and ecological distribution of cyanobacterial populations in glacial ecosystem.
Molecular Phylogenetics: Concepts for a Newcomer.
Ajawatanawong, Pravech
Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.
Bruskiewich, Richard; Burris, Jason N.; Carrigan, Charlotte T.; Chase, Mark W.; Clarke, Neil D.; Covshoff, Sarah; dePamphilis, Claude W.; Edger, Patrick P.; Goh, Falicia; Graham, Sean; Greiner, Stephan; Hibberd, Julian M.; Jordon-Thaden, Ingrid; Kutchan, Toni M.; Leebens-Mack, James; Melkonian, Michael; Miles, Nicholas; Myburg, Henrietta; Patterson, Jordan; Pires, J. Chris; Ralph, Paula; Rolf, Megan; Sage, Rowan F.; Soltis, Douglas; Soltis, Pamela; Stevenson, Dennis; Stewart, C. Neal; Surek, Barbara; Thomsen, Christina J. M.; Villarreal, Juan Carlos; Wu, Xiaolei; Zhang, Yong; Deyholos, Michael K.; Wong, Gane Ka-Shu
2012-01-01
Next-generation sequencing plays a central role in the characterization and quantification of transcriptomes. Although numerous metrics are purported to quantify the quality of RNA, there have been no large-scale empirical evaluations of the major determinants of sequencing success. We used a combination of existing and newly developed methods to isolate total RNA from 1115 samples from 695 plant species in 324 families, which represents >900 million years of phylogenetic diversity from green algae through flowering plants, including many plants of economic importance. We then sequenced 629 of these samples on Illumina GAIIx and HiSeq platforms and performed a large comparative analysis to identify predictors of RNA quality and the diversity of putative genes (scaffolds) expressed within samples. Tissue types (e.g., leaf vs. flower) varied in RNA quality, sequencing depth and the number of scaffolds. Tissue age also influenced RNA quality but not the number of scaffolds ≥1000 bp. Overall, 36% of the variation in the number of scaffolds was explained by metrics of RNA integrity (RIN score), RNA purity (OD 260/230), sequencing platform (GAIIx vs HiSeq) and the amount of total RNA used for sequencing. However, our results show that the most commonly used measures of RNA quality (e.g., RIN) are weak predictors of the number of scaffolds because Illumina sequencing is robust to variation in RNA quality. These results provide novel insight into the methods that are most important in isolating high quality RNA for sequencing and assembling plant transcriptomes. The methods and recommendations provided here could increase the efficiency and decrease the cost of RNA sequencing for individual labs and genome centers. PMID:23185583
Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael
2011-04-01
We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.
Environmental determinants and spatial mismatch of mammal diversity measures in Colombia
Directory of Open Access Journals (Sweden)
González–Maya, J. F.
2016-02-01
Full Text Available Including complementary diversity measures into ecological and conservation studies should improve our ability to link species assemblages to ecosystems. Recent measures such as phylogenetic and functional diversity have furthered our understanding of assemblage patterns of ecosystems and species, allowing improved inference of ecosystem function and conservation. We evaluated spatial patterns of taxonomic, phylogenetic and functional diversity of mammals in Colombia and identified their main environmental determinants, as well as interrelationships and spatial mismatch between the three measures. We found significant effects of elevation and precipitation on species richness, slope and species richness on phylogenetic diversity, and slope and phylogenetic diversity on functional diversity. We also identified a spatial mismatch of the three measures in some areas of the country: 12% of the country for species richness and 14% for phylogenetic and functional diversity. Our results highlight the importance of including species relationships within environmental drivers with biogeographical and distribution analyses and could facilitate selection of priority areas for conservation, especially when mismatch occurs between measures.
Schweizer, Manuel; Ayé, Raffael; Kashkarov, Roman; Roth, Tobias
2014-01-01
Although phylogenetic diversity has been suggested to be relevant from a conservation point of view, its role is still limited in applied nature conservation. Recently, the practice of investing conservation resources based on threatened species was identified as a reason for the slow integration of phylogenetic diversity in nature conservation planning. One of the main arguments is based on the observation that threatened species are not evenly distributed over the phylogenetic tree. However this argument seems to dismiss the fact that conservation action is a spatially explicit process, and even if threatened species are not evenly distributed over the phylogenetic tree, the occurrence of threatened species could still indicate areas with above average phylogenetic diversity and consequently could protect phylogenetic diversity. Here we aim to study the selection of important bird areas in Central Asia, which were nominated largely based on the presence of threatened bird species. We show that although threatened species occurring in Central Asia do not capture phylogenetically more distinct species than expected by chance, the current spatially explicit conservation approach of selecting important bird areas covers above average taxonomic and phylogenetic diversity of breeding and wintering birds. We conclude that the spatially explicit processes of conservation actions need to be considered in the current discussion of whether new prioritization methods are needed to complement conservation action based on threatened species. PMID:25337861
Ricci, J. N.; Coleman, M. L.; Osburn, M. R.; Sessions, A. L.; Spear, J. R.; Newman, D. K.
2011-12-01
Hopanoids are a class of sterols produced by bacteria. Their hydrocarbon skeletons are resistant to degradation making their diagenetic products, hopanes, attractive biomarkers. Particular attention has been paid to 2-methylhopanes, which have been found at discrete times and locations in Earth history as far back as 2,500 Myr. Previously, they were inferred to be markers of oxygenic photosynthesis in cyanobacteria, but the discovery of an anoxygenic phototroph, Rhodopseudomonas palustris TIE-1, capable of producing significant quantities of 2-methylbacteriohopanetetrol, the parent molecule of the fossil 2-methylhopane, challenged this interpretation. In this study, we sought to determine the diversity and origin of the enzyme responsible for methylating hopanoids, HpnP. To accomplish this task, we surveyed a diversity of Yellowstone hot springs using degenerate PCR primers and searched publically available metagenomic databases for hpnP-like sequences. The Yellowstone hot spring samples were dominated by cyanobacterial-like hpnP sequences, while the metagenomic data contained many hpnP-like sequences from a diversity of environments that grouped with all known hpnP-containing phyla. With these additional hpnP sequences, we will report updated phylogenetic trees that attempt to determine the origin of hpnP. Understanding the distribution of 2-methylhopanoid production throughout the tree of life and its origin is important to be able to use 2-methylhopanes as biomarkers for any particular taxonomic group.
Govindarajulu, Rajanikanth; Hughes, Colin E; Bailey, C Donovan
2011-12-01
Leucaena comprises 17 diploid species, five tetraploid species, and a complex series of hybrids whose evolutionary histories have been influenced by human seed translocation, cultivation, and subsequent spontaneous hybridization. Here we investigated patterns of evolutionary divergence among diploid Leucaena through comprehensively sampled multilocus phylogenetic and population genetic approaches to address species delimitation, interspecific relationships, hybridization, and the predominant mode of speciation among diploids. Parsimony- and maximum-likelihood-based phylogenetic approaches were applied to 59 accessions sequenced for six SCAR-based nuclear loci, nrDNA ITS, and four cpDNA regions. Population genetic comparisons included 1215 AFLP loci representing 42 populations and 424 individuals. Phylogenetic results provided a well-resolved hypothesis of divergent species relationships, recovering previously recognized clades of diploids as well as newly resolved relationships. Phylogenetic and population genetic assessments identified two cryptic species that are consistent with geography and morphology. Findings from this study highlight the importance and utility of multilocus data in the recovery of complex evolutionary histories. The results are consistent with allopatric divergence representing the predominant mode of speciation among diploid Leucaena. These findings contrast with the potential hybrid origin of several tetraploid species and highlight the importance of human translocation of seed to the origin of these tetraploids. The recognition of one previously unrecognized species (L. cruziana) and the elevation of another taxon (L. collinsii subsp. zacapana) to specific status (L. zacapana) is consistent with a growing number of newly diagnosed species from neotropical seasonally dry forests, suggesting these communities harbor greater species diversity than previously recognized.
Lee, Hea-Young; Ro, Na-Young; Jeong, Hee-Jin; Kwon, Jin-Kyung; Jo, Jinkwan; Ha, Yeaseong; Jung, Ayoung; Han, Ji-Woong; Venkatesh, Jelli; Kang, Byoung-Cheorl
2016-11-14
Conservation of genetic diversity is an essential prerequisite for developing new cultivars with desirable agronomic traits. Although a large number of germplasm collections have been established worldwide, many of them face major difficulties due to large size and a lack of adequate information about population structure and genetic diversity. Core collection with a minimum number of accessions and maximum genetic diversity of pepper species and its wild relatives will facilitate easy access to genetic material as well as the use of hidden genetic diversity in Capsicum. To explore genetic diversity and population structure, we investigated patterns of molecular diversity using a transcriptome-based 48 single nucleotide polymorphisms (SNPs) in a large germplasm collection comprising 3,821 accessions. Among the 11 species examined, Capsicum annuum showed the highest genetic diversity (H E = 0.44, I = 0.69), whereas the wild species C. galapagoense showed the lowest genetic diversity (H E = 0.06, I = 0.07). The Capsicum germplasm collection was divided into 10 clusters (cluster 1 to 10) based on population structure analysis, and five groups (group A to E) based on phylogenetic analysis. Capsicum accessions from the five distinct groups in an unrooted phylogenetic tree showed taxonomic distinctness and reflected their geographic origins. Most of the accessions from European countries are distributed in the A and B groups, whereas the accessions from Asian countries are mainly distributed in C and D groups. Five different sampling strategies with diverse genetic clustering methods were used to select the optimal method for constructing the core collection. Using a number of allelic variations based on 48 SNP markers and 32 different phenotypic/morphological traits, a core collection 'CC240' with a total of 240 accessions (5.2 %) was selected from within the entire Capsicum germplasm. Compared to the other core collections, CC240 displayed higher
Patil, Hemant J; Benet-Perelberg, Ayana; Naor, Alon; Smirnov, Margarita; Ofek, Tamir; Nasser, Ahmed; Minz, Dror; Cytryn, Eddie
2016-01-01
The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain the effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically to fingerling stocks and water column-associated Aeromonas were monitored periodically over an 11-month fish fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a 3-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas isolates were initially screened for sulfadiazine resistance and further screened against five additional antimicrobials. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamicin, and chloramphenicol resistances were low. Multidrug resistant strains as well as sul1, tetA , and intI1 gene-harboring strains were significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically distinct Aeromonas clusters were identified using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were identified, including an A. salmonicida
Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael
2011-01-01
We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085
Energy Technology Data Exchange (ETDEWEB)
Siddique, Naila, E-mail: naila.nrlpd@gmail.com [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan); Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan)
2013-09-15
Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic {sup 112}GRQGRL{sup 117} and velogenic {sup 112}RRQKRF{sup 117} along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks.
Detecting Network Communities: An Application to Phylogenetic Analysis
Andrade, Roberto F. S.; Rocha-Neto, Ivan C.; Santos, Leonardo B. L.; de Santana, Charles N.; Diniz, Marcelo V. C.; Lobão, Thierry Petit; Goés-Neto, Aristóteles; Pinho, Suani T. R.; El-Hani, Charbel N.
2011-01-01
This paper proposes a new method to identify communities in generally weighted complex networks and apply it to phylogenetic analysis. In this case, weights correspond to the similarity indexes among protein sequences, which can be used for network construction so that the network structure can be analyzed to recover phylogenetically useful information from its properties. The analyses discussed here are mainly based on the modular character of protein similarity networks, explored through the Newman-Girvan algorithm, with the help of the neighborhood matrix . The most relevant networks are found when the network topology changes abruptly revealing distinct modules related to the sets of organisms to which the proteins belong. Sound biological information can be retrieved by the computational routines used in the network approach, without using biological assumptions other than those incorporated by BLAST. Usually, all the main bacterial phyla and, in some cases, also some bacterial classes corresponded totally (100%) or to a great extent (>70%) to the modules. We checked for internal consistency in the obtained results, and we scored close to 84% of matches for community pertinence when comparisons between the results were performed. To illustrate how to use the network-based method, we employed data for enzymes involved in the chitin metabolic pathway that are present in more than 100 organisms from an original data set containing 1,695 organisms, downloaded from GenBank on May 19, 2007. A preliminary comparison between the outcomes of the network-based method and the results of methods based on Bayesian, distance, likelihood, and parsimony criteria suggests that the former is as reliable as these commonly used methods. We conclude that the network-based method can be used as a powerful tool for retrieving modularity information from weighted networks, which is useful for phylogenetic analysis. PMID:21573202
Frank, Daniel N
2008-10-07
Advances in automated DNA sequencing technology have accelerated the generation of metagenomic DNA sequences, especially environmental ribosomal RNA gene (rDNA) sequences. As the scale of rDNA-based studies of microbial ecology has expanded, need has arisen for software that is capable of managing, annotating, and analyzing the plethora of diverse data accumulated in these projects. XplorSeq is a software package that facilitates the compilation, management and phylogenetic analysis of DNA sequences. XplorSeq was developed for, but is not limited to, high-throughput analysis of environmental rRNA gene sequences. XplorSeq integrates and extends several commonly used UNIX-based analysis tools by use of a Macintosh OS-X-based graphical user interface (GUI). Through this GUI, users may perform basic sequence import and assembly steps (base-calling, vector/primer trimming, contig assembly), perform BLAST (Basic Local Alignment and Search Tool; 123) searches of NCBI and local databases, create multiple sequence alignments, build phylogenetic trees, assemble Operational Taxonomic Units, estimate biodiversity indices, and summarize data in a variety of formats. Furthermore, sequences may be annotated with user-specified meta-data, which then can be used to sort data and organize analyses and reports. A document-based architecture permits parallel analysis of sequence data from multiple clones or amplicons, with sequences and other data stored in a single file. XplorSeq should benefit researchers who are engaged in analyses of environmental sequence data, especially those with little experience using bioinformatics software. Although XplorSeq was developed for management of rDNA sequence data, it can be applied to most any sequencing project. The application is available free of charge for non-commercial use at http://vent.colorado.edu/phyloware.
Genome-wide comparative analysis of phylogenetic trees: the prokaryotic forest of life.
Puigbò, Pere; Wolf, Yuri I; Koonin, Eugene V
2012-01-01
Genome-wide comparison of phylogenetic trees is becoming an increasingly common approach in evolutionary genomics, and a variety of approaches for such comparison have been developed. In this article, we present several methods for comparative analysis of large numbers of phylogenetic trees. To compare phylogenetic trees taking into account the bootstrap support for each internal branch, the Boot-Split Distance (BSD) method is introduced as an extension of the previously developed Split Distance method for tree comparison. The BSD method implements the straightforward idea that comparison of phylogenetic trees can be made more robust by treating tree splits differentially depending on the bootstrap support. Approaches are also introduced for detecting tree-like and net-like evolutionary trends in the phylogenetic Forest of Life (FOL), i.e., the entirety of the phylogenetic trees for conserved genes of prokaryotes. The principal method employed for this purpose includes mapping quartets of species onto trees to calculate the support of each quartet topology and so to quantify the tree and net contributions to the distances between species. We describe the application of these methods to analyze the FOL and the results obtained with these methods. These results support the concept of the Tree of Life (TOL) as a central evolutionary trend in the FOL as opposed to the traditional view of the TOL as a "species tree."
Zhang, Xiao-Yong; Fu, Wen; Chen, Xiao; Yan, Mu-Ting; Huang, Xian-De; Bao, Jie
2018-06-09
To search for more microbial resources for screening environment-friendly antifoulants, we investigated the phylogenetic diversity and antifouling potentials of culturable fungi in mangrove sediments from Techeng Isle, China. A total of 176 isolates belonging to 57 fungal taxa were recovered and identified. The high levels of diversity and abundance of mangrove fungi from Techeng Isle were in accordance with previous studies on fungi from other mangrove ecosystems. Fifteen of the 176 isolates demonstrated high divergence (87-93%) from the known fungal taxa in GenBank. Moreover, 26 isolates recorded in mangrove ecosystems for the first time. These results suggested that mangrove sediments from Techeng Isle harbored some new fungal communities compared with other mangrove ecosystems. The antifouling activity of 57 representative isolates (belonging to 57 different fungal taxa) was tested against three marine bacteria (Loktanella hongkongensis, Micrococcus luteus and Pseudoalteromonas piscida) and two marine macrofoulers (bryozoan Bugula neritina and barnacle Balanus amphitrite). Approximately 40% of the tested isolates displayed distinct antifouling activity. Furthermore, 17 fungal isolates were found to display strong or a wide spectrum of antifouling activity in this study, suggesting that these isolates deserve further study as potential sources of novel antifouling metabolites. To our knowledge, this is the first report on the investigation of the phylogenetic diversity and antifouling potential of culturable fungi in mangrove sediments from Techeng Isle, China. These results contribute to our knowledge of mangrove fungi and further increases the pool of fungi available for natural bioactive product screening.
Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences
DEFF Research Database (Denmark)
Svitashev, S.; Bryngelsson, T.; Vershinin, A.
1994-01-01
A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...
On the Shapley Value of Unrooted Phylogenetic Trees.
Wicke, Kristina; Fischer, Mareike
2018-01-17
The Shapley value, a solution concept from cooperative game theory, has recently been considered for both unrooted and rooted phylogenetic trees. Here, we focus on the Shapley value of unrooted trees and first revisit the so-called split counts of a phylogenetic tree and the Shapley transformation matrix that allows for the calculation of the Shapley value from the edge lengths of a tree. We show that non-isomorphic trees may have permutation-equivalent Shapley transformation matrices and permutation-equivalent null spaces. This implies that estimating the split counts associated with a tree or the Shapley values of its leaves does not suffice to reconstruct the correct tree topology. We then turn to the use of the Shapley value as a prioritization criterion in biodiversity conservation and compare it to a greedy solution concept. Here, we show that for certain phylogenetic trees, the Shapley value may fail as a prioritization criterion, meaning that the diversity spanned by the top k species (ranked by their Shapley values) cannot approximate the total diversity of all n species.
Tang, Cuong Q; Humphreys, Aelys M; Fontaneto, Diego; Barraclough, Timothy G; Paradis, Emmanuel
2014-10-01
Coalescent-based species delimitation methods combine population genetic and phylogenetic theory to provide an objective means for delineating evolutionarily significant units of diversity. The generalised mixed Yule coalescent (GMYC) and the Poisson tree process (PTP) are methods that use ultrametric (GMYC or PTP) or non-ultrametric (PTP) gene trees as input, intended for use mostly with single-locus data such as DNA barcodes. Here, we assess how robust the GMYC and PTP are to different phylogenetic reconstruction and branch smoothing methods. We reconstruct over 400 ultrametric trees using up to 30 different combinations of phylogenetic and smoothing methods and perform over 2000 separate species delimitation analyses across 16 empirical data sets. We then assess how variable diversity estimates are, in terms of richness and identity, with respect to species delimitation, phylogenetic and smoothing methods. The PTP method generally generates diversity estimates that are more robust to different phylogenetic methods. The GMYC is more sensitive, but provides consistent estimates for BEAST trees. The lower consistency of GMYC estimates is likely a result of differences among gene trees introduced by the smoothing step. Unresolved nodes (real anomalies or methodological artefacts) affect both GMYC and PTP estimates, but have a greater effect on GMYC estimates. Branch smoothing is a difficult step and perhaps an underappreciated source of bias that may be widespread among studies of diversity and diversification. Nevertheless, careful choice of phylogenetic method does produce equivalent PTP and GMYC diversity estimates. We recommend simultaneous use of the PTP model with any model-based gene tree (e.g. RAxML) and GMYC approaches with BEAST trees for obtaining species hypotheses.
Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying
2016-01-01
Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.
Hu, Chih-Yi; Tsai, You-Zen; Lin, Shun-Fu
2014-12-01
Tea (Camellia sinensis) is an important economic crop in Taiwan. Particularly, two major commercial types of tea (Paochong tea and Oolong tea) which are produced in Taiwan are famous around the world, and they must be manufactured with specific cultivars. Nevertheless, many elite cultivars have been illegally introduced to foreign countries. Because of the lower cost, large amount of "Taiwan-type tea" are produced and imported to Taiwan, causing a dramatic damage in the tea industry. It is very urgent to develop the stable, fast and reliable DNA markers for fingerprinting tea cultivars in Taiwan and protecting intellectual property rights for breeders. Furthermore, genetic diversity and phylogenetic relationship evaluations of tea germplasm in Taiwan are imperative for parental selection in the cross-breeding program and avoidance of genetic vulnerability. Two STS and 37 CAPS markers derived from cytoplasmic genome and ESTs of tea have been developed in this study providing a useful tool for distinguishing all investigated germplasm. For identifying 12 prevailing tea cultivars in Taiwan, five core markers, including each one of mitochondria and chloroplast, and three nuclear markers, were developed. Based on principal coordinate analysis and cluster analysis, 55 tea germplasm in Taiwan were divided into three groups: sinensis type (C. sinensis var. sinensis), assamica type (C. sinensis var. assamica) and Taiwan wild species (C. formosensis). The result of genetic diversity analysis revealed that both sinensis (0.44) and assamica (0.41) types had higher genetic diversity than wild species (0.25). The close genetic distance between the first (Chin-Shin-Oolong) and the third (Shy-Jih-Chuen) prevailing cultivars was found, and many recently released varieties are the descents of Chin-Shin-Oolong. This implies the potential risk of genetic vulnerability for tea cultivation in Taiwan. We have successfully developed a tool for tea germplasm discrimination and genetic
Directory of Open Access Journals (Sweden)
Paola Pedraza-Penalosa
2015-04-01
Full Text Available The blueberry tribe Vaccinieae (Ericaceae is particularly diverse in South America and underwent extensive radiation in Colombia where many endemics occur. Recent fieldwork in Colombia has resulted in valuable additions to the phylogeny and as well in the discovery of morphologically noteworthy new species that need to be phylogenetically placed before being named. This is particularly important, as the monophyly of many of the studied genera have not been confirmed. In order to advance our understanding of the relationships within neotropical Vaccinieae and advice the taxonomy of the new blueberry relatives, here we present the most comprehensive phylogenetic analysis for the Andean clade. Anthopterus, Demosthenesia, and Pellegrinia are among the putative Andean genera recovered as monophyletic, while other eight Andean genera were not. The analyses also showed that genera that have been traditionally widely defined are non-monophyletic and could be further split into more discrete groups. Four newly discovered Colombian Vaccinieae are placed in the monophyletic Satyria s.s. and the Psammisia I clade. Although these new species are endemic to the Colombian Western Cordillera and Chocó biogeographic region and three are not known outside of Las Orquídeas National Park, they do not form sister pairs.
Directory of Open Access Journals (Sweden)
Guozeng Wang
Full Text Available BACKGROUND: Xylan is one of the most abundant biopolymers on Earth. Its degradation is mediated primarily by microbial xylanase in nature. To explore the diversity and distribution patterns of xylanase genes in soils, samples of five soil types with different physicochemical characters were analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Partial xylanase genes of glycoside hydrolase (GH family 10 were recovered following direct DNA extraction from soil, PCR amplification and cloning. Combined with our previous study, a total of 1084 gene fragments were obtained, representing 366 OTUs. More than half of the OTUs were novel (identities of <65% with known xylanases and had no close relatives based on phylogenetic analyses. Xylanase genes from all the soil environments were mainly distributed in Bacteroidetes, Proteobacteria, Acidobacteria, Firmicutes, Actinobacteria, Dictyoglomi and some fungi. Although identical sequences were found in several sites, habitat-specific patterns appeared to be important, and geochemical factors such as pH and oxygen content significantly influenced the compositions of xylan-degrading microbial communities. CONCLUSION/SIGNIFICANCE: These results provide insight into the GH 10 xylanases in various soil environments and reveal that xylan-degrading microbial communities are environment specific with diverse and abundant populations.
Vďačný, Peter
2017-10-01
The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.
Phylogenetic relationship among Kenyan sorghum germplasms ...
African Journals Online (AJOL)
Mr Kiboi
phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.
Rai, Shalini; Kashyap, Prem Lal; Kumar, Sudheer; Srivastava, Alok Kumar; Ramteke, Pramod W
2016-01-01
The use of Trichoderma isolates with efficient antagonistic activity represents a potentially effective and alternative disease management strategy to replace health hazardous chemical control. In this context, twenty isolates were obtained from tomato rhizosphere and evaluated by their antagonistic activity against four fungal pathogens ( Fusarium oxysporum f. sp. lycopersici , Alternaria alternata , Colletotrichum gloeosporoides and Rhizoctonia solani ). The production of extracellular cell wall degrading enzymes of tested isolates was also measured. All the isolates significantly reduced the mycelial growth of tested pathogens but the amount of growth reduction varied significantly as well. There was a positive correlation between the antagonistic capacity of Trichoderma isolates towards fungal pathogens and their lytic enzyme production. The Trichoderma isolates were initially sorted according to morphology and based on the translation elongation factor 1-α gene sequence similarity, the isolates were designated as Trichoderma harzianum , T. koningii , T. asperellum , T. virens and T. viride . PCA analysis explained 31.53, 61.95, 62.22 and 60.25% genetic variation among Trichoderma isolates based on RAPD, REP-, ERIC- and BOX element analysis, respectively. ERG - 1 gene, encoding a squalene epoxidase has been used for the first time for diversity analysis of antagonistic Trichoderma from tomato rhizosphere. Phylogenetic analysis of ERG -1 gene sequences revealed close relatedness of ERG -1sequences with earlier reported sequences of Hypocrea lixii , T. arundinaceum and T. reesei. However, ERG -1 gene also showed heterogeneity among some antagonistic isolates and indicated the possibility of occurrence of squalene epoxidase driven triterpene biosynthesis as an alternative biocontrol mechanism in Trichoderma species.
Molecular analysis and genetic diversity of Aedes albopictus (Diptera, Culicidae) from China.
Ruiling, Zhang; Peien, Leng; Xuejun, Wang; Zhong, Zhang
2018-05-01
Aedes albopictus is one of the most invasive species, which can carry Dengue virus, Yellow fever virus and more than twenty arboviruses. Based on mitochondrial gene cytochrome c oxidase I (COI) and samples collected from 17 populations, we investigated the molecular character and genetic diversity of Ae. albopictus from China. Altogether, 25 haplotypes were detected, including 10 shared haplotypes and 15 private haplotypes. H1 was the dominant haplotype, which is widely distributed in 13 populations. Tajima'D value of most populations was significantly negative, demonstrating that populations experienced rapid range expansion recently. Most haplotypes clustered together both in phylogenetic and median-joining network analysis without clear phylogeographic patterns. However, neutrality tests revealed shallow divergences among Hainan and Guangxi with other populations (0.15599 ≤ F ST ≤ 0.75858), which probably due to interrupted gene flow, caused by geographical isolations. In conclusion, Ae. albopictus populations showed low genetic diversity in China.
Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks.
Oh, S June; Joung, Je-Gun; Chang, Jeong-Ho; Zhang, Byoung-Tak
2006-06-06
To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway structures using meta-level information rather than sequence
Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks
Directory of Open Access Journals (Sweden)
Chang Jeong-Ho
2006-06-01
Full Text Available Abstract Background To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. Results To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. Conclusion By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway
Phylogenetic comparative methods on phylogenetic networks with reticulations.
Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile
2018-04-25
The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.
Assembly and phylogenetic structure of Neotropical palm communities
DEFF Research Database (Denmark)
Eiserhardt, Wolf L.; Svenning, J.-C.; Balslev, Henrik
Diversity, composition and dynamics of Neotropical palm communities are receiving an increasing amount of attention due to their economic importance, but also because their high species richness and functional diversity render them valuable model systems for overall forest biodiversity. However......, to better understand these palm communities, it is crucial to gain insight into the mechanisms responsible for their assembly. These can be dispersal limitation, environmental filtering, or biotic interactions. If the degree of niche conservatism is known for a group of organisms, patterns of community...... an unspecific assumption of “general niche conservatism”, phylogenetic signal will be analysed for Neotropical palms. Moreover, as an example for evolutionary mechanisms disrupting phylogenetic signal, speciation modes will be examined in selected genera. With the combined results we aim to show the relative...
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
Sharma, Anshul; Kaur, Jasmine; Lee, Sulhee; Park, Young-Seo
2018-06-01
In the present study, 35 Leuconostoc mesenteroides strains isolated from vegetables and food products from South Korea were studied by multilocus sequence typing (MLST) of seven housekeeping genes (atpA, groEL, gyrB, pheS, pyrG, rpoA, and uvrC). The fragment sizes of the seven amplified housekeeping genes ranged in length from 366 to 1414 bp. Sequence analysis indicated 27 different sequence types (STs) with 25 of them being represented by a single strain indicating high genetic diversity, whereas the remaining 2 were characterized by five strains each. In total, 220 polymorphic nucleotide sites were detected among seven housekeeping genes. The phylogenetic analysis based on the STs of the seven loci indicated that the 35 strains belonged to two major groups, A (28 strains) and B (7 strains). Split decomposition analysis showed that intraspecies recombination played a role in generating diversity among strains. The minimum spanning tree showed that the evolution of the STs was not correlated with food source. This study signifies that the multilocus sequence typing is a valuable tool to access the genetic diversity among L. mesenteroides strains from South Korea and can be used further to monitor the evolutionary changes.
Molecular phylogenetics of porcini mushrooms (Boletus section Boletus).
Dentinger, Bryn T M; Ammirati, Joseph F; Both, Ernst E; Desjardin, Dennis E; Halling, Roy E; Henkel, Terry W; Moreau, Pierre-Arthur; Nagasawa, Eiji; Soytong, Kasem; Taylor, Andy F; Watling, Roy; Moncalvo, Jean-Marc; McLaughlin, David J
2010-12-01
Porcini (Boletus section Boletus: Boletaceae: Boletineae: Boletales) are a conspicuous group of wild, edible mushrooms characterized by fleshy fruiting bodies with a poroid hymenophore that is "stuffed" with white hyphae when young. Their reported distribution is with ectomycorrhizal plants throughout the Northern Hemisphere. Little progress has been made on the systematics of this group using modern molecular phylogenetic tools because sampling has been limited primarily to European species and the genes employed were insufficient to resolve the phylogeny. We examined the evolutionary history of porcini by using a global geographic sampling of most known species, new discoveries from little explored areas, and multiple genes. We used 78 sequences from the fast-evolving nuclear internal transcribed spacers and are able to recognize 18 reciprocally monophyletic species. To address whether or not porcini form a monophyletic group, we compiled a broadly sampled dataset of 41 taxa, including other members of the Boletineae, and used separate and combined phylogenetic analysis of sequences from the nuclear large subunit ribosomal DNA, the largest subunit of RNA polymerase II, and the mitochondrial ATPase subunit six gene. Contrary to previous studies, our separate and combined phylogenetic analyses support the monophyly of porcini. We also report the discovery of two taxa that expand the known distribution of porcini to Australia and Thailand and have ancient phylogenetic connections to the rest of the group. A relaxed molecular clock analysis with these new taxa dates the origin of porcini to between 42 and 54 million years ago, coinciding with the initial diversification of angiosperms, during the Eocene epoch when the climate was warm and humid. These results reveal an unexpected diversity, distribution, and ancient origin of a group of commercially valuable mushrooms that may provide an economic incentive for conservation and support the hypothesis of a tropical
Genetic and phylogenetic analysis of ten Gobiidae species in China ...
African Journals Online (AJOL)
To study the genetic and phylogenetic relationship of gobioid fishes in China, the representatives of 10 gobioid fishes from 2 subfamilies in China were examined by amplified fragment length polymorphism (AFLP) analysis. We established 220 AFLP bands for 45 individuals from the 10 species, and the percentage of ...
Directory of Open Access Journals (Sweden)
Dongwon Seo
2016-04-01
Full Text Available Native duck populations have lower productivity, and have not been developed as much as commercials duck breeds. However, native ducks have more importance in terms of genetic diversity and potentially valuable economic traits. For this reason, population discriminable genetic markers are needed for conservation and development of native ducks. In this study, 24 highly polymorphic microsatellite (MS markers were investigated using commercial ducks and native East and South Asian ducks. The average polymorphic information content (PIC value for all MS markers was 0.584, indicating high discrimination power. All populations were discriminated using 14 highly polymorphic MS markers by genetic distance and phylogenetic analysis. The results indicated that there were close genetic relationships among populations. In the structure analysis, East Asian ducks shared more haplotypes with commercial ducks than South Asian ducks, and they had more independent haplotypes than others did. These results will provide useful information for genetic diversity studies in ducks and for the development of duck traceability systems in the market.
DEFF Research Database (Denmark)
Nielsen, L; Arctander, P; Jensen, T H
2009-01-01
To investigate the possible origin and spread of the dramatic re-emergent 2002 distemper epizootic observed among seals in Danish Waters, we have sequenced wild-type genes of the attachment (H) glycoproteins of viruses from both the 2002 and 1988 epizootics. Phylogenetic analysis of the H genes...... of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...... epizootic in Danish Waters was investigated and determined to be caused by canine distemper virus, the closest relative of PDV, revealing no direct epidemiological link to the seal epizootics. (C) 2009 Elsevier B.V. All rights reserved....
Cruciani, Fulvio; Trombetta, Beniamino; Massaia, Andrea; Destro-Bisol, Giovanni; Sellitto, Daniele; Scozzari, Rosaria
2011-06-10
To shed light on the structure of the basal backbone of the human Y chromosome phylogeny, we sequenced about 200 kb of the male-specific region of the human Y chromosome (MSY) from each of seven Y chromosomes belonging to clades A1, A2, A3, and BT. We detected 146 biallelic variant sites through this analysis. We used these variants to construct a patrilineal tree, without taking into account any previously reported information regarding the phylogenetic relationships among the seven Y chromosomes here analyzed. There are several key changes at the basal nodes as compared with the most recent reference Y chromosome tree. A different position of the root was determined, with important implications for the origin of human Y chromosome diversity. An estimate of 142 KY was obtained for the coalescence time of the revised MSY tree, which is earlier than that obtained in previous studies and easier to reconcile with plausible scenarios of modern human origin. The number of deep branchings leading to African-specific clades has doubled, further strengthening the MSY-based evidence for a modern human origin in the African continent. An analysis of 2204 African DNA samples showed that the deepest clades of the revised MSY phylogeny are currently found in central and northwest Africa, opening new perspectives on early human presence in the continent. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Extensive diversity and evolution of hepadnaviruses in bats in China.
Nie, Fang-Yuan; Lin, Xian-Dan; Hao, Zong-Yu; Chen, Xiao-Nan; Wang, Zhao-Xiao; Wang, Miao-Ruo; Wu, Jun; Wang, Hong-Wei; Zhao, Guoqiang; Ma, Runlin Z; Holmes, Edward C; Zhang, Yong-Zhen
2018-01-15
To better understand the evolution of hepadnaviruses, we sampled bats from Guizhou, Henan and Zhejiang provinces, China, and rodents from Zhejiang province. Genetically diverse hepadnaviruses were identified in a broad range of bat species, with an overall prevalence of 13.3%. In contrast, no rodent hepadnaviruses were identified. The newly discovered bat hepadnaviruses fell into two distinct phylogenetic groups. The viruses within the first group exhibited high diversity, with some closely related to viruses previously identified in Yunnan province. Strikingly, the newly discovered viruses sampled from Jiyuan city in the second phylogenetic group were most closely related to those found in bats from West Africa, suggestive of a long-term association between bats and hepadnaviruses. A co-phylogenetic analysis revealed frequent cross-species transmission among bats from different species, genera, and families. Overall, these data suggest that there are likely few barriers to the cross-species transmission of bat hepadnaviruses. Copyright © 2017. Published by Elsevier Inc.
Yang, Jiangke
2011-02-08
To gain insight into the species richness and phylogeny of the microbial communities associated with sponges in mangroves, we performed an extensive phylogenetic analysis, based on terminal restriction fragment length polymorphism profiling and 16S ribosomal RNA gene sequences, of the 4 sponge species Aplysina fulva, Haliclona hogarthi, Tedania ignis and Ircinia strobilina as well as of ambient seawater. The sponge-associated bacterial communities contained 13 phyla, including Poribacteria and an unclassified group not found in the ambient seawater community, 98% of which comprised Proteobacteria, Cyanobacteria and Bacteroidetes. Although the sponges themselves were phylogenetically distant and bacterial community variation within the host species was observed, microbial phyla such as Proteobacteria, Acidobacteria, Chloroflexi and the unclassified group were consistently observed as the dominant populations within the communities. The sponge-associated bacterial communities resident in the Caribbean Sea mangroves are phylogenetically similar but significantly distinct from communities found in other biogeographical sites such as the deep-water environments of the Caribbean Sea, the South China Sea and Australia. The interspecific variation within the host species and the distinct biogeographical characteristics that the sponge-associated bacteria exhibited indicate that the acquisition, establishment and formation of functional sponge-associated bacterial communities may initially be the product of both vertical and horizontal transmission, and is then shaped by the internal environment created by the sponge species and certain external environmental factors. © Inter-Research 2011.
Phylogenetic analysis of West Nile virus, Nuevo Leon State, Mexico.
Blitvich, Bradley J; Fernández-Salas, Ildefonso; Contreras-Cordero, Juan F; Loroño-Pino, María A; Marlenee, Nicole L; Díaz, Francisco J; González-Rojas, José I; Obregón-Martínez, Nelson; Chiu-García, Jorge A; Black, William C; Beaty, Barry J
2004-07-01
West Nile virus RNA was detected in brain tissue from a horse that died in June 2003 in Nuevo Leon State, Mexico. Nucleotide sequencing and phylogenetic analysis of the premembrane and envelope genes showed that the virus was most closely related to West Nile virus isolates collected in Texas in 2002.
Leng, Xue; Liu, Dongxu; Li, Jianming; Shi, Kun; Zeng, Fanli; Zong, Ying; Liu, Yi; Sun, Zhibo; Zhang, Shanshan; Liu, Yadong; Du, Rui
2018-05-01
Aleutian mink disease is the most important disease in the mink-farming industry worldwide. So far, few large-scale molecular epidemiological studies of AMDV, based on the NS1 and VP2 genes, have been conducted in China. Here, eight new Chinese isolates of AMDV from three provinces in north-east China were analyzed to clarify the molecular epidemiology of AMDV. The seroprevalence of AMDV in north-east China was 41.8% according to counterimmuno-electrophoresis. Genetic variation analysis of the eight isolates showed significant non-synonymous substitutions in the NS1 and VP2 genes, especially in the NS1 gene. All eight isolates included the caspase-recognition sequence NS1:285 (DQTD↓S), but not the caspase recognition sequence NS1:227 (INTD↓S). The LN1 and LN2 strains had a new 10-amino-acid deletion in-between amino acids 28-37, while the JL3 strain had a one-amino-acid deletion at position 28 in the VP2 protein, compared with the AMDV-G strain. Phylogenetic analysis based on most of NS1 (1755 bp) and complete VP2 showed that the AMDV genotypes did not cluster according to their pathogenicity or geographic origin. Local and imported ADMV species are all prevalent in mink-farming populations in the north-east of China. This is the first study to report the molecular epidemiology of AMDV in north-east China based on most of NS1 and the complete VP2, and further provides information about polyG deletions and new variations in the amino acid sequences of NS1 and VP2 proteins. This report is a good foundation for further study of AMDV in China.
Genetic and phylogenetic analysis of a novel parvovirus isolated from chickens in Guangxi, China.
Feng, Bin; Xie, Zhixun; Deng, Xianwen; Xie, Liji; Xie, Zhiqin; Huang, Li; Fan, Qin; Luo, Sisi; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Wang, Sheng; Wang, Leyi
2016-11-01
A previously unidentified chicken parvovirus (ChPV) strain, associated with runting-stunting syndrome (RSS), is now endemic among chickens in China. To explore the genetic diversity of ChPV strains, we determined the first complete genome sequence of a novel ChPV isolate (GX-CH-PV-7) identified in chickens in Guang Xi, China, and showed moderate genome sequence similarity to reference strains. Analysis showed that the viral genome sequence is 86.4 %-93.9 % identical to those of other ChPVs. Genetic and phylogenetic analyses showed that this newly emergent GX-CH-PV-7 is closely related to Gallus gallus enteric parvovirus isolate ChPV 798 from the USA, indicating that they may share a common ancestor. The complete DNA sequence is 4612 bp long with an A+T content of 56.66 %. We determined the first complete genome sequence of a previously unidentified ChPV strain to elucidate its origin and evolutionary status.
Consequences of recombination on traditional phylogenetic analysis
DEFF Research Database (Denmark)
Schierup, M H; Hein, J
2000-01-01
We investigate the shape of a phylogenetic tree reconstructed from sequences evolving under the coalescent with recombination. The motivation is that evolutionary inferences are often made from phylogenetic trees reconstructed from population data even though recombination may well occur (mt......DNA or viral sequences) or does occur (nuclear sequences). We investigate the size and direction of biases when a single tree is reconstructed ignoring recombination. Standard software (PHYLIP) was used to construct the best phylogenetic tree from sequences simulated under the coalescent with recombination....... With recombination present, the length of terminal branches and the total branch length are larger, and the time to the most recent common ancestor smaller, than for a tree reconstructed from sequences evolving with no recombination. The effects are pronounced even for small levels of recombination that may...
Estimating bacterial diversity for ecological studies: methods, metrics, and assumptions.
Directory of Open Access Journals (Sweden)
Julia Birtel
Full Text Available Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5. Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques.
Genomic Diversity and Evolution of the Lyssaviruses
Delmas, Olivier; Holmes, Edward C.; Talbi, Chiraz; Larrous, Florence; Dacheux, Laurent; Bouchier, Christiane; Bourhy, Hervé
2008-01-01
Lyssaviruses are RNA viruses with single-strand, negative-sense genomes responsible for rabies-like diseases in mammals. To date, genomic and evolutionary studies have most often utilized partial genome sequences, particularly of the nucleoprotein and glycoprotein genes, with little consideration of genome-scale evolution. Herein, we report the first genomic and evolutionary analysis using complete genome sequences of all recognised lyssavirus genotypes, including 14 new complete genomes of field isolates from 6 genotypes and one genotype that is completely sequenced for the first time. In doing so we significantly increase the extent of genome sequence data available for these important viruses. Our analysis of these genome sequence data reveals that all lyssaviruses have the same genomic organization. A phylogenetic analysis reveals strong geographical structuring, with the greatest genetic diversity in Africa, and an independent origin for the two known genotypes that infect European bats. We also suggest that multiple genotypes may exist within the diversity of viruses currently classified as ‘Lagos Bat’. In sum, we show that rigorous phylogenetic techniques based on full length genome sequence provide the best discriminatory power for genotype classification within the lyssaviruses. PMID:18446239
Genomic diversity and evolution of the lyssaviruses.
Directory of Open Access Journals (Sweden)
Olivier Delmas
2008-04-01
Full Text Available Lyssaviruses are RNA viruses with single-strand, negative-sense genomes responsible for rabies-like diseases in mammals. To date, genomic and evolutionary studies have most often utilized partial genome sequences, particularly of the nucleoprotein and glycoprotein genes, with little consideration of genome-scale evolution. Herein, we report the first genomic and evolutionary analysis using complete genome sequences of all recognised lyssavirus genotypes, including 14 new complete genomes of field isolates from 6 genotypes and one genotype that is completely sequenced for the first time. In doing so we significantly increase the extent of genome sequence data available for these important viruses. Our analysis of these genome sequence data reveals that all lyssaviruses have the same genomic organization. A phylogenetic analysis reveals strong geographical structuring, with the greatest genetic diversity in Africa, and an independent origin for the two known genotypes that infect European bats. We also suggest that multiple genotypes may exist within the diversity of viruses currently classified as 'Lagos Bat'. In sum, we show that rigorous phylogenetic techniques based on full length genome sequence provide the best discriminatory power for genotype classification within the lyssaviruses.
Directory of Open Access Journals (Sweden)
Valery Mikhailov
2013-06-01
Full Text Available A total of 16 marine strains belonging to the genus Arenibacter, recovered from diverse microbial communities associated with various marine habitats and collected from different locations, were evaluated in degradation of natural polysaccharides and chromogenic glycosides. Most strains were affiliated with five recognized species, and some presented three new species within the genus Arenibacter. No strains contained enzymes depolymerizing polysaccharides, but synthesized a wide spectrum of glycosidases. Highly active β-N-acetylglucosaminidases and α-N-acetylgalactosaminidases were the main glycosidases for all Arenibacter. The genes, encoding two new members of glycoside hydrolyses (GH families, 20 and 109, were isolated and characterized from the genomes of Arenibacter latericius. Molecular genetic analysis using glycosidase-specific primers shows the absence of GH27 and GH36 genes. A sequence comparison with functionally-characterized GH20 and GH109 enzymes shows that both sequences are closest to the enzymes of chitinolytic bacteria Vibrio furnissii and Cellulomonas fimi of marine and terrestrial origin, as well as human pathogen Elisabethkingia meningoseptica and simbionts Akkermansia muciniphila, gut and non-gut Bacteroides, respectively. These results revealed that the genus Arenibacter is a highly taxonomic diverse group of microorganisms, which can participate in degradation of natural polymers in marine environments depending on their niche and habitat adaptations. They are new prospective candidates for biotechnological applications due to their production of unique glycosidases.
Sharpton, Thomas J; Jospin, Guillaume; Wu, Dongying; Langille, Morgan G I; Pollard, Katherine S; Eisen, Jonathan A
2012-10-13
New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as "Sifting Families," or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology-based analyses. We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/).
A Distance Measure for Genome Phylogenetic Analysis
Cao, Minh Duc; Allison, Lloyd; Dix, Trevor
Phylogenetic analyses of species based on single genes or parts of the genomes are often inconsistent because of factors such as variable rates of evolution and horizontal gene transfer. The availability of more and more sequenced genomes allows phylogeny construction from complete genomes that is less sensitive to such inconsistency. For such long sequences, construction methods like maximum parsimony and maximum likelihood are often not possible due to their intensive computational requirement. Another class of tree construction methods, namely distance-based methods, require a measure of distances between any two genomes. Some measures such as evolutionary edit distance of gene order and gene content are computational expensive or do not perform well when the gene content of the organisms are similar. This study presents an information theoretic measure of genetic distances between genomes based on the biological compression algorithm expert model. We demonstrate that our distance measure can be applied to reconstruct the consensus phylogenetic tree of a number of Plasmodium parasites from their genomes, the statistical bias of which would mislead conventional analysis methods. Our approach is also used to successfully construct a plausible evolutionary tree for the γ-Proteobacteria group whose genomes are known to contain many horizontally transferred genes.
First phylogenetic analysis of Ehrlichia canis in dogs and ticks from Mexico. Preliminary study
Directory of Open Access Journals (Sweden)
Carolina G. Sosa-Gutiérrez
2016-09-01
Full Text Available Objective. Phylogenetic characterization of Ehrlichia canis in dogs naturally infected and ticks, diagnosed by PCR and sequencing of 16SrRNA gene; compare different isolates found in American countries. Materials and methods. Were collected Blood samples from 139 dogs with suggestive clinical manifestations of this disease and they were infested with ticks; part of 16SrRNA gene was sequenced and aligned, with 17 sequences reported in American countries. Two phylogenetic trees were constructed using the Maximum likelihood method, and Maximum parsimony. Results. They were positive to E. canis 25/139 (18.0% dogs and 29/139 (20.9% ticks. The clinical manifestations presented were fever, fatigue, depression and vomiting. Rhipicephalus sanguineus Dermacentor variabilis and Haemaphysalis leporis-palustris ticks were positive for E. canis. Phylogenetic analysis showed that the sequences of dogs and ticks in Mexico form a third group diverging of sequences from South America and USA. Conclusions. This is the first phylogenetic analysis of E. canis in Mexico. There are differences in the sequences of Mexico with those reported in South America and USA. This research lays the foundation for further study of genetic variability.
Climate-driven extinctions shape the phylogenetic structure of temperate tree floras.
Eiserhardt, Wolf L; Borchsenius, Finn; Plum, Christoffer M; Ordonez, Alejandro; Svenning, Jens-Christian
2015-03-01
When taxa go extinct, unique evolutionary history is lost. If extinction is selective, and the intrinsic vulnerabilities of taxa show phylogenetic signal, more evolutionary history may be lost than expected under random extinction. Under what conditions this occurs is insufficiently known. We show that late Cenozoic climate change induced phylogenetically selective regional extinction of northern temperate trees because of phylogenetic signal in cold tolerance, leading to significantly and substantially larger than random losses of phylogenetic diversity (PD). The surviving floras in regions that experienced stronger extinction are phylogenetically more clustered, indicating that non-random losses of PD are of increasing concern with increasing extinction severity. Using simulations, we show that a simple threshold model of survival given a physiological trait with phylogenetic signal reproduces our findings. Our results send a strong warning that we may expect future assemblages to be phylogenetically and possibly functionally depauperate if anthropogenic climate change affects taxa similarly. © 2015 John Wiley & Sons Ltd/CNRS.
Qian, Hong; Chen, Shengbin; Zhang, Jin-Long
2017-07-17
Niche-based and neutrality-based theories are two major classes of theories explaining the assembly mechanisms of local communities. Both theories have been frequently used to explain species diversity and composition in local communities but their relative importance remains unclear. Here, we analyzed 57 assemblages of angiosperm trees in 0.1-ha forest plots across China to examine the effects of environmental heterogeneity (relevant to niche-based processes) and spatial contingency (relevant to neutrality-based processes) on phylogenetic structure of angiosperm tree assemblages distributed across a wide range of environment and space. Phylogenetic structure was quantified with six phylogenetic metrics (i.e., phylogenetic diversity, mean pairwise distance, mean nearest taxon distance, and the standardized effect sizes of these three metrics), which emphasize on different depths of evolutionary histories and account for different degrees of species richness effects. Our results showed that the variation in phylogenetic metrics explained independently by environmental variables was on average much greater than that explained independently by spatial structure, and the vast majority of the variation in phylogenetic metrics was explained by spatially structured environmental variables. We conclude that niche-based processes have played a more important role than neutrality-based processes in driving phylogenetic structure of angiosperm tree species in forest communities in China.
Directory of Open Access Journals (Sweden)
Hemant J Patil
2016-11-01
Full Text Available The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically upon fingerling stocking and water column-associated Aeromonas were monitored periodically over an eleven-month fish-fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a three-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas spp. were isolated, initially screened for sulfadiazine resistance and further screened against five additional antibiotics. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamycin and chloramphenicol resistances were low. Abundance of multi-drug resistant strains as well as sul1, tetA and intI1 gene-harboring strains was significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically-distinct Aeromonas clusters were revealed using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were
Phylogenetic analysis of local-scale tree soil associations in a lowland moist tropical forest.
Directory of Open Access Journals (Sweden)
Laura A Schreeg
-wide signal. Trends highlighted in this analysis suggest how plant-soil associations may drive plant distributions and diversity at the local-scale.
Choudoir, Mallory J; Buckley, Daniel H
2018-06-07
The latitudinal diversity gradient is a pattern of biogeography observed broadly in plants and animals but largely undocumented in terrestrial microbial systems. Although patterns of microbial biogeography across broad taxonomic scales have been described in a range of contexts, the mechanisms that generate biogeographic patterns between closely related taxa remain incompletely characterized. Adaptive processes are a major driver of microbial biogeography, but there is less understanding of how microbial biogeography and diversification are shaped by dispersal limitation and drift. We recently described a latitudinal diversity gradient of species richness and intraspecific genetic diversity in Streptomyces by using a geographically explicit culture collection. Within this geographically explicit culture collection, we have identified Streptomyces sister-taxa whose geographic distribution is delimited by latitude. These sister-taxa differ in geographic distribution, genomic diversity, and ecological traits despite having nearly identical SSU rRNA gene sequences. Comparative genomic analysis reveals genomic differentiation of these sister-taxa consistent with restricted gene flow across latitude. Furthermore, we show phylogenetic conservatism of thermal traits between the sister-taxa suggesting that thermal trait adaptation limits dispersal and gene flow across climate regimes as defined by latitude. Such phylogenetic conservatism of thermal traits is commonly associated with latitudinal diversity gradients for plants and animals. These data provide further support for the hypothesis that the Streptomyces latitudinal diversity gradient was formed as a result of historical demographic processes defined by dispersal limitation and driven by paleoclimate dynamics.
Inferring influenza global transmission networks without complete phylogenetic information.
Aris-Brosou, Stéphane
2014-03-01
Influenza is one of the most severe respiratory infections affecting humans throughout the world, yet the dynamics of its global transmission network are still contentious. Here, I describe a novel combination of phylogenetics, time series, and graph theory to analyze 14.25 years of data stratified in space and in time, focusing on the main target of the human immune response, the hemagglutinin gene. While bypassing the complete phylogenetic inference of huge data sets, the method still extracts information suggesting that waves of genetic or of nucleotide diversity circulate continuously around the globe for subtypes that undergo sustained transmission over several seasons, such as H3N2 and pandemic H1N1/09, while diversity of prepandemic H1N1 viruses had until 2009 a noncontinuous transmission pattern consistent with a source/sink model. Irrespective of the shift in the structure of H1N1 diversity circulation with the emergence of the pandemic H1N1/09 strain, US prevalence peaks during the winter months when genetic diversity is at its lowest. This suggests that a dominant strain is generally responsible for epidemics and that monitoring genetic and/or nucleotide diversity in real time could provide public health agencies with an indirect estimate of prevalence.
The ethnobotany of psychoactive plant use: a phylogenetic perspective
Directory of Open Access Journals (Sweden)
Nashmiah Aid Alrashedy
2016-10-01
Full Text Available Psychoactive plants contain chemicals that presumably evolved as allelochemicals but target certain neuronal receptors when consumed by humans, altering perception, emotion and cognition. These plants have been used since ancient times as medicines and in the context of religious rituals for their various psychoactive effects (e.g., as hallucinogens, stimulants, sedatives. The ubiquity of psychoactive plants in various cultures motivates investigation of the commonalities among these plants, in which a phylogenetic framework may be insightful. A phylogeny of culturally diverse psychoactive plant taxa was constructed with their psychotropic effects and affected neurotransmitter systems mapped on the phylogeny. The phylogenetic distribution shows multiple evolutionary origins of psychoactive families. The plant families Myristicaceae (e.g., nutmeg, Papaveraceae (opium poppy, Cactaceae (peyote, Convolvulaceae (morning glory, Solanaceae (tobacco, Lamiaceae (mints, Apocynaceae (dogbane have a disproportionate number of psychoactive genera with various indigenous groups using geographically disparate members of these plant families for the same psychoactive effect, an example of cultural convergence. Pharmacological traits related to hallucinogenic and sedative potential are phylogenetically conserved within families. Unrelated families that exert similar psychoactive effects also modulate similar neurotransmitter systems (i.e., mechanistic convergence. However, pharmacological mechanisms for stimulant effects were varied even within families suggesting that stimulant chemicals may be more evolutionarily labile than those associated with hallucinogenic and sedative effects. Chemically similar psychoactive chemicals may also exist in phylogenetically unrelated lineages, suggesting convergent evolution or differential gene regulation of a common metabolic pathway. Our study has shown that phylogenetic analysis of traditionally used psychoactive plants
Rajilic-Stojanovic, M.; Maathuis, A.; Heilig, G.H.J.; Venema, K.; Vos, de W.M.; Smidt, H.
2010-01-01
A high-density phylogenetic microarray targeting small subunit rRNA (SSU rRNA) sequences of over 1000 microbial phylotypes of the human gastrointestinal tract, the HITChip, was used to assess the impact of faecal inoculum preparation and operation conditions on an in vitro model of the human large
A phylogenetic transform enhances analysis of compositional microbiota data.
Silverman, Justin D; Washburne, Alex D; Mukherjee, Sayan; David, Lawrence A
2017-02-15
Surveys of microbial communities (microbiota), typically measured as relative abundance of species, have illustrated the importance of these communities in human health and disease. Yet, statistical artifacts commonly plague the analysis of relative abundance data. Here, we introduce the PhILR transform, which incorporates microbial evolutionary models with the isometric log-ratio transform to allow off-the-shelf statistical tools to be safely applied to microbiota surveys. We demonstrate that analyses of community-level structure can be applied to PhILR transformed data with performance on benchmarks rivaling or surpassing standard tools. Additionally, by decomposing distance in the PhILR transformed space, we identified neighboring clades that may have adapted to distinct human body sites. Decomposing variance revealed that covariation of bacterial clades within human body sites increases with phylogenetic relatedness. Together, these findings illustrate how the PhILR transform combines statistical and phylogenetic models to overcome compositional data challenges and enable evolutionary insights relevant to microbial communities.
Limited Influence of Oxygen on the Evolution of Chemical Diversity in Metabolic Networks
Directory of Open Access Journals (Sweden)
Kazuhiro Takemoto
2013-10-01
Full Text Available Oxygen is thought to promote species and biomolecule diversity. Previous studies have suggested that oxygen expands metabolic networks by acquiring metabolites with different chemical properties (higher hydrophobicity, for example. However, such conclusions are typically based on biased evaluation, and are therefore non-conclusive. Thus, we re-investigated the effect of oxygen on metabolic evolution using a phylogenetic comparative method and metadata analysis to reduce the bias as much as possible. Notably, we found no difference in metabolic network expansion between aerobes and anaerobes when evaluating phylogenetic relationships. Furthermore, we showed that previous studies have overestimated or underestimated the degrees of differences in the chemical properties (e.g., hydrophobicity between oxic and anoxic metabolites in metabolic networks of unicellular organisms; however, such overestimation was not observed when considering the metabolic networks of multicellular organisms. These findings indicate that the contribution of oxygen to increased chemical diversity in metabolic networks is lower than previously thought; rather, phylogenetic signals and cell-cell communication result in increased chemical diversity. However, this conclusion does not contradict the effect of oxygen on metabolic evolution; instead, it provides a deeper understanding of how oxygen contributes to metabolic evolution despite several limitations in data analysis methods.
Yu, Jie; Song, Yuqin; Ren, Yan; Qing, Yanting; Liu, Wenjun; Sun, Zhihong
2017-11-03
The genomic diversity of different species within the genus Lactococcus and the relationships between genomic differentiation and environmental factors remain unclear. In this study, type isolates of ten Lactococcus species/subspecies were sequenced to assess their genomic characteristics, metabolic diversity, and phylogenetic relationships. The total genome sizes varied between 1.99 (Lactococcus plantarum) and 2.46 megabases (Mb; L. lactis subsp. lactis), and the G + C content ranged from 34.81 (L. lactis subsp. hordniae) to 39.67% (L. raffinolactis) with an average value of 37.02%. Analysis of genome dynamics indicated that the genus Lactococcus has an open pan-genome, while the core genome size decreased with sequential addition at the genus and species group levels. A phylogenetic dendrogram based on the concatenated amino acid sequences of 643 core genes was largely consistent with the phylogenetic tree obtained by 16S ribosomal RNA (rRNA) genes, but it provided a more robust phylogenetic resolution than the 16S rRNA gene-based analysis. Comparative genomics indicated that species in the genus Lactococcus had high degrees of diversity in genome size, gene content, and carbohydrate metabolism. This may be important for the specific adaptations that allow different Lactococcus species to survive in different environments. These results provide a quantitative basis for understanding the genomic and metabolic diversity within the genus Lactococcus, laying the foundation for future studies on taxonomy and functional genomics.
Conus pennaceus : a phylogenetic analysis of the Mozambican ...
African Journals Online (AJOL)
The genus Conus has over 500 species and is the most species-rich taxon of marine invertebrates. Based on mitochondrial DNA, this study focuses on the phylogenetics of Conus, particularly the pennaceus complex collected along the Mozambican coast. Phylogenetic trees based on both the 16S and the 12S ribosomal ...
Phylogenetic Analysis of Dengue Virus in Bangkalan, Madura Island, East Java Province, Indonesia.
Sucipto, Teguh Hari; Kotaki, Tomohiro; Mulyatno, Kris Cahyo; Churrotin, Siti; Labiqah, Amaliah; Soegijanto, Soegeng; Kameoka, Masanori
2018-01-01
Dengue virus (DENV) infection is a major health issue in tropical and subtropical areas. Indonesia is one of the biggest dengue endemic countries in the world. In the present study, the phylogenetic analysis of DENV in Bangkalan, Madura Island, Indonesia, was performed in order to obtain a clearer understanding of its dynamics in this country. A total of 359 blood samples from dengue-suspected patients were collected between 2012 and 2014. Serotyping was conducted using a multiplex Reverse Transcriptase-Polymerase Chain Reaction and a phylogenetic analysis of E gene sequences was performed using the Bayesian Markov chain Monte Carlo (MCMC) method. 17 out of 359 blood samples (4.7%) were positive for the isolation of DENV. Serotyping and the phylogenetic analysis revealed the predominance of DENV-1 genotype I (9/17, 52.9%), followed by DENV-2 Cosmopolitan type (7/17, 41.2%) and DENV-3 genotype I (1/17, 5.9%) . DENV-4 was not isolated. The Madura Island isolates showed high nucleotide similarity to other Indonesian isolates, indicating frequent virus circulation in Indonesia. The results of the present study highlight the importance of continuous viral surveillance in dengue endemic areas in order to obtain a clearer understanding of the dynamics of DENV in Indonesia.
Belskii, Eugen A; Mikryukov, Vladimir S
2018-05-07
The effects of industrial pollution on bird diversity have been widely studied using traditional diversity measures, which assume all species to be equivalent. We compared species richness and Shannon index with distance-based measures of taxonomic, functional, and phylogenetic diversity (the abundance-weighted mean nearest taxon distances), which describe within-community dissimilarity at terminal branches. Analysis of dissimilarity can shed light on the processes underlying community assembly, i.e., environmental filtering decreases dissimilarity whereas competitive exclusion increases it. In the 2-year study near Karabash and Revda copper smelters in Russia, point counts of nesting birds and habitat descriptions were taken at 10 sites (40 plots) along each pollution gradient. The abundance and diversity of birds showed good repeatability in both regions. The total density of birds, number of species per plot, and Shannon diversity decreased at high toxic load in both regions. The taxonomic, functional, and phylogenetic nearest taxon distances showed the same pattern within regions. Species dissimilarity within communities increased with pollution in Karabash (due to loss of functionally similar species), but did not change in Revda (due to mass replacement of forest species by species of open habitats). Pollution-induced changes in bird communities near Karabash were greater due to the stronger deterioration of the forest ecosystems and less favorable natural conditions (more arid climate, lower diversity and vitality of the tree stand and understorey) compared to Revda. This study emphasizes the need for a multi-level approach to the analysis of bird communities using traditional indices of diversity, functional, taxonomic, or phylogenetic distances between species and environmental variables.
Study of fecal bacterial diversity in Yunnan snub-nosed monkey ...
African Journals Online (AJOL)
Yomi
The bacterial diversity in fecal samples from Yunnan snub-nosed monkey ... Based on the phylogenetic analysis, the fecal bacteria of R. bieti distributed ... and conservation genetics, but research on fecal bacterial ... The large number of microorganisms in the intestine of .... There was high evolutional relativity between.
Directory of Open Access Journals (Sweden)
Sangwon Suh
2014-11-01
Full Text Available Four Korean native cattle (KNC breeds—Hanwoo, Chikso, Heugu, and Jeju black—are entered in the Domestic Animal Diversity Information System of the United Nations Food and Agriculture Organization (FAO. The objective of this study was to assess the genetic diversity, phylogenetic relationships and population structure of these KNC breeds (n = 120 and exotic breeds (Holstein and Charolais, n = 56. Thirty microsatellite loci recommended by the International Society for Animal Genetics/FAO were genotyped. These genotypes were used to determine the allele frequencies, allelic richness, heterozygosity and polymorphism information content per locus and breed. Genetic diversity was lower in Heugu and Jeju black breeds. Phylogenetic analysis, Factorial Correspondence Analysis and genetic clustering grouped each breed in its own cluster, which supported the genetic uniqueness of the KNC breeds. These results will be useful for conservation and management of KNC breeds as animal genetic resources.
Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.
Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F
2017-08-01
Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ultrafast Approximation for Phylogenetic Bootstrap
Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt
Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and
Cheng, Xia-Lan; Yuan, Lang-Xing; Nizamani, Mir Mohammad; Zhu, Zhi-Xin; Friedman, Cynthia Ross; Wang, Hua-Feng
2018-01-01
Anthropogenic processes and socio-economic factors play important roles in shaping plant diversity in urban parks. To investigate how plant diversity of Ma' anling urban volcano park in Hainan Province, China respond to these factors, we carried out a field investigation on the taxonomic and phylogenetic diversity of vascular plants and soil properties in this area. We found 284 species of vascular plants belonging to 88 families and 241 genera, which included 194 native species, 23 invasive species, 31 naturalized species, 40 cultivars, and 4 rare / endangered plant species. Tree composition and richness significantly varied between different vegetation formations (plantation, secondary forest, and abandoned land). Plant species richness and community composition were significantly affected by elevation (El), soil water content (WC), total soil nitrogen (TN) and soil organic matter (SOM). There were significant diversity differences between plantations and abandoned lands, but not between the plantations and secondary forests. The flora in the study site was tropical in nature, characterized by pantropic distributions. Compared to adjacent areas, floristic composition in the study site was most similar to that of Guangdong, followed by that of Vietnam. Our study revealed the diversity patterns of volcanic plants and provided the basis for future planning of plant conservation, such as preserving plant species, maintaining plant habitats, and coordinating plant management in this region.
DEFF Research Database (Denmark)
Pellissier, Loïc; Wisz, Mary S.; Strandberg, Beate
2014-01-01
on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy...... height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were......Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based...
Carvalho Coutinho, Ludmilla; Alves de Oliveira, João
2017-10-01
Sigmodontinae rodents constitute the second-largest subfamily among mammals. Alongside the taxonomic diversity, they are also ecologically diverse, exhibiting a wide array of locomotion modes, with semifossorial, terrestrial, semiaquatic, scansorial, arboreal, and saltatorial forms. To understand the ecomorphologic aspects that allow these rodents to display such locomotion diversity, we analyzed 35 qualitative characters of the appendicular skeleton (humerus, ulna, radius, scapula, femur, tibia, ilium, ischium and pubis) in 795 specimens belonging to 64 species, 34 genera and 10 tribes, representing all locomotion modes assigned to this subfamily. We performed a statistical analysis based upon the coefficient of trait differentiation to test the congruence of character states and the different locomotion modes. We also mapped characters states in a molecular phylogeny in order to reconstruct ancestral states and to evaluate how appendicular characters evolved within main lineages of Sigmodontinae radiation under a phylogenetic framework. The statistical analyses revealed six characters related to specific locomotion modes, except terrestrial. The mapping and parsimony ancestral states reconstruction identified two characters with phylogenetical signal and eight characters that are exclusively or more frequently recorded in certain modes of locomotion, four of them also detected by the statistical analysis. Notwithstanding the documented morphological variation, few changes characterize the transition to each of the locomotion modes, at least regarding the appendicular skeleton. This finding corroborates previous results that showed that sigmodontines exhibit an all-purpose appendicular morphology that allows them to use and explore a great variety of habitats. © 2017 Anatomical Society.
Ecosystem productivity is associated with bacterial phylogenetic distance in surface marine waters.
Galand, Pierre E; Salter, Ian; Kalenitchenko, Dimitri
2015-12-01
Understanding the link between community diversity and ecosystem function is a fundamental aspect of ecology. Systematic losses in biodiversity are widely acknowledged but the impact this may exert on ecosystem functioning remains ambiguous. There is growing evidence of a positive relationship between species richness and ecosystem productivity for terrestrial macro-organisms, but similar links for marine micro-organisms, which help drive global climate, are unclear. Community manipulation experiments show both positive and negative relationships for microbes. These previous studies rely, however, on artificial communities and any links between the full diversity of active bacterial communities in the environment, their phylogenetic relatedness and ecosystem function remain hitherto unexplored. Here, we test the hypothesis that productivity is associated with diversity in the metabolically active fraction of microbial communities. We show in natural assemblages of active bacteria that communities containing more distantly related members were associated with higher bacterial production. The positive phylogenetic diversity-productivity relationship was independent of community diversity calculated as the Shannon index. From our long-term (7-year) survey of surface marine bacterial communities, we also found that similarly, productive communities had greater phylogenetic similarity to each other, further suggesting that the traits of active bacteria are an important predictor of ecosystem productivity. Our findings demonstrate that the evolutionary history of the active fraction of a microbial community is critical for understanding their role in ecosystem functioning. © 2015 John Wiley & Sons Ltd.
treespace: Statistical exploration of landscapes of phylogenetic trees.
Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline
2017-11-01
The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.
The present study was conducted to better understand how the phylogenetic diversity of true morels (Morchella) in Turkey compares with species found in other regions of the world. The current research builds on our recently published survey of 10 Turkish provinces and another of the world in which D...
Buchwalter, David B; Cain, Daniel J; Martin, Caitrin A; Xie, Lingtian; Luoma, Samuel N; Garland, Theodore
2008-06-17
We used a phylogenetically based comparative approach to evaluate the potential for physiological studies to reveal patterns of diversity in traits related to susceptibility to an environmental stressor, the trace metal cadmium (Cd). Physiological traits related to Cd bioaccumulation, compartmentalization, and ultimately susceptibility were measured in 21 aquatic insect species representing the orders Ephemeroptera, Plecoptera, and Trichoptera. We mapped these experimentally derived physiological traits onto a phylogeny and quantified the tendency for related species to be similar (phylogenetic signal). All traits related to Cd bioaccumulation and susceptibility exhibited statistically significant phylogenetic signal, although the signal strength varied among traits. Conventional and phylogenetically based regression models were compared, revealing great variability within orders but consistent, strong differences among insect families. Uptake and elimination rate constants were positively correlated among species, but only when effects of body size and phylogeny were incorporated in the analysis. Together, uptake and elimination rates predicted dramatic Cd bioaccumulation differences among species that agreed with field-based measurements. We discovered a potential tradeoff between the ability to eliminate Cd and the ability to detoxify it across species, particularly mayflies. The best-fit regression models were driven by phylogenetic parameters (especially differences among families) rather than functional traits, suggesting that it may eventually be possible to predict a taxon's physiological performance based on its phylogenetic position, provided adequate physiological information is available for close relatives. There appears to be great potential for evolutionary physiological approaches to augment our understanding of insect responses to environmental stressors in nature.
Directory of Open Access Journals (Sweden)
Sharpton Thomas J
2012-10-01
Full Text Available Abstract Background New computational resources are needed to manage the increasing volume of biological data from genome sequencing projects. One fundamental challenge is the ability to maintain a complete and current catalog of protein diversity. We developed a new approach for the identification of protein families that focuses on the rapid discovery of homologous protein sequences. Results We implemented fully automated and high-throughput procedures to de novo cluster proteins into families based upon global alignment similarity. Our approach employs an iterative clustering strategy in which homologs of known families are sifted out of the search for new families. The resulting reduction in computational complexity enables us to rapidly identify novel protein families found in new genomes and to perform efficient, automated updates that keep pace with genome sequencing. We refer to protein families identified through this approach as “Sifting Families,” or SFams. Our analysis of ~10.5 million protein sequences from 2,928 genomes identified 436,360 SFams, many of which are not represented in other protein family databases. We validated the quality of SFam clustering through statistical as well as network topology–based analyses. Conclusions We describe the rapid identification of SFams and demonstrate how they can be used to annotate genomes and metagenomes. The SFam database catalogs protein-family quality metrics, multiple sequence alignments, hidden Markov models, and phylogenetic trees. Our source code and database are publicly available and will be subject to frequent updates (http://edhar.genomecenter.ucdavis.edu/sifting_families/.
Rowe, Janet M; Fabre, Marie-Françoise; Gobena, Daniel; Wilson, William H; Wilhelm, Steven W
2011-05-01
Studies of the Phycodnaviridae have traditionally relied on the DNA polymerase (pol) gene as a biomarker. However, recent investigations have suggested that the major capsid protein (MCP) gene may be a reliable phylogenetic biomarker. We used MCP gene amplicons gathered across the North Atlantic to assess the diversity of Emiliania huxleyi-infecting Phycodnaviridae. Nucleotide sequences were examined across >6000 km of open ocean, with comparisons between concentrates of the virus-size fraction of seawater and of lysates generated by exposing host strains to these same virus concentrates. Analyses revealed that many sequences were only sampled once, while several were over-represented. Analyses also revealed nucleotide sequences distinct from previous coastal isolates. Examination of lysed cultures revealed a new richness in phylogeny, as MCP sequences previously unrepresented within the existing collection of E. huxleyi viruses (EhV) were associated with viruses lysing cultures. Sequences were compared with previously described EhV MCP sequences from the North Sea and a Norwegian Fjord, as well as from the Gulf of Maine. Principal component analysis indicates that location-specific distinctions exist despite the presence of sequences common across these environments. Overall, this investigation provides new sequence data and an assessment on the use of the MCP gene. © 2011 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved.
DNA barcode analysis: a comparison of phylogenetic and statistical classification methods.
Austerlitz, Frederic; David, Olivier; Schaeffer, Brigitte; Bleakley, Kevin; Olteanu, Madalina; Leblois, Raphael; Veuille, Michel; Laredo, Catherine
2009-11-10
DNA barcoding aims to assign individuals to given species according to their sequence at a small locus, generally part of the CO1 mitochondrial gene. Amongst other issues, this raises the question of how to deal with within-species genetic variability and potential transpecific polymorphism. In this context, we examine several assignation methods belonging to two main categories: (i) phylogenetic methods (neighbour-joining and PhyML) that attempt to account for the genealogical framework of DNA evolution and (ii) supervised classification methods (k-nearest neighbour, CART, random forest and kernel methods). These methods range from basic to elaborate. We investigated the ability of each method to correctly classify query sequences drawn from samples of related species using both simulated and real data. Simulated data sets were generated using coalescent simulations in which we varied the genealogical history, mutation parameter, sample size and number of species. No method was found to be the best in all cases. The simplest method of all, "one nearest neighbour", was found to be the most reliable with respect to changes in the parameters of the data sets. The parameter most influencing the performance of the various methods was molecular diversity of the data. Addition of genetically independent loci--nuclear genes--improved the predictive performance of most methods. The study implies that taxonomists can influence the quality of their analyses either by choosing a method best-adapted to the configuration of their sample, or, given a certain method, increasing the sample size or altering the amount of molecular diversity. This can be achieved either by sequencing more mtDNA or by sequencing additional nuclear genes. In the latter case, they may also have to modify their data analysis method.
DNA barcode analysis: a comparison of phylogenetic and statistical classification methods
Directory of Open Access Journals (Sweden)
Leblois Raphael
2009-11-01
Full Text Available Abstract Background DNA barcoding aims to assign individuals to given species according to their sequence at a small locus, generally part of the CO1 mitochondrial gene. Amongst other issues, this raises the question of how to deal with within-species genetic variability and potential transpecific polymorphism. In this context, we examine several assignation methods belonging to two main categories: (i phylogenetic methods (neighbour-joining and PhyML that attempt to account for the genealogical framework of DNA evolution and (ii supervised classification methods (k-nearest neighbour, CART, random forest and kernel methods. These methods range from basic to elaborate. We investigated the ability of each method to correctly classify query sequences drawn from samples of related species using both simulated and real data. Simulated data sets were generated using coalescent simulations in which we varied the genealogical history, mutation parameter, sample size and number of species. Results No method was found to be the best in all cases. The simplest method of all, "one nearest neighbour", was found to be the most reliable with respect to changes in the parameters of the data sets. The parameter most influencing the performance of the various methods was molecular diversity of the data. Addition of genetically independent loci - nuclear genes - improved the predictive performance of most methods. Conclusion The study implies that taxonomists can influence the quality of their analyses either by choosing a method best-adapted to the configuration of their sample, or, given a certain method, increasing the sample size or altering the amount of molecular diversity. This can be achieved either by sequencing more mtDNA or by sequencing additional nuclear genes. In the latter case, they may also have to modify their data analysis method.
Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A
2017-03-01
Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.
Directory of Open Access Journals (Sweden)
Dwueng-Chwuan Jhwueng
Full Text Available Phylogenetic comparative methods (PCMs have been applied widely in analyzing data from related species but their fit to data is rarely assessed.Can one determine whether any particular comparative method is typically more appropriate than others by examining comparative data sets?I conducted a meta-analysis of 122 phylogenetic data sets found by searching all papers in JEB, Blackwell Synergy and JSTOR published in 2002-2005 for the purpose of assessing the fit of PCMs. The number of species in these data sets ranged from 9 to 117.I used the Akaike information criterion to compare PCMs, and then fit PCMs to bivariate data sets through REML analysis. Correlation estimates between two traits and bootstrapped confidence intervals of correlations from each model were also compared.For phylogenies of less than one hundred taxa, the Independent Contrast method and the independent, non-phylogenetic models provide the best fit.For bivariate analysis, correlations from different PCMs are qualitatively similar so that actual correlations from real data seem to be robust to the PCM chosen for the analysis. Therefore, researchers might apply the PCM they believe best describes the evolutionary mechanisms underlying their data.
Ari, Eszter; Ittzés, Péter; Podani, János; Thi, Quynh Chi Le; Jakó, Eena
2012-04-01
Boolean analysis (or BOOL-AN; Jakó et al., 2009. BOOL-AN: A method for comparative sequence analysis and phylogenetic reconstruction. Mol. Phylogenet. Evol. 52, 887-97.), a recently developed method for sequence comparison uses the Iterative Canonical Form of Boolean functions. It considers sequence information in a way entirely different from standard phylogenetic methods (i.e. Maximum Parsimony, Maximum-Likelihood, Neighbor-Joining, and Bayesian analysis). The performance and reliability of Boolean analysis were tested and compared with the standard phylogenetic methods, using artificially evolved - simulated - nucleotide sequences and the 22 mitochondrial tRNA genes of the great apes. At the outset, we assumed that the phylogeny of Hominidae is generally well established, and the guide tree of artificial sequence evolution can also be used as a benchmark. These offer a possibility to compare and test the performance of different phylogenetic methods. Trees were reconstructed by each method from 2500 simulated sequences and 22 mitochondrial tRNA sequences. We also introduced a special re-sampling method for Boolean analysis on permuted sequence sites, the P-BOOL-AN procedure. Considering the reliability values (branch support values of consensus trees and Robinson-Foulds distances) we used for simulated sequence trees produced by different phylogenetic methods, BOOL-AN appeared as the most reliable method. Although the mitochondrial tRNA sequences of great apes are relatively short (59-75 bases long) and the ratio of their constant characters is about 75%, BOOL-AN, P-BOOL-AN and the Bayesian approach produced the same tree-topology as the established phylogeny, while the outcomes of Maximum Parsimony, Maximum-Likelihood and Neighbor-Joining methods were equivocal. We conclude that Boolean analysis is a promising alternative to existing methods of sequence comparison for phylogenetic reconstruction and congruence analysis. Copyright © 2012 Elsevier Inc. All
Digital Repository Service at National Institute of Oceanography (India)
Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.
of sporulating cultures mostly matched either with 18S or ITS sequences but seldom with both the sequences. Phylogenetic analysis of ascomycetes using 18S sequence data grouped them into 7 clusters belonging to Aspergillus sp., Sagenomella sp., Exophiala sp...
Phylogenetic inertia and Darwin's higher law.
Shanahan, Timothy
2011-03-01
The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.
Romano, Stefano; Fernàndez-Guerra, Antonio; Reen, F Jerry; Glöckner, Frank O; Crowley, Susan P; O'Sullivan, Orla; Cotter, Paul D; Adams, Claire; Dobson, Alan D W; O'Gara, Fergal
2016-01-01
Strains of the Pseudovibrio genus have been detected worldwide, mainly as part of bacterial communities associated with marine invertebrates, particularly sponges. This recurrent association has been considered as an indication of a symbiotic relationship between these microbes and their host. Until recently, the availability of only two genomes, belonging to closely related strains, has limited the knowledge on the genomic and physiological features of the genus to a single phylogenetic lineage. Here we present 10 newly sequenced genomes of Pseudovibrio strains isolated from marine sponges from the west coast of Ireland, and including the other two publicly available genomes we performed an extensive comparative genomic analysis. Homogeneity was apparent in terms of both the orthologous genes and the metabolic features shared amongst the 12 strains. At the genomic level, a key physiological difference observed amongst the isolates was the presence only in strain P. axinellae AD2 of genes encoding proteins involved in assimilatory nitrate reduction, which was then proved experimentally. We then focused on studying those systems known to be involved in the interactions with eukaryotic and prokaryotic cells. This analysis revealed that the genus harbors a large diversity of toxin-like proteins, secretion systems and their potential effectors. Their distribution in the genus was not always consistent with the phylogenetic relationship of the strains. Finally, our analyses identified new genomic islands encoding potential toxin-immunity systems, previously unknown in the genus. Our analyses shed new light on the Pseudovibrio genus, indicating a large diversity of both metabolic features and systems for interacting with the host. The diversity in both distribution and abundance of these systems amongst the strains underlines how metabolically and phylogenetically similar bacteria may use different strategies to interact with the host and find a niche within its
Orthology prediction at scalable resolution by phylogenetic tree analysis
Heijden, R.T.J.M. van der; Snel, B.; Noort, V. van; Huynen, M.A.
2007-01-01
BACKGROUND: Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic
A format for phylogenetic placements.
Directory of Open Access Journals (Sweden)
Frederick A Matsen
Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.
Hongmei, Jing; Aitchison, Jonathan C; Lacap, Donnabella C; Peerapornpisal, Yuwadee; Sompong, Udomluk; Pointing, Stephen B
2005-08-01
Most community molecular studies of thermophilic cyanobacterial mats to date have focused on Synechococcus occurring at temperatures of approximately 50-65 degrees C. These reveal that molecular diversity exceeds that indicated by morphology, and that phylogeographic lineages exist. The moderately thermophilic and generally filamentous cyanobacterial mat communities occurring at lower temperatures have not previously been investigated at the community molecular level. Here we report community diversity in mats of 42-53 degrees C recovered from previously unstudied geothermal locations. Separation of 16S rRNA gene-defined genotypes from community DNA was achieved by DGGE. Genotypic diversity was greater than morphotype diversity in all mats sampled, although genotypes generally corresponded to observed morphotypes. Thirty-six sequences were recovered from DGGE bands. Phylogenetic analyses revealed these to form novel thermophilic lineages distinct from their mesophilic counterparts, within Calothrix, Cyanothece, Fischerella, Phormidium, Pleurocapsa, Oscillatoria and Synechococcus. Where filamentous cyanobacterial sequences belonging to the same genus were recovered from the same site, these were generally closely affiliated. Location-specific sequences were observed for some genotypes recovered from geochemically similar yet spatially separated sites, thus providing evidence for phylogeographic lineages that evolve in isolation. Other genotypes were more closely affiliated to geographically remote counterparts from similar habitats suggesting that adaptation to certain niches is also important.
Phylogenetic reconstruction methods: an overview.
De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre
2014-01-01
Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.
International Nuclear Information System (INIS)
Pellissier, Loïc; Wisz, Mary S; Strandberg, Beate; Damgaard, Christian
2014-01-01
Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were not phylogenetically conserved. Species richness also decreased with increasing levels of nitrogen and glyphosate. Our results suggest that predicting the cumulative effects of agrochemicals is more complex than anticipated due to their distinct selection of traits that may or may not be conserved phylogenetically. Precautionary efforts to mitigate drift of agricultural chemicals into semi-natural habitats are warranted to prevent unforeseeable biodiversity shifts. (paper)
Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.
Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel
2017-02-01
Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.
Rodrigues, Anderson Messias; de Melo Teixeira, Marcus; de Hoog, G Sybren; Schubach, Tânia Maria Pacheco; Pereira, Sandro Antonio; Fernandes, Geisa Ferreira; Bezerra, Leila Maria Lopes; Felipe, Maria Sueli; de Camargo, Zoilo Pires
2013-01-01
Sporothrix schenckii, previously assumed to be the sole agent of human and animal sporotrichosis, is in fact a species complex. Recently recognized taxa include S. brasiliensis, S. globosa, S. mexicana, and S. luriei, in addition to S. schenckii sensu stricto. Over the last decades, large epidemics of sporotrichosis occurred in Brazil due to zoonotic transmission, and cats were pointed out as key susceptible hosts. In order to understand the eco-epidemiology of feline sporotrichosis and its role in human sporotrichosis a survey was conducted among symptomatic cats. Prevalence and phylogenetic relationships among feline Sporothrix species were investigated by reconstructing their phylogenetic origin using the calmodulin (CAL) and the translation elongation factor-1 alpha (EF1α) loci in strains originated from Rio de Janeiro (RJ, n = 15), Rio Grande do Sul (RS, n = 10), Paraná (PR, n = 4), São Paulo (SP, n =3) and Minas Gerais (MG, n = 1). Our results showed that S. brasiliensis is highly prevalent among cats (96.9%) with sporotrichosis, while S. schenckii was identified only once. The genotype of Sporothrix from cats was found identical to S. brasiliensis from human sources confirming that the disease is transmitted by cats. Sporothrix brasiliensis presented low genetic diversity compared to its sister taxon S. schenckii. No evidence of recombination in S. brasiliensis was found by split decomposition or PHI-test analysis, suggesting that S. brasiliensis is a clonal species. Strains recovered in states SP, MG and PR share the genotype of the RJ outbreak, different from the RS clone. The occurrence of separate genotypes among strains indicated that the Brazilian S. brasiliensis epidemic has at least two distinct sources. We suggest that cats represent a major host and the main source of cat and human S. brasiliensis infections in Brazil.
Detection and phylogenetic analysis of bacteriophage WO in spiders (Araneae).
Yan, Qian; Qiao, Huping; Gao, Jin; Yun, Yueli; Liu, Fengxiang; Peng, Yu
2015-11-01
Phage WO is a bacteriophage found in Wolbachia. Herein, we represent the first phylogenetic study of WOs that infect spiders (Araneae). Seven species of spiders (Araneus alternidens, Nephila clavata, Hylyphantes graminicola, Prosoponoides sinensis, Pholcus crypticolens, Coleosoma octomaculatum, and Nurscia albofasciata) from six families were infected by Wolbachia and WO, followed by comprehensive sequence analysis. Interestingly, WO could be only detected Wolbachia-infected spiders. The relative infection rates of those seven species of spiders were 75, 100, 88.9, 100, 62.5, 72.7, and 100 %, respectively. Our results indicated that both Wolbachia and WO were found in three different body parts of N. clavata, and WO could be passed to the next generation of H. graminicola by vertical transmission. There were three different sequences for WO infected in A. alternidens and two different WO sequences from C. octomaculatum. Only one sequence of WO was found for the other five species of spiders. The discovered sequence of WO ranged from 239 to 311 bp. Phylogenetic tree was generated using maximum likelihood (ML) based on the orf7 gene sequences. According to the phylogenetic tree, WOs in N. clavata and H. graminicola were clustered in the same group. WOs from A. alternidens (WAlt1) and C. octomaculatum (WOct2) were closely related to another clade, whereas WO in P. sinensis was classified as a sole cluster.
Hong, Pei-Ying; Mao, Yuejian; Ortiz-Kofoed, Shannon; Shah, Rushabh; Cann, Isaac; Mackie, Roderick I
2015-02-01
In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.
Hong, Pei-Ying
2014-12-19
In this study, a metagenome-based analysis of the fecal samples from the macrophytic algae-consuming marine iguana (MI; Amblyrhynchus cristatus) and terrestrial biomass-consuming land iguanas (LI; Conolophus spp.) was conducted. Phylogenetic affiliations of the fecal microbiome were more similar between both iguanas than to other mammalian herbivorous hosts. However, functional gene diversities in both MI and LI iguana hosts differed in relation to the diet, where the MI fecal microbiota had a functional diversity that clustered apart from the other terrestrial-biomass consuming reptilian and mammalian hosts. A further examination of the carbohydrate-degrading genes revealed that several of the prevalent glycosyl hydrolases (GH), glycosyl transferases (GT), carbohydrate binding modules (CBM), and carbohydrate esterases (CE) gene classes were conserved among all examined herbivorous hosts, reiterating the important roles these genes play in the breakdown and metabolism of herbivorous diets. Genes encoding some classes of carbohydrate-degrading families, including GH2, GH13, GT2, GT4, CBM50, CBM48, CE4, and CE11, as well as genes associated with sulfur metabolism and dehalogenation, were highly enriched or unique to the MI. In contrast, gene sequences that relate to archaeal methanogenesis were detected only in LI fecal microbiome, and genes coding for GH13, GH66, GT2, GT4, CBM50, CBM13, CE4, and CE8 carbohydrate active enzymes were highly abundant in the LI. Bacterial populations were enriched on various carbohydrates substrates (e.g., glucose, arabinose, xylose). The majority of the enriched bacterial populations belong to genera Clostridium spp. and Enterococcus spp. that likely accounted for the high prevalence of GH13 and GH2, as well as the GT families (e.g., GT2, GT4, GT28, GT35, and GT51) that were ubiquitously present in the fecal microbiota of all herbivorous hosts.
Genetic diversity of siderophore-producing bacteria of tobacco rhizosphere
Tian, Fang; Ding, Yanqin; Zhu, Hui; Yao, Liangtong; Du, Binghai
2009-01-01
The genetic diversity of siderophore-producing bacteria of tobacco rhizosphere was studied by amplified ribosomal DNA restriction analysis (ARDRA), 16S rRNA sequence homology and phylogenetics analysis methods. Studies demonstrated that 85% of the total 354 isolates produced siderophores in iron limited liquid medium. A total of 28 ARDRA patterns were identified among the 299 siderophore-producing bacterial isolates. The 28 ARDRA patterns represented bacteria of 14 different genera belonging ...
Liu, Chi; Yao, Minjie; Stegen, James C; Rui, Junpeng; Li, Jiabao; Li, Xiangzhen
2017-12-13
How press disturbance (long-term) influences the phylogenetic turnover of soil microbial communities responding to pulse disturbances (short-term) is not fully known. Understanding the complex connections between the history of environmental conditions, assembly processes and microbial community dynamics is necessary to predict microbial response to perturbation. We started by investigating phylogenetic spatial turnover (based on DNA) of soil prokaryotic communities after long-term nitrogen (N) deposition and temporal turnover (based on RNA) of communities responding to pulse by conducting short-term rewetting experiments. The results showed that moderate N addition increased ecological stochasticity and phylogenetic diversity. In contrast, high N addition slightly increased homogeneous selection and decreased phylogenetic diversity. Examining the system with higher phylogenetic resolution revealed a moderate contribution of variable selection across the whole N gradient. The moisture pulse experiment showed that high N soils had higher rates of phylogenetic turnover across short phylogenetic distances and significant changes in community compositions through time. Long-term N input history influenced spatial turnover of microbial communities, but the dominant community assembly mechanisms differed across different N deposition gradients. We further revealed an interaction between press and pulse disturbances whereby deterministic processes were particularly important following pulse disturbances in high N soils.
A gateway for phylogenetic analysis powered by grid computing featuring GARLI 2.0.
Bazinet, Adam L; Zwickl, Derrick J; Cummings, Michael P
2014-09-01
We introduce molecularevolution.org, a publicly available gateway for high-throughput, maximum-likelihood phylogenetic analysis powered by grid computing. The gateway features a garli 2.0 web service that enables a user to quickly and easily submit thousands of maximum likelihood tree searches or bootstrap searches that are executed in parallel on distributed computing resources. The garli web service allows one to easily specify partitioned substitution models using a graphical interface, and it performs sophisticated post-processing of phylogenetic results. Although the garli web service has been used by the research community for over three years, here we formally announce the availability of the service, describe its capabilities, highlight new features and recent improvements, and provide details about how the grid system efficiently delivers high-quality phylogenetic results. © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.
Diversity, Mutation and Recombination Analysis of Cotton Leaf Curl Geminiviruses.
Directory of Open Access Journals (Sweden)
Huma Saleem
Full Text Available The spread of cotton leaf curl disease in China, India and Pakistan is a recent phenomenon. Analysis of available sequence data determined that there is a substantial diversity of cotton-infecting geminiviruses in Pakistan. Phylogenetic analyses indicated that recombination between two major groups of viruses, cotton leaf curl Multan virus (CLCuMuV and cotton leaf curl Kokhran virus (CLCuKoV, led to the emergence of several new viruses. Recombination detection programs and phylogenetic analyses showed that CLCuMuV and CLCuKoV are highly recombinant viruses. Indeed, CLCuKoV appeared to be a major donor virus for the coat protein (CP gene, while CLCuMuV donated the Rep gene in the majority of recombination events. Using recombination free nucleotide datasets the substitution rates for CP and Rep genes were determined. We inferred similar nucleotide substitution rates for the CLCuMuV-Rep gene (4.96X10-4 and CLCuKoV-CP gene (2.706X10-4, whereas relatively higher substitution rates were observed for CLCuMuV-CP and CLCuKoV-Rep genes. The combination of sequences with equal and relatively low substitution rates, seemed to result in the emergence of viral isolates that caused epidemics in Pakistan and India. Our findings also suggest that CLCuMuV is spreading at an alarming rate, which can potentially be a threat to cotton production in the Indian subcontinent.
DEFF Research Database (Denmark)
Gaya, Ester; Högnabba, Filip; Holguin, Ángela
2012-01-01
The resolution of the phylogenetic relationships within the order Teloschistales (Ascomycota, lichen-forming-fungi), with nearly 2000 known species and outstanding phenotypic diversity, has been hindered by the limitation in the resolving power that single-locus or two-locus phylogenetic studies...... – the Megalosporaceae – which is sister to the mainly rock-inhabiting, cosmopolitan, and species rich Teloschistaceae, with a diversity of growth habits ranging from crustose to fruticose. Our results confirm the use of a cumulative supermatrix approach as a viable method to generate comprehensive phylogenies...
Walker, Marina; Lyra, Mariana L; Haddad, Célio F B
2018-06-01
The genus Fritziana (Anura: Hemiphractidae) comprises six described species (F. goeldii, F. ohausi, F. fissilis, F. ulei, F. tonimi, and F. izecksohni) that are endemic to the Brazilian Atlantic Forest. Although the genus has been the subject of studies dealing with its taxonomy, phylogeny, and systematics, there is considerable evidence for cryptic diversity hidden among the species. The present study aims to understand the genetic diversity and phylogenetic relationships among the species of Fritziana, as well as the relationships among populations within species. We analyzed 107 individuals throughout the distribution of the genus using three mitochondrial gene fragments (12S, 16S, and COI) and two nuclear genes (RAG1 and SLC8A3). Our data indicated that the species diversity in the genus Fritziana is underestimated by the existence of at least three candidate species hidden amongst the group of species with a closed dorsal pouch (i.e. F. fissilis and F. ulei). We also found four species presenting geographical population structures and high genetic diversity, and thus require further investigations. In addition, we found that two candidate species show a new arrangement for the tRNA-Phe gene, unique in Anura so far. Based on our results, we suggest that the conservation status of the species, as well as the species diversity in the genus Fritziana, needs to be reviewed. Copyright © 2018 Elsevier Inc. All rights reserved.
Johnson, D B; Beddows, P A; Flynn, T M; Osburn, M R
2018-05-01
Laguna Bacalar is a sulfate-rich freshwater lake on the Yucatan Peninsula that hosts large microbialites. High sulfate concentrations distinguish Laguna Bacalar from other freshwater microbialite sites such as Pavilion Lake and Alchichica, Mexico, as well as from other aqueous features on the Yucatan Peninsula. While cyanobacterial populations have been described here previously, this study offers a more complete characterization of the microbial populations and corresponding biogeochemical cycling using a three-pronged geobiological approach of microscopy, high-throughput DNA sequencing, and lipid biomarker analyses. We identify and compare diverse microbial communities of Alphaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria that vary with location along a bank-to-bank transect across the lake, within microbialites, and within a neighboring mangrove root agglomeration. In particular, sulfate-reducing bacteria are extremely common and diverse, constituting 7%-19% of phylogenetic diversity within the microbialites, and are hypothesized to significantly influence carbonate precipitation. In contrast, Cyanobacteria account for less than 1% of phylogenetic diversity. The distribution of lipid biomarkers reflects these changes in microbial ecology, providing meaningful biosignatures for the microbes in this system. Polysaturated short-chain fatty acids characteristic of cyanobacteria account for Bacalar microbialites. By contrast, even short-chain and monounsaturated short-chain fatty acids attributable to both Cyanobacteria and many other organisms including types of Alphaproteobacteria and Gammaproteobacteria constitute 43%-69% and 17%-25%, respectively, of total abundance in microbialites. While cyanobacteria are the largest and most visible microbes within these microbialites and dominate the mangrove root agglomeration, it is clear that their smaller, metabolically diverse associates are responsible for significant biogeochemical cycling in this
Beta-diversity of ectoparasites at two spatial scales: nested hierarchy, geography and habitat type.
Warburton, Elizabeth M; van der Mescht, Luther; Stanko, Michal; Vinarski, Maxim V; Korallo-Vinarskaya, Natalia P; Khokhlova, Irina S; Krasnov, Boris R
2017-06-01
Beta-diversity of biological communities can be decomposed into (a) dissimilarity of communities among units of finer scale within units of broader scale and (b) dissimilarity of communities among units of broader scale. We investigated compositional, phylogenetic/taxonomic and functional beta-diversity of compound communities of fleas and gamasid mites parasitic on small Palearctic mammals in a nested hierarchy at two spatial scales: (a) continental scale (across the Palearctic) and (b) regional scale (across sites within Slovakia). At each scale, we analyzed beta-diversity among smaller units within larger units and among larger units with partitioning based on either geography or ecology. We asked (a) whether compositional, phylogenetic/taxonomic and functional dissimilarities of flea and mite assemblages are scale dependent; (b) how geographical (partitioning of sites according to geographic position) or ecological (partitioning of sites according to habitat type) characteristics affect phylogenetic/taxonomic and functional components of dissimilarity of ectoparasite assemblages and (c) whether assemblages of fleas and gamasid mites differ in their degree of dissimilarity, all else being equal. We found that compositional, phylogenetic/taxonomic, or functional beta-diversity was greater on a continental rather than a regional scale. Compositional and phylogenetic/taxonomic components of beta-diversity were greater among larger units than among smaller units within larger units, whereas functional beta-diversity did not exhibit any consistent trend regarding site partitioning. Geographic partitioning resulted in higher values of beta-diversity of ectoparasites than ecological partitioning. Compositional and phylogenetic components of beta-diversity were higher in fleas than mites but the opposite was true for functional beta-diversity in some, but not all, traits.
Zrafi-Nouira, Ines; Guermazi, Sonda; Chouari, Rakia; Safi, Nimer M D; Pelletier, Eric; Bakhrouf, Amina; Saidane-Mosbahi, Dalila; Sghir, Abdelghani
2009-07-01
The indigenous microbiota of polluted coastal seawater in Tunisia was enriched by increasing the concentration of zarzatine crude oil. The resulting adapted microbiota was incubated with zarzatine crude oil as the only carbon and energy source. Crude oil biodegradation capacity and bacterial population dynamics of the microbiota were evaluated every week for 28 days (day 7, day 14, day 21, and day 28). Results show that the percentage of petroleum degradation was 23.9, 32.1, 65.3, and 77.8%, respectively. At day 28, non-aromatic and aromatic hydrocarbon degradation rates reached 92.6 and 68.7%, respectively. Bacterial composition of the adapted microflora was analysed by 16S rRNA gene cloning and sequencing, using total genomic DNA extracted from the adapted microflora at days 0, 7, 14, 21, and 28. Five clone libraries were constructed and a total of 430 sequences were generated and grouped into OTUs using the ARB software package. Phylogenetic analysis of the adapted microbiota shows the presence of four phylogenetic groups: Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes. Diversity indices show a clear decrease in bacterial diversity of the adapted microflora according to the incubation time. The Proteobacteria are the most predominant (>80%) at day 7, day 14 and day 21 but not at day 28 for which the microbiota was reduced to only one OTU affiliated with the genus Kocuria of the Actinobacteria. This study shows that the degradation of zarzatine crude oil components depends on the activity of a specialized and dynamic seawater consortium composed of different phylogenetic taxa depending on the substrate complexity.
Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.
Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L
2015-01-01
Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.
Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.
Directory of Open Access Journals (Sweden)
Jordan R Gaston
Full Text Available Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA, serum resistance protein (dsrA, and a collagen adhesin (ncaA contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.
Higher speciation and lower extinction rates influence mammal diversity gradients in Asia.
Tamma, Krishnapriya; Ramakrishnan, Uma
2015-02-04
Little is known about the patterns and correlates of mammal diversity gradients in Asia. In this study, we examine patterns of species distributions and phylogenetic diversity in Asia and investigate if the observed diversity patterns are associated with differences in diversification rates between the tropical and non-tropical regions. We used species distribution maps and phylogenetic trees to generate species and phylogenetic diversity measures for 1° × 1° cells across mainland Asia. We constructed lineage-through-time plots and estimated diversification shift-times to examine the temporal patterns of diversifications across orders. Finally, we tested if the observed gradients in Asia could be associated with geographical differences in diversification rates across the tropical and non-tropical biomes. We estimated speciation, extinction and dispersal rates across these two regions for mammals, both globally and for Asian mammals. Our results demonstrate strong latitudinal and longitudinal gradients of species and phylogenetic diversity with Southeast Asia and the Himalayas showing highest diversity. Importantly, our results demonstrate that differences in diversification (speciation, extinction and dispersal) rates between the tropical and the non-tropical biomes influence the observed diversity gradients globally and in Asia. For the first time, we demonstrate that Asian tropics act as both cradles and museums of mammalian diversity. Temporal and spatial variation in diversification rates across different lineages of mammals is an important correlate of species diversity gradients observed in Asia.
Orthology prediction at scalable resolution by phylogenetic tree analysis
Directory of Open Access Journals (Sweden)
Huynen Martijn A
2007-03-01
Full Text Available Abstract Background Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic relations results in inparalogs and outparalogs. For situations with more than two species we lack semantics to specifically describe the phylogenetic relations, let alone to exploit them. Published procedures to extract orthologous groups from phylogenetic trees do not allow identification of orthology at various levels of resolution, nor do they document the relations between the orthologous groups. Results We introduce "levels of orthology" to describe the multi-level nature of gene relations. This is implemented in a program LOFT (Levels of Orthology From Trees that assigns hierarchical orthology numbers to genes based on a phylogenetic tree. To decide upon speciation and gene duplication events in a tree LOFT can be instructed either to perform classical species-tree reconciliation or to use the species overlap between partitions in the tree. The hierarchical orthology numbers assigned by LOFT effectively summarize the phylogenetic relations between genes. The resulting high-resolution orthologous groups are depicted in colour, facilitating visual inspection of (large trees. A benchmark for orthology prediction, that takes into account the varying levels of orthology between genes, shows that the phylogeny-based high-resolution orthology assignments made by LOFT are reliable. Conclusion The "levels of orthology" concept offers high resolution, reliable orthology, while preserving the relations between orthologous groups. A Windows as well as a preliminary Java version of LOFT is available from the LOFT website http://www.cmbi.ru.nl/LOFT.
Characterization of casein gene complex and genetic diversity analysis in Indian goats.
Rout, P K; Kumar, A; Mandal, A; Laloe, D; Singh, S K; Roy, R
2010-04-01
Milk protein polymorphism plays an important role in genetic diversity analysis, phylogenetic studies, establishing geographical diversity, conservation decision, and improving breeding goals. Milk protein polymorphism in Indian goat breeds has not been well studied; therefore, an investigation was carried out to analyze the genetic structure of the casein gene and milk protein diversity at six milk protein loci in nine Indian goat breeds/genetic groups from varied agro-climatic zones. Milk protein genotyping was carried out in 1098 individual milk samples by SDS-PAGE at alphaS1-CN (CSN1S1), beta-CN (CSN2), alphaS2-CN (CSN1S2), kappa-CN (CSN3), beta-LG, and alpha-LA loci. Indian goats exhibited alphaS1-casein A allele in higher frequency in the majority of breeds except Ganjam and local goats. The alphaS1-casein A allele frequencies varied from 0.45 to 0.77. A total of 16 casein haplotypes were observed in seven breeds and breed specific haplotypes were observed with respect to geographic region. The average number of alleles was lowest in Ganjam (1.66 +/- 0.81) and highest in Sirohi goats (2.50 +/- 1.05). Expected heterozygosity at six different loci demonstrated genetic diversity and breed fragmentation. Neighbor-Joining tree was built basing on Nei's distance. There was about 16.95% variability due to differences between breeds, indicating a strong subdivision. Principal component analysis was carried out to highlight the relationship among breeds. The variability among goat breeds was contributed by alphaS2-CN, beta-LG and alphaS1-CN. The Indian goats exhibited alphaS1-CN (CSN1S1) A allele in higher frequency in all the breeds indicating the higher casein yield in their milk.
Expressed sequence tags as a tool for phylogenetic analysis of placental mammal evolution.
Directory of Open Access Journals (Sweden)
Morgan Kullberg
Full Text Available BACKGROUND: We investigate the usefulness of expressed sequence tags, ESTs, for establishing divergences within the tree of placental mammals. This is done on the example of the established relationships among primates (human, lagomorphs (rabbit, rodents (rat and mouse, artiodactyls (cow, carnivorans (dog and proboscideans (elephant. METHODOLOGY/PRINCIPAL FINDINGS: We have produced 2000 ESTs (1.2 mega bases from a marsupial mouse and characterized the data for their use in phylogenetic analysis. The sequences were used to identify putative orthologous sequences from whole genome projects. Although most ESTs stem from single sequence reads, the frequency of potential sequencing errors was found to be lower than allelic variation. Most of the sequences represented slowly evolving housekeeping-type genes, with an average amino acid distance of 6.6% between human and mouse. Positive Darwinian selection was identified at only a few single sites. Phylogenetic analyses of the EST data yielded trees that were consistent with those established from whole genome projects. CONCLUSIONS: The general quality of EST sequences and the general absence of positive selection in these sequences make ESTs an attractive tool for phylogenetic analysis. The EST approach allows, at reasonable costs, a fast extension of data sampling from species outside the genome projects.
Directory of Open Access Journals (Sweden)
E.M.C Sanches
2011-10-01
Full Text Available The Pneumocystis genus is comprised of pathogens dwelling in the lungs of terrestrial, aerial, and aquatic mammals. Occasionally they induce severe pneumonitis, particularly in hosts with severe impairment of the immune system and progressively may fill pulmonary alveolar cavities causing respiratory failure. Molecular genetic studies revealed that Pneumocystis gene sequences present a marked divergence with the host species concerned. In the present study, the genetic diversity of Pneumocystis obtained from lungs of swines was examined by analyzing mitochondrial large subunit (mtLSU and small subunit (mtSSU rRNA sequences. The samples were obtained from two slaughterhouses located in two Brazilian states. Phylogenetic analysis demonstrated that genetic groupings within Pneumocystis organisms were in accordance with those of the corresponding hosts and that two clusters were formed. In conclusion, these data show that there are genetically distinct porcine Pneumocystis genotypes with at least two separate clusters in Brazil.
Functional and phylogenetic structure of island bird communities.
Si, Xingfeng; Cadotte, Marc W; Zeng, Di; Baselga, Andrés; Zhao, Yuhao; Li, Jiaqi; Wu, Yiru; Wang, Siyu; Ding, Ping
2017-05-01
Biodiversity change in anthropogenically transformed habitats is often nonrandom, yet the nature and importance of the different mechanisms shaping community structure are unclear. Here, we extend the classic Theory of Island Biogeography (TIB) to account for nonrandom processes by incorporating species traits and phylogenetic relationships into a study of faunal relaxation following habitat loss and fragmentation. Two possible mechanisms can create nonrandom community patterns on fragment islands. First, small and isolated islands might consist of similar or closely related species because they are environmentally homogeneous or select for certain shared traits, such as dispersal ability. Alternatively, communities on small islands might contain more dissimilar or distantly related species than on large islands because limited space and resource availability result in greater competitive exclusion among species with high niche overlap. Breeding birds were surveyed on 36 islands and two mainland sites annually from 2010 to 2014 in the Thousand Island Lake region, China. We assessed community structure of breeding birds on these subtropical land-bridge islands by integrating species' trait and evolutionary distances. We additionally analysed habitat heterogeneity and variance in size ratios to distinguish biotic and abiotic processes of community assembly. Results showed that functional-phylogenetic diversity increased with island area, and decreased with isolation. Bird communities on the mainland were more diverse and generally less clustered than island bird communities and not different than randomly assembled communities. Bird communities on islands tend to be functionally similar and phylogenetically clustered, especially on small and isolated islands. The nonrandom decline in species diversity and change in bird community structure with island area and isolation, along with the relatively homogeneous habitats on small islands, support the environmental
van Dijk, Bram; Hogeweg, P.
2016-01-01
Microbial communities can show astonishing ecological and phylogenetic diversity. What is the role of pervasive horizontal gene transfer (HGT) in shaping this diversity in the presence of clonally expanding "killer strains"? Does HGT of antibiotic production and resistance genes erase phylogenetic
GapCoder automates the use of indel characters in phylogenetic analysis.
Young, Nelson D; Healy, John
2003-02-19
Several ways of incorporating indels into phylogenetic analysis have been suggested. Simple indel coding has two strengths: (1) biological realism and (2) efficiency of analysis. In the method, each indel with different start and/or end positions is considered to be a separate character. The presence/absence of these indel characters is then added to the data set. We have written a program, GapCoder to automate this procedure. The program can input PIR format aligned datasets, find the indels and add the indel-based characters. The output is a NEXUS format file, which includes a table showing what region each indel characters is based on. If regions are excluded from analysis, this table makes it easy to identify the corresponding indel characters for exclusion. Manual implementation of the simple indel coding method can be very time-consuming, especially in data sets where indels are numerous and/or overlapping. GapCoder automates this method and is therefore particularly useful during procedures where phylogenetic analyses need to be repeated many times, such as when different alignments are being explored or when various taxon or character sets are being explored. GapCoder is currently available for Windows from http://www.home.duq.edu/~youngnd/GapCoder.
Directory of Open Access Journals (Sweden)
María Natalia Umaña
Full Text Available The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace and flooded forests (Igapó. We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties.
Umaña, María Natalia; Norden, Natalia; Cano, Ángela; Stevenson, Pablo R.
2012-01-01
The Amazon harbours one of the richest ecosystems on Earth. Such diversity is likely to be promoted by plant specialization, associated with the occurrence of a mosaic of landscape units. Here, we integrate ecological and phylogenetic data at different spatial scales to assess the importance of habitat specialization in driving compositional and phylogenetic variation across the Amazonian forest. To do so, we evaluated patterns of floristic dissimilarity and phylogenetic turnover, habitat association and phylogenetic structure in three different landscape units occurring in terra firme (Hilly and Terrace) and flooded forests (Igapó). We established two 1-ha tree plots in each of these landscape units at the Caparú Biological Station, SW Colombia, and measured edaphic, topographic and light variables. At large spatial scales, terra firme forests exhibited higher levels of species diversity and phylodiversity than flooded forests. These two types of forests showed conspicuous differences in species and phylogenetic composition, suggesting that environmental sorting due to flood is important, and can go beyond the species level. At a local level, landscape units showed floristic divergence, driven both by geographical distance and by edaphic specialization. In terms of phylogenetic structure, Igapó forests showed phylogenetic clustering, whereas Hilly and Terrace forests showed phylogenetic evenness. Within plots, however, local communities did not show any particular trend. Overall, our findings suggest that flooded forests, characterized by stressful environments, impose limits to species occurrence, whereas terra firme forests, more environmentally heterogeneous, are likely to provide a wider range of ecological conditions and therefore to bear higher diversity. Thus, Amazonia should be considered as a mosaic of landscape units, where the strength of habitat association depends upon their environmental properties. PMID:23028844
Unrealistic phylogenetic trees may improve phylogenetic footprinting.
Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo
2017-06-01
The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
Rothwell, Gar W; Stockey, Ruth A
2016-05-01
Discovery of cupulate ovules of Doylea tetrahedrasperma within a compact, compound seed cone highlights the rich diversity of fructification morphologies, pollination biologies, postpollination enclosure of seeds, and systematic diversity of Early Cretaceous gymnosperms. Specimens were studied using the cellulose acetate peel technique, three-dimensional reconstructions (in AVIZO), and morphological phylogenetic analyses (in TNT). Doylea tetrahedrasperma has bract/fertile short shoot complexes helically arranged within a compact, compound seed cone. Complexes diverge from the axis as a single unit and separate distally into a free bract tip and two sporophylls. Each sporophyll bears a single, abaxial seed, recurved toward the cone axis, that is enveloped after pollinaton by sporophyll tissue, forming a closed cupule. Ovules are pollinated by bisaccate grains captured by micropylar pollination horns. The unique combination of characters shown by D. tetrahedrasperma includes the presence of cupulate seeds borne in conifer-like compound seed cones, an ovuliferous scale analogue structurally equivalent to the ovulate stalk of Ginkgo biloba, gymnospermous pollination, and nearly complete enclosure of mature seeds. These features characterize the Doyleales ord. nov., clearly distinguish it from the seed fern order Corystospermales, and allow for recognition of another recently described Early Cretaceous seed plant as a second species in genus Doylea. A morphological phylogenetic analysis highlights systematic relationships of the Doyleales ord. nov. and emphasizes the explosive phylogenetic diversification of gymnosperms that was underway at the time when flowering plants may have originated and/or first began to radiate. © 2016 Botanical Society of America.
Directory of Open Access Journals (Sweden)
Zheng Wang
Full Text Available An abundance of novel fungal lineages have been indicated by DNA sequencing of the nuclear ribosomal ITS region from environmental samples such as soil and wood. Although phylogenetic analysis of these novel lineages is a key component of unveiling the structure and diversity of complex communities, such analyses are rare for environmental ITS data due to the difficulties of aligning this locus across significantly divergent taxa. One potential approach to this issue is simultaneous alignment and tree estimation. We targeted divergent ITS sequences of the earth tongue fungi (Geoglossomycetes, a basal class in the Ascomycota, to assess the performance of SATé, recent software that combines progressive alignment and tree building. We found that SATé performed well in generating high-quality alignments and in accurately estimating the phylogeny of earth tongue fungi. Drawing from a data set of 300 sequences of earth tongues and progressively more distant fungal lineages, 30 insufficiently identified ITS sequences from the public sequence databases were assigned to the Geoglossomycetes. The association between earth tongues and plants has been hypothesized for a long time, but hard evidence is yet to be collected. The ITS phylogeny showed that four ectomycorrhizal isolates shared a clade with Geoglossum but not with Trichoglossum earth tongues, pointing to the significant potential inherent to ecological data mining of environmental samples. Environmental sampling holds the key to many focal questions in mycology, and simultaneous alignment and tree estimation, as performed by SATé, can be a highly efficient companion in that pursuit.
Penicillium simile sp. nov. revealed by morphological and phylogenetic analysis.
Davolos, Domenico; Pietrangeli, Biancamaria; Persiani, Anna Maria; Maggi, Oriana
2012-02-01
The morphology of three phenetically identical Penicillium isolates, collected from the bioaerosol in a restoration laboratory in Italy, displayed macro- and microscopic characteristics that were similar though not completely ascribable to Penicillium raistrickii. For this reason, a phylogenetic approach based on DNA sequencing analysis was performed to establish both the taxonomic status and the evolutionary relationships of these three peculiar isolates in relation to previously described species of the genus Penicillium. We used four nuclear loci (both rRNA and protein coding genes) that have previously proved useful for the molecular investigation of taxa belonging to the genus Penicillium at various evolutionary levels. The internal transcribed spacer region (ITS1-5.8S-ITS2), domains D1 and D2 of the 28S rDNA, a region of the tubulin beta chain gene (benA) and part of the calmodulin gene (cmd) were amplified by PCR and sequenced. Analysis of the rRNA genes and of the benA and cmd sequence data indicates the presence of three isogenic isolates belonging to a genetically distinct species of the genus Penicillium, here described and named Penicillium simile sp. nov. (ATCC MYA-4591(T) = CBS 129191(T)). This novel species is phylogenetically different from P. raistrickii and other related species of the genus Penicillium (e.g. Penicillium scabrosum), from which it can be distinguished on the basis of morphological trait analysis.
Highly structured genetic diversity of the Mycobacterium tuberculosis population in Djibouti.
Godreuil, S; Renaud, F; Choisy, M; Depina, J J; Garnotel, E; Morillon, M; Van de Perre, P; Bañuls, A L
2010-07-01
Djibouti is an East African country with a high tuberculosis incidence. This study was conducted over a 2-month period in Djibouti, during which 62 consecutive patients with pulmonary tuberculosis (TB) were included. Genetic characterization of Mycobacterium tuberculosis, using mycobacterial interspersed repetitive-unit variable-number tandem-repeat typing and spoligotyping, was performed. The genetic and phylogenetic analysis revealed only three major families (Central Asian, East African Indian and T). The high diversity and linkage disequilibrium within each family suggest a long period of clonal evolution. A Bayesian approach shows that the phylogenetic structure observed in our sample of 62 isolates is very likely to be representative of the phylogenetic structure of the M. tuberculosis population in the total number of TB cases.
Phylogenetic trees in bioinformatics
Energy Technology Data Exchange (ETDEWEB)
Burr, Tom L [Los Alamos National Laboratory
2008-01-01
Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.
Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs.
Amarouche-Yala, Samia; Benouadah, Ali; El Ouahab Bentabet, Abd; López-García, Purificación
2014-11-01
Geothermal springs in Algeria have been known since the Roman Empire. They mainly locate in Eastern Algeria and are inhabited by thermophilic organisms, which include cyanobacteria forming mats and concretions. In this work, we have investigated the cyanobacterial diversity of these springs. Cyanobacteria were collected from water, concretions and mats in nine hot springs with water temperatures ranging from 39 to 93 °C. Samples were collected for isolation in culture, microscopic morphological examination, and molecular diversity analysis based on 16S rRNA gene sequences. Nineteen different cyanobacterial morphotypes were identified, the most abundant of which were three species of Leptolyngbya, accompanied by members of the genera Gloeocapsa, Gloeocapsopsis, Stigonema, Fischerella, Synechocystis, Microcoleus, Cyanobacterium, Chroococcus and Geitlerinema. Molecular diversity analyses were in good general agreement with classical identification and allowed the detection of additional species in three springs with temperatures higher than 50 °C. They corresponded to a Synechococcus clade and to relatives of the intracellularly calcifying Candidatus Gloeomargarita lithophora. The hottest springs were dominated by members of Leptolyngbya, Synechococcus-like cyanobacteria and Gloeomargarita, whereas Oscillatoriales other than Leptolyngbya, Chroococcales and Stigonematales dominated lower temperature springs. The isolation of some of these strains sets the ground for future studies on the biology of thermophilic cyanobacteria.
PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis
Benavente, Ernest D
2015-05-13
Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).
Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert
2016-01-01
We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.
Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History
Directory of Open Access Journals (Sweden)
N.L.P Indi Dharmayanti
2011-03-01
Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.
Slingsby, Jasper A; Verboom, G Anthony
2006-07-01
Species co-occurrence at fine spatial scales is expected to be nonrandom with respect to phylogeny because of the joint effects of evolutionary (trait convergence and conservatism) and ecological (competitive exclusion and habitat filtering) processes. We use data from 11 existing vegetation surveys to test whether co-occurrence in schoenoid sedge assemblages in the Cape Floristic Region shows significant phylogenetic structuring and to examine whether this changes with the phylogenetic scale of the analysis. We provide evidence for phylogenetic overdispersion in an alliance of closely related species (the reticulate-sheathed Tetraria clade) using both quantile regression analysis and a comparison between the mean observed and expected phylogenetic distances between co-occurring species. Similar patterns are not evident when the analyses are performed at a broader phylogenetic scale. Examination of six functional traits suggests a general pattern of trait conservatism within the reticulate-sheathed Tetraria clade, suggesting a potential role for interspecific competition in structuring co-occurrence within this group. We suggest that phylogenetic overdispersion of communities may be common throughout many of the Cape lineages, since interspecific interactions are likely intensified in lineages with large numbers of species restricted to a small geographic area, and we discuss the potential implications for patterns of diversity in the Cape.
Genome Size Diversity in Lilium (Liliaceae Is Correlated with Karyotype and Environmental Traits
Directory of Open Access Journals (Sweden)
Yun-peng Du
2017-07-01
Full Text Available Genome size (GS diversity is of fundamental biological importance. The occurrence of giant genomes in angiosperms is restricted to just a few lineages in the analyzed genome size of plant species so far. It is still an open question whether GS diversity is shaped by neutral or natural selection. The genus Lilium, with giant genomes, is phylogenetically and horticulturally important and is distributed throughout the northern hemisphere. GS diversity in Lilium and the underlying evolutionary mechanisms are poorly understood. We performed a comprehensive study involving phylogenetically independent analysis on 71 species to explore the diversity and evolution of GS and its correlation with karyological and environmental traits within Lilium (including Nomocharis. The strong phylogenetic signal detected for GS in the genus provides evidence consistent with that the repetitive DNA may be the primary contributors to the GS diversity, while the significant positive relationships detected between GS and the haploid chromosome length (HCL provide insights into patterns of genome evolution. The relationships between GS and karyotypes indicate that ancestral karyotypes of Lilium are likely to have exhibited small genomes, low diversity in centromeric index (CVCI values and relatively high relative variation in chromosome length (CVCL values. Significant relationships identified between GS and annual temperature and between GS and annual precipitation suggest that adaptation to habitat strongly influences GS diversity. We conclude that GS in Lilium is shaped by both neutral (genetic drift and adaptive evolution. These findings will have important consequences for understanding the evolution of giant plant genomes, and exploring the role of repetitive DNA fraction and chromosome changes in a plant group with large genomes and conservation of chromosome number.
Kuechler, Stefan Martin; Matsuura, Yu; Dettner, Konrad; Kikuchi, Yoshitomo
2016-06-25
Diverse phytophagous heteropteran insects, commonly known as stinkbugs, are associated with specific gut symbiotic bacteria, which have been found in midgut cryptic spaces. Recent studies have revealed that members of the stinkbug families Coreidae and Alydidae of the superfamily Coreoidea are consistently associated with a specific group of the betaproteobacterial genus Burkholderia, called the "stinkbug-associated beneficial and environmental (SBE)" group, and horizontally acquire specific symbionts from the environment every generation. However, the symbiotic system of another coreoid family, Stenocephalidae remains undetermined. We herein investigated four species of the stenocephalid genus Dicranocephalus. Examinations via fluorescence in situ hybridization (FISH) and transmission electron microscopy (TEM) revealed the typical arrangement and ultrastructures of midgut crypts and gut symbionts. Cloning and molecular phylogenetic analyses of bacterial genes showed that the midgut crypts of all species are colonized by Burkholderia strains, which were further assigned to different subgroups of the genus Burkholderia. In addition to the SBE-group Burkholderia, a number of stenocephalid symbionts belonged to a novel clade containing B. sordidicola and B. udeis, suggesting a specific symbiont clade for the Stenocephalidae. The symbiotic systems of stenocephalid bugs may provide a unique opportunity to study the ongoing evolution of symbiont associations in the stinkbug-Burkholderia interaction.
Directory of Open Access Journals (Sweden)
Dennis Hanke
2016-07-01
Full Text Available There has been limited knowledge on spatio-temporal epidemiology of zoonotic arctic fox rabies among countries bordering the Arctic, in particular Greenland. Previous molecular epidemiological studies have suggested the occurrence of one particular arctic rabies virus (RABV lineage (arctic-3, but have been limited by a low number of available samples preventing in-depth high resolution phylogenetic analysis of RABVs at that time. However, an improved knowledge of the evolution, at a molecular level, of the circulating RABVs and a better understanding of the historical perspective of the disease in Greenland is necessary for better direct control measures on the island. These issues have been addressed by investigating the spatio-temporal genetic diversity of arctic RABVs and their reservoir host, the arctic fox, in Greenland using both full and partial genome sequences. Using a unique set of 79 arctic RABV full genome sequences from Greenland, Canada, USA (Alaska and Russia obtained between 1977 and 2014, a description of the historic context in relation to the genetic diversity of currently circulating RABV in Greenland and neighboring Canadian Northern territories has been provided. The phylogenetic analysis confirmed delineation into four major arctic RABV lineages (arctic 1-4 with viruses from Greenland exclusively grouping into the circumpolar arctic-3 lineage. High resolution analysis enabled distinction of seven geographically distinct subclades (3.I - 3.VII with two subclades containing viruses from both Greenland and Canada. By combining analysis of full length RABV genome sequences and host derived sequences encoding mitochondrial proteins obtained simultaneously from brain tissues of 49 arctic foxes, the interaction of viruses and their hosts was explored in detail. Such an approach can serve as a blueprint for analysis of infectious disease dynamics and virus-host interdependencies. The results showed a fine-scale spatial population
Directory of Open Access Journals (Sweden)
Jérôme Beaufays
Full Text Available BACKGROUND: During their blood meal, ticks secrete a wide variety of proteins that interfere with their host's defense mechanisms. Among these proteins, lipocalins play a major role in the modulation of the inflammatory response. METHODOLOGY/PRINCIPAL FINDINGS: Screening a cDNA library in association with RT-PCR and RACE methodologies allowed us to identify 14 new lipocalin genes in the salivary glands of the Ixodes ricinus hard tick. A computational in-depth structural analysis confirmed that LIRs belong to the lipocalin family. These proteins were called LIR for "Lipocalin from I. ricinus" and numbered from 1 to 14 (LIR1 to LIR14. According to their percentage identity/similarity, LIR proteins may be assigned to 6 distinct phylogenetic groups. The mature proteins have calculated pM and pI varying from 21.8 kDa to 37.2 kDa and from 4.45 to 9.57 respectively. In a western blot analysis, all recombinant LIRs appeared as a series of thin bands at 50-70 kDa, suggesting extensive glycosylation, which was experimentally confirmed by treatment with N-glycosidase F. In addition, the in vivo expression analysis of LIRs in I. ricinus, examined by RT-PCR, showed homogeneous expression profiles for certain phylogenetic groups and relatively heterogeneous profiles for other groups. Finally, we demonstrated that LIR6 codes for a protein that specifically binds leukotriene B4. CONCLUSIONS/SIGNIFICANCE: This work confirms that, regarding their biochemical properties, expression profile, and sequence signature, lipocalins in Ixodes hard tick genus, and more specifically in the Ixodes ricinus species, are segregated into distinct phylogenetic groups suggesting potential distinct function. This was particularly demonstrated by the ability of LIR6 to scavenge leukotriene B4. The other LIRs did not bind any of the ligands tested, such as 5-hydroxytryptamine, ADP, norepinephrine, platelet activating factor, prostaglandins D2 and E2, and finally leukotrienes B4 and C
International Nuclear Information System (INIS)
Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.
2017-01-01
Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)
She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C
2015-01-01
The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Toyama, Hironori; Kajisa, Tsuyoshi; Tagane, Shuichiro; Mase, Keiko; Chhang, Phourin; Samreth, Vanna; Ma, Vuthy; Sokh, Heng; Ichihashi, Ryuji; Onoda, Yusuke; Mizoue, Nobuya; Yahara, Tetsukazu
2015-02-19
Ecological communities including tropical rainforest are rapidly changing under various disturbances caused by increasing human activities. Recently in Cambodia, illegal logging and clear-felling for agriculture have been increasing. Here, we study the effects of logging, mortality and recruitment of plot trees on phylogenetic community structure in 32 plots in Kampong Thom, Cambodia. Each plot was 0.25 ha; 28 plots were established in primary evergreen forests and four were established in secondary dry deciduous forests. Measurements were made in 1998, 2000, 2004 and 2010, and logging, recruitment and mortality of each tree were recorded. We estimated phylogeny using rbcL and matK gene sequences and quantified phylogenetic α and β diversity. Within communities, logging decreased phylogenetic diversity, and increased overall phylogenetic clustering and terminal phylogenetic evenness. Between communities, logging increased phylogenetic similarity between evergreen and deciduous plots. On the other hand, recruitment had opposite effects both within and between communities. The observed patterns can be explained by environmental homogenization under logging. Logging is biased to particular species and larger diameter at breast height, and forest patrol has been effective in decreasing logging. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Jing, Hongmei; Zhang, Rui; Pointing, Stephen B; Liu, Hongbin; Qian, Peiyuan
2009-03-01
The phylogenetic diversity of the marine Synechococcus community in the subtropical coastal waters of Hong Kong, China, was examined through intergenic transcribed spacer clone libraries. All the sequences obtained fell within both marine cluster A (MC-A) and B (MC-B), with MC-A phylotypes dominating throughout the year. Distinct phylogenetic lineages specific to Hong Kong waters were detected from both MC-A and MC-B. The highest Synechococcus community diversity occurred in December, but the highest Synechococcus abundance occurred in August. On the other hand, both the abundance and diversity of Synechococcus showed a minimum in February. The remarkable seasonal variations of Synechococcus diversity observed were likely the result of the changes of hydrographic condition modulated by monsoons. Principal component analysis revealed that the in situ abiotic water characteristics, especially salinity and water turbidity, explained much of the variability of the marine Synechococcus population diversity in Hong Kong coastal waters. In addition, the temporal changes of Synechococcus abundance were largely driven by water temperature.
Accurate phylogenetic classification of DNA fragments based onsequence composition
Energy Technology Data Exchange (ETDEWEB)
McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore
2006-05-01
Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.
Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus)
2011-01-01
Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58), we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP) were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of ompA as a fine
Novel molecular markers of Chlamydia pecorum genetic diversity in the koala (Phascolarctos cinereus
Directory of Open Access Journals (Sweden)
Timms Peter
2011-04-01
Full Text Available Abstract Background Chlamydia pecorum is an obligate intracellular bacterium and the causative agent of reproductive and ocular disease in several animal hosts including koalas, sheep, cattle and goats. C. pecorum strains detected in koalas are genetically diverse, raising interesting questions about the origin and transmission of this species within koala hosts. While the ompA gene remains the most widely-used target in C. pecorum typing studies, it is generally recognised that surface protein encoding genes are not suited for phylogenetic analysis and it is becoming increasingly apparent that the ompA gene locus is not congruent with the phylogeny of the C. pecorum genome. Using the recently sequenced C. pecorum genome sequence (E58, we analysed 10 genes, including ompA, to evaluate the use of ompA as a molecular marker in the study of koala C. pecorum genetic diversity. Results Three genes (incA, ORF663, tarP were found to contain sufficient nucleotide diversity and discriminatory power for detailed analysis and were used, with ompA, to genotype 24 C. pecorum PCR-positive koala samples from four populations. The most robust representation of the phylogeny of these samples was achieved through concatenation of all four gene sequences, enabling the recreation of a "true" phylogenetic signal. OmpA and incA were of limited value as fine-detailed genetic markers as they were unable to confer accurate phylogenetic distinctions between samples. On the other hand, the tarP and ORF663 genes were identified as useful "neutral" and "contingency" markers respectively, to represent the broad evolutionary history and intra-species genetic diversity of koala C. pecorum. Furthermore, the concatenation of ompA, incA and ORF663 sequences highlighted the monophyletic nature of koala C. pecorum infections by demonstrating a single evolutionary trajectory for koala hosts that is distinct from that seen in non-koala hosts. Conclusions While the continued use of
Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards
Erens, Jesse; Miralles, A.; Glaw, F.; Chatrou, L.W.; Vences, M.
2017-01-01
Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the
Bouskill, Nicholas J; Eveillard, Damien; Chien, Diana; Jayakumar, Amal; Ward, Bess B
2012-03-01
Ammonia-oxidizing bacteria (AOB) and archaea (AOA) play a vital role in bridging the input of fixed nitrogen, through N-fixation and remineralization, to its loss by denitrification and anammox. Yet the major environmental factors determining AOB and AOA population dynamics are little understood, despite both groups having a wide environmental distribution. This study examined the relative abundance of both groups of ammonia-oxidizing organisms (AOO) and the diversity of AOA across large-scale gradients in temperature, salinity and substrate concentration and dissolved oxygen. The relative abundance of AOB and AOA varied across environments, with AOB dominating in the freshwater region of the Chesapeake Bay and AOA more abundant in the water column of the coastal and open ocean. The highest abundance of the AOA amoA gene was recorded in the oxygen minimum zones (OMZs) of the Eastern Tropical South Pacific (ETSP) and the Arabian Sea (AS). The ratio of AOA : AOB varied from 0.7 in the Chesapeake Bay to 1600 in the Sargasso Sea. Relative abundance of both groups strongly correlated with ammonium concentrations. AOA diversity, as determined by phylogenetic analysis of clone library sequences and archetype analysis from a functional gene DNA microarray, detected broad phylogenetic differences across the study sites. However, phylogenetic diversity within physicochemically congruent stations was more similar than would be expected by chance. This suggests that the prevailing geochemistry, rather than localized dispersal, is the major driving factor determining OTU distribution. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Diogo Neves Proença
Full Text Available Pine wilt disease (PWD is native to North America and has spread to Asia and Europe. Lately, mutualistic relationship has been suggested between the pinewood nematode (PWN, Bursaphelenchus xylophilus the causal nematode agent of PWD, and bacteria. In countries where PWN occurs, nematodes from diseased trees were reported to carry bacteria from several genera. However no data exists for the United States. The objective of this study was to evaluate the diversity of the bacterial community carried by B. xylophilus, isolated from different Pinus spp. with PWD in Nebraska, United States. The bacteria carried by PWN belonged to Gammaproteobacteria (79.9%, Betaproteobacteria (11.7%, Bacilli (5.0%, Alphaproteobacteria (1.7% and Flavobacteriia (1.7%. Strains from the genera Chryseobacterium and Pigmentiphaga were found associated with the nematode for the first time. These results were compared to results from similar studies conducted from other countries of three continents in order to assess the diversity of bacteria with associated with PWN. The isolates from the United States, Portugal and China belonged to 25 different genera and only strains from the genus Pseudomonas were found in nematodes from all countries. The strains from China were closely related to P. fluorescens and the strains isolated from Portugal and USA were phylogenetically related to P. mohnii and P. lutea. Nematodes from the different countries are associated with bacteria of different species, not supporting a relationship between PWN with a particular bacterial species. Moreover, the diversity of the bacteria carried by the pinewood nematode seems to be related to the geographic area and the Pinus species. The roles these bacteria play within the pine trees or when associated with the nematodes, might be independent of the presence of the nematode in the tree and only related on the bacteria's relationship with the tree.
International Nuclear Information System (INIS)
Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)
Gill, Aman S; Lee, Angela; McGuire, Krista L
2017-08-15
New York City (NYC) is pioneering green infrastructure with the use of bioswales and other engineered soil-based habitats to provide stormwater infiltration and other ecosystem functions. In addition to avoiding the environmental and financial costs of expanding traditional built infrastructure, green infrastructure is thought to generate cobenefits in the form of diverse ecological processes performed by its plant and microbial communities. Yet, although plant communities in these habitats are closely managed, we lack basic knowledge about how engineered ecosystems impact the distribution and functioning of soil bacteria. We sequenced amplicons of the 16S ribosomal subunit, as well as seven genes associated with functional pathways, generated from both total (DNA-based) and expressed (RNA) soil communities in the Bronx, NYC, NY, in order to test whether bioswale soils host characteristic bacterial communities with evidence for enriched microbial functioning, compared to nonengineered soils in park lawns and tree pits. Bioswales had distinct, phylogenetically diverse bacterial communities, including taxa associated with nutrient cycling and metabolism of hydrocarbons and other pollutants. Bioswale soils also had a significantly greater diversity of genes involved in several functional pathways, including carbon fixation ( cbbL-R [ cbbL gene, red-like subunit] and apsA ), nitrogen cycling ( noxZ and amoA ), and contaminant degradation ( bphA ); conversely, no functional genes were significantly more abundant in nonengineered soils. These results provide preliminary evidence that urban land management can shape the diversity and activity of soil communities, with positive consequences for genetic resources underlying valuable ecological functions, including biogeochemical cycling and degradation of common urban pollutants. IMPORTANCE Management of urban soil biodiversity by favoring taxa associated with decontamination or other microbial metabolic processes is a
The rhabdoviruses: biodiversity, phylogenetics, and evolution.
Kuzmin, I V; Novella, I S; Dietzgen, R G; Padhi, A; Rupprecht, C E
2009-07-01
Rhabdoviruses (family Rhabdoviridae) include a diversity of important pathogens of animals and plants. They share morphology and genome organization. The understanding of rhabdovirus phylogeny, ecology and evolution has progressed greatly during the last 30 years, due to enhanced surveillance and improved methodologies of molecular characterization. Along with six established genera, several phylogenetic groups at different levels were described within the Rhabdoviridae. However, comparative relationships between viral phylogeny and taxonomy remains incomplete, with multiple representatives awaiting further genetic characterization. The same is true for rhabdovirus evolution. To date, rather simplistic molecular clock models only partially describe the evolutionary dynamics of postulated viral lineages. Ongoing progress in viral evolutionary and ecological investigations will provide the platform for future studies of this diverse family.
Chen, Jin-Min; Poyarkov, Nikolay A; Suwannapoom, Chatmongkon; Lathrop, Amy; Wu, Yun-He; Zhou, Wei-Wei; Yuan, Zhi-Yong; Jin, Jie-Qiong; Chen, Hong-Man; Liu, He-Qun; Nguyen, Truong Quang; Nguyen, Sang Ngoc; Duong, Tang Van; Eto, Koshiro; Nishikawa, Kanto; Matsui, Masafumi; Orlov, Nikolai L; Stuart, Bryan L; Brown, Rafe M; Rowley, Jodi J L; Murphy, Robert W; Wang, Ying-Yong; Che, Jing
2018-07-01
Southeast Asia and southern China (SEA-SC) harbor a highly diverse and endemic flora and fauna that is under increasing threat. An understanding of the biogeographical history and drivers of this diversity is lacking, especially in some of the most diverse and threatened groups. The Asian leaf-litter frog genus Leptolalax Dubois 1980 is a forest-dependent genus distributed throughout SEA-SC, making it an ideal study group to examine specific biogeographic hypotheses. In addition, the diversity of this genus remains poorly understood, and the phylogenetic relationships among species of Leptolalax and closely related Leptobrachella Smith 1928 remain unclear. Herein, we evaluate species-level diversity based on 48 of the 53 described species from throughout the distribution of Leptolalax. Molecular analyses reveal many undescribed species, mostly in southern China and Indochina. Our well-resolved phylogeny based on multiple nuclear DNA markers shows that Leptolalax is not monophyletic with respect to Leptobrachella and, thus, we assign the former to being a junior synonym of the latter. Similarly, analyses reject monophyly of the two subgenera of Leptolalax. The diversification pattern of the group is complex, involving a high degree of sympatry and prevalence of microendemic species. Northern Sundaland (Borneo) and eastern Indochina (Vietnam) appear to have played pivotal roles as geographical centers of diversification, and paleoclimatic changes and tectonic movements seem to have driven the major divergence of clades. Analyses fail to reject an "upstream" colonization hypothesis, and, thus, the genus appears to have originated in Sundaland and then colonized mainland Asia. Our results reveal that both vicariance and dispersal are responsible for current distribution patterns in the genus. Copyright © 2018 Elsevier Inc. All rights reserved.
Crawford, Andrew J; Lips, Karen R; Bermingham, Eldredge
2010-08-03
Amphibian populations around the world are experiencing unprecedented declines attributed to a chytrid fungal pathogen, Batrachochytrium dendrobatidis. Despite the severity of the crisis, quantitative analyses of the effects of the epidemic on amphibian abundance and diversity have been unavailable as a result of the lack of equivalent data collected before and following disease outbreak. We present a community-level assessment combining long-term field surveys and DNA barcode data describing changes in abundance and evolutionary diversity within the amphibian community of El Copé, Panama, following a disease epidemic and mass-mortality event. The epidemic reduced taxonomic, lineage, and phylogenetic diversity similarly. We discovered that 30 species were lost, including five undescribed species, representing 41% of total amphibian lineage diversity in El Copé. These extirpations represented 33% of the evolutionary history of amphibians within the community, and variation in the degree of population loss and decline among species was random with respect to the community phylogeny. Our approach provides a fast, economical, and informative analysis of loss in a community whether measured by species or phylogenetic diversity.
[New isolation methods and phylogenetic diversity of actinobacteria from hypersaline beach in Aksu].
Zhang, Yao; Xia, Zhanfeng; Cao, Xinbo; Li, Jun; Zhang, Lili
2013-08-04
We explored 4 new methods to improve the isolation of actinobacterial resources from high salt areas. Optimized media based on 4 new strategies were used for isolating actinobacteria from hypersaline beaches. Glycerin-arginine, trehalose-creatine, glycerol-asparticacid, mannitol-casein, casein-mannitol, mannitol-alanine, chitosan-asparagineand GAUZE' No. 1 were used as basic media. New isolation strategy includes 4 methods: ten-fold dilution culture, simulation of the original environment, actinobacterial culture guided by uncultured molecular technology detected, and reference of actinobacterial media for brackish marine environment. The 16S rRNA genes of the isolates were amplified with bacterial universal primers. The results of 16S rRNA gene sequences were compared with sequences obtained from GenBank databases. We constructed phylogenetic tree with the neighbor-joining method. No actinobacterial strains were isolated by 8 media of control group, while 403 strains were isolated by new strategies. The isolates by new methods were members of 14 genera (Streptomyces, Streptomonospora, Saccharomonospora, Plantactinospora, Nocardia, Amycolatopsis, Glycomyces, Micromonospora, Nocardiopsis, Isoptericola, Nonomuraea, Thermobifida, Actinopolyspora, Actinomadura) of 10 families in 8 suborders. The most abundant and diverse isolates were the two suborders of Streptomycineae (69.96%) and Streptosporangineaesuborder (9.68%) within the phylum Actinobacteria, including 9 potential novel species. New isolation methods significantly improved the actinobacterial culturability of hypersaline areas, and obtained many potential novel species, which provided a new and more effective way to isolate actinobacteria resources in hypersaline environments.
Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.
Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M
2012-02-01
The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).
Life at the hyperarid margin: novel bacterial diversity in arid soils of the Atacama Desert, Chile
Neilson, Julia W.; Quade, Jay; Ortiz, Marianyoly; Nelson, William M.; Legatzki, Antje; Tian, Fei; LaComb, Michelle; Betancourt, Julio L.; Wing, Rod A.; Soderlund, Carol A.; Maier, Raina M.
2012-01-01
Nearly half the earth's surface is occupied by dryland ecosystems, regions susceptible to reduced states of biological productivity caused by climate fluctuations. Of these regions, arid zones located at the interface between vegetated semiarid regions and biologically unproductive hyperarid zones are considered most vulnerable. The objective of this study was to conduct a deep diversity analysis of bacterial communities in unvegetated arid soils of the Atacama Desert, to characterize community structure and infer the functional potential of these communities based on observed phylogenetic associations. A 454-pyrotag analysis was conducted of three unvegetated arid sites located at the hyperarid-arid margin. The analysis revealed communities with unique bacterial diversity marked by high abundances of novel Actinobacteria and Chloroflexi and low levels of Acidobacteria and Proteobacteria, phyla that are dominant in many biomes. A 16S rRNA gene library of one site revealed the presence of clones with phylogenetic associations to chemoautotrophic taxa able to obtain energy through oxidation of nitrite, carbon monoxide, iron, or sulfur. Thus, soils at the hyperarid margin were found to harbor a wealth of novel bacteria and to support potentially viable communities with phylogenetic associations to non-phototrophic primary producers and bacteria capable of biogeochemical cycling.
Life at the hyperarid margin: novel bacterial diversity in arid soils of the Atacama Desert, Chile.
Neilson, Julia W; Quade, Jay; Ortiz, Marianyoly; Nelson, William M; Legatzki, Antje; Tian, Fei; LaComb, Michelle; Betancourt, Julio L; Wing, Rod A; Soderlund, Carol A; Maier, Raina M
2012-05-01
Nearly half the earth's surface is occupied by dryland ecosystems, regions susceptible to reduced states of biological productivity caused by climate fluctuations. Of these regions, arid zones located at the interface between vegetated semiarid regions and biologically unproductive hyperarid zones are considered most vulnerable. The objective of this study was to conduct a deep diversity analysis of bacterial communities in unvegetated arid soils of the Atacama Desert, to characterize community structure and infer the functional potential of these communities based on observed phylogenetic associations. A 454-pyrotag analysis was conducted of three unvegetated arid sites located at the hyperarid-arid margin. The analysis revealed communities with unique bacterial diversity marked by high abundances of novel Actinobacteria and Chloroflexi and low levels of Acidobacteria and Proteobacteria, phyla that are dominant in many biomes. A 16S rRNA gene library of one site revealed the presence of clones with phylogenetic associations to chemoautotrophic taxa able to obtain energy through oxidation of nitrite, carbon monoxide, iron, or sulfur. Thus, soils at the hyperarid margin were found to harbor a wealth of novel bacteria and to support potentially viable communities with phylogenetic associations to non-phototrophic primary producers and bacteria capable of biogeochemical cycling.
Lamers, Susanna L; Gray, Rebecca R; Salemi, Marco; Huysentruyt, Leanne C; McGrath, Michael S
2011-01-01
Brain infection by the human immunodeficiency virus type 1 (HIV-1) has been investigated in many reports with a variety of conclusions concerning the time of entry and degree of viral compartmentalization. To address these diverse findings, we sequenced HIV-1 gp120 clones from a wide range of brain, peripheral and meningeal tissues from five patients who died from several HIV-1 associated disease pathologies. High-resolution phylogenetic analysis confirmed previous studies that showed a significant degree of compartmentalization in brain and peripheral tissue subpopulations. Some intermixing between the HIV-1 subpopulations was evident, especially in patients that died from pathologies other than HIV-associated dementia. Interestingly, the major tissue harboring virus from both the brain and peripheral tissues was the meninges. These results show that (1) HIV-1 is clearly capable of migrating out of the brain, (2) the meninges are the most likely primary transport tissues, and (3) infected brain macrophages comprise an important HIV reservoir during highly active antiretroviral therapy. Copyright © 2010 Elsevier B.V. All rights reserved.
Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir
2014-01-01
Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.
PyElph - a software tool for gel images analysis and phylogenetics
Directory of Open Access Journals (Sweden)
Pavel Ana Brânduşa
2012-01-01
Full Text Available Abstract Background This paper presents PyElph, a software tool which automatically extracts data from gel images, computes the molecular weights of the analyzed molecules or fragments, compares DNA patterns which result from experiments with molecular genetic markers and, also, generates phylogenetic trees computed by five clustering methods, using the information extracted from the analyzed gel image. The software can be successfully used for population genetics, phylogenetics, taxonomic studies and other applications which require gel image analysis. Researchers and students working in molecular biology and genetics would benefit greatly from the proposed software because it is free, open source, easy to use, has a friendly Graphical User Interface and does not depend on specific image acquisition devices like other commercial programs with similar functionalities do. Results PyElph software tool is entirely implemented in Python which is a very popular programming language among the bioinformatics community. It provides a very friendly Graphical User Interface which was designed in six steps that gradually lead to the results. The user is guided through the following steps: image loading and preparation, lane detection, band detection, molecular weights computation based on a molecular weight marker, band matching and finally, the computation and visualization of phylogenetic trees. A strong point of the software is the visualization component for the processed data. The Graphical User Interface provides operations for image manipulation and highlights lanes, bands and band matching in the analyzed gel image. All the data and images generated in each step can be saved. The software has been tested on several DNA patterns obtained from experiments with different genetic markers. Examples of genetic markers which can be analyzed using PyElph are RFLP (Restriction Fragment Length Polymorphism, AFLP (Amplified Fragment Length Polymorphism, RAPD
Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng
2016-05-01
Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.
Moyle, R.G.; Chesser, R.T.; Brumfield, R.T.; Tello, J.G.; Marchese, D.J.; Cracraft, J.
2009-01-01
The infraorder Furnariides is a diverse group of suboscine passerine birds comprising a substantial component of the Neotropical avifauna. The included species encompass a broad array of morphologies and behaviours, making them appealing for evolutionary studies, but the size of the group (ca. 600 species) has limited well-sampled higher-level phylogenetic studies. Using DNA sequence data from the nuclear RAG-1 and RAG-2 exons, we undertook a phylogenetic analysis of the Furnariides sampling 124 (more than 88%) of the genera. Basal relationships among family-level taxa differed depending on phylogenetic method, but all topologies had little nodal support, mirroring the results from earlier studies in which discerning relationships at the base of the radiation was also difficult. In contrast, branch support for family-rank taxa and for many relationships within those clades was generally high. Our results support the Melanopareidae and Grallariidae as distinct from the Rhinocryptidae and Formicariidae, respectively. Within the Furnariides our data contradict some recent phylogenetic hypotheses and suggest that further study is needed to resolve these discrepancies. Of the few genera represented by multiple species, several were not monophyletic, indicating that additional systematic work remains within furnariine families and must include dense taxon sampling. We use this study as a basis for proposing a new phylogenetic classification for the group and in the process erect new family-group names for clades having high branch support across methods. ?? 2009 The Willi Hennig Society.
Maia, João P; Harris, D James; Carranza, Salvador; Goméz-Díaz, Elena
2016-11-01
Understanding the processes that shape parasite diversification, their distribution and abundance provides valuable information on the dynamics and evolution of disease. In this study, we assessed the diversity, distribution, host-specificity and infection patterns of apicomplexan parasites in amphibians and reptiles from Oman, Arabia. Using a quantitative PCR approach we detected three apicomplexan parasites (haemogregarines, lankesterellids and sarcocystids). A total of 13 haemogregarine haplotypes were identified, which fell into four main clades in a phylogenetic framework. Phylogenetic analysis of six new lankesterellid haplotypes revealed that these parasites were distinct from, but phylogenetically related to, known Lankesterella species and might represent new taxa. The percentage of infected hosts (prevalence) and the number of haemogregarines in the blood (parasitaemia) varied significantly between gecko species. We also found significant differences in parasitaemia between haemogregarine parasite lineages (defined by phylogenetic clustering of haplotypes), suggesting differences in host-parasite compatibility between these lineages. For Pristurus rupestris, we found significant differences in haemogregarine prevalence between geographical areas. Our results suggest that host ecology and host relatedness may influence haemogregarine distributions and, more generally, highlight the importance of screening wild hosts from remote regions to provide new insights into parasite diversity.
Global biogeography of Prochlorococcus genome diversity in the surface ocean.
Kent, Alyssa G; Dupont, Chris L; Yooseph, Shibu; Martiny, Adam C
2016-08-01
Prochlorococcus, the smallest known photosynthetic bacterium, is abundant in the ocean's surface layer despite large variation in environmental conditions. There are several genetically divergent lineages within Prochlorococcus and superimposed on this phylogenetic diversity is extensive gene gain and loss. The environmental role in shaping the global ocean distribution of genome diversity in Prochlorococcus is largely unknown, particularly in a framework that considers the vertical and lateral mechanisms of evolution. Here we show that Prochlorococcus field populations from a global circumnavigation harbor extensive genome diversity across the surface ocean, but this diversity is not randomly distributed. We observed a significant correspondence between phylogenetic and gene content diversity, including regional differences in both phylogenetic composition and gene content that were related to environmental factors. Several gene families were strongly associated with specific regions and environmental factors, including the identification of a set of genes related to lower nutrient and temperature regions. Metagenomic assemblies of natural Prochlorococcus genomes reinforced this association by providing linkage of genes across genomic backbones. Overall, our results show that the phylogeography in Prochlorococcus taxonomy is echoed in its genome content. Thus environmental variation shapes the functional capabilities and associated ecosystem role of the globally abundant Prochlorococcus.
Phylogenetic Paleoecology: Tree-Thinking and Ecology in Deep Time.
Lamsdell, James C; Congreve, Curtis R; Hopkins, Melanie J; Krug, Andrew Z; Patzkowsky, Mark E
2017-06-01
The new and emerging field of phylogenetic paleoecology leverages the evolutionary relationships among species to explain temporal and spatial changes in species diversity, abundance, and distribution in deep time. This field is poised for rapid progress as knowledge of the evolutionary relationships among fossil species continues to expand. In particular, this approach will lend new insights to many of the longstanding questions in evolutionary biology, such as: the relationships among character change, ecology, and evolutionary rates; the processes that determine the evolutionary relationships among species within communities and along environmental gradients; and the phylogenetic signal underlying ecological selectivity in background and mass extinctions and in major evolutionary radiations. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana
2011-01-01
Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.
Phylogenetically-informed priorities for amphibian conservation.
Isaac, Nick J B; Redding, David W; Meredith, Helen M; Safi, Kamran
2012-01-01
The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.
Phylogenetically-informed priorities for amphibian conservation.
Directory of Open Access Journals (Sweden)
Nick J B Isaac
Full Text Available The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.
Phylogenetic analysis of rabbit haemorrhagic disease virus (RHDV) strains isolated in Poland.
Fitzner, Andrzej; Niedbalski, Wieslaw
2017-10-01
The aim of this study was to characterise the nucleotide and amino acid sequence of complete genomes (7.5 kb) from RHDV strains isolated in Poland and estimate the genetic variability in different elements of the viral RNA. In addition, the sequence of Polish RHDV isolates isolated from 1988-2015 was compared with the sequences of other European RHDV, including the RHDVa and RHDV2/RHDVb subtypes. The complete sequence was developed by the compilation of partial nucleotide sequences. This sequence consisted of approximately 7428 nucleotides. For comparison of nucleotide sequences and the development of phylogenetic trees of Polish RHDV isolates and reference RHDV strains representing the main phylogenetic groups of classical RHDV, RHDVa and RHDV2 as well as the non-pathogenic rabbit lagovirus RCV, the BLAST software with blastn and MEGA6 with neighbour-joining method was applied. The complete nucleotide sequence of Polish isolates of RHDV has also been entered into GenBank. For comparative analysis, nineteen complete sequences representing the main RHDV genetic types available in GenBank were used. The results of phylogenetic analysis of Polish RHDV strains reveals the presence of three classical RHDV genogroups (G2, G4 and G5) and an RHDVa variant (G6). The oldest RHDV isolates (KGM 1988, PD 1989 and MAL 1994) belong to genogroup G2. It can be assumed that the elimination of these strains from the environment probably occurred at the turn of 1994 and 1995. Genogroup G2 was replaced by the phylogenetically younger BLA 1994 and OPO 2004 strains from genogroup G4, which probably originated from the G3 lineage, represented by the Italian strains BS89. The last representatives of classical RHDV in Poland are isolates GSK 1988 and ZD0 2000 from genogroup G5. A single clade contains the Polish RHDV strains from 2004-2015 (GRZ 2004, KRY 2004, L145 2004, W147 2005, SKO 2013, GLE 2013, RED1 2013, STR 2012, STR2 2013, STR 2014, BIE 2015) identified as RHDVa, which clustered
Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A
2008-05-01
Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extraordinary genome size. Few algal viruses in the Phycodnaviridae family have been sequenced, and those that have been have few genes in common and low gene homology. It has hence been difficult to design general PCR primers that allow further studies of their ecology and diversity. In this study, we screened the nine type I core genes of the nucleocytoplasmic large DNA viruses for sequences suitable for designing a general set of primers. Sequence comparison between members of the Phycodnaviridae family, including three partly sequenced viruses infecting the prymnesiophyte Pyramimonas orientalis and the haptophytes Phaeocystis pouchetii and Chrysochromulina ericina (Pyramimonas orientalis virus 01B [PoV-01B], Phaeocystis pouchetii virus 01 [PpV-01], and Chrysochromulina ericina virus 01B [CeV-01B], respectively), revealed eight conserved regions in the major capsid protein (MCP). Two of these regions also showed conservation at the nucleotide level, and this allowed us to design degenerate PCR primers. The primers produced 347- to 518-bp amplicons when applied to lysates from algal viruses kept in culture and from natural viral communities. The aim of this work was to use the MCP as a proxy to infer phylogenetic relationships and genetic diversity among members of the Phycodnaviridae family and to determine the occurrence and diversity of this gene in natural viral communities. The results support the current legitimate genera in the Phycodnaviridae based on alga host species. However, while placing the mimivirus in close proximity to the type species, PBCV-1, of Phycodnaviridae along with the three new viruses assigned to the family (PoV-01B, PpV-01, and CeV-01B), the results also indicate that the coccolithoviruses and phaeoviruses are more diverged from this
Phylogenetic analysis and taxonomic revision of Physodactylinae (Coleoptera, Elateridae
Directory of Open Access Journals (Sweden)
Simone Policena Rosa
2014-01-01
Full Text Available A phylogeny based on male morphological characters and taxonomic revision of the Physodactylinae genera are presented. The phylogenetic analysis based on 66 male characters resulted in the polyphyly of Physodactylinae which comprises four independent lineages. Oligostethius and Idiotropia from Africa were found to be sister groups. Teslasena from Brazil was corroborated as belonging to Cardiophorinae clade. The South American genera Physodactylus and Dactylophysus were found to be sister groups and phylogenetically related to Heterocrepidius species. The Oriental Toxognathus resulted as sister group of that clade plus (Dicrepidius ramicornis (Lissomus sp, Physorhynus erythrocephalus. Taxonomic revisions include diagnoses and redescriptions of genera and distributional records and illustrations of species. Key to species of Teslasena, Toxognathus, Dactylophysus and Physodactylus are also provided. Teslasena lucasi is synonymized with T. femoralis. A new species of Dactylophysus is described, D. hirtus sp. nov., and lectotypes are designated to non-conspecific D. mendax sensu Fleutiaux and Heterocrepidius mendax Candèze. Physodactylus niger is removed from synonymy under P. oberthuri; P. carreti is synonymized with P. niger; P. obesus and P. testaceus are synonymized with P. sulcatus. Nine new species are described in Physodactylus: P. asper sp. nov., P. brunneus sp. nov., P. chassaini sp. nov., P. flavifrons sp. nov., P. girardi sp. nov., P. gounellei sp. nov., P. latithorax sp. nov., P. patens sp. nov. and P. tuberculatus sp. nov.
Green, David H; Llewellyn, Lyndon E; Negri, Andrew P; Blackburn, Susan I; Bolch, Christopher J S
2004-03-01
Gymnodinium catenatum is one of several dinoflagellates that produce a suite of neurotoxins called the paralytic shellfish toxins (PST), responsible for outbreaks of paralytic shellfish poisoning in temperate and tropical waters. Previous research suggested that the bacteria associated with the surface of the sexual resting stages (cyst) were important to the production of PST by G. catenatum. This study sought to characterise the cultivable bacterial diversity of seven different strains of G. catenatum that produce both high and abnormally low amounts of PST, with the long-term aim of understanding the role the bacterial flora has in bloom development and toxicity of this alga. Sixty-one bacterial isolates were cultured and phylogenetically identified as belonging to the Proteobacteria (70%), Bacteroidetes (26%) or Actinobacteria (3%). The Alphaproteobacteria were the most numerous both in terms of the number of isolates cultured (49%) and were also the most abundant type of bacteria in each G. catenatum culture. Two phenotypic (functional) traits inferred from the phylogenetic data were shown to be a common feature of the bacteria present in each G. catenatum culture: firstly, Alphaproteobacteria capable of aerobic anoxygenic photosynthesis, and secondly, Gammaproteobacteria capable of hydrocarbon utilisation and oligotrophic growth. In relation to reports of autonomous production of PST by dinoflagellate-associated bacteria, PST production by bacterial isolates was investigated, but none were shown to produce any PST-like toxins. Overall, this study has identified a number of emergent trends in the bacterial community of G. catenatum which are mirrored in the bacterial flora of other dinoflagellates, and that are likely to be of especial relevance to the population dynamics of natural and harmful algal blooms.
Cruz, Alejandra; Marín, Patricia; González-Jaén, M Teresa; Aguilar, Kristel Grace I; Cumagun, Christian Joseph R
2013-09-01
Fusarium fujikuroi Nirenberg is a maize and rice pathogen causing important agricultural losses and produces fumonisins - mycotoxins which pose health risk to humans and farm animals. However, little information is available about the phylogenetics of this species and its ability to produce fumonisins in rice. We studied 32 strains isolated from rice in the Philippines and performed a phylogenetic analysis using the partial sequence of Elongation Factor 1 alpha (EF-1α) including isolates belonging to closely related species. Fumonisin B1 (FB1 ) production was analyzed in 7-day-old cultures grown in fumonisin-inducing medium by an enzyme-linked immunosorbent assay-based method and by real-time reverse transcriptase-polymerase chain reaction using primers for FUM1 gene, a key gene in fumonisin biosynthesis. Nucleotide diversities per site (π) were 0.00024 ± 0.00022 (standard deviation) for the 32 F. fujikuroi strains from the Philippines and 0.00189 ± 0.00143 for all 34 F. fujikuroi strains, respectively. F. fujikuroi isolates grouped into one cluster separated from the rest of isolates belonging to the closely related F. proliferatum and showed very low variability, irrespective of their geographic origin. The cluster containing strains of F. proliferatum showed higher intraspecific variability than F. fujikuroi. Thirteen of the 32 strains analyzed were FB1 producers (40.62%), with production ranging from 0.386 to 223.83 ppm. All isolates analyzed showed FUM1 gene expression above 1 and higher than the CT value of the non-template control sample. Both seedling stunting and elongation were induced by the isolates in comparison with the control. F. fujikuroi are distinct from F. proliferatum isolates based on phytogenetic analysis and are potential fumonisin producers because all are positive for FUM1 gene expression. No relationship between fumonisin production and pathogenicity could be observed. © 2013 Society of Chemical Industry.
Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long
2017-08-01
Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.
Statistical assignment of DNA sequences using Bayesian phylogenetics
DEFF Research Database (Denmark)
Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Huelsenbeck, John P.
2008-01-01
We provide a new automated statistical method for DNA barcoding based on a Bayesian phylogenetic analysis. The method is based on automated database sequence retrieval, alignment, and phylogenetic analysis using a custom-built program for Bayesian phylogenetic analysis. We show on real data...... that the method outperforms Blast searches as a measure of confidence and can help eliminate 80% of all false assignment based on best Blast hit. However, the most important advance of the method is that it provides statistically meaningful measures of confidence. We apply the method to a re......-analysis of previously published ancient DNA data and show that, with high statistical confidence, most of the published sequences are in fact of Neanderthal origin. However, there are several cases of chimeric sequences that are comprised of a combination of both Neanderthal and modern human DNA....
Phylogenetic analysis of the Neks reveals early diversification of ciliary-cell cycle kinases.
Directory of Open Access Journals (Sweden)
Jeremy D K Parker
2007-10-01
Full Text Available NIMA-related kinases (Neks have been studied in diverse eukaryotes, including the fungus Aspergillus and the ciliate Tetrahymena. In the former, a single Nek plays an essential role in cell cycle regulation; in the latter, which has more than 30 Neks in its genome, multiple Neks regulate ciliary length. Mammalian genomes encode an intermediate number of Neks, several of which are reported to play roles in cell cycle regulation and/or localize to centrosomes. Previously, we reported that organisms with cilia typically have more Neks than organisms without cilia, but were unable to establish the evolutionary history of the gene family.We have performed a large-scale analysis of the Nek family using Bayesian techniques, including tests of alternate topologies. We find that the Nek family had already expanded in the last common ancestor of eukaryotes, a ciliated cell which likely expressed at least five Neks. We suggest that Neks played an important role in the common ancestor in regulating cilia, centrioles, and centrosomes with respect to mitotic entry, and that this role continues today in organisms with cilia. Organisms that lack cilia generally show a reduction in the number of Nek clades represented, sometimes associated with lineage specific expansion of a single clade, as has occurred in the plants.This is the first rigorous phylogenetic analysis of a kinase family across a broad array of phyla. Our findings provide a coherent framework for the study of Neks and their roles in coordinating cilia and cell cycle progression.
Directory of Open Access Journals (Sweden)
Eugene Thomas Cloete
2011-08-01
degradation. Cluster analysis of DGGE bands using simple matching group average setting revealed that poultry droppings-amended soils and calcium ammonium nitrate-amended soils formed distinct clades meaning that the treatment selected similar bacterial populations for each of the treatments whereas NPK soils showed less association. Excision, reamplification and sequencing of dominant DGGE bands in biostimulated soils revealed the presence of distinct hydrocarbon degraders like Corynebacterium spp., Dietzia spp., low G+C Gram positive bacteria and some uncultured bacterial clones. Phylogenetic analysis of the 16S rRNA gene sequences of these dominant bacterial communities was conducted using the neighbour joining method of PHYLIP. Two distinct clades appeared in the tree clustered members of the Actinobacteria and Firmicutes separately. The overall data suggested that Gram positive bacteria especially members of the Actinobacteria may have a key role in bioremediation of crude oil-polluted soil.
Eroshenko, Galina A; Nosov, Nikita Yu; Krasnov, Yaroslav M; Oglodin, Yevgeny G; Kukleva, Lyubov M; Guseva, Natalia P; Kuznetsov, Alexander A; Abdikarimov, Sabyrzhan T; Dzhaparova, Aigul K; Kutyrev, Vladimir V
2017-01-01
Fifty six Yersinia pestis strains, isolated over the period of more than 50 years in three high-mountain foci of Kyrgyzstan (Tien Shan, Alai, and Talas), have been characterized by means of PCR and single nucleotide polymorphism (SNP) typing methods. Seven of these strains were also characterized by means of whole genome sequencing and genome-wide SNP phylogenetic analysis. It was found that forty two strains belong to 0.ANT2, 0.ANT3 and 0.ANT5 phylogenetic branches. From these, strains of 0.ANT2 and 0.ANT3 branches were earlier detected in China only, whereas 0.ANT5 phylogenetic branch was identified for Y. pestis phylogeny for the first time. According to the results of genome-wide SNP analysis, 0.ANT5 strains are ones of the most closely related to Y. pestis strain responsible for the Justinianic Plague. We have also found out that four of the studied strains belong to the phylogenetic branch 2.MED1, and ten strains from Talas high-mountain focus belong to the phylogenetic branch 0.PE4 (sub-branch 0.PE4t). Established diversity of Y. pestis strains and extensive dissemination of the strains pertaining to the 0.ANT branch confirm the antiquity of the mentioned above plague foci and suggest that strains of the 0.ANT branch, which serve as precursors for all highly virulent Y. pestis strains, had their origin in the Tien Shan mountains.
Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin
2015-10-01
Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.
Pan, Ting Shuang; Nie, Pin
2013-07-01
Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.
Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro
2014-01-01
The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631
Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir
2014-01-01
Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations
Zhang, Li-Na; Zhang, Xian-Zhi; Zhang, Yu-Xiao; Zeng, Chun-Xia; Ma, Peng-Fei; Zhao, Lei; Guo, Zhen-Hua; Li, De-Zhu
2014-09-01
The temperate woody bamboos (Arundinarieae) are highly diverse in morphology but lack a substantial amount of genetic variation. The taxonomy of this lineage is intractable, and the relationships within the tribe have not been well resolved. Recent studies indicated that this tribe could have a complex evolutionary history. Although phylogenetic studies of the tribe have been carried out, most of these phylogenetic reconstructions were based on plastid data, which provide lower phylogenetic resolution compared with nuclear data. In this study, we intended to identify a set of desirable nuclear genes for resolving the phylogeny of the temperate woody bamboos. Using two different methodologies, we identified 209 and 916 genes, respectively, as putative single copy orthologous genes. A total of 112 genes was successfully amplified and sequenced by next-generation sequencing technologies in five species sampled from the tribe. As most of the genes exhibited intra-individual allele heterozygotes, we investigated phylogenetic utility by reconstructing the phylogeny based on individual genes. Discordance among gene trees was observed and, to resolve the conflict, we performed a range of analyses using BUCKy and HybTree. While caution should be taken when inferring a phylogeny from multiple conflicting genes, our analysis indicated that 74 of the 112 investigated genes are potential markers for resolving the phylogeny of the temperate woody bamboos. © 2014 John Wiley & Sons Ltd.
YBYRÁ facilitates comparison of large phylogenetic trees.
Machado, Denis Jacob
2015-07-01
The number and size of tree topologies that are being compared by phylogenetic systematists is increasing due to technological advancements in high-throughput DNA sequencing. However, we still lack tools to facilitate comparison among phylogenetic trees with a large number of terminals. The "YBYRÁ" project integrates software solutions for data analysis in phylogenetics. It comprises tools for (1) topological distance calculation based on the number of shared splits or clades, (2) sensitivity analysis and automatic generation of sensitivity plots and (3) clade diagnoses based on different categories of synapomorphies. YBYRÁ also provides (4) an original framework to facilitate the search for potential rogue taxa based on how much they affect average matching split distances (using MSdist). YBYRÁ facilitates comparison of large phylogenetic trees and outperforms competing software in terms of usability and time efficiency, specially for large data sets. The programs that comprises this toolkit are written in Python, hence they do not require installation and have minimum dependencies. The entire project is available under an open-source licence at http://www.ib.usp.br/grant/anfibios/researchSoftware.html .
Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.
Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi
2014-10-01
One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Yan, Yujing; Yang, Xian; Tang, Zhiyao
2013-11-01
Large-scale patterns of species richness and the underlying mechanisms regulating these patterns have long been the central issues in biogeography and macroecology. Phylogenetic community structure is a result of combined effects of contemporary ecological interactions, environmental filtering, and evolutionary history, and it links community ecology with biogeography and trait evolution. The Qinghai-Tibetan Plateau provides a good opportunity to test the influence of contemporary climate on shaping species richness because of its unique geological history, cold climate, and high biodiversity. In this study, based on high-resolution distributions of ˜9000 vascular plant species, we explored how species richness and phylogenetic structure of vascular plants correlate with climates on the highest (and species rich) plateau on the Earth. The results showed that most of the vascular plants were distributed on the eastern part of the plateau; there was a strong association between species richness and climate, even after the effects of habitat heterogeneity were controlled. However, the responses of richness to climate remarkably depended on life-forms. Richness of woody plants showed stronger climatic associations than that of herbaceous plants; energy and water availability together regulated richness pattern of woody plants; whereas water availability predominantly regulated richness pattern of herbaceous plants. The phylogenetic structure of vascular species clustered in most areas of the plateau, suggesting that rapid speciation and environment filtering dominated the assembly of communities on the plateau. We further propose that biodiversity conservation in this area should better take into account ecological features for different life-forms and phylogenetic lineages.
Manel, Stéphanie; Couvreur, Thomas L P; Munoz, François; Couteron, Pierre; Hardy, Olivier J; Sonké, Bonaventure
2014-01-01
Tropical rain forests, the richest terrestrial ecosystems in biodiversity on Earth are highly threatened by global changes. This paper aims to infer the mechanisms governing species tree assemblages by characterizing the phylogenetic structure of a tropical rain forest in a protected area of the Congo Basin, the Dja Faunal Reserve (Cameroon). We re-analyzed a dataset of 11538 individuals belonging to 372 taxa found along nine transects spanning five habitat types. We generated a dated phylogenetic tree including all sampled taxa to partition the phylogenetic diversity of the nine transects into alpha and beta components at the level of the transects and of the habitat types. The variation in phylogenetic composition among transects did not deviate from a random pattern at the scale of the Dja Faunal Reserve, probably due to a common history and weak environmental variation across the park. This lack of phylogenetic structure combined with an isolation-by-distance pattern of taxonomic diversity suggests that neutral dispersal limitation is a major driver of community assembly in the Dja. To assess any lack of sensitivity to the variation in habitat types, we restricted the analyses of transects to the terra firme primary forest and found results consistent with those of the whole dataset at the level of the transects. Additionally to previous analyses, we detected a weak but significant phylogenetic turnover among habitat types, suggesting that species sort in varying environments, even though it is not predominating on the overall phylogenetic structure. Finer analyses of clades indicated a signal of clustering for species from the Annonaceae family, while species from the Apocynaceae family indicated overdispersion. These results can contribute to the conservation of the park by improving our understanding of the processes dictating community assembly in these hyperdiverse but threatened regions of the world.
Munoz, François; Couteron, Pierre; Hardy, Olivier J.; Sonké, Bonaventure
2014-01-01
Tropical rain forests, the richest terrestrial ecosystems in biodiversity on Earth are highly threatened by global changes. This paper aims to infer the mechanisms governing species tree assemblages by characterizing the phylogenetic structure of a tropical rain forest in a protected area of the Congo Basin, the Dja Faunal Reserve (Cameroon). We re-analyzed a dataset of 11538 individuals belonging to 372 taxa found along nine transects spanning five habitat types. We generated a dated phylogenetic tree including all sampled taxa to partition the phylogenetic diversity of the nine transects into alpha and beta components at the level of the transects and of the habitat types. The variation in phylogenetic composition among transects did not deviate from a random pattern at the scale of the Dja Faunal Reserve, probably due to a common history and weak environmental variation across the park. This lack of phylogenetic structure combined with an isolation-by-distance pattern of taxonomic diversity suggests that neutral dispersal limitation is a major driver of community assembly in the Dja. To assess any lack of sensitivity to the variation in habitat types, we restricted the analyses of transects to the terra firme primary forest and found results consistent with those of the whole dataset at the level of the transects. Additionally to previous analyses, we detected a weak but significant phylogenetic turnover among habitat types, suggesting that species sort in varying environments, even though it is not predominating on the overall phylogenetic structure. Finer analyses of clades indicated a signal of clustering for species from the Annonaceae family, while species from the Apocynaceae family indicated overdispersion. These results can contribute to the conservation of the park by improving our understanding of the processes dictating community assembly in these hyperdiverse but threatened regions of the world. PMID:24936786
Yu, Yong; Li, Hui-Rong; Chen, Bo; Zeng, Yin-Xin; He, Jian-Feng
2006-04-01
The phylogenetic diversity of culturable psychrophilic bacteria associated with sea ice from high latitude sea (77 degrees 30'N - 81 degrees 12'N), Canadian Basin and Greenland sea Arctic, was investigated. A total of 37 psychrophilic strains were isolated using three different methods of ( i ) spread plate method: 100 microL of each dilution ice-melt sample was spreaded onto the surface of Marine 2216 agar (DIFCO laboratories, Detroit, MI) and incubated for 2 to 6 weeks at 4 degrees C; ( ii ) bath culture and spread plate method: 1 mL of sample was added to 9mL of NSW (unamended natural seawater, 0.2 microm prefiltered and autoclaved) and incubated for 1 months at - 1 degrees C, then spread plate method was used to isolate bacterial strains from the pre-cultured samples; ( iii ) cold shock, bath culture and spread plate method: samples were exposed to - 20 degrees C for 24h, then bacterial strains isolated by bath culture and spread plate method under aerobic conditions. Nearly half of psychrophilic strains are isolated by using method iii . 16S rDNA nearly full-length sequence analysis reveal that psychrophilic strains fall in two phylogenetic divisions, gamma-proteobacteria (in the genera Colwellia, Marinobacter, Shewanella, Thalassomonas, Glaciecola, Marinomonas and Pseudoalteromonas) and Cytophaga-Flexibacter-Bacteroides (in the genera Flavobacterium and Psychroflexus). Nine of bacterial isolates (BSi20007, BSi20497, BSi20517, BSi20537, BSi20170, BSi20001, BSi20002, BSi20675 and BSi20101) quite likely represent novel species (16S rDNA sequence similarity below 97%). One of strains (BSi20002) from Canadian Basin shows 100% sequence similarity to the Antarctic Weddell sea ice isolate Marinobacter sp. ANT8277, suggesting bacteria may have a bipolar distribution at the species level. AF283859 sequences were submitted to the BLAST search program of the National Center for Biotechnology Information website (NCBI, http://www. ncbi. nlm.nih. gov). Twenty sequences
Global diversity and phylogeny of the Asteroidea (Echinodermata.
Directory of Open Access Journals (Sweden)
Christopher L Mah
Full Text Available Members of the Asteroidea (phylum Echinodermata, popularly known as starfish or sea stars, are ecologically important and diverse members of marine ecosystems in all of the world's oceans. We present a comprehensive overview of diversity and phylogeny as they have figured into the evolution of the Asteroidea from Paleozoic to the living fauna. Living post-Paleozoic asteroids, the Neoasteroidea, are morphologically separate from those in the Paleozoic. Early Paleozoic asteroid faunas were diverse and displayed morphology that foreshadowed later living taxa. Preservation presents significant difficulties, but fossil occurrence and current accounts suggests a diverse Paleozoic fauna, which underwent extinction around the Permian-Triassic interval was followed by re-diversification of at least one surviving lineage. Ongoing phylogenetic classification debates include the status of the Paxillosida and the Concentricycloidea. Fossil and molecular evidence has been and continues to be part of the ongoing evolution of asteroid phylogenetic research. The modern lineages of asteroids include the Valvatacea, the Forcipulatacea, the Spinlosida, and the Velatida. We present an overview of diversity in these taxa, as well as brief notes on broader significance, ecology, and functional morphology of each. Although much asteroid taxonomy is stable, many new taxa remain to be discovered with many new species currently awaiting description. The Goniasteridae is currently one of the most diverse families within the Asteroidea. New data from molecular phylogenetics and the advent of global biodiversity databases, such as the World Asteroidea Database (http://www.marinespecies.org/Asteroidea/ present important new springboards for understanding the global biodiversity and evolution of asteroids.
Molecular characterization and phylogenetic analysis of Fasciola hepatica from Peru.
Ichikawa-Seki, Madoka; Ortiz, Pedro; Cabrera, Maria; Hobán, Cristian; Itagaki, Tadashi
2016-06-01
The causative agent of fasciolosis in South America is thought to be Fasciola hepatica. In this study, Fasciola flukes from Peru were analyzed to investigate their genetic structure and phylogenetic relationships with those from other countries. Fasciola flukes were collected from the three definitive host species: cattle, sheep, and pigs. They were identified as F. hepatica because mature sperms were observed in their seminal vesicles, and also they displayed Fh type, which has an identical fragment pattern to F. hepatica in the nuclear internal transcribed spacer 1. Eight haplotypes were obtained from the mitochondrial NADH dehydrogenase subunit 1 (nad1) sequences of Peruvian F. hepatica; however, no special difference in genetic structure was observed between the three host species. Its extremely low genetic diversity suggests that the Peruvian population was introduced from other regions. Nad1 haplotypes identical to those of Peruvian F. hepatica were detected in China, Uruguay, Italy, Iran, and Australia. Our results indicate that F. hepatica rapidly expanded its range due to human migration. Future studies are required to elucidate dispersal route of F. hepatica from Europe, its probable origin, to other areas, including Peru. Copyright © 2015. Published by Elsevier Ireland Ltd.
Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang
2013-01-01
Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.
Popescu, Bogdan; Banica, Leontina; Nicolae, Ionelia; Radu, Eugen; Niculescu, Iulia; Abagiu, Adrian; Otelea, Dan; Paraschiv, Simona
2018-04-04
Dual HIV infections are possible and likely in people who inject drugs (PWID). Thirty-eight newly diagnosed patients, 19 PWID and 19 heterosexually HIV infected were analysed. V2-V3 loop of HIV-1 env gene was sequenced on the NGS platform 454 GSJunior (Roche). HIV-1 dual/multiple infections were identified in five PWID. For three of these patients, the reconstructed variants belonged to pure F1 subtype and CRF14_BG strains according to phylogenetic analysis. New recombinant forms between these parental strains were identified in two PWID samples. NGS data can provide, with the help of phylogenetic analysis, important insights about the intra-host sub-population structure. Copyright © 2018. Published by Elsevier Masson SAS.
Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter
2017-12-01
Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.
Caruso, Claudio; Dondo, Alessandro; Cerutti, Francesco; Masoero, Loretta; Rosamilia, Alfonso; Zoppi, Simona; D'Errico, Valeria; Grattarola, Carla; Acutis, Pier Luigi; Peletto, Simone
2014-07-01
We describe Aujeszky's disease in a female of red fox (Vulpes vulpes). Although wild boar (Sus scrofa) would be the expected source of infection, phylogenetic analysis suggested a domestic rather than a wild source of virus, underscoring the importance of biosecurity measures in pig farms to prevent contact with wild animals.
Directory of Open Access Journals (Sweden)
Komivi Dossa
2016-04-01
Full Text Available Sesame is an important oil crop widely cultivated in Africa and Asia. Understanding the genetic diversity of accessions from these continents is critical to designing breeding methods and for additional collection of sesame germplasm. To determine the genetic diversity in relation to geographical regions, 96 sesame accessions collected from 22 countries distributed over six geographic regions in Africa and Asia were genotyped using 33 polymorphic SSR markers. Large genetic variability was found within the germplasm collection. The total number of alleles was 137, averaging 4.15 alleles per locus. The accessions from Asia displayed more diversity than those from Africa. Accessions from Southern Asia (SAs, Eastern Asia (EAs, and Western Africa (WAf were highly diversified, while those from Western Asia (WAs, Northern Africa (NAf, and Southeastern Africa (SAf had the lowest diversity. The analysis of molecular variance revealed that more than 44% of the genetic variance was due to diversity among geographic regions. Five subpopulations, including three in Asia and two in Africa, were cross-identified through phylogenetic, PCA, and STRUCTURE analyses. Most accessions clustered in the same population based on their geographical origins. Our results provide technical guidance for efficient management of sesame genetic resources in breeding programs and further collection of sesame germplasm from these different regions.
A Latitudinal Diversity Gradient in Terrestrial Bacteria of the Genus Streptomyces
Andam, Cheryl P.; Doroghazi, James R.; Campbell, Ashley N.; Kelly, Peter J.; Choudoir, Mallory J.
2016-01-01
ABSTRACT We show that Streptomyces biogeography in soils across North America is influenced by the regional diversification of microorganisms due to dispersal limitation and genetic drift. Streptomyces spp. form desiccation-resistant spores, which can be dispersed on the wind, allowing for a strong test of whether dispersal limitation governs patterns of terrestrial microbial diversity. We employed an approach that has high sensitivity for determining the effects of genetic drift. Specifically, we examined the genetic diversity and phylogeography of physiologically similar Streptomyces strains isolated from geographically distributed yet ecologically similar habitats. We found that Streptomyces beta diversity scales with geographic distance and both beta diversity and phylogenetic diversity manifest in a latitudinal diversity gradient. This pattern of Streptomyces biogeography resembles patterns seen for diverse species of plants and animals, and we therefore evaluated these data in the context of ecological and evolutionary hypotheses proposed to explain latitudinal diversity gradients. The data are consistent with the hypothesis that niche conservatism limits dispersal, and historical patterns of glaciation have limited the time for speciation in higher-latitude sites. Most notably, higher-latitude sites have lower phylogenetic diversity, higher phylogenetic clustering, and evidence of range expansion from lower latitudes. In addition, patterns of beta diversity partition with respect to the glacial history of sites. Hence, the data support the hypothesis that extant patterns of Streptomyces biogeography have been driven by historical patterns of glaciation and are the result of demographic range expansion, dispersal limitation, and regional diversification due to drift. PMID:27073097
A Latitudinal Diversity Gradient in Terrestrial Bacteria of the Genus Streptomyces
Directory of Open Access Journals (Sweden)
Cheryl P. Andam
2016-04-01
Full Text Available We show that Streptomyces biogeography in soils across North America is influenced by the regional diversification of microorganisms due to dispersal limitation and genetic drift. Streptomyces spp. form desiccation-resistant spores, which can be dispersed on the wind, allowing for a strong test of whether dispersal limitation governs patterns of terrestrial microbial diversity. We employed an approach that has high sensitivity for determining the effects of genetic drift. Specifically, we examined the genetic diversity and phylogeography of physiologically similar Streptomyces strains isolated from geographically distributed yet ecologically similar habitats. We found that Streptomyces beta diversity scales with geographic distance and both beta diversity and phylogenetic diversity manifest in a latitudinal diversity gradient. This pattern of Streptomyces biogeography resembles patterns seen for diverse species of plants and animals, and we therefore evaluated these data in the context of ecological and evolutionary hypotheses proposed to explain latitudinal diversity gradients. The data are consistent with the hypothesis that niche conservatism limits dispersal, and historical patterns of glaciation have limited the time for speciation in higher-latitude sites. Most notably, higher-latitude sites have lower phylogenetic diversity, higher phylogenetic clustering, and evidence of range expansion from lower latitudes. In addition, patterns of beta diversity partition with respect to the glacial history of sites. Hence, the data support the hypothesis that extant patterns of Streptomyces biogeography have been driven by historical patterns of glaciation and are the result of demographic range expansion, dispersal limitation, and regional diversification due to drift.
Bernard, E J; Azad, Y; Vandamme, A M; Weait, M; Geretti, A M
2007-09-01
Phylogenetic analysis - the study of the genetic relatedness between HIV strains - has recently been used in criminal prosecutions as evidence of responsibility for HIV transmission. In these trials, the expert opinion of virologists has been of critical importance. Phylogenetic analysis of HIV gene sequences is complex and its findings do not achieve the levels of certainty obtained with the forensic analysis of human DNA. Although two individuals may carry HIV strains that are closely related, these will not necessarily be unique to the two parties and could extend to other persons within the same transmission network. For forensic purposes, phylogenetic analysis should be conducted under strictly controlled conditions by laboratories with relevant expertise applying rigorous methods. It is vitally important to include the right controls, which should be epidemiologically and temporally relevant to the parties under investigation. Use of inappropriate controls can exaggerate any relatedness between the virus strains of the complainant and defendant as being strikingly unique. It will be often difficult to obtain the relevant controls. If convenient but less appropriate controls are used, interpretation of the findings should be tempered accordingly. Phylogenetic analysis cannot prove that HIV transmission occurred directly between two individuals. However, it can exonerate individuals by demonstrating that the defendant carries a virus strain unrelated to that of the complainant. Expert witnesses should acknowledge the limitations of the inferences that might be made and choose the correct language in both written and verbal testimony.
Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod
2016-02-01
Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.
Directory of Open Access Journals (Sweden)
Gu Xun
2007-03-01
Full Text Available Abstract Background Phylogenetically related miRNAs (miRNA families convey important information of the function and evolution of miRNAs. Due to the special sequence features of miRNAs, pair-wise sequence identity between miRNA precursors alone is often inadequate for unequivocally judging the phylogenetic relationships between miRNAs. Most of the current methods for miRNA classification rely heavily on manual inspection and lack measurements of the reliability of the results. Results In this study, we designed an analysis pipeline (the Phylogeny-Bootstrap-Cluster (PBC pipeline to identify miRNA families based on branch stability in the bootstrap trees derived from overlapping genome-wide miRNA sequence sets. We tested the PBC analysis pipeline with the miRNAs from six animal species, H. sapiens, M. musculus, G. gallus, D. rerio, D. melanogaster, and C. elegans. The resulting classification was compared with the miRNA families defined in miRBase. The two classifications were largely consistent. Conclusion The PBC analysis pipeline is an efficient method for classifying large numbers of heterogeneous miRNA sequences. It requires minimum human involvement and provides measurements of the reliability of the classification results.
Teng, Jade L L; Huang, Yi; Tse, Herman; Chen, Jonathan H K; Tang, Ying; Lau, Susanna K P; Woo, Patrick C Y
2014-10-20
Streptococcus sinensis is a recently discovered human pathogen isolated from blood cultures of patients with infective endocarditis. Its phylogenetic position, as well as those of its closely related species, remains inconclusive when single genes were used for phylogenetic analysis. For example, S. sinensis branched out from members of the anginosus, mitis, and sanguinis groups in the 16S ribosomal RNA gene phylogenetic tree, but it was clustered with members of the anginosus and sanguinis groups when groEL gene sequences used for analysis. In this study, we sequenced the draft genome of S. sinensis and used a polyphasic approach, including concatenated genes, whole genomes, and matrix-assisted laser desorption ionization-time of flight mass spectrometry to analyze the phylogeny of S. sinensis. The size of the S. sinensis draft genome is 2.06 Mb, with GC content of 42.2%. Phylogenetic analysis using 50 concatenated genes or whole genomes revealed that S. sinensis formed a distinct cluster with Streptococcus oligofermentans and Streptococcus cristatus, and these three streptococci were clustered with the "sanguinis group." As for phylogenetic analysis using hierarchical cluster analysis of the mass spectra of streptococci, S. sinensis also formed a distinct cluster with S. oligofermentans and S. cristatus, but these three streptococci were clustered with the "mitis group." On the basis of the findings, we propose a novel group, named "sinensis group," to include S. sinensis, S. oligofermentans, and S. cristatus, in the Streptococcus genus. Our study also illustrates the power of phylogenomic analyses for resolving ambiguities in bacterial taxonomy. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Wan, Yizhen; Schwaninger, Heidi R; Baldo, Angela M; Labate, Joanne A; Zhong, Gan-Yuan; Simon, Charles J
2013-07-05
Grapes are one of the most economically important fruit crops. There are about 60 species in the genus Vitis. The phylogenetic relationships among these species are of keen interest for the conservation and use of this germplasm. We selected 309 accessions from 48 Vitis species,varieties, and outgroups, examined ~11 kb (~3.4 Mb total) of aligned nuclear DNA sequences from 27 unlinked genes in a phylogenetic context, and estimated divergence times based on fossil calibrations. Vitis formed a strongly supported clade. There was substantial support for species and less for the higher-level groupings (series). As estimated from extant taxa, the crown age of Vitis was 28 Ma and the divergence of subgenera (Vitis and Muscadinia) occurred at ~18 Ma. Higher clades in subgenus Vitis diverged 16 - 5 Ma with overlapping confidence intervals, and ongoing divergence formed extant species at 12 - 1.3 Ma. Several species had species-specific SNPs. NeighborNet analysis showed extensive reticulation at the core of subgenus Vitis representing the deeper nodes, with extensive reticulation radiating outward. Fitch Parsimony identified North America as the origin of the most recent common ancestor of extant Vitis species. Phylogenetic patterns suggested origination of the genus in North America, fragmentation of an ancestral range during the Miocene, formation of extant species in the late Miocene-Pleistocene, and differentiation of species in the context of Pliocene-Quaternary tectonic and climatic change. Nuclear SNPs effectively resolved relationships at and below the species level in grapes and rectified several misclassifications of accessions in the repositories. Our results challenge current higher-level classifications, reveal the abundance of genetic diversity in the genus that is potentially available for crop improvement, and provide a valuable resource for species delineation, germplasm conservation and use.
Prigigallo, Maria I; Abdelfattah, Ahmed; Cacciola, Santa O; Faedda, Roberto; Sanzani, Simona M; Cooke, David E L; Schena, L
2016-03-01
A metabarcoding method based on genus-specific primers and 454 pyrosequencing was utilized to investigate the genetic diversity of Phytophthora spp. in soil and root samples of potted plants, from eight nurseries. Pyrosequencing enabled the detection of 25 Phytophthora phylotypes distributed in seven different clades and provided a much higher resolution than a corresponding cloning/Sanger sequencing approach. Eleven of these phylotypes, including P. cactorum, P. citricola s.str., P. palmivora, P. palmivora-like, P. megasperma or P. gonapodyides, P. ramorum, and five putative new Phytophthora species phylogenetically related to clades 1, 2, 4, 6, and 7 were detected only with the 454 pyrosequencing approach. We also found an additional 18 novel records of a phylotype in a particular nursery that were not detected with cloning/Sanger sequencing. Several aspects confirmed the reliability of the method: (i) many identical sequence types were identified independently in different nurseries, (ii) most sequence types identified with 454 pyrosequencing were identical to those from the cloning/Sanger sequencing approach and/or perfectly matched GenBank deposited sequences, and (iii) the divergence noted between sequence types of putative new Phytophthora species and all other detected sequences was sufficient to rule out sequencing errors. The proposed method represents a powerful tool to study Phytophthora diversity providing that particular attention is paid to the analysis of 454 pyrosequencing raw read sequences and to the identification of sequence types.
The space of ultrametric phylogenetic trees.
Gavryushkin, Alex; Drummond, Alexei J
2016-08-21
The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sobral, Fernando L; Lees, Alexander C; Cianciaruso, Marcus V
2016-09-01
The ratio of species extinctions to introductions has been comparable for many insular assemblages, suggesting that introductions could have 'compensated' for extinctions. However, the capacity for introduced species to replace ecological roles and evolutionary history lost following extinction is unclear. We investigated changes in bird functional and phylogenetic diversity in the wake of extinctions and introductions across a sample of 32 islands worldwide. We found that extinct and introduced species have comparable functional and phylogenetic alpha diversity. However, this was distributed at different positions in functional space and in the phylogeny, indicating a 'false compensation'. Introduced and extinct species did not have equivalent functional roles nor belong to similar lineages. This makes it unlikely that novel island biotas composed of introduced taxa will be able to maintain ecological roles and represent the evolutionary histories of pre-disturbance assemblages and highlights the importance of evaluating changes in alpha and beta diversity concurrently. © 2016 John Wiley & Sons Ltd/CNRS.
Directory of Open Access Journals (Sweden)
Edgar E. Lara-Ramírez
2014-01-01
Full Text Available The increasing number of dengue virus (DENV genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4 has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3 as well as the effective number of codons (ENC, ENCp versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA and clustering analysis on relative synonymous codon usage (RSCU within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution.
Experimental analysis of specification language diversity impact on NPP software diversity
International Nuclear Information System (INIS)
Yoo, Chang Sik
1999-02-01
In order to increase computer system reliability, software fault tolerance methods have been adopted to some safety critical systems including NPP. Prevention of software common mode failure is very crucial problem in software fault tolerance, but the effective method for this problem is not found yet. In our research, to find out an effective method for prevention of software common mode failure, the impact of specification language diversity on NPP software diversity was examined experimentally. Three specification languages were used to compose three requirements specifications, and programmers made twelve product codes from the specifications. From the product codes analysis, using fault diversity criteria, we concluded that diverse specification language method would enhance program diversity through diversification of requirements specification imperfections
A phylogenetic analysis of the sugar porters in hemiascomycetous yeasts.
Palma, Margarida; Goffeau, André; Spencer-Martins, Isabel; Baret, Philippe V
2007-01-01
A total of 214 members of the sugar porter (SP) family (TC 2.A.1.1) from eight hemiascomycetous yeasts: Saccharomyces cerevisiae, Candida glabrata, Kluyveromyces lactis, Ashbya (Eremothecium) gossypii, Debaryomyces hansenii, Yarrowia lipolytica, Candida albicans and Pichia stipitis, were identified. The yeast SPs were classified in 13 different phylogenetic clusters. Specific sugar substrates could be allocated to nine phylogenetic clusters, including two novel TC clusters that are specific to fungi, i.e. the glycerol:H(+) symporter (2.A.1.1.38) and the high-affinity glucose transporter (2.A.1.1.39). Four phylogenetic clusters are identified by the preliminary fifth number Z23, Z24, Z25 and Z26 and the substrates of their members remain undetermined. The amplification of the SP clusters across the Hemiascomycetes reflects adaptation to specific carbon and energy sources available in the habitat of each yeast species. (c) 2007 S. Karger AG, Basel.
Czech Academy of Sciences Publication Activity Database
Gerhold, P.; Pärtel, M.; Tackenberg, O.; Hennekens, S.M.; Bartish, Igor; Schaminée, J.H.J.; Fergus, A. J. F.; Ozinga, W.A.; Prinzing, A.
2011-01-01
Roč. 177, č. 5 (2011), s. 68-680 ISSN 0003-0147 Institutional research plan: CEZ:AV0Z60050516 Keywords : species richness * phylogenetic diversity * invasions Subject RIV: EF - Botanics Impact factor: 4.725, year: 2011
Bayesian phylogenetic estimation of fossil ages.
Drummond, Alexei J; Stadler, Tanja
2016-07-19
Recent advances have allowed for both morphological fossil evidence and molecular sequences to be integrated into a single combined inference of divergence dates under the rule of Bayesian probability. In particular, the fossilized birth-death tree prior and the Lewis-Mk model of discrete morphological evolution allow for the estimation of both divergence times and phylogenetic relationships between fossil and extant taxa. We exploit this statistical framework to investigate the internal consistency of these models by producing phylogenetic estimates of the age of each fossil in turn, within two rich and well-characterized datasets of fossil and extant species (penguins and canids). We find that the estimation accuracy of fossil ages is generally high with credible intervals seldom excluding the true age and median relative error in the two datasets of 5.7% and 13.2%, respectively. The median relative standard error (RSD) was 9.2% and 7.2%, respectively, suggesting good precision, although with some outliers. In fact, in the two datasets we analyse, the phylogenetic estimate of fossil age is on average less than 2 Myr from the mid-point age of the geological strata from which it was excavated. The high level of internal consistency found in our analyses suggests that the Bayesian statistical model employed is an adequate fit for both the geological and morphological data, and provides evidence from real data that the framework used can accurately model the evolution of discrete morphological traits coded from fossil and extant taxa. We anticipate that this approach will have diverse applications beyond divergence time dating, including dating fossils that are temporally unconstrained, testing of the 'morphological clock', and for uncovering potential model misspecification and/or data errors when controversial phylogenetic hypotheses are obtained based on combined divergence dating analyses.This article is part of the themed issue 'Dating species divergences using
Genetic diversity of archaea in deep-sea hydrothermal vent environments.
Takai, K; Horikoshi, K
1999-01-01
Molecular phylogenetic analysis of naturally occurring archaeal communities in deep-sea hydrothermal vent environments was carried out by PCR-mediated small subunit rRNA gene (SSU rDNA) sequencing. As determined through partial sequencing of rDNA clones amplified with archaea-specific primers, the archaeal populations in deep-sea hydrothermal vent environments showed a great genetic diversity, and most members of these populations appeared to be uncultivated and unidentified organisms. In the...
It's all relative: ranking the diversity of aquatic bacterial communities.
Shaw, Allison K; Halpern, Aaron L; Beeson, Karen; Tran, Bao; Venter, J Craig; Martiny, Jennifer B H
2008-09-01
The study of microbial diversity patterns is hampered by the enormous diversity of microbial communities and the lack of resources to sample them exhaustively. For many questions about richness and evenness, however, one only needs to know the relative order of diversity among samples rather than total diversity. We used 16S libraries from the Global Ocean Survey to investigate the ability of 10 diversity statistics (including rarefaction, non-parametric, parametric, curve extrapolation and diversity indices) to assess the relative diversity of six aquatic bacterial communities. Overall, we found that the statistics yielded remarkably similar rankings of the samples for a given sequence similarity cut-off. This correspondence, despite the different underlying assumptions of the statistics, suggests that diversity statistics are a useful tool for ranking samples of microbial diversity. In addition, sequence similarity cut-off influenced the diversity ranking of the samples, demonstrating that diversity statistics can also be used to detect differences in phylogenetic structure among microbial communities. Finally, a subsampling analysis suggests that further sequencing from these particular clone libraries would not have substantially changed the richness rankings of the samples.
Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium.
Machado, Henrique; Gram, Lone
2017-01-01
Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur , amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.
Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz
2017-07-01
The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Molecular phylogenetic analysis of Fasciola flukes from eastern India.
Hayashi, Kei; Ichikawa-Seki, Madoka; Mohanta, Uday Kumar; Singh, T Shantikumar; Shoriki, Takuya; Sugiyama, Hiromu; Itagaki, Tadashi
2015-10-01
Fasciola flukes from eastern India were characterized on the basis of spermatogenesis status and nuclear ITS1. Both Fasciola gigantica and aspermic Fasciola flukes were detected in Imphal, Kohima, and Gantoku districts. The sequences of mitochondrial nad1 were analyzed to infer their phylogenetical relationship with neighboring countries. The haplotypes of aspermic Fasciola flukes were identical or showed a single nucleotide substitution compared to those from populations in the neighboring countries, corroborating the previous reports that categorized them in the same lineage. However, the prevalence of aspermic Fasciola flukes in eastern India was lower than those in the neighboring countries, suggesting that they have not dispersed throughout eastern India. In contrast, F. gigantica was predominant and well diversified, and the species was thought to be distributed in the area for a longer time than the aspermic Fasciola flukes. Fasciola gigantica populations from eastern India were categorized into two distinct haplogroups A and B. The level of their genetic diversity suggests that populations belonging to haplogroup A have dispersed from the west side of the Indian subcontinent to eastern India with the artificial movement of domestic cattle, Bos indicus, whereas populations belonging to haplogroup B might have spread from Myanmar to eastern India with domestic buffaloes, Bubalus bubalis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Phylogenetic radiation of the greenbottle flies (Diptera, Calliphoridae, Luciliinae)
Williams, Kirstin A.; Lamb, Jennifer; Villet, Martin H.
2016-01-01
Abstract The subfamily Luciliinae is diverse and geographically widespread. Its four currently recognised genera (Dyscritomyia Grimshaw, 1901, Hemipyrellia Townsend, 1918, Hypopygiopsis Townsend 1916 and Lucilia Robineau-Desvoidy, 1830) contain species that range from saprophages to obligate parasites, but their pattern of phylogenetic diversification is unclear. The 28S rRNA, COI and Period genes of 14 species of Lucilia and Hemipyrellia were partially sequenced and analysed together with sequences of 11 further species from public databases. The molecular data confirmed molecular paraphyly in three species-pairs in Lucilia that hamper barcode identifications of those six species. Lucilia sericata and Lucilia cuprina were confirmed as mutual sister species. The placements of Dyscritomyia and Hypopygiopsis were ambiguous, since both made Lucilia paraphyletic in some analyses. Recognising Hemipyrellia as a genus consistently left Lucilia s.l. paraphyletic, and the occasionally-recognised (sub)genus Phaenicia was consistently paraphyletic, so these taxa should be synonymised with Lucilia to maintain monophyly. Analysis of a matrix of 14 morphological characters scored for adults of all genera and for most of the species included in the molecular analysis confirmed several of these findings. The different degrees of parasitism were phylogenetically clustered within this genus but did not form a graded series of evolutionary stages, and there was no particular relationship between feeding habits and biogeography. Because of the ubiquity of hybridization, introgression and incomplete lineage sorting in blow flies, we recommend that using a combination of mitochondrial and nuclear markers should be a procedural standard for medico-criminal forensic identifications of insects. PMID:27103874
Petrisko, Jill E; Pearl, Christopher A; Pilliod, David S; Sheridan, Peter P; Williams, Charles F; Peterson, Charles R; Bury, R Bruce
2008-01-01
We assessed the diversity and phylogeny of Saprolegniaceae on amphibian eggs from the Pacific Northwest, with particular focus on Saprolegnia ferax, a species implicated in high egg mortality. We identified isolates from eggs of six amphibians with the internal transcribed spacer (ITS) and 5.8S gene regions and BLAST of the GenBank database. We identified 68 sequences as Saprolegniaceae and 43 sequences as true fungi from at least nine genera. Our phylogenetic analysis of the Saprolegniaceae included isolates within the genera Saprolegnia, Achlya and Leptolegnia. Our phylogeny grouped S. semihypogyna with Achlya rather than with the Saprolegnia reference sequences. We found only one isolate that grouped closely with S. ferax, and this came from a hatchery-raised salmon (Idaho) that we sampled opportunistically. We had representatives of 7-12 species and three genera of Saprolegniaceae on our amphibian eggs. Further work on the ecological roles of different species of Saprolegniaceae is needed to clarify their potential importance in amphibian egg mortality and potential links to population declines.
SNPhylo: a pipeline to construct a phylogenetic tree from huge SNP data.
Lee, Tae-Ho; Guo, Hui; Wang, Xiyin; Kim, Changsoo; Paterson, Andrew H
2014-02-26
Phylogenetic trees are widely used for genetic and evolutionary studies in various organisms. Advanced sequencing technology has dramatically enriched data available for constructing phylogenetic trees based on single nucleotide polymorphisms (SNPs). However, massive SNP data makes it difficult to perform reliable analysis, and there has been no ready-to-use pipeline to generate phylogenetic trees from these data. We developed a new pipeline, SNPhylo, to construct phylogenetic trees based on large SNP datasets. The pipeline may enable users to construct a phylogenetic tree from three representative SNP data file formats. In addition, in order to increase reliability of a tree, the pipeline has steps such as removing low quality data and considering linkage disequilibrium. A maximum likelihood method for the inference of phylogeny is also adopted in generation of a tree in our pipeline. Using SNPhylo, users can easily produce a reliable phylogenetic tree from a large SNP data file. Thus, this pipeline can help a researcher focus more on interpretation of the results of analysis of voluminous data sets, rather than manipulations necessary to accomplish the analysis.
Latitudinal variation in nematode diversity and ecological roles along the Chinese coast.
Wu, Jihua; Chen, Huili; Zhang, Youzheng
2016-11-01
To test changes in the phylogenetic relatedness, niche breadth, and life-history strategies of nematodes along a latitudinal gradient. Sixteen wetland locations along the Pacific coast of China, from 20°N to 40°N. Linear regression was used to relate nematode phylogenetic relatedness (average taxonomic distinctness (AvTD) and average phylogenetic diversity [AvPD]), life-history group (based on " c - p " colonizer-persister group classification), and dietary specificity (based on guild classification of feeding selectivity) to latitude. Wetland nematode taxonomic diversity (richness and Shannon diversity indices) decreased with increasing latitude along the Chinese coast. Phylogenetic diversity indices (AvTD and AvPD) significantly increased with increasing latitude. This indicates that at lower latitudes, species within the nematode community were more closely related. With increasing latitude, the nematode relative richness and abundance decreased for selective deposit feeders but increased for nonselective deposit feeders. The proportion of general opportunists decreased with increasing latitude, but persisters showed the opposite trend. The annual temperature range and the pH of sediments were more important than vegetation type in structuring nematode communities. Nematode niche breadth was narrower at lower latitudes with respect to dietary specificity. Higher latitudes with a more variable climate favor r over K life-history strategists. Nematode communities at lower latitudes contained more closely related species.
Principal component analysis and the locus of the Fréchet mean in the space of phylogenetic trees.
Nye, Tom M W; Tang, Xiaoxian; Weyenberg, Grady; Yoshida, Ruriko
2017-12-01
Evolutionary relationships are represented by phylogenetic trees, and a phylogenetic analysis of gene sequences typically produces a collection of these trees, one for each gene in the analysis. Analysis of samples of trees is difficult due to the multi-dimensionality of the space of possible trees. In Euclidean spaces, principal component analysis is a popular method of reducing high-dimensional data to a low-dimensional representation that preserves much of the sample's structure. However, the space of all phylogenetic trees on a fixed set of species does not form a Euclidean vector space, and methods adapted to tree space are needed. Previous work introduced the notion of a principal geodesic in this space, analogous to the first principal component. Here we propose a geometric object for tree space similar to the [Formula: see text]th principal component in Euclidean space: the locus of the weighted Fréchet mean of [Formula: see text] vertex trees when the weights vary over the [Formula: see text]-simplex. We establish some basic properties of these objects, in particular showing that they have dimension [Formula: see text], and propose algorithms for projection onto these surfaces and for finding the principal locus associated with a sample of trees. Simulation studies demonstrate that these algorithms perform well, and analyses of two datasets, containing Apicomplexa and African coelacanth genomes respectively, reveal important structure from the second principal components.
Anuran trypanosomes: phylogenetic evidence for new clades in Brazil.
da S Ferreira, Juliana I G; da Costa, Andrea P; Ramirez, Diego; Roldan, Jairo A M; Saraiva, Danilo; da S Founier, Gislene F R; Sue, Ana; Zambelli, Erick R; Minervino, Antonio H H; Verdade, Vanessa K; Gennari, Solange M; Marcili, Arlei
2015-05-01
Trypanosomes of anurans and fish are grouped into the Aquatic Clade which includes species isolated from fish, amphibians, turtles and platypus, usually transmitted by leeches and phlebotomine sand flies. Trypanosomes from Brazilian frogs are grouped within the Aquatic Clade with other anuran trypanosome species, where there seems to be coevolutionary patterns with vertebrate hosts and association to Brazilian biomes (Atlantic Forest, Pantanal and Amazonia Rainforest). We characterised the anuran trypanosomes from two different areas of the Cerrado biome and examined their phylogenetic relationships based on the SSU rRNA gene. A total of 112 anurans of six species was analysed and trypanosome prevalence evaluated through haemoculture was found to be 7% (8 positive frogs). However, only three isolates (2.7%) from two anuran species were recovered and cryopreserved. Analysis including SSU rDNA sequences from previous studies segregated the anuran trypanosomes into six groups, the previously reported An01 to An04, and An05 and An06 reported herein. Clade An05 comprises the isolates from Leptodactylus latrans (Steffen) and Pristimantis sp. captured in the Cerrado biome and Trypanosoma chattoni Mathis & Leger, 1911. The inclusion of new isolates in the phylogenetic analyses provided evidence for a new group (An06) of parasites from phlebotomine hosts. Our results indicate that the diversity of trypanosome species is underestimated since studies conducted in Brazil and other regions of the world are still few.
A phylogenetic blueprint for a modern whale.
Gatesy, John; Geisler, Jonathan H; Chang, Joseph; Buell, Carl; Berta, Annalisa; Meredith, Robert W; Springer, Mark S; McGowen, Michael R
2013-02-01
The emergence of Cetacea in the Paleogene represents one of the most profound macroevolutionary transitions within Mammalia. The move from a terrestrial habitat to a committed aquatic lifestyle engendered wholesale changes in anatomy, physiology, and behavior. The results of this remarkable transformation are extant whales that include the largest, biggest brained, fastest swimming, loudest, deepest diving mammals, some of which can detect prey with a sophisticated echolocation system (Odontoceti - toothed whales), and others that batch feed using racks of baleen (Mysticeti - baleen whales). A broad-scale reconstruction of the evolutionary remodeling that culminated in extant cetaceans has not yet been based on integration of genomic and paleontological information. Here, we first place Cetacea relative to extant mammalian diversity, and assess the distribution of support among molecular datasets for relationships within Artiodactyla (even-toed ungulates, including Cetacea). We then merge trees derived from three large concatenations of molecular and fossil data to yield a composite hypothesis that encompasses many critical events in the evolutionary history of Cetacea. By combining diverse evidence, we infer a phylogenetic blueprint that outlines the stepwise evolutionary development of modern whales. This hypothesis represents a starting point for more detailed, comprehensive phylogenetic reconstructions in the future, and also highlights the synergistic interaction between modern (genomic) and traditional (morphological+paleontological) approaches that ultimately must be exploited to provide a rich understanding of evolutionary history across the entire tree of Life. Copyright © 2012 Elsevier Inc. All rights reserved.
Diversity and Ecological Functions of Crenarchaeota in Terrestrial Hot Springs of Tengchong, China
Li, W.; Song, Z.; Chen, J.; Jiang, H.; Zhou, E.; Wang, F.; Xiao, X.; Zhang, C.
2010-12-01
The diversity and potential ecological functions of Crenarchaeota were investigated in eight terrestrial hot springs (pH: 2.8-7.7; temperature: 43.6-96 C) located in Tengchong, China, using 16S rRNA gene phylogenetic analysis. A total of 826 crenarchaeotal clones were analyzed and a total of 47 Operational taxonomic units (OTUs) were identified. Most (93%) of the identified OTUs were closely related (89-99%) to those retrieved from hot springs and other thermal environments. Our data showed that temperature may predominate over pH in affecting crenarchaeotal diversity in Tengchong hot springs. Crenarchaeotal diversity in moderate-temperature (59 to 77 C) hot springs was the highest, indicating that the moderate-temperature hot springs are more inclusive for Crenarchaeota. To understand what ecological functions these Crenarchaeota may play in Tengchong hot springs, we isolated the environmental RNA and constructed four cDNA clone libraries of the archaeal accA gene that encodes Acetyl CoA carboxylase. The accA gene represents one of the key enzymes responsible for the CO2 fixation in the 3-hydroxypropionate/4-hydroxybutyrate pathway. The results of phylogenetic analysis showed all the transcribed accA gene sequences can be classified into three large clusters, with the first one being affiliated with marine crenarchaeota, the second one with cultured crenarchaeota, and the third one with Chlorobi (Green sulfur bacteria), which have been proved to employ the 3-hydroxypropionate/4-hydroxybutyrate pathway. The long-branch distances of the phylogenetic tree suggest that these sequences represent novel accA-like gene. Our results also showed that sequences of the accA-like gene from the same hot spring belonged to one cluster, which suggests that a single crenarchaeotal group may fix CO2 via 3-hydroxypropionate/4-hydroxybutyrate pathway in the investigated hot springs.
The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...
Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A
2013-01-01
Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.
Genetic diversity in the feline leukemia virus gag gene.
Kawamura, Maki; Watanabe, Shinya; Odahara, Yuka; Nakagawa, So; Endo, Yasuyuki; Tsujimoto, Hajime; Nishigaki, Kazuo
2015-06-02
Feline leukemia virus (FeLV) belongs to the Gammaretrovirus genus and is horizontally transmitted among cats. FeLV is known to undergo recombination with endogenous retroviruses already present in the host during FeLV-subgroup A infection. Such recombinant FeLVs, designated FeLV-subgroup B or FeLV-subgroup D, can be generated by transduced endogenous retroviral env sequences encoding the viral envelope. These recombinant viruses have biologically distinct properties and may mediate different disease outcomes. The generation of such recombinant viruses resulted in structural diversity of the FeLV particle and genetic diversity of the virus itself. FeLV env diversity through mutation and recombination has been studied, while gag diversity and its possible effects are less well understood. In this study, we investigated recombination events in the gag genes of FeLVs isolated from naturally infected cats and reference isolates. Recombination and phylogenetic analyses indicated that the gag genes often contain endogenous FeLV sequences and were occasionally replaced by entire endogenous FeLV gag genes. Phylogenetic reconstructions of FeLV gag sequences allowed for classification into three distinct clusters, similar to those previously established for the env gene. Analysis of the recombination junctions in FeLV gag indicated that these variants have similar recombination patterns within the same genotypes, indicating that the recombinant viruses were horizontally transmitted among cats. It remains to be investigated whether the recombinant sequences affect the molecular mechanism of FeLV transmission. These findings extend our understanding of gammaretrovirus evolutionary patterns in the field. Copyright © 2015 Elsevier B.V. All rights reserved.
Yamasaki, Masahiro; Tsuboi, Yoshihiro; Taniyama, Yusuke; Uchida, Naohiro; Sato, Reeko; Nakamura, Kensuke; Ohta, Hiroshi; Takiguchi, Mitsuyoshi
2016-09-01
The Babesia gibsoni heat shock protein 90 (BgHSP90) gene was cloned and sequenced. The length of the gene was 2,610 bp with two introns. This gene was amplified from cDNA corresponding to full length coding sequence (CDS) with an open reading frame of 2,148 bp. A phylogenetic analysis of the CDS of HSP90 gene showed that B. gibsoni was most closely related to B. bovis and Babesia sp. BQ1/Lintan and lies within a phylogenetic cluster of protozoa. Moreover, mRNA transcription profile for BgHSP90 exposed to high temperature were examined by quantitative real-time reverse transcription-polymerase chain reaction. BgHSP90 levels were elevated when the parasites were incubated at 43°C for 1 hr.
Razafindratsima, Onja H; Dunham, Amy E
2016-08-01
Frugivores are the main seed dispersers in many ecosystems, such that behaviorally driven, nonrandom patterns of seed dispersal are a common process; but patterns are poorly understood. Characterizing these patterns may be essential for understanding spatial organization of fruiting trees and drivers of seed-dispersal limitation in biodiverse forests. To address this, we studied resulting spatial associations between dispersed seeds and adult tree neighbors in a diverse rainforest in Madagascar, using a temporal and phylogenetic approach. Data show that by using fruiting trees as seed-dispersal foci, frugivores bias seed dispersal under conspecific adults and under heterospecific trees that share dispersers and fruiting time with the dispersed species. Frugivore-mediated seed dispersal also resulted in nonrandom phylogenetic associations of dispersed seeds with their nearest adult neighbors, in nine out of the 16 months of our study. However, these nonrandom phylogenetic associations fluctuated unpredictably over time, ranging from clustered to overdispersed. The spatial and phylogenetic template of seed dispersal did not translate to similar patterns of association in adult tree neighborhoods, suggesting the importance of post-dispersal processes in structuring plant communities. Results suggest that frugivore-mediated seed dispersal is important for structuring early stages of plant-plant associations, setting the template for post-dispersal processes that influence ultimate patterns of plant recruitment. Importantly, if biased patterns of dispersal are common in other systems, frugivores may promote tree coexistence in biodiverse forests by limiting the frequency and diversity of heterospecific interactions of seeds they disperse. © 2016 by the Ecological Society of America.
Directory of Open Access Journals (Sweden)
Min Chen
Full Text Available To investigate the linkage of HIV transmission from a man to a woman through unprotected sexual contact without disclosing his HIV-positive status.Combined with epidemiological information and serological tests, phylogenetic analysis was used to test the a priori hypothesis of HIV transmission from the man to the woman. Control subjects, infected with HIV through heterosexual intercourse, from the same location were also sampled. Phylogenetic analyses were performed using the consensus gag, pol and env sequences obtained from blood samples of the man, the woman and the local control subjects. The env quasispecies of the man, the woman, and two controls were also obtained using single genome amplification and sequencing (SGA/S to explore the paraphyletic relationship by phylogenetic analysis.Epidemiological information and serological tests indicated that the man was infected with HIV-1 earlier than the woman. Phylogenetic analyses of the consensus sequences showed a monophyletic cluster for the man and woman in all three genomic regions. Furthermore, gag sequences of the man and woman shared a unique recombination pattern from subtype B and C, which was different from those of CRF07_BC or CRF08_BC observed in the local samples. These indicated that the viral sequences from the two subjects display a high level of similarity. Further, viral quasispecies from the man exhibited a paraphyletic relationship with those from the woman in the Bayesian and maximum-likelihood (ML phylogenetic trees of the env region, which supported the transmission direction from the man to the woman.In the context of epidemiological and serological evidence, the results of phylogenetic analyses support the transmission from the man to the woman.
Detection and phylogenetic analysis of infectious pancreatic necrosis virus in Chile.
Tapia, D; Eissler, Y; Torres, P; Jorquera, E; Espinoza, J C; Kuznar, J
2015-10-27
Infectious pancreatic necrosis virus (IPNV) is the etiological agent of a highly contagious disease that is endemic to salmon farming in Chile and causes great economic losses to the industry. Here we compared different diagnostic methods to detect IPNV in field samples, including 3 real-time reverse transcription PCR (qRT-PCR) assays, cell culture isolation, and indirect fluorescent antibody test (IFAT). Additionally, we performed a phylogenetic analysis to investigate the genogroups prevailing in Chile, as well as their geographic distribution and virulence. The 3 qRT-PCR assays used primers that targeted regions of the VP2 and VP1 genes of the virus and were tested in 46 samples, presenting a fair agreement within their results. All samples were positive for at least 2 of the qRT-PCR assays, 29 were positive for cell culture, and 23 for IFAT, showing less sensitivity for these latter 2 methods. For the phylogenetic analysis, portions of 1180 and 523 bp of the VP2 region of segment A were amplified by RT-PCR, sequenced and compared with sequences from reference strains and from isolates reported by previous studies carried out in Chile. Most of the sequenced isolates belonged to genogroup 5 (European origin), and 5 were classified within genogroup 1 (American origin). Chilean isolates formed clusters within each of the genogroups found, evidencing a clear differentiation from the reference strains. To our knowledge, this is the most extensive study completed for IPNV in Chile, covering isolates from sea- and freshwater salmon farms and showing a high prevalence of this virus in the country.
Directory of Open Access Journals (Sweden)
Marcus J Claesson
Full Text Available BACKGROUND: Variations in the composition of the human intestinal microbiota are linked to diverse health conditions. High-throughput molecular technologies have recently elucidated microbial community structure at much higher resolution than was previously possible. Here we compare two such methods, pyrosequencing and a phylogenetic array, and evaluate classifications based on two variable 16S rRNA gene regions. METHODS AND FINDINGS: Over 1.75 million amplicon sequences were generated from the V4 and V6 regions of 16S rRNA genes in bacterial DNA extracted from four fecal samples of elderly individuals. The phylotype richness, for individual samples, was 1,400-1,800 for V4 reads and 12,500 for V6 reads, and 5,200 unique phylotypes when combining V4 reads from all samples. The RDP-classifier was more efficient for the V4 than for the far less conserved and shorter V6 region, but differences in community structure also affected efficiency. Even when analyzing only 20% of the reads, the majority of the microbial diversity was captured in two samples tested. DNA from the four samples was hybridized against the Human Intestinal Tract (HIT Chip, a phylogenetic microarray for community profiling. Comparison of clustering of genus counts from pyrosequencing and HITChip data revealed highly similar profiles. Furthermore, correlations of sequence abundance and hybridization signal intensities were very high for lower-order ranks, but lower at family-level, which was probably due to ambiguous taxonomic groupings. CONCLUSIONS: The RDP-classifier consistently assigned most V4 sequences from human intestinal samples down to genus-level with good accuracy and speed. This is the deepest sequencing of single gastrointestinal samples reported to date, but microbial richness levels have still not leveled out. A majority of these diversities can also be captured with five times lower sampling-depth. HITChip hybridizations and resulting community profiles correlate
Directory of Open Access Journals (Sweden)
Tarcilla C. Borghesan
2018-02-01
Full Text Available This study is about the inter- and intra-specific genetic diversity of trypanosomatids of the genus Angomonas, and their association with Calliphoridae (blowflies in Neotropical and Afrotropical regions. Microscopic examination of 3,900 flies of various families, mostly Calliphoridae, revealed that 31% of them harbored trypanosomatids. Small subunit rRNA (SSU rRNA barcoding showed that Angomonas predominated (46% over the other common trypanosomatids of blowflies of genera Herpetomonas and Wallacemonas. Among Angomonas spp., A. deanei was much more common than the two-other species, A. desouzai and A. ambiguus. Phylogenetic analyses based on SSU rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH and internal transcribed spacer rDNA (ITS rDNA sequences revealed a marked genetic diversity within A. deanei, which comprised four infraspecific genotypes (Dea1–Dea4, and four corresponding symbiont genotypes (Kcr1–Kcr4. Host and symbiont phylogenies were highly congruent corroborating their co-divergence, consistent with host-symbiont interdependent metabolism and symbiont reduced genomes shaped by a long coevolutionary history. We compared the diversity of Angomonas/symbionts from three genera of blowflies, Lucilia, Chrysomya and Cochliomyia. A. deanei, A. desouzai, and A. ambiguus were found in the three genera of blowflies in South America. In Africa, A. deanei and A. ambiguus were identified in Chrysomya. The absence of A. desouzai in Africa and its presence in Neotropical Cochliomyia and Lucilia suggests parasite spillback of A. desouzai into Chrysomya, which was most likely introduced four decades ago from Africa into the Neotropic. The absence of correlation between parasite diversity and geographic and genetic distances, with identical genotypes of A. deanei found in the Neotropic and Afrotropic, is consistent with disjunct distribution due to the recent human-mediated transoceanic dispersal of Angomonas by Chrysomya. This
Jing, Ruiyong; Liu, Junjie; Yu, Zhenhua; Liu, Xiaobing; Wang, Guanghua
2014-01-01
Numerous studies have revealed the high diversity of cyanophages in marine and freshwater environments, but little is currently known about the diversity of cyanophages in paddy fields, particularly in Northeast (NE) China. To elucidate the genetic diversity of cyanophages in paddy floodwaters in NE China, viral capsid assembly protein gene (g20) sequences from five floodwater samples were amplified with the primers CPS1 and CPS8. Denaturing gradient gel electrophoresis (DGGE) was applied to distinguish different g20 clones. In total, 54 clones differing in g20 nucleotide sequences were obtained in this study. Phylogenetic analysis showed that the distribution of g20 sequences in this study was different from that in Japanese paddy fields, and all the sequences were grouped into Clusters α, β, γ and ε. Within Clusters α and β, three new small clusters (PFW-VII∼-IX) were identified. UniFrac analysis of g20 clone assemblages demonstrated that the community compositions of cyanophage varied among marine, lake and paddy field environments. In paddy floodwater, community compositions of cyanophage were also different between NE China and Japan. PMID:24533125
Sarcocystis nesbitti was first described by Mandour in 1969 from rhesus monkey muscle. Its definitive host remains unknown. 18SrRNA gene of Sarcocystis nesbitti was amplified, sequenced, and subjected to phylogenetic analysis. Among those congeners available for comparison, it shares closest affinit...
BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.
Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu
2013-09-15
Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.
Genetic diversity analysis of the oriental river prawn (Macrobrachium nipponense) in Huaihe River.
Cui, Feng; Yu, Yanyan; Bao, Fangyin; Wang, Song; Xiao, Ming Song
2018-04-19
The oriental river prawn (Macrobrachium nipponense) is an economically and nutritionally important species of decapod crustaceans in China. Genetic structure and demographic history of Macrobrachium nipponense were examined using sequence data from portions of the mitochondrial DNA cytochrome oxidase subunit I (COI) gene. Samples of 191 individuals were collected from 10 localities in the upper to middle reaches of the Huaihe River. Variability was detected at a total of 42 nucleotide sites along 684 bp length of homologous sequence (6.14%), and base substitutions occurred mostly at the second codon position. Haplotype diversity (h) and nucleotide diversity (π) of all populations were 0.9136 ± 0.0116 and 0.0078 ± 0.0042, respectively. Phylogenetic tree constructed using the maximum-likelihood (ML) method showed that the 44 haplotypes were assigned to two obvious clades associated with geographic regions. Moreover, the median-joining network was similar to the topology of the phylogenetic tree with 44 haplotypes. The pairwise F ST values between the populations varied from -0.0298 to 0.2994. Generally, moderate genetic differentiation (F ST = 0.1598, p = .0000) among different geographic populations was detected, with the significant differentiation between the Huaibin (HB) and other Macrobrachium nipponense populations. Both mismatch distribution analyses and neutrality tests suggested the early stage of Late Pleistocene population expansion 85,500 years before present for the species, which was consistent with the palaeoclimatic condition of the Huaihe River Basin.
Symbioses with nitrogen-fixing bacteria: nodulation and phylogenetic data across legume genera.
Afkhami, Michelle E; Luke Mahler, D; Burns, Jean H; Weber, Marjorie G; Wojciechowski, Martin F; Sprent, Janet; Strauss, Sharon Y
2018-02-01
How species interactions shape global biodiversity and influence diversification is a central - but also data-hungry - question in evolutionary ecology. Microbially based mutualisms are widespread and could cause diversification by ameliorating stress and thus allowing organisms to colonize and adapt to otherwise unsuitable habitats. Yet the role of these interactions in generating species diversity has received limited attention, especially across large taxonomic groups. In the massive angiosperm family Leguminosae, plants often associate with root-nodulating bacteria that ameliorate nutrient stress by fixing atmospheric nitrogen. These symbioses are ecologically-important interactions, influencing community assembly, diversity, and succession, contributing ~100-290 million tons of N annually to natural ecosystems, and enhancing growth of agronomically-important forage and crop plants worldwide. In recent work attempting to determine whether mutualism with N-fixing bacteria led to increased diversification across legumes, we were unable to definitively resolve the relationship between diversification and nodulation. We did, however, succeed in compiling a very large searchable, analysis-ready database of nodulation data for 749 legume genera (98% of Leguminosae genera; LPWG 2017), which, along with associated phylogenetic information, will provide a valuable resource for future work addressing this question and others. For each legume genus, we provide information about the species richness, frequency of nodulation, subfamily association, and topological correspondence with an additional data set of 100 phylogenetic trees curated for database compatibility. We found 386 legume genera were confirmed nodulators (i.e., all species examined for nodulation nodulated), 116 were non-nodulating, four were variable (i.e., containing both confirmed nodulators and confirmed non-nodulators), and 243 had not been examined for nodulation in published studies. Interestingly
Phylogenetic Analysis of Apple scar skin viroid Isolates in Korea
Directory of Open Access Journals (Sweden)
Kang Hee Cho
2015-12-01
Full Text Available To identify genome sequences of Apple scar skin viroid (ASSVd isolates in Korea, the field survey was performed from ‘Hongro’ apple orchards located in eight sites in South Korea (Bongwha, Cheongsong, Dangjin, Gimchoen, Muju, Mungyeong, Suwon, and Yeongwol. ASSVd was detected by RT-PCR and PCR fragments were cloned into cloning vector. Full-length viral genomes of eight ASSVd isolates were sequenced and compared with 21 isolates reported previously from Korea, India, China, Japan and Greece. Eight isolates in this study showed 92.2-99.7% nucleotide sequence identities with those reported previously. Phylogenetic analysis showed that seven isolates reported in this study belong to the same group distinct from other groups.
Kuppardt, Anke; Kleinsteuber, Sabine; Vogt, Carsten; Lüders, Tillmann; Harms, Hauke; Chatzinotas, Antonis
2014-08-01
Three toluene-degrading microbial consortia were enriched under sulphate-reducing conditions from different zones of a benzene, toluene, ethylbenzene and xylenes (BTEX) plume of two connected contaminated aquifers. Two cultures were obtained from a weakly contaminated zone of the lower aquifer, while one culture originated from the highly contaminated upper aquifer. We hypothesised that the different habitat characteristics are reflected by distinct degrader populations. Degradation of toluene with concomitant production of sulphide was demonstrated in laboratory microcosms and the enrichment cultures were phylogenetically characterised. The benzylsuccinate synthase alpha-subunit (bssA) marker gene, encoding the enzyme initiating anaerobic toluene degradation, was targeted to characterise the catabolic diversity within the enrichment cultures. It was shown that the hydrogeochemical parameters in the different zones of the plume determined the microbial composition of the enrichment cultures. Both enrichment cultures from the weakly contaminated zone were of a very similar composition, dominated by Deltaproteobacteria with the Desulfobulbaceae (a Desulfopila-related phylotype) as key players. Two different bssA sequence types were found, which were both affiliated to genes from sulphate-reducing Deltaproteobacteria. In contrast, the enrichment culture from the highly contaminated zone was dominated by Clostridia with a Desulfosporosinus-related phylotype as presumed key player. A distinct bssA sequence type with high similarity to other recently detected sequences from clostridial toluene degraders was dominant in this culture. This work contributes to our understanding of the niche partitioning between degrader populations in distinct compartments of BTEX-contaminated aquifers.
DEFF Research Database (Denmark)
Quaiser, Achim; Ochsenreiter, Torsten; Lanz, Christa
2003-01-01
fragments differed between 2.3% and 19.9% and were placed into two different subgroups of Acidobacteria (groups III and V). Although partial co-linearity was found between genomic fragments, the gene content around the rRNA operons was generally not conserved. Phylogenetic reconstructions with orthologues......Acidobacteria have been established as a novel phylum of Bacteria that is consistently detected in many different habitats around the globe by 16S rDNA-based molecular surveys. The phylogenetic diversity, ubiquity and abundance of this group, particularly in soil habitats, suggest an important...... palustris and Bradyrhizobium japonicum, including a conserved two-component system. Phylogenetic analysis of the putative response regulator confirmed that this similarity between Rhizobiales and Acidobacteria might be due to a horizontal gene transfer. In total, our data give first insight into the genome...
On the need for phylogenetic ‘corrections’ in functional trait-based approaches
Czech Academy of Sciences Publication Activity Database
de Bello, Francesco; Berg, M. P.; Dias, A. T. C.; Diniz-Filho, J. A. F.; Götzenberger, Lars; Hortal, J.; Ladle, L. J.; Lepš, Jan
2015-01-01
Roč. 50, č. 4 (2015), 349-357 ISSN 1211-9520 R&D Projects: GA ČR GAP505/12/1296; GA ČR GB14-36079G Institutional support: RVO:67985939 ; RVO:60077344 Keywords : adaptation * functional and phylogenetic diversity * limiting similarity Subject RIV: EH - Ecology, Behaviour Impact factor: 1.433, year: 2015
Effect of site-specific heterogeneous evolution on phylogenetic reconstruction: a simple evaluation.
Cheng, Qiqun; Su, Zhixi; Zhong, Yang; Gu, Xun
2009-07-15
Recent studies have shown that heterogeneous evolution may mislead phylogenetic analysis, which has been neglected for a long time. We evaluate the effect of heterogeneous evolution on phylogenetic analysis, using 18 fish mitogenomic coding sequences as an example. Using the software DIVERGE, we identify 198 amino acid sites that have experienced heterogeneous evolution. After removing these sites, the rest of sites are shown to be virtually homogeneous in the evolutionary rate. There are some differences between phylogenetic trees built with heterogeneous sites ("before tree") and without heterogeneous sites ("after tree"). Our study demonstrates that for phylogenetic reconstruction, an effective approach is to identify and remove sites with heterogeneous evolution, and suggests that researchers can use the software DIVERGE to remove the influence of heterogeneous evolution before reconstructing phylogenetic trees.
Directory of Open Access Journals (Sweden)
María José Benítez-Galeano
2015-07-01
Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.
Directory of Open Access Journals (Sweden)
Elizabeth M Brown
Full Text Available Analysis of the population genetic structure of microbial species is of fundamental importance to many scientific disciplines because it can identify cryptic species, reveal reproductive mode, and elucidate processes that contribute to pathogen evolution. Here, we examined the population genetic structure and geographic differentiation of the sexual, dimorphic fungus Blastomyces dermatitidis, the causative agent of blastomycosis.Criteria for Genealogical Concordance Phylogenetic Species Recognition (GCPSR applied to seven nuclear loci (arf6, chs2, drk1, fads, pyrF, tub1, and its-2 from 78 clinical and environmental isolates identified two previously unrecognized phylogenetic species. Four of seven single gene phylogenies examined (chs2, drk1, pyrF, and its-2 supported the separation of Phylogenetic Species 1 (PS1 and Phylogenetic Species 2 (PS2 which were also well differentiated in the concatenated chs2-drk1-fads-pyrF-tub1-arf6-its2 genealogy with all isolates falling into one of two evolutionarily independent lineages. Phylogenetic species were genetically distinct with interspecific divergence 4-fold greater than intraspecific divergence and a high Fst value (0.772, P<0.001 indicative of restricted gene flow between PS1 and PS2. Whereas panmixia expected of a single freely recombining population was not observed, recombination was detected when PS1 and PS2 were assessed separately, suggesting reproductive isolation. Random mating among PS1 isolates, which were distributed across North America, was only detected after partitioning isolates into six geographic regions. The PS2 population, found predominantly in the hyper-endemic regions of northwestern Ontario, Wisconsin, and Minnesota, contained a substantial clonal component with random mating detected only among unique genotypes in the population.These analyses provide evidence for a genetically divergent clade within Blastomyces dermatitidis, which we use to describe a novel species
Phylogenetic analysis of West Nile virus isolated in Italy in 2008.
Savini, G; Monaco, F; Calistri, P; Lelli, R
2008-11-27
In Italy the first occurrence of West Nile virus (WNV) infection was reported in Tuscany region during the late summer of 1998. In August 2008, the WNV infection re-emerged in Italy, in areas surrounding the Po river delta, and involving three regions Lombardy, Emilia Romagna and Veneto. WNV was isolated from blood and organs samples of one horse, one donkey, one pigeon (Columba livia) and three magpies (Pica pica). The phylogenetic analysis of the isolates, conducted on 255 bp in the region coding for the E protein, indicates that these isolates belong to the lineage I among the European strains. According to the analysis, both the 1998 and 2008 Italian strains as well as isolates from Romania, Russia, Senegal and Kenya fell in the same sub-cluster.
Ragan, Mark A; Murphy, Colleen A; Rand, Thomas G
2003-12-01
Ichthyosporea is a recently recognized group of morphologically simple eukaryotes, many of which cause disease in aquatic organisms. Ribosomal RNA sequence analyses place Ichthyosporea near the divergence of the animal and fungal lineages, but do not allow resolution of its exact phylogenetic position. Some of the best evidence for a specific grouping of animals and fungi (Opisthokonta) has come from elongation factor 1alpha, not only phylogenetic analysis of sequences but also the presence or absence of short insertions and deletions. We sequenced the EF-1alpha gene from the ichthyosporean parasite Ichthyophonus irregularis and determined its phylogenetic position using neighbor-joining, parsimony and Bayesian methods. We also sequenced EF-1alpha genes from four chytrids to provide broader representation within fungi. Sequence analyses and the presence of a characteristic 12 amino acid insertion strongly indicate that I. irregularis is a member of Opisthokonta, but do not resolve whether I. irregularis is a specific relative of animals or of fungi. However, the EF-1alpha of I. irregularis exhibits a two amino acid deletion heretofore reported only among fungi.
Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha
2013-03-01
Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. Copyright © 2012 Elsevier B.V. All rights reserved.
Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R
2014-01-01
Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.
Some limitations of public sequence data for phylogenetic inference (in plants).
Hinchliff, Cody E; Smith, Stephen Andrew
2014-01-01
The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing
Cyanobacterial nitrogenases: phylogenetic diversity, regulation and functional predictions
Directory of Open Access Journals (Sweden)
Alberto A. Esteves-Ferreira
2017-03-01
Full Text Available Abstract Cyanobacteria is a remarkable group of prokaryotic photosynthetic microorganisms, with several genera capable of fixing atmospheric nitrogen (N2 and presenting a wide range of morphologies. Although the nitrogenase complex is not present in all cyanobacterial taxa, it is spread across several cyanobacterial strains. The nitrogenase complex has also a high theoretical potential for biofuel production, since H2 is a by-product produced during N2 fixation. In this review we discuss the significance of a relatively wide variety of cell morphologies and metabolic strategies that allow spatial and temporal separation of N2 fixation from photosynthesis in cyanobacteria. Phylogenetic reconstructions based on 16S rRNA and nifD gene sequences shed light on the evolutionary history of the two genes. Our results demonstrated that (i sequences of genes involved in nitrogen fixation (nifD from several morphologically distinct strains of cyanobacteria are grouped in similarity with their morphology classification and phylogeny, and (ii nifD genes from heterocytous strains share a common ancestor. By using this data we also discuss the evolutionary importance of processes such as horizontal gene transfer and genetic duplication for nitrogenase evolution and diversification. Finally, we discuss the importance of H2 synthesis in cyanobacteria, as well as strategies and challenges to improve cyanobacterial H2 production.
Chauveau, Olivier; Eggers, Lilian; Raquin, Christian; Silvério, Adriano; Brown, Spencer; Couloux, Arnaud; Cruaud, Corine; Kaltchuk-Santos, Eliane; Yockteng, Roxana; Souza-Chies, Tatiana T.; Nadot, Sophie
2011-01-01
Background and Aims Sisyrinchium (Iridaceae: Iridoideae: Sisyrinchieae) is one of the largest, most widespread and most taxonomically complex genera in Iridaceae, with all species except one native to the American continent. Phylogenetic relationships within the genus were investigated and the evolution of oil-producing structures related to specialized oil-bee pollination examined. Methods Phylogenetic analyses based on eight molecular markers obtained from 101 Sisyrinchium accessions representing 85 species were conducted in the first extensive phylogenetic analysis of the genus. Total evidence analyses confirmed the monophyly of the genus and retrieved nine major clades weakly connected to the subdivisions previously recognized. The resulting phylogenetic hypothesis was used to reconstruct biogeographical patterns, and to trace the evolutionary origin of glandular trichomes present in the flowers of several species. Key Results and Conclusions Glandular trichomes evolved three times independently in the genus. In two cases, these glandular trichomes are oil-secreting, suggesting that the corresponding flowers might be pollinated by oil-bees. Biogeographical patterns indicate expansions from Central America and the northern Andes to the subandean ranges between Chile and Argentina and to the extended area of the Paraná river basin. The distribution of oil-flower species across the phylogenetic trees suggests that oil-producing trichomes may have played a key role in the diversification of the genus, a hypothesis that requires future testing. PMID:21527419
Phylogenetics of neotropical Platymiscium (Leguminosae
DEFF Research Database (Denmark)
Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N
2008-01-01
Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...
Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin
2012-04-01
The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.
Identification and phylogenetic analysis of novel cytochrome P450 1A genes from ungulate species.
Darwish, Wageh Sobhy; Kawai, Yusuke; Ikenaka, Yoshinori; Yamamoto, Hideaki; Muroya, Tarou; Ishizuka, Mayumi
2010-09-01
As part of an ongoing effort to understand the biological response of wild and domestic ungulates to different environmental pollutants such as dioxin-like compounds, cDNAs encoding for CYP1A1 and CYP1A2 were cloned and characterized. Four novel CYP1A cDNA fragments from the livers of four wild ungulates (elephant, hippopotamus, tapir and deer) were identified. Three fragments from hippopotamus, tapir and deer were classified as CYP1A2, and the other fragment from elephant was designated as CYP1A1/2. The deduced amino acid sequences of these fragment CYP1As showed identities ranging from 76 to 97% with other animal CYP1As. The phylogenetic analysis of these fragments showed that both elephant and hippopotamus CYP1As made separate branches, while tapir and deer CYP1As were located beside that of horse and cattle respectively in the phylogenetic tree. Analysis of dN/dS ratio among the identified CYP1As indicated that odd toed ungulate CYP1A2s were exposed to different selection pressure.
Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter
2017-01-01
Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...
Phylogenetic characterization of two echinoid species of the southeastern Mediterranean, off Egypt
Directory of Open Access Journals (Sweden)
Taha Soliman
2015-12-01
Full Text Available In this study we investigated the phylogenetics of two sea urchin species, Arbacia lixula and Paracentrotus lividus from the Mediterranean Sea. Specimens were collected from the east coast of Alexandria City, Egypt. Pigmentation examination showed four sympatric color morphotypes (black, purple, reddish brown, and olive green. Mitochondrial DNA was extracted from specimens and mitochondrial cytochrome oxidase subunit I (COI and 16S ribosomal RNA (16S were sequenced. The results showed that all black specimens constituted the species A. lixula. All other colors belonged to P. lividus, with no apparent differentiation between color morphotypes. Moreover, P. lividus showed high haplotype diversity (COI; H = 0.9500 and 16S; H = 0.8580 and low values of nucleotide diversity (COI; π = 0.0075 and 16S; π = 0.0049, indicating a high degree of polymorphism within this species. This study represents the first attempt at DNA barcoding of echinoid species in the southeast Mediterranean off the Egyptian coast, and will provide a base for future phylogenetic analyses.
Directory of Open Access Journals (Sweden)
Thiyagarajan Gurunathan
2010-07-01
Full Text Available New characters emerge in the population of microorganisms living in the extreme environments due to its adaptation to ecological association. The microorganisms living in saline habitat utilize complex nutrients by adopting different strategies in Deoxyribonucleic Acid (DNA and Ribonucleic Acid (RNA, which are related to their metabolic and ecological diversities. Isolation and characterization of the organisms producing extracellular protease from such environment were the prime focus of this investigation, which can indicate the importance of metabolic diversity in phylogeny. Norberg medium was used to isolate halotolerant microorganisms from salt-cured skin. The isolates were screened for high activity of protease and the strain showing maximum activity of protease was taken for further studies. The biochemical characterization and 16s ribosomal RNA sequencing studies confirm that the isolate is Acinetobacter baumannii. Moreover, hydrolysis positive for starch and casein, negative for gelatin shows that the organism is a variant form of A. baumannii. Cell growth parameters such as pH and temperature were optimized and their values are 8 and 37oC respectively. The extracellular production of protease was optimized in the suitable medium and its enzyme activity was 165μg/ml/min. The results imply that the isolate had acquired operational genes through lateral gene transfer (LGT probably from unrelated species in the environment. This indicates that the isolate identified possesses metabolic and ecological diversities with values of phylogenetic delineation