WorldWideScience

Sample records for phylogenetic distinctiveness strain

  1. Draft genome and sequence variant data of the oomycete Pythium insidiosum strain Pi45 from the phylogenetically-distinct Clade-III

    Directory of Open Access Journals (Sweden)

    Weerayuth Kittichotirat

    2017-12-01

    Full Text Available Pythium insidiosum is a unique oomycete microorganism, capable of infecting humans and animals. The organism can be phylogenetically categorized into three distinct clades: Clade-I (strains from the Americas; Clade-II (strains from Asia and Australia, and Clade–III (strains from Thailand and the United States. Two draft genomes of the P. insidiosum Clade-I strain CDC-B5653 and Clade-II strain Pi-S are available in the public domain. The genome of P. insidiosum from the distinct Clade-III, which is distantly-related to the other two clades, is lacking. Here, we report the draft genome sequence of the P. insidiosum strain Pi45 (also known as MCC13; isolated from a Thai patient with pythiosis; accession numbers BCFM01000001-BCFM01017277 as a representative strain of the phylogenetically-distinct Clade-III. We also report a genome-scale data set of sequence variants (i.e., SNPs and INDELs found in P. insidiosum (accessible online at the Mendeley database: http://dx.doi.org/10.17632/r75799jy6c.1. Keywords: Pythium insidiosum, Pythiosis, Draft genome, Sequence variant

  2. Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.

    Science.gov (United States)

    Kendall, Michelle; Colijn, Caroline

    2016-10-01

    Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Multi-gene phylogenetic analysis reveals that shochu-fermenting Saccharomyces cerevisiae strains form a distinct sub-clade of the Japanese sake cluster.

    Science.gov (United States)

    Futagami, Taiki; Kadooka, Chihiro; Ando, Yoshinori; Okutsu, Kayu; Yoshizaki, Yumiko; Setoguchi, Shinji; Takamine, Kazunori; Kawai, Mikihiko; Tamaki, Hisanori

    2017-10-01

    Shochu is a traditional Japanese distilled spirit. The formation of the distinguishing flavour of shochu produced in individual distilleries is attributed to putative indigenous yeast strains. In this study, we performed the first (to our knowledge) phylogenetic classification of shochu strains based on nucleotide gene sequences. We performed phylogenetic classification of 21 putative indigenous shochu yeast strains isolated from 11 distilleries. All of these strains were shown or confirmed to be Saccharomyces cerevisiae, sharing species identification with 34 known S. cerevisiae strains (including commonly used shochu, sake, ale, whisky, bakery, bioethanol and laboratory yeast strains and clinical isolate) that were tested in parallel. Our analysis used five genes that reflect genome-level phylogeny for the strain-level classification. In a first step, we demonstrated that partial regions of the ZAP1, THI7, PXL1, YRR1 and GLG1 genes were sufficient to reproduce previous sub-species classifications. In a second step, these five analysed regions from each of 25 strains (four commonly used shochu strains and the 21 putative indigenous shochu strains) were concatenated and used to generate a phylogenetic tree. Further analysis revealed that the putative indigenous shochu yeast strains form a monophyletic group that includes both the shochu yeasts and a subset of the sake group strains; this cluster is a sister group to other sake yeast strains, together comprising a sake-shochu group. Differences among shochu strains were small, suggesting that it may be possible to correlate subtle phenotypic differences among shochu flavours with specific differences in genome sequences. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  4. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Science.gov (United States)

    Gaston, Jordan R; Roberts, Sally A; Humphreys, Tricia L

    2015-01-01

    Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU) that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA), serum resistance protein (dsrA), and a collagen adhesin (ncaA) contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  5. Molecular phylogenetic analysis of non-sexually transmitted strains of Haemophilus ducreyi.

    Directory of Open Access Journals (Sweden)

    Jordan R Gaston

    Full Text Available Haemophilus ducreyi, the etiologic agent of chancroid, has been previously reported to show genetic variance in several key virulence factors, placing strains of the bacterium into two genetically distinct classes. Recent studies done in yaws-endemic areas of the South Pacific have shown that H. ducreyi is also a major cause of cutaneous limb ulcers (CLU that are not sexually transmitted. To genetically assess CLU strains relative to the previously described class I, class II phylogenetic hierarchy, we examined nucleotide sequence diversity at 11 H. ducreyi loci, including virulence and housekeeping genes, which encompass approximately 1% of the H. ducreyi genome. Sequences for all 11 loci indicated that strains collected from leg ulcers exhibit DNA sequences homologous to class I strains of H. ducreyi. However, sequences for 3 loci, including a hemoglobin receptor (hgbA, serum resistance protein (dsrA, and a collagen adhesin (ncaA contained informative amounts of variation. Phylogenetic analyses suggest that these non-sexually transmitted strains of H. ducreyi comprise a sub-clonal population within class I strains of H. ducreyi. Molecular dating suggests that CLU strains are the most recently developed, having diverged approximately 0.355 million years ago, fourteen times more recently than the class I/class II divergence. The CLU strains' divergence falls after the divergence of humans from chimpanzees, making it the first known H. ducreyi divergence event directly influenced by the selective pressures accompanying human hosts.

  6. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  7. A non-toxigenic but morphologically and phylogenetically distinct new species of Pseudo-nitzschia, P. sabit sp. nov. (Bacillariophyceae).

    Science.gov (United States)

    Teng, Sing Tung; Lim, Po Teen; Lim, Hong Chang; Rivera-Vilarelle, María; Quijano-Scheggia, Sonia; Takata, Yoshinobu; Quilliam, Michael A; Wolf, Matthias; Bates, Stephen S; Leaw, Chui Pin

    2015-08-01

    A new species of Pseudo-nitzschia (Bacillariophyceae) is described from plankton samples collected from Port Dickson (Malacca Strait, Malaysia) and Manzanillo Bay (Colima, Mexico). The species possesses a distinctive falcate cell valve, from which they form sickle-like colonies in both environmental samples and cultured strains. Detailed observation of frustules under TEM revealed ultrastructure that closely resembles P. decipiens, yet the new species differs by the valve shape and greater ranges of striae and poroid densities. The species is readily distinguished from the curve-shaped P. subcurvata by the presence of a central interspace. The morphological distinction is further supported by phylogenetic discrimination. We sequenced and analyzed the nuclear ribosomal RNA genes in the LSU and the second internal transcribed spacer, including its secondary structure, to infer the phylogenetic relationship of the new species with its closest relatives. The results revealed a distinct lineage of the new species, forming a sister cluster with its related species, P. decipiens and P. galaxiae, but not with P. subcurvata. We examined the domoic acid (DA) production of five cultured strains from Malaysia by Liquid chromatography-mass spectrometry (LC-MS), but they showed no detectable DA. Here, we present the taxonomic description of the vegetative cells, document the sexual reproduction, and detail the molecular phylogenetics of Pseudo-nitzschia sabit sp. nov. © 2015 Phycological Society of America.

  8. Phylogenetic analysis of feline coronavirus strains in an epizootic outbreak of feline infectious peritonitis.

    Science.gov (United States)

    Barker, E N; Tasker, S; Gruffydd-Jones, T J; Tuplin, C K; Burton, K; Porter, E; Day, M J; Harley, R; Fews, D; Helps, C R; Siddell, S G

    2013-01-01

    Feline coronavirus (FCoV) infection is common. In a small percentage of cats, FCoV infection is associated with the fatal disease feline infectious peritonitis (FIP). Genetically distinct virulent and avirulent strains of FCoV might coexist within a cat population. To determine whether the strains of FCoV in FIP-affected cats are closely related or genetically distinct from the fecally derived strains of FCoV in contemporary-asymptomatic cats during an epizootic outbreak of FIP. Four cats euthanized because of FIP and 16 asymptomatic cats. This prospective outbreak investigation was initiated during an outbreak of FIP in cats within or rehomed from a rescue/rehoming center. Postmortem samples were collected from cats with FIP and contemporaneous fecal samples from asymptomatic cats. RNA was purified from tissue and fecal samples, FCoV gene fragments were reverse transcribed, PCR-amplified using novel primers, and sequenced. Sequences were aligned with ClustalW and compared with published FCoV sequences. FCoV RNA was detected in all 4 FIP cat postmortem samples and in 9 of the 16 fecal samples from contemporary-asymptomatic cats. Novel primers successfully amplified fragments from 4 regions of the genome for all FCoV-positive samples. Phylogenetic analysis showed that the FIP-associated strains of FCoV from the outbreak were very closely related to the fecally derived strains of FCoV from contemporary-asymptomatic cats. Sequence analysis provided no evidence that genetically distinct virulent and avirulent strains of FCoV were present during this FIP outbreak. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  9. Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

    Science.gov (United States)

    2013-01-01

    Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727

  10. A curated database of cyanobacterial strains relevant for modern taxonomy and phylogenetic studies.

    Science.gov (United States)

    Ramos, Vitor; Morais, João; Vasconcelos, Vitor M

    2017-04-25

    The dataset herein described lays the groundwork for an online database of relevant cyanobacterial strains, named CyanoType (http://lege.ciimar.up.pt/cyanotype). It is a database that includes categorized cyanobacterial strains useful for taxonomic, phylogenetic or genomic purposes, with associated information obtained by means of a literature-based curation. The dataset lists 371 strains and represents the first version of the database (CyanoType v.1). Information for each strain includes strain synonymy and/or co-identity, strain categorization, habitat, accession numbers for molecular data, taxonomy and nomenclature notes according to three different classification schemes, hierarchical automatic classification, phylogenetic placement according to a selection of relevant studies (including this), and important bibliographic references. The database will be updated periodically, namely by adding new strains meeting the criteria for inclusion and by revising and adding up-to-date metadata for strains already listed. A global 16S rDNA-based phylogeny is provided in order to assist users when choosing the appropriate strains for their studies.

  11. Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

    Science.gov (United States)

    Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Shim, Tae-Sun; Kook, Yoon-Hoh; Kim, Bum-Joon

    2017-01-01

    Recent multi locus sequence typing (MLST) and genome based studies indicate that lateral gene transfer (LGT) events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas), we applied rpoB typing (711 bp) to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp). The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60) genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46), showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41) PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

  12. Phylogenetic analysis of Mycobacterium massiliense strains having recombinant rpoB gene laterally transferred from Mycobacterium abscessus.

    Directory of Open Access Journals (Sweden)

    Byoung-Jun Kim

    Full Text Available Recent multi locus sequence typing (MLST and genome based studies indicate that lateral gene transfer (LGT events in the rpoB gene are prevalent between Mycobacterium abscessus complex strains. To check the prevalence of the M. massiliense strains subject to rpoB LGT (Rec-mas, we applied rpoB typing (711 bp to 106 Korean strains of M. massiliense infection that had already been identified by hsp65 sequence analysis (603 bp. The analysis indicated 6 smooth strains in M. massiliense Type I (10.0%, 6/60 genotypes but no strains in M. massiliense Type II genotypes (0%, 0/46, showing a discrepancy between the 2 typing methods. Further MLST analysis based on the partial sequencing of seven housekeeping genes, argH, cya, glpK, gnd, murC, pta and purH, as well as erm(41 PCR proved that these 6 Rec-mas strains consisted of two distinct genotypes belonging to M. massiliense and not M. abscessus. The complete rpoB sequencing analysis showed that these 6 Rec-mas strains have an identical hybrid rpoB gene, of which a 478 bp partial rpoB fragment may be laterally transferred from M. abscessus. Notably, five of the 6 Rec-mas strains showed complete identical sequences in a total of nine genes, including the seven MLST genes, hsp65, and rpoB, suggesting their clonal propagation in South Korea. In conclusion, we identified 6 M. massiliense smooth strains of 2 phylogenetically distinct genotypes with a specific hybrid rpoB gene laterally transferred from M. abscessus from Korean patients. Their clinical relevance and bacteriological traits remain to be elucidated.

  13. Evidence of two distinct phylogenetic lineages of dog rabies virus circulating in Cambodia.

    Science.gov (United States)

    Mey, Channa; Metlin, Artem; Duong, Veasna; Ong, Sivuth; In, Sotheary; Horwood, Paul F; Reynes, Jean-Marc; Bourhy, Hervé; Tarantola, Arnaud; Buchy, Philippe

    2016-03-01

    This first extensive retrospective study of the molecular epidemiology of dog rabies in Cambodia included 149 rabies virus (RABV) entire nucleoprotein sequences obtained from 1998-2011. The sequences were analyzed in conjunction with RABVs from other Asian countries. Phylogenetic reconstruction confirmed the South-East Asian phylogenetic clade comprising viruses from Cambodia, Vietnam, Thailand, Laos and Myanmar. The present study represents the first attempt to classify the phylogenetic lineages inside this clade, resulting in the confirmation that all the Cambodian viruses belonged to the South-East Asian (SEA) clade. Three distinct phylogenetic lineages in the region were established with the majority of viruses from Cambodia closely related to viruses from Thailand, Laos and Vietnam, forming the geographically widespread phylogenetic lineage SEA1. A South-East Asian lineage SEA2 comprised two viruses from Cambodia was identified, which shared a common ancestor with RABVs originating from Laos. Viruses from Myanmar formed separate phylogenetic lineages within the major SEA clade. Bayesian molecular clock analysis suggested that the time to most recent common ancestor (TMRCA) of all Cambodian RABVs dated to around 1950. The TMRCA of the Cambodian SEA1 lineage was around 1964 and that of the SEA2 lineage was around 1953. The results identified three phylogenetically distinct and geographically separated lineages inside the earlier identified major SEA clade, covering at least five countries in the region. A greater understanding of the molecular epidemiology of rabies in South-East Asia is an important step to monitor progress on the efforts to control canine rabies in the region. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

    Science.gov (United States)

    Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

    2005-10-01

    Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

  15. Phylogenetic analysis of rabbit haemorrhagic disease virus (RHDV) strains isolated in Poland.

    Science.gov (United States)

    Fitzner, Andrzej; Niedbalski, Wieslaw

    2017-10-01

    The aim of this study was to characterise the nucleotide and amino acid sequence of complete genomes (7.5 kb) from RHDV strains isolated in Poland and estimate the genetic variability in different elements of the viral RNA. In addition, the sequence of Polish RHDV isolates isolated from 1988-2015 was compared with the sequences of other European RHDV, including the RHDVa and RHDV2/RHDVb subtypes. The complete sequence was developed by the compilation of partial nucleotide sequences. This sequence consisted of approximately 7428 nucleotides. For comparison of nucleotide sequences and the development of phylogenetic trees of Polish RHDV isolates and reference RHDV strains representing the main phylogenetic groups of classical RHDV, RHDVa and RHDV2 as well as the non-pathogenic rabbit lagovirus RCV, the BLAST software with blastn and MEGA6 with neighbour-joining method was applied. The complete nucleotide sequence of Polish isolates of RHDV has also been entered into GenBank. For comparative analysis, nineteen complete sequences representing the main RHDV genetic types available in GenBank were used. The results of phylogenetic analysis of Polish RHDV strains reveals the presence of three classical RHDV genogroups (G2, G4 and G5) and an RHDVa variant (G6). The oldest RHDV isolates (KGM 1988, PD 1989 and MAL 1994) belong to genogroup G2. It can be assumed that the elimination of these strains from the environment probably occurred at the turn of 1994 and 1995. Genogroup G2 was replaced by the phylogenetically younger BLA 1994 and OPO 2004 strains from genogroup G4, which probably originated from the G3 lineage, represented by the Italian strains BS89. The last representatives of classical RHDV in Poland are isolates GSK 1988 and ZD0 2000 from genogroup G5. A single clade contains the Polish RHDV strains from 2004-2015 (GRZ 2004, KRY 2004, L145 2004, W147 2005, SKO 2013, GLE 2013, RED1 2013, STR 2012, STR2 2013, STR 2014, BIE 2015) identified as RHDVa, which clustered

  16. Genomic and phylogenetic characterization of luminous bacteria symbiotic with the deep-sea fish Chlorophthalmus albatrossis (Aulopiformes: Chlorophthalmidae).

    Science.gov (United States)

    Dunlap, Paul V; Ast, Jennifer C

    2005-02-01

    Bacteria forming light-organ symbiosis with deep-sea chlorophthalmid fishes (Aulopiformes: Chlorophthalmidae) are considered to belong to the species Photobacterium phosphoreum. The identification of these bacteria as P. phosphoreum, however, was based exclusively on phenotypic traits, which may not discriminate between phenetically similar but evolutionarily distinct luminous bacteria. Therefore, to test the species identification of chlorophthalmid symbionts, we carried out a genomotypic (repetitive element palindromic PCR genomic profiling) and phylogenetic analysis on strains isolated from the perirectal light organ of Chlorophthalmus albatrossis. Sequence analysis of the 16S rRNA gene of 10 strains from 5 fish specimens placed these bacteria in a cluster related to but phylogenetically distinct from the type strain of P. phosphoreum, ATCC 11040(T), and the type strain of Photobacterium iliopiscarium, ATCC 51760(T). Analysis of gyrB resolved the C. albatrossis strains as a strongly supported clade distinct from P. phosphoreum and P. iliopiscarium. Genomic profiling of 109 strains from the 5 C. albatrossis specimens revealed a high level of similarity among strains but allowed identification of genomotypically different types from each fish. Representatives of each type were then analyzed phylogenetically, using sequence of the luxABFE genes. As with gyrB, analysis of luxABFE resolved the C. albatrossis strains as a robustly supported clade distinct from P. phosphoreum. Furthermore, other strains of luminous bacteria reported as P. phosphoreum, i.e., NCIMB 844, from the skin of Merluccius capensis (Merlucciidae), NZ-11D, from the light organ of Nezumia aequalis (Macrouridae), and pjapo.1.1, from the light organ of Physiculus japonicus (Moridae), grouped phylogenetically by gyrB and luxABFE with the C. albatrossis strains, not with ATCC 11040(T). These results demonstrate that luminous bacteria symbiotic with C. albatrossis, together with certain other strains of

  17. [Phylogenetic analysis of genomes of Vibrio cholerae strains isolated on the territory of Rostov region].

    Science.gov (United States)

    Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A

    2013-01-01

    Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.

  18. A curated database of cyanobacterial strains relevant for modern taxonomy and phylogenetic studies

    OpenAIRE

    Ramos, Vitor; Morais, Jo?o; Vasconcelos, Vitor M.

    2017-01-01

    The dataset herein described lays the groundwork for an online database of relevant cyanobacterial strains, named CyanoType (http://lege.ciimar.up.pt/cyanotype). It is a database that includes categorized cyanobacterial strains useful for taxonomic, phylogenetic or genomic purposes, with associated information obtained by means of a literature-based curation. The dataset lists 371 strains and represents the first version of the database (CyanoType v.1). Information for each strain includes st...

  19. Phylogenetic resolution and habitat specificity of members of the Photobacterium phosphoreum species group.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2005-10-01

    Substantial ambiguity exists regarding the phylogenetic status of facultatively psychrophilic luminous bacteria identified as Photobacterium phosphoreum, a species thought to be widely distributed in the world's oceans and believed to be the specific bioluminescent light-organ symbiont of several deep-sea fishes. Members of the P. phosphoreum species group include luminous and non-luminous strains identified phenotypically from a variety of different habitats as well as phylogenetically defined lineages that appear to be evolutionarily distinct. To resolve this ambiguity and to begin developing a meaningful knowledge of the geographic distributions, habitats and symbiotic relationships of bacteria in the P. phosphoreum species group, we carried out a multilocus, fine-scale phylogenetic analysis based on sequences of the 16S rRNA, gyrB and luxABFE genes of many newly isolated luminous strains from symbiotic and saprophytic habitats, together with previously isolated luminous and non-luminous strains identified as P. phosphoreum from these and other habitats. Parsimony analysis unambiguously resolved three evolutionarily distinct clades, phosphoreum, iliopiscarium and kishitanii. The tight phylogenetic clustering within these clades and the distinct separation between them indicates they are different species, P. phosphoreum, Photobacterium iliopiscarium and the newly recognized 'Photobacterium kishitanii'. Previously reported non-luminous strains, which had been identified phenotypically as P. phosphoreum, resolved unambiguously as P. iliopiscarium, and all examined deep-sea fishes (specimens of families Chlorophthalmidae, Macrouridae, Moridae, Trachichthyidae and Acropomatidae) were found to harbour 'P. kishitanii', not P. phosphoreum, in their light organs. This resolution revealed also that 'P. kishitanii' is cosmopolitan in its geographic distribution. Furthermore, the lack of phylogenetic variation within 'P. kishitanii' indicates that this facultatively

  20. Yersinia pestis strains of ancient phylogenetic branch 0.ANT are widely spread in the high-mountain plague foci of Kyrgyzstan.

    Science.gov (United States)

    Eroshenko, Galina A; Nosov, Nikita Yu; Krasnov, Yaroslav M; Oglodin, Yevgeny G; Kukleva, Lyubov M; Guseva, Natalia P; Kuznetsov, Alexander A; Abdikarimov, Sabyrzhan T; Dzhaparova, Aigul K; Kutyrev, Vladimir V

    2017-01-01

    Fifty six Yersinia pestis strains, isolated over the period of more than 50 years in three high-mountain foci of Kyrgyzstan (Tien Shan, Alai, and Talas), have been characterized by means of PCR and single nucleotide polymorphism (SNP) typing methods. Seven of these strains were also characterized by means of whole genome sequencing and genome-wide SNP phylogenetic analysis. It was found that forty two strains belong to 0.ANT2, 0.ANT3 and 0.ANT5 phylogenetic branches. From these, strains of 0.ANT2 and 0.ANT3 branches were earlier detected in China only, whereas 0.ANT5 phylogenetic branch was identified for Y. pestis phylogeny for the first time. According to the results of genome-wide SNP analysis, 0.ANT5 strains are ones of the most closely related to Y. pestis strain responsible for the Justinianic Plague. We have also found out that four of the studied strains belong to the phylogenetic branch 2.MED1, and ten strains from Talas high-mountain focus belong to the phylogenetic branch 0.PE4 (sub-branch 0.PE4t). Established diversity of Y. pestis strains and extensive dissemination of the strains pertaining to the 0.ANT branch confirm the antiquity of the mentioned above plague foci and suggest that strains of the 0.ANT branch, which serve as precursors for all highly virulent Y. pestis strains, had their origin in the Tien Shan mountains.

  1. Phylogenetic analysis, fumonisin production and pathogenicity of Fusarium fujikuroi strains isolated from rice in the Philippines.

    Science.gov (United States)

    Cruz, Alejandra; Marín, Patricia; González-Jaén, M Teresa; Aguilar, Kristel Grace I; Cumagun, Christian Joseph R

    2013-09-01

    Fusarium fujikuroi Nirenberg is a maize and rice pathogen causing important agricultural losses and produces fumonisins - mycotoxins which pose health risk to humans and farm animals. However, little information is available about the phylogenetics of this species and its ability to produce fumonisins in rice. We studied 32 strains isolated from rice in the Philippines and performed a phylogenetic analysis using the partial sequence of Elongation Factor 1 alpha (EF-1α) including isolates belonging to closely related species. Fumonisin B1 (FB1 ) production was analyzed in 7-day-old cultures grown in fumonisin-inducing medium by an enzyme-linked immunosorbent assay-based method and by real-time reverse transcriptase-polymerase chain reaction using primers for FUM1 gene, a key gene in fumonisin biosynthesis. Nucleotide diversities per site (π) were 0.00024 ± 0.00022 (standard deviation) for the 32 F. fujikuroi strains from the Philippines and 0.00189 ± 0.00143 for all 34 F. fujikuroi strains, respectively. F. fujikuroi isolates grouped into one cluster separated from the rest of isolates belonging to the closely related F. proliferatum and showed very low variability, irrespective of their geographic origin. The cluster containing strains of F. proliferatum showed higher intraspecific variability than F. fujikuroi. Thirteen of the 32 strains analyzed were FB1 producers (40.62%), with production ranging from 0.386 to 223.83 ppm. All isolates analyzed showed FUM1 gene expression above 1 and higher than the CT value of the non-template control sample. Both seedling stunting and elongation were induced by the isolates in comparison with the control. F. fujikuroi are distinct from F. proliferatum isolates based on phytogenetic analysis and are potential fumonisin producers because all are positive for FUM1 gene expression. No relationship between fumonisin production and pathogenicity could be observed. © 2013 Society of Chemical Industry.

  2. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  3. Phylogenetic analysis of Bacillus subtilis strains applicable to natto (fermented soybean) production.

    Science.gov (United States)

    Kubo, Yuji; Rooney, Alejandro P; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-09-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group.

  4. Evolution of two distinct phylogenetic lineages of the emerging human pathogen Mycobacterium ulcerans

    Directory of Open Access Journals (Sweden)

    Portaels Francoise

    2007-09-01

    Full Text Available Abstract Background Comparative genomics has greatly improved our understanding of the evolution of pathogenic mycobacteria such as Mycobacterium tuberculosis. Here we have used data from a genome microarray analysis to explore insertion-deletion (InDel polymorphism among a diverse strain collection of Mycobacterium ulcerans, the causative agent of the devastating skin disease, Buruli ulcer. Detailed analysis of large sequence polymorphisms in twelve regions of difference (RDs, comprising irreversible genetic markers, enabled us to refine the phylogenetic succession within M. ulcerans, to define features of a hypothetical M. ulcerans most recent common ancestor and to confirm its origin from Mycobacterium marinum. Results M. ulcerans has evolved into five InDel haplotypes that separate into two distinct lineages: (i the "classical" lineage including the most pathogenic genotypes – those that come from Africa, Australia and South East Asia; and (ii an "ancestral" M. ulcerans lineage comprising strains from Asia (China/Japan, South America and Mexico. The ancestral lineage is genetically closer to the progenitor M. marinum in both RD composition and DNA sequence identity, whereas the classical lineage has undergone major genomic rearrangements. Conclusion Results of the InDel analysis are in complete accord with recent multi-locus sequence analysis and indicate that M. ulcerans has passed through at least two major evolutionary bottlenecks since divergence from M. marinum. The classical lineage shows more pronounced reductive evolution than the ancestral lineage, suggesting that there may be differences in the ecology between the two lineages. These findings improve the understanding of the adaptive evolution and virulence of M. ulcerans and pathogenic mycobacteria in general and will facilitate the development of new tools for improved diagnostics and molecular epidemiology.

  5. Phylogenetic Analysis of Bacillus subtilis Strains Applicable to Natto (Fermented Soybean) Production ▿

    OpenAIRE

    Kubo, Yuji; Rooney, Alejandro P.; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-01-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analy...

  6. Phylogenetic features of hemagglutin gene in canine distemper virus strains from different genetic lineages.

    Science.gov (United States)

    Liao, Peng; Guo, Li; Wen, Yongjun; Yang, Yangling; Cheng, Shipeng

    2015-01-01

    In the present study, the genotype of two Canine distemper virus (CDV) strains, namely, ZJJ-SD and ZJJ-LN, were investigated, based on the whole hemagglutinin (HA) gene. The CDV strains were obtained from two foxes in Shandong Province and Liaoning Province in 2011. Phylogenetic analyses were carried out for 260 CDV strains worldwide, and a statistical analysis was performed in the amino acid substitutions at positions 530 and 549 of the HA protein. Phylogenetic analyses revealed that the two strains, ZJJ-SD and ZJJ-LN, belonged to the CDV Asia I lineage. Site 530 of HA protein was found to be relatively conserved within CDV lineages in different host species by combining the genetic sequence data with the published data from 260 CDV strains worldwide. The data analysis showed a bias toward the predicted substitution Y549H for the non-dog strains in Asia I and Europe lineages. The ratio of site 549 genetic drift in the HA gene were significantly different between dogs and non-dogs in the two lineages. The strain ZJJ-SD, from wild canid, has an Y549H substitution. It is one of three Y549H substitution for wild canids in Asia I lineages. Site 530 of HA protein was not immediately relative to CDV genetic drift from dogs to non-dogs. Statistical analysis indicated that non-dog strains have a high probability to contain Y549H than dog strains in Asia I and Europe lineages. Thus, site 549 is considered important in genetic drift from dogs to non-dogs, at least in Asia I and Europe lineages.

  7. Dengue virus type 3 in Brazil: a phylogenetic perspective

    Directory of Open Access Journals (Sweden)

    Josélio Maria Galvão de Araújo

    2009-05-01

    Full Text Available Circulation of a new dengue virus (DENV-3 genotype was recently described in Brazil and Colombia, but the precise classification of this genotype has been controversial. Here we perform phylogenetic and nucleotide-distance analyses of the envelope gene, which support the subdivision of DENV-3 strains into five distinct genotypes (GI to GV and confirm the classification of the new South American genotype as GV. The extremely low genetic distances between Brazilian GV strains and the prototype Philippines/L11423 GV strain isolated in 1956 raise important questions regarding the origin of GV in South America.

  8. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  9. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  10. High genetic diversity of equine infectious anaemia virus strains from Slovenia revealed upon phylogenetic analysis of the p15 gag gene region.

    Science.gov (United States)

    Kuhar, U; Malovrh, T

    2016-03-01

    The equine infectious anaemia virus (EIAV), which belongs to the Retroviridae family, infects equids almost worldwide. Every year, sporadic EIAV cases are detected in Slovenia. To characterise the Slovenian EIAV strains in the p15 gag gene region phylogenetically in order to compare the Slovenian EIAV strains with EIAV strains from abroad, especially with the recently published European strains. Cross-sectional study using material derived from post mortem examination. In total, 29 EIAV serologically positive horses from 18 different farms were examined in this study. Primers were designed to amplify the p15 gag gene region. Amplicons of 28 PCRs were subjected to direct DNA sequencing and phylogenetic analysis. Altogether, 28 EIAV sequences were obtained from 17 different farms and were distributed between 4 separate monophyletic groups and 9 branches upon phylogenetic analysis. Among EIAV strains from abroad, the closest relatives to Slovenian EIAV strains were European EIAV strains from Italy. Phylogenetic analysis also showed that some animals from distantly located farms were most probably infected with the same EIAV strains, as well as animals from the same farm and animals from farms located in the same geographical region. This is the first report of such high genetic diversity of EIAV strains from one country. This led to speculation that there is a potential virus reservoir among the populations of riding horses, horses kept for pleasure and horses for meat production, with some farmers or horse-owners not following legislation, thus enabling the spread of infection with EIAV. The low sensitivity of the agar gel immunodiffusion test may also contribute to the spread of infection with EIAV, because some infected horses might have escaped detection. The results of the phylogenetic analysis also provide additional knowledge about the highly heterogeneous nature of the EIAV genome. © 2015 EVJ Ltd.

  11. Haemophilus ducreyi Cutaneous Ulcer Strains Diverged from Both Class I and Class II Genital Ulcer Strains: Implications for Epidemiological Studies.

    Directory of Open Access Journals (Sweden)

    Dharanesh Gangaiah

    2016-12-01

    Full Text Available Haemophilus ducreyi has emerged as a major cause of cutaneous ulcers (CU in yaws-endemic regions of the tropics in the South Pacific, South East Asia and Africa. H. ducreyi was once thought only to cause the genital ulcer (GU disease chancroid; GU strains belong to 2 distinct classes, class I and class II. Using whole-genome sequencing of 4 CU strains from Samoa, 1 from Vanuatu and 1 from Papua New Guinea, we showed that CU strains diverged from the class I strain 35000HP and that one CU strain expressed β-lactamase. Recently, the Center for Disease Control and Prevention released the genomes of 11 additional CU strains from Vanuatu and Ghana; however, the evolutionary relationship of these CU strains to previously-characterized CU and GU strains is unknown.We performed phylogenetic analysis of 17 CU and 10 GU strains. Class I and class II GU strains formed two distinct clades. The class I strains formed two subclades, one containing 35000HP and HD183 and the other containing the remainder of the class I strains. Twelve of the CU strains formed a subclone under the class I 35000HP subclade, while 2 CU strains formed a subclone under the other class I subclade. Unexpectedly, 3 of the CU strains formed a subclone under the class II clade. Phylogenetic analysis of dsrA-hgbA-ncaA sequences yielded a tree similar to that of whole-genome phylogenetic tree.CU strains diverged from multiple lineages within both class I and class II GU strains. Multilocus sequence typing of dsrA-hgbA-ncaA could be reliably used for epidemiological investigation of CU and GU strains. As class II strains grow relatively poorly and are relatively more susceptible to vancomycin than class I strains, these findings have implications for methods to recover CU strains. Comparison of contemporary CU and GU isolates would help clarify the relationship between these entities.

  12. Haemophilus ducreyi Cutaneous Ulcer Strains Diverged from Both Class I and Class II Genital Ulcer Strains: Implications for Epidemiological Studies.

    Science.gov (United States)

    Gangaiah, Dharanesh; Spinola, Stanley M

    2016-12-01

    Haemophilus ducreyi has emerged as a major cause of cutaneous ulcers (CU) in yaws-endemic regions of the tropics in the South Pacific, South East Asia and Africa. H. ducreyi was once thought only to cause the genital ulcer (GU) disease chancroid; GU strains belong to 2 distinct classes, class I and class II. Using whole-genome sequencing of 4 CU strains from Samoa, 1 from Vanuatu and 1 from Papua New Guinea, we showed that CU strains diverged from the class I strain 35000HP and that one CU strain expressed β-lactamase. Recently, the Center for Disease Control and Prevention released the genomes of 11 additional CU strains from Vanuatu and Ghana; however, the evolutionary relationship of these CU strains to previously-characterized CU and GU strains is unknown. We performed phylogenetic analysis of 17 CU and 10 GU strains. Class I and class II GU strains formed two distinct clades. The class I strains formed two subclades, one containing 35000HP and HD183 and the other containing the remainder of the class I strains. Twelve of the CU strains formed a subclone under the class I 35000HP subclade, while 2 CU strains formed a subclone under the other class I subclade. Unexpectedly, 3 of the CU strains formed a subclone under the class II clade. Phylogenetic analysis of dsrA-hgbA-ncaA sequences yielded a tree similar to that of whole-genome phylogenetic tree. CU strains diverged from multiple lineages within both class I and class II GU strains. Multilocus sequence typing of dsrA-hgbA-ncaA could be reliably used for epidemiological investigation of CU and GU strains. As class II strains grow relatively poorly and are relatively more susceptible to vancomycin than class I strains, these findings have implications for methods to recover CU strains. Comparison of contemporary CU and GU isolates would help clarify the relationship between these entities.

  13. Internal Transcribed Spacer 1 (ITS1 based sequence typing reveals phylogenetically distinct Ascaris population

    Directory of Open Access Journals (Sweden)

    Koushik Das

    2015-01-01

    Full Text Available Taxonomic differentiation among morphologically identical Ascaris species is a debatable scientific issue in the context of Ascariasis epidemiology. To explain the disease epidemiology and also the taxonomic position of different Ascaris species, genome information of infecting strains from endemic areas throughout the world is certainly crucial. Ascaris population from human has been genetically characterized based on the widely used genetic marker, internal transcribed spacer1 (ITS1. Along with previously reported and prevalent genotype G1, 8 new sequence variants of ITS1 have been identified. Genotype G1 was significantly present among female patients aged between 10 to 15 years. Intragenic linkage disequilibrium (LD analysis at target locus within our study population has identified an incomplete LD value with potential recombination events. A separate cluster of Indian isolates with high bootstrap value indicate their distinct phylogenetic position in comparison to the global Ascaris population. Genetic shuffling through recombination could be a possible reason for high population diversity and frequent emergence of new sequence variants, identified in present and other previous studies. This study explores the genetic organization of Indian Ascaris population for the first time which certainly includes some fundamental information on the molecular epidemiology of Ascariasis.

  14. Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

    Science.gov (United States)

    Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

    2011-04-09

    Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

  15. Phylogenetic Analysis of Bacillus subtilis Strains Applicable to Natto (Fermented Soybean) Production ▿

    Science.gov (United States)

    Kubo, Yuji; Rooney, Alejandro P.; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-01-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group. PMID:21764950

  16. Phylogenetic analysis and survey of Apis cerana strain of Sacbrood virus (AcSBV) in Taiwan suggests a recent introduction.

    Science.gov (United States)

    Huang, Wei-Fone; Mehmood, Shahid; Huang, Shaokang; Chen, Yue-Wen; Ko, Chong-Yu; Su, Songkun

    2017-06-01

    The Sacbrood virus (SBV) is widely distributed in European honey bees, Apis mellifera. AcSBV, a distinct SBV strain in Asian honey bees (A. cerana) causes larva death before pupation and often depopulates colonies, leading to collapse. It is the most severe disease in A. cerana beekeeping. AcSBV infects A. cerana in most natural habitats, yet occurrences were not reported in Taiwan before 2015 and were not a concern for local beekeepers. However, in 2016, A. cerana beekeepers in central Taiwan reported SBV-like symptoms. We screened samples of larvae using RT-PCR and surveyed asymptomatic apiaries in north Taiwan. Phylogenetic analyses suggested that AcSBV isolates from central Taiwan were introduced; all isolates had high similarity in sequences to AcSBV genomes identified in mainland China, Vietnam, and Korea and distinct differences to SBV sequence identified in Taiwan. The overall prevalence in symptomatic colonies was low. No latent infections were detected in asymptomatic colonies. The AcSBV epizootic may not yet have reached its highest potential. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

  18. The pan-genome of Lactobacillus reuteri strains originating from the pig gastrointestinal tract.

    Science.gov (United States)

    Wegmann, Udo; MacKenzie, Donald A; Zheng, Jinshui; Goesmann, Alexander; Roos, Stefan; Swarbreck, David; Walter, Jens; Crossman, Lisa C; Juge, Nathalie

    2015-12-01

    Lactobacillus reuteri is a gut symbiont of a wide variety of vertebrate species that has diversified into distinct phylogenetic clades which are to a large degree host-specific. Previous work demonstrated host specificity in mice and begun to determine the mechanisms by which gut colonisation and host restriction is achieved. However, how L. reuteri strains colonise the gastrointestinal (GI) tract of pigs is unknown. To gain insight into the ecology of L. reuteri in the pig gut, the genome sequence of the porcine small intestinal isolate L. reuteri ATCC 53608 was completed and consisted of a chromosome of 1.94 Mbp and two plasmids of 138.5 kbp and 9.09 kbp, respectively. Furthermore, we generated draft genomes of four additional L. reuteri strains isolated from pig faeces or lower GI tract, lp167-67, pg-3b, 20-2 and 3c6, and subjected all five genomes to a comparative genomic analysis together with the previously completed genome of strain I5007. A phylogenetic analysis based on whole genomes showed that porcine L. reuteri strains fall into two distinct clades, as previously suggested by multi-locus sequence analysis. These six pig L. reuteri genomes contained a core set of 1364 orthologous gene clusters, as determined by OrthoMCL analysis, that contributed to a pan-genome totalling 3373 gene clusters. Genome comparisons of the six pig L. reuteri strains with 14 L. reuteri strains from other host origins gave a total pan-genome of 5225 gene clusters that included a core genome of 851 gene clusters but revealed that there were no pig-specific genes per se. However, genes specific for and conserved among strains of the two pig phylogenetic lineages were detected, some of which encoded cell surface proteins that could contribute to the diversification of the two lineages and their observed host specificity. This study extends the phylogenetic analysis of L. reuteri strains at a genome-wide level, pointing to distinct evolutionary trajectories of porcine L. reuteri

  19. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  20. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  1. Phylogenetic analysis of feline immunodeficiency virus strains from naturally infected cats in Belgium and The Netherlands.

    Science.gov (United States)

    Roukaerts, Inge D M; Theuns, Sebastiaan; Taffin, Elien R L; Daminet, Sylvie; Nauwynck, Hans J

    2015-01-22

    Feline immunodeficiency virus (FIV) is a major pathogen in feline populations worldwide, with seroprevalences up to 26%. Virus strains circulating in domestic cats are subdivided into different phylogenetic clades (A-E), based on the genetic diversity of the V3-V4 region of the env gene. In this report, a phylogenetic analysis of the V3-V4 env region, and a variable region in the gag gene was made for 36 FIV strains isolated in Belgium and The Netherlands. All newly generated gag sequences clustered together with previously known clade A FIV viruses, confirming the dominance of clade A viruses in Northern Europe. The same was true for the obtained env sequences, with only one sample of an unknown env subtype. Overall, the genetic diversity of FIV strains sequenced in this report was low. This indicates a relatively recent introduction of FIV in Belgium and The Netherlands. However, the sample with an unknown env subtype indicates that new introductions of FIV from unknown origin do occur and this will likely increase genetic variability in time. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Intraspecific differentiation of Paramecium novaurelia strains (Ciliophora, Protozoa) inferred from phylogenetic analysis of ribosomal and mitochondrial DNA variation.

    Science.gov (United States)

    Tarcz, Sebastian

    2013-01-01

    Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.

  3. Laboratory-Cultured Strains of the Sea Anemone Exaiptasia Reveal Distinct Bacterial Communities

    KAUST Repository

    Herrera Sarrias, Marcela; Ziegler, Maren; Voolstra, Christian R.; Aranda, Manuel

    2017-01-01

    Exaiptasia is a laboratory sea anemone model system for stony corals. Two clonal strains are commonly used, referred to as H2 and CC7, that originate from two genetically distinct lineages and that differ in their Symbiodinium specificity. However, little is known about their other microbial associations. Here, we examined and compared the taxonomic composition of the bacterial assemblages of these two symbiotic Exaiptasia strains, both of which have been cultured in the laboratory long-term under identical conditions. We found distinct bacterial microbiota for each strain, indicating the presence of host-specific microbial consortia. Putative differences in the bacterial functional profiles (i.e., enrichment and depletion of various metabolic processes) based on taxonomic inference were also detected, further suggesting functional differences of the microbiomes associated with these lineages. Our study contributes to the current knowledge of the Exaiptasia holobiont by comparing the bacterial diversity of two commonly used strains as models for coral research.

  4. Laboratory-Cultured Strains of the Sea Anemone Exaiptasia Reveal Distinct Bacterial Communities

    KAUST Repository

    Herrera Sarrias, Marcela

    2017-05-02

    Exaiptasia is a laboratory sea anemone model system for stony corals. Two clonal strains are commonly used, referred to as H2 and CC7, that originate from two genetically distinct lineages and that differ in their Symbiodinium specificity. However, little is known about their other microbial associations. Here, we examined and compared the taxonomic composition of the bacterial assemblages of these two symbiotic Exaiptasia strains, both of which have been cultured in the laboratory long-term under identical conditions. We found distinct bacterial microbiota for each strain, indicating the presence of host-specific microbial consortia. Putative differences in the bacterial functional profiles (i.e., enrichment and depletion of various metabolic processes) based on taxonomic inference were also detected, further suggesting functional differences of the microbiomes associated with these lineages. Our study contributes to the current knowledge of the Exaiptasia holobiont by comparing the bacterial diversity of two commonly used strains as models for coral research.

  5. Co-circulation of genetically distinct human metapneumovirus and human bocavirus strains in young children with respiratory tract infections in Italy.

    Science.gov (United States)

    Zappa, Alessandra; Canuti, Marta; Frati, Elena; Pariani, Elena; Perin, Silvana; Ruzza, Maria Lorena; Farina, Claudio; Podestà, Alberto; Zanetti, Alessandro; Amendola, Antonella; Tanzi, Elisabetta

    2011-01-01

    The discovery of human Metapneumovirus (hMPV) and human Bocavirus (hBoV) identified the etiological causes of several cases of acute respiratory tract infections in children. This report describes the molecular epidemiology of hMPV and hBoV infections observed following viral surveillance of children hospitalized for acute respiratory tract infections in Milan, Italy. Pharyngeal swabs were collected from 240 children ≤3 years of age (130 males, 110 females; median age, 5.0 months; IQR, 2.0-12.5 months) and tested for respiratory viruses, including hMPV and hBoV, by molecular methods. hMPV-RNA and hBoV-DNA positive samples were characterized molecularly and a phylogenetical analysis was performed. PCR analysis identified 131/240 (54.6%) samples positive for at least one virus. The frequency of hMPV and hBoV infections was similar (8.3% and 12.1%, respectively). Both infections were associated with lower respiratory tract infections: hMPV was present as a single infectious agent in 7.2% of children with bronchiolitis, hBoV was associated with 18.5% of pediatric pneumonias and identified frequently as a single etiological agent. Genetically distinct hMPV and hBoV strains were identified in children examined with respiratory tract infections. Phylogenetic analysis showed an increased prevalence of hMPV genotype A (A2b sublineage) compared to genotype B (80% vs. 20%, respectively) and of the hBoV genotype St2 compared to genotype St1 (71.4% vs. 28.6%, respectively). Interestingly, a shift in hMPV infections resulting from A2 strains has been observed in recent years. In addition, the occurrence of recombination events between two hBoV strains with a breakpoint located in the VP1/VP2 region was identified. © 2010 Wiley-Liss, Inc.

  6. Human parainfluenza virus type 2 hemagglutinin-neuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009

    Directory of Open Access Journals (Sweden)

    Almajhdi Fahad N

    2012-12-01

    Full Text Available Abstract Background Although human parainfluenza type 2 (HPIV-2 virus is an important respiratory pathogen, a little is known about strains circulating in Saudi Arabia. Findings Among 180 nasopharyngeal aspirates collected from suspected cases in Riyadh, only one sample (0.56% was confirmed HPIV-2 positive by nested RT-PCR. The sample that was designated Riyadh 105/2009 was used for sequencing and phylogenetic analysis of the most variable virus gene; the haemagglutinin-neuramindase (HN. Comparison of HN gene of Riyadh 105/2009 strain and the relevant sequences available in GenBank revealed a strong relationship with Oklahoma-94-2009 strain. Phylogenetic analysis indicated four different clusters of HPIV-2 strains (G1-4. Twenty-three amino acid substitutions were recorded for Riyadh 105/2009, from which four are unique. The majority of substitutions (n=18 had changed their amino acids characteristics. By analyzing the effect of the recorded substitutions on the protein function using SIFT program, only two located at positions 360 and 571 were predicted to be deleterious. Conclusions The presented changes of Riyadh 105/2009 strain may possess potential effect on the protein structure and/or function level. This is the first report that describes partial characterization of Saudi HPIV-2 strain.

  7. Unique Phylogenetic Lineage Found in the Fusarium-like Clade after Re-examining BCCM/IHEM Fungal Culture Collection Material.

    Science.gov (United States)

    Triest, David; De Cremer, Koen; Piérard, Denis; Hendrickx, Marijke

    2016-09-01

    Recently, the Fusarium genus has been narrowed based upon phylogenetic analyses and a Fusarium -like clade was adopted. The few species of the Fusarium -like clade were moved to new, re-installed or existing genera or provisionally retained as " Fusarium ." Only a limited number of reference strains and DNA marker sequences are available for this clade and not much is known about its actual species diversity. Here, we report six strains, preserved by the Belgian fungal culture collection BCCM/IHEM as a Fusarium species, that belong to the Fusarium -like clade. They showed a slow growth and produced pionnotes, typical morphological characteristics of many Fusarium -like species. Multilocus sequencing with comparative sequence analyses in GenBank and phylogenetic analyses, using reference sequences of type material, confirmed that they were indeed member of the Fusarium -like clade. One strain was identified as "Fusarium" ciliatum whereas another strain was identified as Fusicolla merismoides . The four remaining strains were shown to represent a unique phylogenetic lineage in the Fusarium -like clade and were also found morphologically distinct from other members of the Fusarium -like clade. Based upon phylogenetic considerations, a new genus, Pseudofusicolla gen. nov., and a new species, Pseudofusicolla belgica sp. nov., were installed for this lineage. A formal description is provided in this study. Additional sampling will be required to gather isolates other than the historical strains presented in the present study as well as to further reveal the actual species diversity in the Fusarium -like clade.

  8. A novel methanotroph in the genus Methylomonas that contains a distinct clade of soluble methane monooxygenase.

    Science.gov (United States)

    Nguyen, Ngoc-Loi; Yu, Woon-Jong; Yang, Hye-Young; Kim, Jong-Geol; Jung, Man-Young; Park, Soo-Je; Roh, Seong-Woon; Rhee, Sung-Keun

    2017-10-01

    Aerobic methane oxidation is a key process in the global carbon cycle that acts as a major sink of methane. In this study, we describe a novel methanotroph designated EMGL16-1 that was isolated from a freshwater lake using the floating filter culture technique. Based on a phylogenetic analysis of 16S rRNA gene sequences, the isolate was found to be closely related to the genus Methylomonas in the family Methylococcaceae of the class Gammaproteobacteria with 94.2-97.4% 16S rRNA gene similarity to Methylomonas type strains. Comparison of chemotaxonomic and physiological properties further suggested that strain EMGL16-1 was taxonomically distinct from other species in the genus Methylomonas. The isolate was versatile in utilizing nitrogen sources such as molecular nitrogen, nitrate, nitrite, urea, and ammonium. The genes coding for subunit of the particulate form methane monooxygenase (pmoA), soluble methane monooxygenase (mmoX), and methanol dehydrogenase (mxaF) were detected in strain EMGL16-1. Phylogenetic analysis of mmoX indicated that mmoX of strain EMGL16-1 is distinct from those of other strains in the genus Methylomonas. This isolate probably represents a novel species in the genus. Our study provides new insights into the diversity of species in the genus Methylomonas and their environmental adaptations.

  9. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus "Ferrovum".

    Directory of Open Access Journals (Sweden)

    Sophie R Ullrich

    Full Text Available Members of the genus "Ferrovum" are ubiquitously distributed in acid mine drainage (AMD waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain "Ferrovum myxofaciens" P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus "Ferrovum" is extremely scarce.In order to access the wider genetic pool of the genus "Ferrovum" we sequenced the genome of a "Ferrovum"-containing mixed culture and successfully assembled the almost complete genome sequence of the novel "Ferrovum" strain JA12.The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct "Ferrovum" species. "Ferrovum" strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that "Ferrovum" strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively.The potential utilisation of urea by "Ferrovum" strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs "Ferrovum" strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin and Acidithiobacillus ferrivorans (iron oxidase indicates the existence of a modified pathway in "Ferrovum" strain JA12

  10. Characterization of Escherichia coli Phylogenetic Groups ...

    African Journals Online (AJOL)

    Background: Escherichia coli strains mainly fall into four phylogenetic groups (A, B1, B2, and D) and that virulent extra‑intestinal strains mainly belong to groups B2 and D. Aim: The aim was to determine the association between phylogenetic groups of E. coli causing extraintestinal infections (ExPEC) regarding the site of ...

  11. Identification of Phylogenetic Position in the Chlamydiaceae Family for Chlamydia Strains Released from Monkeys and Humans with Chlamydial Pathology

    Directory of Open Access Journals (Sweden)

    Alexander Karaulov

    2010-01-01

    Full Text Available Based on the results of the comparative analysis concerning relatedness and evolutional difference of the 16S–23S nucleotide sequences of the middle ribosomal cluster and 23S rRNA I domain, and based on identification of phylogenetic position for Chlamydophila pneumoniae and Chlamydia trichomatis strains released from monkeys, relatedness of the above stated isolates with similar strains released from humans and with strains having nucleotide sequences presented in the GenBank electronic database has been detected for the first time ever. Position of these isolates in the Chlamydiaceae family phylogenetic tree has been identified. The evolutional position of the investigated original Chlamydia and Chlamydophila strains close to analogous strains from the Gen-Bank electronic database has been demonstrated. Differences in the 16S–23S nucleotide sequence of the middle ribosomal cluster and 23S rRNA I domain of plasmid and nonplasmid Chlamydia trachomatis strains released from humans and monkeys relative to different genotype groups (group B-B, Ba, D, Da, E, L1, L2, L2a; intermediate group-F, G, Ga have been revealed for the first time ever. Abnormality in incA chromosomal gene expression resulting in Chlamydia life development cycle disorder, and decrease of Chlamydia virulence can be related to probable changes in the nucleotide sequence of the gene under consideration

  12. [Identification and phylogenetic analysis of one strain of Lactobacillus delbrueckii subsp. bulgaricus separated from yoghourt].

    Science.gov (United States)

    Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan

    2007-11-01

    For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.

  13. Phylogenomic and MALDI-TOF MS analysis of Streptococcus sinensis HKU4T reveals a distinct phylogenetic clade in the genus Streptococcus.

    Science.gov (United States)

    Teng, Jade L L; Huang, Yi; Tse, Herman; Chen, Jonathan H K; Tang, Ying; Lau, Susanna K P; Woo, Patrick C Y

    2014-10-20

    Streptococcus sinensis is a recently discovered human pathogen isolated from blood cultures of patients with infective endocarditis. Its phylogenetic position, as well as those of its closely related species, remains inconclusive when single genes were used for phylogenetic analysis. For example, S. sinensis branched out from members of the anginosus, mitis, and sanguinis groups in the 16S ribosomal RNA gene phylogenetic tree, but it was clustered with members of the anginosus and sanguinis groups when groEL gene sequences used for analysis. In this study, we sequenced the draft genome of S. sinensis and used a polyphasic approach, including concatenated genes, whole genomes, and matrix-assisted laser desorption ionization-time of flight mass spectrometry to analyze the phylogeny of S. sinensis. The size of the S. sinensis draft genome is 2.06 Mb, with GC content of 42.2%. Phylogenetic analysis using 50 concatenated genes or whole genomes revealed that S. sinensis formed a distinct cluster with Streptococcus oligofermentans and Streptococcus cristatus, and these three streptococci were clustered with the "sanguinis group." As for phylogenetic analysis using hierarchical cluster analysis of the mass spectra of streptococci, S. sinensis also formed a distinct cluster with S. oligofermentans and S. cristatus, but these three streptococci were clustered with the "mitis group." On the basis of the findings, we propose a novel group, named "sinensis group," to include S. sinensis, S. oligofermentans, and S. cristatus, in the Streptococcus genus. Our study also illustrates the power of phylogenomic analyses for resolving ambiguities in bacterial taxonomy. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Unique Phylogenetic Lineage Found in the Fusarium-like Clade after Re-examining BCCM/IHEM Fungal Culture Collection Material

    Science.gov (United States)

    De Cremer, Koen; Piérard, Denis; Hendrickx, Marijke

    2016-01-01

    Recently, the Fusarium genus has been narrowed based upon phylogenetic analyses and a Fusarium-like clade was adopted. The few species of the Fusarium-like clade were moved to new, re-installed or existing genera or provisionally retained as "Fusarium." Only a limited number of reference strains and DNA marker sequences are available for this clade and not much is known about its actual species diversity. Here, we report six strains, preserved by the Belgian fungal culture collection BCCM/IHEM as a Fusarium species, that belong to the Fusarium-like clade. They showed a slow growth and produced pionnotes, typical morphological characteristics of many Fusarium-like species. Multilocus sequencing with comparative sequence analyses in GenBank and phylogenetic analyses, using reference sequences of type material, confirmed that they were indeed member of the Fusarium-like clade. One strain was identified as "Fusarium" ciliatum whereas another strain was identified as Fusicolla merismoides. The four remaining strains were shown to represent a unique phylogenetic lineage in the Fusarium-like clade and were also found morphologically distinct from other members of the Fusarium-like clade. Based upon phylogenetic considerations, a new genus, Pseudofusicolla gen. nov., and a new species, Pseudofusicolla belgica sp. nov., were installed for this lineage. A formal description is provided in this study. Additional sampling will be required to gather isolates other than the historical strains presented in the present study as well as to further reveal the actual species diversity in the Fusarium-like clade. PMID:27790062

  15. Identification of a vertically transmitted strain from Anaplasma marginale (UFMG3): Molecular and phylogenetic characterization, and evaluation of virulence.

    Science.gov (United States)

    Silvestre, Bruna T; Silveira, Júlia A G; Meneses, Rodrigo M; Facury-Filho, Elias J; Carvalho, Antônio U; Ribeiro, Múcio F B

    2016-02-01

    Bovine anaplasmosis is a disease caused by the intraerythrocytic rickettsia species Anaplasma marginale and results in great economic losses in tropical and subtropical regions. Vertical transmission is an important phenomenon that contributes to the persistence of different strains of the agent within the same herd. The identification of new strains and genetic characterization studies are essential to understanding their epidemiology and virulence and for vaccine development. The aim of this study was to perform molecular and phylogenetic characterizations of a new vertically transmitted strain from A. marginale and to evaluate its virulence by experimental inoculation of rickettsia-free calves. Thirty newborn Holstein calves were subjected to molecular tests for the detection of A. marginale, Babesia bovis and Babesia bigemina. Calves positive for A. marginale (n=3) were splenectomized and monitored for the clinical manifestations of anaplasmosis. Blood samples from one of the calves that presented rickettsemia of 42.8% and spontaneous recovery of clinical parameters were used for molecular and phylogenetic characterization (msp1a gene), and inoculum production was used for the evaluation of virulence. This strain was identified as UFMG3. Three tandem repeat forms (13 and MGI19) were identified from the analysis of the msp1a gene, in which the form MGI19 appeared twice. Analysis of these repeats revealed the presence of the sequences QASTSS and SSASGQQQESS and of aspartic acid (D) at position 20 of both repeats. Phylogenetic analysis showed a close relationship among the UFMG3, MGI19 and UFMG2 strains. For virulence evaluation, six Holstein calves were inoculated intravenously with 2×10(7)A. marginale UFMG3-infected erythrocytes. The calves showed maximum rickettsemia of 5.1%, a moderate decrease in packed cell volume and spontaneous recovery of clinical parameters without the need for treatment. The results of experimental inoculation suggest that the strain A

  16. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  17. Phylogenetic reconstruction of the Legionella pneumophila Philadelphia-1 laboratory strains through comparative genomics.

    Directory of Open Access Journals (Sweden)

    Chitong Rao

    Full Text Available Over 20 years ago, two groups independently domesticated Legionella pneumophila from a clinical isolate of bacteria collected during the first recognized outbreak of Legionnaires' disease (at the 1976 American Legion's convention in Philadelphia. These two laboratory strains, JR32 and Lp01, along with their derivatives, have been disseminated to a number of laboratories around the world and form the cornerstone of much of the research conducted on this important pathogen to date. Nevertheless, no exhaustive examination of the genetic distance between these strains and their clinical progenitor has been performed thus far. Such information is of paramount importance for making sense of several phenotypic differences observed between these strains. As environmental replication of L. pneumophila is thought to exclusively occur within natural protozoan hosts, retrospective analysis of the domestication and axenic culture of the Philadelphia-1 progenitor strain by two independent groups also provides an excellent opportunity to uncover evidence of adaptation to the laboratory environment. To reconstruct the phylogenetic relationships between the common laboratory strains of L. pneumophila Philadelphia-1 and their clinical ancestor, we performed whole-genome Illumina resequencing of the two founders of each laboratory lineage: JR32 and Lp01. As expected from earlier, targeted studies, Lp01 and JR32 contain large deletions in the lvh and tra regions, respectively. By sequencing additional strains derived from Lp01 (Lp02 and Lp03, we retraced the phylogeny of these strains relative to their reported ancestor, thereby reconstructing the evolutionary dynamics of each laboratory lineage from genomic data.

  18. Phylogenetic and Pathotypic Characterization of a Newcastle Disease Virus Strain Isolated from Ducks and Pigeons in Hubei, China

    Directory of Open Access Journals (Sweden)

    Y Wang

    Full Text Available ABSTRACT Newcastle disease is a highly contagious disease responsible for major outbreaks and considerable economic losses in the poultry industry in China. There is still little information available regarding gene characterization of the NDV, especially in ducks and pigeons. Therefore, the aim of this study was to investigate NDV isolated from ducks and pigeons in Hubei, China. In this study, three NDVs from ducks and pigeons were isolated between 2013 and 2015.The fusion protein (F gene of the NDV isolates was sequenced and phylogenetically analyzed. The clinical signs and gross histopathological lesions were examined. Phylogenetic analysis of these strains indicated that all the sequences are classified as genotype II. The isolates shared a 112 G-R-Q-G-R-L 117motif at the F protein cleavage site, indicating that these three isolates strains are lentogenic. Necropsy and histopathology showed the typical pathological changes. It was concluded that commercial ducks and pigeons in Hubei province carry lentogenic NDV strains with regular genetic divergence, indicating that these species may act as the main reservoirs of NDV in poultry. Therefore, strategies and surveillance should be undertaken to reduce the risk of ND outbreaks.

  19. Identification of Four Distinct Phylogenetic Groups in Flavobacterium columnare With Fish Host Associations

    Directory of Open Access Journals (Sweden)

    Benjamin R. LaFrentz

    2018-03-01

    Full Text Available Columnaris disease, caused by the Gram-negative bacterium Flavobacterium columnare, is one of the most prevalent fish diseases worldwide. An exceptionally high level of genetic diversity among isolates of F. columnare has long been recognized, whereby six established genomovars have been described to date. However, little has been done to quantify or characterize this diversity further in a systematic fashion. The objective of this research was to perform phylogenetic analyses of 16S rRNA and housekeeping gene sequences to decipher the genetic diversity of F. columnare. Fifty isolates and/or genomes of F. columnare, originating from diverse years, geographic locations, fish hosts, and representative of the six genomovars were analyzed in this study. A multilocus phylogenetic analysis (MLPA of the 16S rRNA and six housekeeping genes supported four distinct F. columnare genetic groups. There were associations between genomovar and genetic group, but these relationships were imperfect indicating that genomovar assignment does not accurately reflect F. columnare genetic diversity. To expand the dataset, an additional 90 16S rRNA gene sequences were retrieved from GenBank and a phylogenetic analysis of this larger dataset also supported the establishment of four genetic groups. Examination of isolate historical data indicated biological relevance to the identified genetic diversity, with some genetic groups isolated preferentially from specific fish species or families. It is proposed that F. columnare isolates be assigned to the four genetic groups defined in this study rather than genomovar in order to facilitate a standard nomenclature across the scientific community. An increased understanding of which genetic groups are most prevalent in different regions and/or aquaculture industries may allow for the development of improved targeted control and treatment measures for columnaris disease.

  20. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  1. A novel pAA virulence plasmid encoding toxins and two distinct variants of the fimbriae of enteroaggregative Escherichia coli

    DEFF Research Database (Denmark)

    Jønsson, Rie; Struve, Carsten; Boll, Erik J.

    2017-01-01

    phylogenetically distinct, strains harboring the major pilin subunits from both AAF/III and AAF/V. Whole-genome and plasmid sequencing revealed that in these six strains the agg3A and agg5A genes were located on a novel pAA plasmid variant. Moreover, the plasmid also encoded several other virulence genes including...... some not previously found on pAA plasmids. Thus, this plasmid endows the host strains with a remarkably high number of EAEC associated virulence genes hereby likely promoting strain pathogenicity....

  2. Distinct prion-like strains of amyloid beta implicated in phenotypic diversity of Alzheimer's disease.

    Science.gov (United States)

    Cohen, Mark; Appleby, Brian; Safar, Jiri G

    2016-01-01

    Vast evidence on human prions demonstrates that variable disease phenotypes, rates of propagation, and targeting of distinct brain structures are determined by unique conformers (strains) of pathogenic prion protein (PrP(Sc)). Recent progress in the development of advanced biophysical tools that inventory structural characteristics of amyloid beta (Aβ) in the brain cortex of phenotypically diverse Alzheimer's disease (AD) patients, revealed unique spectrum of oligomeric particles in the cortex of rapidly progressive cases, implicating these structures in variable rates of propagation in the brain, and in distict disease manifestation. Since only ∼30% of phenotypic diversity of AD can be explained by polymorphisms in risk genes, these and transgenic bioassay data argue that structurally distinct Aβ particles play a major role in the diverse pathogenesis of AD, and may behave as distinct prion-like strains encoding diverse phenotypes. From these observations and our growing understanding of prions, there is a critical need for new strain-specific diagnostic strategies for misfolded proteins causing these elusive disorders. Since targeted drug therapy can induce mutation and evolution of prions into new strains, effective treatments of AD will require drugs that enhance clearance of pathogenic conformers, reduce the precursor protein, or inhibit the conversion of precursors into prion-like states.

  3. Genome Analysis of the Biotechnologically Relevant Acidophilic Iron Oxidising Strain JA12 Indicates Phylogenetic and Metabolic Diversity within the Novel Genus “Ferrovum”

    Science.gov (United States)

    Ullrich, Sophie R.; Poehlein, Anja; Tischler, Judith S.; González, Carolina; Ossandon, Francisco J.; Daniel, Rolf; Holmes, David S.; Schlömann, Michael; Mühling, Martin

    2016-01-01

    Background Members of the genus “Ferrovum” are ubiquitously distributed in acid mine drainage (AMD) waters which are characterised by their high metal and sulfate loads. So far isolation and microbiological characterisation have only been successful for the designated type strain “Ferrovum myxofaciens” P3G. Thus, knowledge about physiological characteristics and the phylogeny of the genus “Ferrovum” is extremely scarce. Objective In order to access the wider genetic pool of the genus “Ferrovum” we sequenced the genome of a “Ferrovum”-containing mixed culture and successfully assembled the almost complete genome sequence of the novel “Ferrovum” strain JA12. Phylogeny and Lifestyle The genome-based phylogenetic analysis indicates that strain JA12 and the type strain represent two distinct “Ferrovum” species. “Ferrovum” strain JA12 is characterised by an unusually small genome in comparison to the type strain and other iron oxidising bacteria. The prediction of nutrient assimilation pathways suggests that “Ferrovum” strain JA12 maintains a chemolithoautotrophic lifestyle utilising carbon dioxide and bicarbonate, ammonium and urea, sulfate, phosphate and ferrous iron as carbon, nitrogen, sulfur, phosphorous and energy sources, respectively. Unique Metabolic Features The potential utilisation of urea by “Ferrovum” strain JA12 is moreover remarkable since it may furthermore represent a strategy among extreme acidophiles to cope with the acidic environment. Unlike other acidophilic chemolithoautotrophs “Ferrovum” strain JA12 exhibits a complete tricarboxylic acid cycle, a metabolic feature shared with the closer related neutrophilic iron oxidisers among the Betaproteobacteria including Sideroxydans lithotrophicus and Thiobacillus denitrificans. Furthermore, the absence of characteristic redox proteins involved in iron oxidation in the well-studied acidophiles Acidithiobacillus ferrooxidans (rusticyanin) and Acidithiobacillus

  4. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008

    Directory of Open Access Journals (Sweden)

    Seon Young Choi

    2016-03-01

    Full Text Available An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997. Nontoxigenic (CTX− V. cholerae El Tor dominated toxigenic (CTX+ strains (2001 to 2003, but V. cholerae CTX+ variant El Tor was isolated during 2004 to 2008, outcompeting CTX−V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX+ El Tor, two were CTX− El Tor, and the remaining strain was a CTX+ classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX− isolate is ancestral to the 6th and 7th pandemic CTX+V. cholerae isolates. The other CTX− isolate joined with CTX− non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX+ isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX+ El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX+ El Tor isolate contained West African-South American (WASA recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity.

  5. Desmodus rotundus and Artibeus spp. bats might present distinct rabies virus lineages

    Directory of Open Access Journals (Sweden)

    Willian Oliveira Fahl

    Full Text Available In Brazil, bats have been assigned an increasing importance in public health as they are important rabies reservoirs. Phylogenetic studies have shown that rabies virus (RABV strains from frugivorous bats Artibeus spp. are closely associated to those from the vampire bat Desmodus rotundus, but little is known about the molecular diversity of RABV in Artibeus spp. The N and G genes of RABV isolated from Artibeus spp. and cattle infected by D. rotundus were sequenced, and phylogenetic trees were constructed. The N gene nucleotides tree showed three clusters: one for D. rotundus and two for Artibeus spp. Regarding putative N amino acid-trees, two clusters were formed, one for D. rotundus and another for Artibeus spp. RABV G gene phylogeny supported the distinction between D. rotundus and Artibeus spp. strains. These results show the intricate host relationship of RABV's evolutionary history, and are invaluable for the determination of RABV infection sources.

  6. Desmodus rotundus and Artibeus spp. bats might present distinct rabies virus lineages

    Directory of Open Access Journals (Sweden)

    Willian Oliveira Fahl

    2012-12-01

    Full Text Available In Brazil, bats have been assigned an increasing importance in public health as they are important rabies reservoirs. Phylogenetic studies have shown that rabies virus (RABV strains from frugivorous bats Artibeus spp. are closely associated to those from the vampire bat Desmodus rotundus, but little is known about the molecular diversity of RABV in Artibeus spp. The N and G genes of RABV isolated from Artibeus spp. and cattle infected by D. rotundus were sequenced, and phylogenetic trees were constructed. The N gene nucleotides tree showed three clusters: one for D. rotundus and two for Artibeus spp. Regarding putative N amino acid-trees, two clusters were formed, one for D. rotundus and another for Artibeus spp. RABV G gene phylogeny supported the distinction between D. rotundus and Artibeus spp. strains. These results show the intricate host relationship of RABV's evolutionary history, and are invaluable for the determination of RABV infection sources.

  7. Desmodus rotundus and Artibeus spp. bats might present distinct rabies virus lineages.

    Science.gov (United States)

    Fahl, Willian Oliveira; Carnieli, Pedro; Castilho, Juliana Galera; Carrieri, Maria Luiza; Kotait, Ivanete; Iamamoto, Keila; Oliveira, Rafael Novaes; Brandão, Paulo Eduardo

    2012-01-01

    In Brazil, bats have been assigned an increasing importance in public health as they are important rabies reservoirs. Phylogenetic studies have shown that rabies virus (RABV) strains from frugivorous bats Artibeus spp. are closely associated to those from the vampire bat Desmodus rotundus, but little is known about the molecular diversity of RABV in Artibeus spp. The N and G genes of RABV isolated from Artibeus spp. and cattle infected by D. rotundus were sequenced, and phylogenetic trees were constructed. The N gene nucleotides tree showed three clusters: one for D. rotundus and two for Artibeus spp. Regarding putative N amino acid-trees, two clusters were formed, one for D. rotundus and another for Artibeus spp. RABV G gene phylogeny supported the distinction between D. rotundus and Artibeus spp. strains. These results show the intricate host relationship of RABV's evolutionary history, and are invaluable for the determination of RABV infection sources. Copyright © 2012 Elsevier Editora Ltda. All rights reserved.

  8. Phylogenetic Diversity of Vibrio cholerae Associated with Endemic Cholera in Mexico from 1991 to 2008.

    Science.gov (United States)

    Choi, Seon Young; Rashed, Shah M; Hasan, Nur A; Alam, Munirul; Islam, Tarequl; Sadique, Abdus; Johura, Fatema-Tuz; Eppinger, Mark; Ravel, Jacques; Huq, Anwar; Cravioto, Alejandro; Colwell, Rita R

    2016-03-15

    An outbreak of cholera occurred in 1991 in Mexico, where it had not been reported for more than a century and is now endemic. Vibrio cholerae O1 prototype El Tor and classical strains coexist with altered El Tor strains (1991 to 1997). Nontoxigenic (CTX(-)) V. cholerae El Tor dominated toxigenic (CTX(+)) strains (2001 to 2003), but V. cholerae CTX(+) variant El Tor was isolated during 2004 to 2008, outcompeting CTX(-) V. cholerae. Genomes of six Mexican V. cholerae O1 strains isolated during 1991 to 2008 were sequenced and compared with both contemporary and archived strains of V. cholerae. Three were CTX(+) El Tor, two were CTX(-) El Tor, and the remaining strain was a CTX(+) classical isolate. Whole-genome sequence analysis showed the six isolates belonged to five distinct phylogenetic clades. One CTX(-) isolate is ancestral to the 6th and 7th pandemic CTX(+) V. cholerae isolates. The other CTX(-) isolate joined with CTX(-) non-O1/O139 isolates from Haiti and seroconverted O1 isolates from Brazil and Amazonia. One CTX(+) isolate was phylogenetically placed with the sixth pandemic classical clade and the V. cholerae O395 classical reference strain. Two CTX(+) El Tor isolates possessing intact Vibrio seventh pandemic island II (VSP-II) are related to hybrid El Tor isolates from Mozambique and Bangladesh. The third CTX(+) El Tor isolate contained West African-South American (WASA) recombination in VSP-II and showed relatedness to isolates from Peru and Brazil. Except for one isolate, all Mexican isolates lack SXT/R391 integrative conjugative elements (ICEs) and sensitivity to selected antibiotics, with one isolate resistant to streptomycin. No isolates were related to contemporary isolates from Asia, Africa, or Haiti, indicating phylogenetic diversity. Sequencing of genomes of V. cholerae is critical if genetic changes occurring over time in the circulating population of an area of endemicity are to be understood. Although cholera outbreaks occurred rarely

  9. Distinct Host Tropism Protein Signatures to Identify Possible Zoonotic Influenza A Viruses.

    Science.gov (United States)

    Eng, Christine L P; Tong, Joo Chuan; Tan, Tin Wee

    2016-01-01

    Zoonotic influenza A viruses constantly pose a health threat to humans as novel strains occasionally emerge from the avian population to cause human infections. Many past epidemic as well as pandemic strains have originated from avian species. While most viruses are restricted to their primary hosts, zoonotic strains can sometimes arise from mutations or reassortment, leading them to acquire the capability to escape host species barrier and successfully infect a new host. Phylogenetic analyses and genetic markers are useful in tracing the origins of zoonotic infections, but there are still no effective means to identify high risk strains prior to an outbreak. Here we show that distinct host tropism protein signatures can be used to identify possible zoonotic strains in avian species which have the potential to cause human infections. We have discovered that influenza A viruses can now be classified into avian, human, or zoonotic strains based on their host tropism protein signatures. Analysis of all influenza A viruses with complete proteome using the host tropism prediction system, based on machine learning classifications of avian and human viral proteins has uncovered distinct signatures of zoonotic strains as mosaics of avian and human viral proteins. This is in contrast with typical avian or human strains where they show mostly avian or human viral proteins in their signatures respectively. Moreover, we have found that zoonotic strains from the same influenza outbreaks carry similar host tropism protein signatures characteristic of a common ancestry. Our results demonstrate that the distinct host tropism protein signature in zoonotic strains may prove useful in influenza surveillance to rapidly identify potential high risk strains circulating in avian species, which may grant us the foresight in anticipating an impending influenza outbreak.

  10. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China

    Directory of Open Access Journals (Sweden)

    Tan Bin

    2011-11-01

    Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  11. Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China.

    Science.gov (United States)

    Tan, Bin; Wen, Yong-Jun; Wang, Feng-Xue; Zhang, Shu-Qin; Wang, Xiu-Dong; Hu, Jia-Xin; Shi, Xin-Chuan; Yang, Bo-Chao; Chen, Li-Zhi; Cheng, Shi-Peng; Wu, Hua

    2011-11-16

    A new isolate of canine distemper virus (CDV), named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N), phosphoprotein (P) and receptor binding haemagglutinin (H) gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

  12. Phylogenetic and chemical diversity of MAR4 streptomycete lineage

    Directory of Open Access Journals (Sweden)

    Marisa Paulino

    2014-06-01

    To date, phylogenetic characterization of 6 representative isolates, based on partial sequence of gene encoding 16S rRNA, confirm that these strains belong to the specie Streptomyces aculeolatus. Figure 2. Neighbour-joining phylogenetic tree created from 6 partial 16S rRNA gene sequence from Streptomyces aculeolatus strains cultured from Madeira Archipelago, based on 1000 bootstrap replicates. BLAST matches (deposited in GenBank are included with species and strain name followed by accession number. Verrucosispora maris and Micromonospora aurantiaca were used as outgroups.

  13. Virulence, serotype and phylogenetic groups of diarrhoeagenic ...

    African Journals Online (AJOL)

    Dr DADIE Thomas

    2014-02-17

    Feb 17, 2014 ... The virulence, serotype and phylogenetic traits of diarrhoeagenic Escherichia coli were detected in 502 strains isolated during digestive infections. Molecular detection of the target virulence genes, rfb gene of operon O and phylogenetic grouping genes Chua, yjaA and TSPE4.C2 was performed.

  14. Risk factors for fecal colonization with multiple distinct strains of Escherichia coli among long-term care facility residents.

    Science.gov (United States)

    Lautenbach, Ebbing; Tolomeo, Pam; Black, Nicole; Maslow, Joel N

    2009-05-01

    Of 49 long-term care facility residents, 21 (43%) were colonized with 2 or more distinct strains of Escherichia coli. There were no significant risk factors for colonization with multiple strains of E. coli. These results suggest that future efforts to efficiently identify the diversity of colonizing strains will be challenging.

  15. Phylogenetic relationships of the glycoprotein gene of bovine ephemeral fever virus isolated from mainland China, Taiwan, Japan, Turkey, Israel and Australia

    Directory of Open Access Journals (Sweden)

    Zheng Fuying

    2012-11-01

    Full Text Available Abstract Background The glycoprotein (G gene sequences of bovine ephemeral fever virus (BEFV strains derived from mainland China have not been compared with those of the isolates from other countries or areas. Therefore, the G genes of four BEFV isolates obtained from mainland China were amplified and sequenced. A phylogenetic tree was constructed in order to compare and analyze the genetic relationships of the BEFV isolates derived from mainland China and different countries and areas. Results The complete BEFV G gene was successfully amplified and sequenced from four isolates that originated from mainland China. A total of fifty-one BEFV strains were analyzed based on the G gene sequence and were found to be highly conserved. A phylogenetic tree showed that the isolates were grouped into three distinct lineages depending on their source of origin. The antigenic sites of G1, G2 and G3 are conserved among the isolates, except for several substitutions in a few strains. Conclusions The phylogenetic relationships of the BEFV isolates that originated from mainland China, Taiwan, Japan, Turkey, Israel and Australia were closely related to their source of origin, while the antigenic sites G1, G2 and G3 are conserved among the BEFV isolates used in this work.

  16. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. [Phylogenetic analysis and nitrogen removal characteristics of a heterotrophic nitrifying-aerobic denitrifying bacteria strain from marine environment].

    Science.gov (United States)

    Sun, Xuemei; Li, Qiufen; Zhang, Yan; Liu, Huaide; Zhao, Jun; Qu, Keming

    2012-06-04

    We determined the phylogenetic position of a heterotrophic nitrifying-aerobic denitrifying bacterium X3, and detected its nitrogen removal characteristics for providing evidence to explain the principle of heterotrophic nitrification-aerobic denitrification and to improve the process in purification of marine-culture wastewater. The evolutionary position of the strain was determined based on its morphological, physiological, biochemical characteristics and 16SrRNA gene sequence. The nitrification-denitrification ability of this strain was detected by detecting its nitrogen removal efficiency and growth on different inorganic nitrogen source. Strain X3 was identified as Halomonas sp. It grew optimally at salinity 3%, pH 8.5, C:N 10:1 at 28 degrees C, and it could still survive at 15% salinity. The removal of NH4+ -N, NO2(-) -N and NO3(-) -N was 98.29%, 99.07%, 96.48% respectively within 24 h. When three inorganic nitrogen existed simultaneously, it always utilized ammonia firstly, and the total inorganic nitrogen removal was higher than with only one nitrogen, suggesting that strain X3 has the ability of simultaneous nitrification and denitrification and completing the whole nitrogen removing process. Strain X3 belonged to the genus of Halomonas. It had strong simultaneous nitrification and denitrification capability and could live in high-salinity environment.

  18. Molecular typing of canine parvovirus from Sulaimani, Iraq and phylogenetic analysis using partial VP2 gene

    Directory of Open Access Journals (Sweden)

    M.O.Baba Sheikh

    2017-09-01

    Full Text Available Canine parvovirus (CPV remains the most significant viral cause of haemorrhagic enteritis and bloody diarrhoea in puppies over the age of 12 weeks. The objective of the present study was to detect and genotype CPV-2 by polymerase chain reaction (PCR and to perform phylogenetic analysis using partial VP2 gene sequences. We analysed eight faecal samples of unvaccinated dogs with signs of vomiting and bloody diarrhoea during the period from December 2013 to May 2014 in different locations in Sulaimani, Kurdistan, Iraq. After PCR detection, we found that all viral sequences in our study were CPV-2b variants, which differed genetically by 0.8% to 3.6% from five commercially available vaccines. Alignment between eight nucleotides of field virus sequences showed 95% to 99.5% similarity. The phylogenetic analysis for the 8 field sequences formed two distinct clusters with two sequences belonging to strains from China and Thailand and the other six – with a strain from Egypt. Molecular characterisation and CPV typing are crucial in epidemiological studies for future prevention and control of the disease.

  19. Variability of geographically distinct isolates of maize rayado fino virus in Latin America.

    Science.gov (United States)

    Hammond, R W; Kogel, R; Ramirez, P

    1997-12-01

    We have examined the molecular epidemiology of the leafhopper-borne maize rayado fino virus (MRFV) in Latin America. The coat protein gene and 3' non-translated region of 14 isolates of MRFV collected from Latin America and the United States were sequenced and phylogenetic relationships examined. The nucleotide sequence revealed remarkable conservation, with a sequence similarity of 88-99%. Phylogenetic analysis of sequence data obtained from a 633 bp fragment showed that MRFV has diverged into three main clusters, i.e. the geographically distinct northern and southern isolates and the Colombian isolates. Significant differences between the isolates collected from Colombia, previously named maize rayado colombiana virus, based upon differences in symptomatology and serological relationships to MRFV, and the other MRFV isolates, provides additional evidence supporting its designation as a unique strain of MRFV.

  20. Phylogenetic analysis and protein structure modelling identifies distinct Ca(2+)/Cation antiporters and conservation of gene family structure within Arabidopsis and rice species.

    Science.gov (United States)

    Pittman, Jon K; Hirschi, Kendal D

    2016-12-01

    The Ca(2+)/Cation Antiporter (CaCA) superfamily is an ancient and widespread family of ion-coupled cation transporters found in nearly all kingdoms of life. In animals, K(+)-dependent and K(+)-indendent Na(+)/Ca(2+) exchangers (NCKX and NCX) are important CaCA members. Recently it was proposed that all rice and Arabidopsis CaCA proteins should be classified as NCX proteins. Here we performed phylogenetic analysis of CaCA genes and protein structure homology modelling to further characterise members of this transporter superfamily. Phylogenetic analysis of rice and Arabidopsis CaCAs in comparison with selected CaCA members from non-plant species demonstrated that these genes form clearly distinct families, with the H(+)/Cation exchanger (CAX) and cation/Ca(2+) exchanger (CCX) families dominant in higher plants but the NCKX and NCX families absent. NCX-related Mg(2+)/H(+) exchanger (MHX) and CAX-related Na(+)/Ca(2+) exchanger-like (NCL) proteins are instead present. Analysis of genomes of ten closely-related rice species and four Arabidopsis-related species found that CaCA gene family structures are highly conserved within related plants, apart from minor variation. Protein structures were modelled for OsCAX1a and OsMHX1. Despite exhibiting broad structural conservation, there are clear structural differences observed between the different CaCA types. Members of the CaCA superfamily form clearly distinct families with different phylogenetic, structural and functional characteristics, and therefore should not be simply classified as NCX proteins, which should remain as a separate gene family.

  1. Hepatitis A virus strains circulating during 1997-2015 in Campania, a Southern Italy region with periodic outbreaks.

    Science.gov (United States)

    Costantino, Angela; Coppola, Nicola; Spada, Enea; Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Marcantonio, Cinzia; Sagnelli, Caterina; Dell'Isola, Chiara; Tosone, Grazia; Mascolo, Silvia; Sagnelli, Evangelista; Ciccaglione, Anna Rita

    2017-11-01

    In Italy, the incidence of hepatitis A has progressively declined over the last 30 years, though not homogeneously throughout the country. In Campania, Southern Italy, high annual incidence rates have been reported and several periodic outbreaks have occurred. To investigate the phylogenetic and epidemiologic relationships among HAV strains circulating in Campania over the period 1997-2015, 87 hepatitis A cases were investigated. The most frequent risk factor was the consumption of raw/undercooked shellfish (75/87, 86.2%). During 1997-2002 most viral strains were subtype IA (16/23, 70%); the phylogenetic pattern suggests that the incidence peaks observed in 2000-2001 had likely been caused by multiple strains. During a large 2004 outbreak, almost all viral variants were subtype IB (38/41, 93%); most of them (22/38, 58%) were recognized to be one of two main strains (differing for just a single nucleotide), the remaining sequences were strictly related variants. In 2014/2015, only IA strains were observed; two phylogenetically related but distinct strains were responsible, respectively, for a small cluster in 2014 and an outbreak in 2015. In each outbreak, several strains unrelated to those responsible for most cases were detected in a minority of patients, documenting a background of sporadic cases occurring even in the course of outbreaks; some of them proved to be identical to strains detected 11-14 years previously. Overall, the data suggest that several related and unrelated HAV strains have endemically circulated over the last 15 years in Campania, with some strains gaining epidemic transmission likely because of a local combination of multiple factors, including inadequate waste water purification and dietary habits. © 2017 Wiley Periodicals, Inc.

  2. Multilocus sequence analysis of Treponema denticola strains of diverse origin

    Directory of Open Access Journals (Sweden)

    Mo Sisu

    2013-02-01

    Full Text Available Abstract Background The oral spirochete bacterium Treponema denticola is associated with both the incidence and severity of periodontal disease. Although the biological or phenotypic properties of a significant number of T. denticola isolates have been reported in the literature, their genetic diversity or phylogeny has never been systematically investigated. Here, we describe a multilocus sequence analysis (MLSA of 20 of the most highly studied reference strains and clinical isolates of T. denticola; which were originally isolated from subgingival plaque samples taken from subjects from China, Japan, the Netherlands, Canada and the USA. Results The sequences of the 16S ribosomal RNA gene, and 7 conserved protein-encoding genes (flaA, recA, pyrH, ppnK, dnaN, era and radC were successfully determined for each strain. Sequence data was analyzed using a variety of bioinformatic and phylogenetic software tools. We found no evidence of positive selection or DNA recombination within the protein-encoding genes, where levels of intraspecific sequence polymorphism varied from 18.8% (flaA to 8.9% (dnaN. Phylogenetic analysis of the concatenated protein-encoding gene sequence data (ca. 6,513 nucleotides for each strain using Bayesian and maximum likelihood approaches indicated that the T. denticola strains were monophyletic, and formed 6 well-defined clades. All analyzed T. denticola strains appeared to have a genetic origin distinct from that of ‘Treponema vincentii’ or Treponema pallidum. No specific geographical relationships could be established; but several strains isolated from different continents appear to be closely related at the genetic level. Conclusions Our analyses indicate that previous biological and biophysical investigations have predominantly focused on a subset of T. denticola strains with a relatively narrow range of genetic diversity. Our methodology and results establish a genetic framework for the discrimination and phylogenetic

  3. Comparative Genomic and Phylogenetic Analysis of a Shiga Toxin Producing Shigella sonnei (STSS Strain

    Directory of Open Access Journals (Sweden)

    Domonkos Sváb

    2017-05-01

    Full Text Available Shigella strains are important agents of bacillary dysentery, and in recent years Shigella sonnei has emerged as the leading cause of shigellosis in industrialized and rapidly developing countries. More recently, several S. sonnei and Shigella flexneri strains producing Shiga toxin (Stx have been reported from sporadic cases and from an outbreak in America. In the present study we aimed to shed light on the evolution of a recently identified Shiga toxin producing S. sonnei (STSS isolated in Europe. Here we report the first completely assembled whole genome sequence of a multidrug resistant (MDR Stx-producing S. sonnei (STSS clinical strain and reveal its phylogenetic relations. STSS 75/02 proved to be resistant to ampicillin, streptomycin, tetracycline, chloramphenicol, thrimetoprim, and sulfomethoxazol. The genome of STSS 75/02 contains a 4,891,717 nt chromosome and seven plasmids including the 214 kb invasion plasmid (pInv harboring type III secretion system genes and associated effectors. The chromosome harbors 23 prophage regions including the Stx1 converting prophage. The genome carries all virulence determinants necessary for an enteroinvasive lifestyle, as well as the Stx1 encoding gene cluster within an earlier described inducible converting prophage. In silico SNP genotyping of the assembled genome as well as 438 complete or draft S. sonnei genomes downloaded from NCBI GenBank revealed that S. sonnei 75/02 belongs to the more recently diverged global MDR lineage (IIIc. Targeted screening of 1131 next-generation sequencing projects taken from NCBI Short Read Archive of confirms that only a few S. sonnei isolates are Stx positive. Our results suggest that the acquisition of Stx phages could have occurred in different environments as independent events and that multiple horizontal transfers are responsible for the appearance of Stx phages in S. sonnei strains.

  4. A robust SNP barcode for typing Mycobacterium tuberculosis complex strains

    KAUST Repository

    Coll, Francesc

    2014-09-01

    Strain-specific genomic diversity in the Mycobacterium tuberculosis complex (MTBC) is an important factor in pathogenesis that may affect virulence, transmissibility, host response and emergence of drug resistance. Several systems have been proposed to classify MTBC strains into distinct lineages and families. Here, we investigate single-nucleotide polymorphisms (SNPs) as robust (stable) markers of genetic variation for phylogenetic analysis. We identify ∼92k SNP across a global collection of 1,601 genomes. The SNP-based phylogeny is consistent with the gold-standard regions of difference (RD) classification system. Of the ∼7k strain-specific SNPs identified, 62 markers are proposed to discriminate known circulating strains. This SNP-based barcode is the first to cover all main lineages, and classifies a greater number of sublineages than current alternatives. It may be used to classify clinical isolates to evaluate tools to control the disease, including therapeutics and vaccines whose effectiveness may vary by strain type. © 2014 Macmillan Publishers Limited.

  5. Phenotypic and genotypic description of Sedimenticola selenatireducens strain CUZ, a marine (per)chlorate-respiring gammaproteobacterium, and its close relative the chlorate-respiring Sedimenticola strain NSS.

    Science.gov (United States)

    Carlström, Charlotte I; Loutey, Dana E; Wang, Ouwei; Engelbrektson, Anna; Clark, Iain; Lucas, Lauren N; Somasekhar, Pranav Y; Coates, John D

    2015-04-01

    Two (per)chlorate-reducing bacteria, strains CUZ and NSS, were isolated from marine sediments in Berkeley and San Diego, CA, respectively. Strain CUZ respired both perchlorate and chlorate [collectively designated (per)chlorate], while strain NSS respired only chlorate. Phylogenetic analysis classified both strains as close relatives of the gammaproteobacterium Sedimenticola selenatireducens. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) preparations showed the presence of rod-shaped, motile cells containing one polar flagellum. Optimum growth for strain CUZ was observed at 25 to 30 °C, pH 7, and 4% NaCl, while strain NSS grew optimally at 37 to 42 °C, pH 7.5 to 8, and 1.5 to 2.5% NaCl. Both strains oxidized hydrogen, sulfide, various organic acids, and aromatics, such as benzoate and phenylacetate, as electron donors coupled to oxygen, nitrate, and (per)chlorate or chlorate as electron acceptors. The draft genome of strain CUZ carried the requisite (per)chlorate reduction island (PRI) for (per)chlorate respiration, while that of strain NSS carried the composite chlorate reduction transposon responsible for chlorate metabolism. The PRI of strain CUZ encoded a perchlorate reductase (Pcr), which reduced both perchlorate and chlorate, while the genome of strain NSS included a gene for a distinct chlorate reductase (Clr) that reduced only chlorate. When both (per)chlorate and nitrate were present, (per)chlorate was preferentially utilized if the inoculum was pregrown on (per)chlorate. Historically, (per)chlorate-reducing bacteria (PRB) and chlorate-reducing bacteria (CRB) have been isolated primarily from freshwater, mesophilic environments. This study describes the isolation and characterization of two highly related marine halophiles, one a PRB and the other a CRB, and thus broadens the known phylogenetic and physiological diversity of these unusual metabolisms. Copyright © 2015, American Society for Microbiology. All Rights

  6. Phylogenetic diversity and biological activity of culturable Actinobacteria isolated from freshwater fish gut microbiota.

    Science.gov (United States)

    Jami, Mansooreh; Ghanbari, Mahdi; Kneifel, Wolfgang; Domig, Konrad J

    2015-06-01

    The diversity of Actinobacteria isolated from the gut microbiota of two freshwater fish species namely Schizothorax zarudnyi and Schizocypris altidorsalis was investigated employing classical cultivation techniques, repetitive sequence-based PCR (rep-PCR), partial and full 16S rDNA sequencing followed by phylogenetic analysis. A total of 277 isolates were cultured by applying three different agar media. Based on rep-PCR profile analysis a subset of 33 strains was selected for further phylogenetic investigations, antimicrobial activity testing and diversity analysis of secondary-metabolite biosynthetic genes. The identification based on 16S rRNA gene sequencing revealed that the isolates belong to eight genera distributed among six families. At the family level, 72% of the 277 isolates belong to the family Streptomycetaceae. Among the non-streptomycetes group, the most dominant group could be allocated to the family of Pseudonocardiaceae followed by the members of Micromonosporaceae. Phylogenetic analysis clearly showed that many of the isolates in the genera Streptomyces, Saccharomonospora, Micromonospora, Nocardiopsis, Arthrobacter, Kocuria, Microbacterium and Agromyces formed a single and distinct cluster with the type strains. Notably, there is no report so far about the occurrence of these Actinobacteria in the microbiota of freshwater fish. Of the 33 isolates, all the strains exhibited antibacterial activity against a set of tested human and fish pathogenic bacteria. Then, to study their associated potential capacity to synthesize diverse bioactive natural products, diversity of genes associated with secondary-metabolite biosynthesis including PKS I, PKS II, NRPS, the enzyme PhzE of the phenazine pathways, the enzyme dTGD of 6-deoxyhexoses glycosylation pathway, the enzyme Halo of halogenation pathway and the enzyme CYP in polyene polyketide biosynthesis were investigated among the isolates. All the strains possess at least two types of the investigated

  7. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation.

    Science.gov (United States)

    Guevara Andino, Juan Ernesto; Pitman, Nigel C A; Ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V A

    2017-11-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one-hectare plots in terra firme forests of Ecuadorian Amazon. In these plots, we tagged, collected, and identified every single adult tree with dbh ≥10 cm. These data were combined with a regional community phylogenetic tree to calculate different phylogenetic diversity (PD) metrics in order to create spatial models. We used Loess regression to estimate the spatial variation of taxonomic and phylogenetic beta diversity as well as phylogenetic endemism and evolutionary distinctiveness. We found evidence for the definition of three floristic districts in the Ecuadorian Amazon, supported by both taxonomic and phylogenetic diversity data. Areas with high levels of phylogenetic endemism and evolutionary distinctiveness in Ecuadorian Amazon forests are unprotected. Furthermore, these areas are severely threatened by proposed plans of oil and mining extraction at large scales and should be prioritized in conservation planning for this region.

  8. Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran

    Directory of Open Access Journals (Sweden)

    Sadegh Chinikar

    2016-01-01

    Full Text Available Background: Crimean Congo hemorrhagic fever virus (CCHFV is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran.Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were ana­lyzed using Mega5 software.Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1, clade IV-(Asia 2 and clade V-(Europe accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22 was associated with none of other sequences and formed a new clade (VII. The phylogenetic analysis of complete S-segment nucleotide sequences from selected Ira­nian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either associa­tion with clade III (Asia-Africa or clade V (Europe.Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we pro­pose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration.

  9. Molecular characterization of different equine-like G3 rotavirus strains from Germany.

    Science.gov (United States)

    Pietsch, Corinna; Liebert, Uwe G

    2018-01-01

    The genetic heterogeneity of rotaviruses constitutes a substantial burden to human and animal health. Occasional interspecies transmissions can generate novel virus strains in the human population. We detected equine-like G3P[8] strains in feces sampled from three children in Germany in 2015 and 2016, respectively. Thereof two showed a DS-1-like backbone. In one strain the NSP2 gene segment was of distinct genotype (G3-P[8]-I2-R2-C2-M2-A2-N1-T2-E2-H2). Phylogenetic analyses of the German strains showed a relation to other equine-like G3 rotaviruses circulating in different countries. The reconstruction of reassortment events in the evolution of novel equine-like G3 rotaviruses suggests an independent introduction of the three strains into the local human rotavirus population. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Myenteric plexus is differentially affected by infection with distinct Trypanosoma cruzi strains in Beagle dogs

    Directory of Open Access Journals (Sweden)

    Nívia Carolina Nogueira-Paiva

    2014-02-01

    Full Text Available Chagasic megaoesophagus and megacolon are characterised by motor abnormalities related to enteric nervous system lesions and their development seems to be related to geographic distribution of distinct Trypanosoma cruzi subpopulations. Beagle dogs were infected with Y or Berenice-78 (Be-78 T. cruzi strains and necropsied during the acute or chronic phase of experimental disease for post mortem histopathological evaluation of the oesophagus and colon. Both strains infected the oesophagus and colon and caused an inflammatory response during the acute phase. In the chronic phase, inflammatory process was observed exclusively in the Be-78 infected animals, possibly due to a parasitism persistent only in this group. Myenteric denervation occurred during the acute phase of infection for both strains, but persisted chronically only in Be-78 infected animals. Glial cell involvement occurred earlier in animals infected with the Y strain, while animals infected with the Be-78 strain showed reduced glial fibrillary acidic protein immunoreactive area of enteric glial cells in the chronic phase. These results suggest that although both strains cause lesions in the digestive tract, the Y strain is associated with early control of the lesion, while the Be-78 strain results in progressive gut lesions in this model.

  11. Cyanobacterial nitrogenases: phylogenetic diversity, regulation and functional predictions

    Directory of Open Access Journals (Sweden)

    Alberto A. Esteves-Ferreira

    2017-03-01

    Full Text Available Abstract Cyanobacteria is a remarkable group of prokaryotic photosynthetic microorganisms, with several genera capable of fixing atmospheric nitrogen (N2 and presenting a wide range of morphologies. Although the nitrogenase complex is not present in all cyanobacterial taxa, it is spread across several cyanobacterial strains. The nitrogenase complex has also a high theoretical potential for biofuel production, since H2 is a by-product produced during N2 fixation. In this review we discuss the significance of a relatively wide variety of cell morphologies and metabolic strategies that allow spatial and temporal separation of N2 fixation from photosynthesis in cyanobacteria. Phylogenetic reconstructions based on 16S rRNA and nifD gene sequences shed light on the evolutionary history of the two genes. Our results demonstrated that (i sequences of genes involved in nitrogen fixation (nifD from several morphologically distinct strains of cyanobacteria are grouped in similarity with their morphology classification and phylogeny, and (ii nifD genes from heterocytous strains share a common ancestor. By using this data we also discuss the evolutionary importance of processes such as horizontal gene transfer and genetic duplication for nitrogenase evolution and diversification. Finally, we discuss the importance of H2 synthesis in cyanobacteria, as well as strategies and challenges to improve cyanobacterial H2 production.

  12. Detection and phylogenetic analyses of spike genes in porcine epidemic diarrhea virus strains circulating in China in 2016-2017.

    Science.gov (United States)

    Zhang, Qiaoling; Liu, Xinsheng; Fang, Yuzhen; Zhou, Peng; Wang, Yonglu; Zhang, Yongguang

    2017-10-10

    Large-scale outbreaks of porcine epidemic diarrhea (PED) have re-emerged in China in recent years. However, little is known about the genetic diversity and molecular epidemiology of field strains of PED virus (PEDV) in China in 2016-2017. To address this issue, in this study, 116 diarrhea samples were collected from pig farms in 6 Chinese provinces in 2016-2017 and were detected using PCR for main porcine enteric pathogens, including PEDV, porcine deltacoronavirus (PDCoV), porcine transmissible gastroenteritis virus (TGEV) and porcine kobuvirus (PKV). In addition, the complete S genes from 11 representative PEDV strains were sequenced and analyzed. PCR detection showed that 52.6% (61/116) of these samples were positive for PEDV. Furthermore, sequencing results for the spike (S) genes from 11 of the epidemic PEDV strains showed 93-94% nucleotide identity and 92-93% amino acid identity with the classical CV777 strain. Compared with the CV777 vaccine strain, these strains had an insertion (A 133 ), a deletion (G 155 ), and a continuous 4-amino-acid insertion ( 56 NNTN 59 ) in the S1 region. Phylogenetic analysis based on the S gene indicated that the 11 assessed PEDV strains were genetically diverse and clustered into the G2 group. These results demonstrate that the epidemic strains of PEDV in China in 2016-2017 are mainly virulent strains that belong to the G2 group and genetically differ from the vaccine strain. Importantly, this is the first report that the samples collected in Hainan Province were positive for PEDV (59.2%, 25/42). To our knowledge, this article presents the first report of a virulent PEDV strain isolated from Hainan Island, China. The results of this study will contribute to the understanding of the epidemiology and genetic characteristics of PEDV in China.

  13. Typing of Canine Parvovirus Strains Circulating in North-East China.

    Science.gov (United States)

    Zhao, H; Wang, J; Jiang, Y; Cheng, Y; Lin, P; Zhu, H; Han, G; Yi, L; Zhang, S; Guo, L; Cheng, S

    2017-04-01

    Canine parvovirus (CPV) is highly contagious and is a major cause of haemorrhagic enteritis and myocarditis in dogs. We investigated the genetic variation of emerging CPV strains by sequencing 64 CPV VP2 genes from 216 clinical samples of dogs from Heilongjiang, Jilin, Liaoning, Shandong and Hebei in 2014. Genetic analysis revealed that CPV-2b was predominant in Hebei and CPV-2a was predominant in the other four provinces. In addition, a CPV-2c strain has emerged in Shandong province. All samples had a Ser-Ala substitution at residue 297 and an Ile-Arg substitution at residue 324. Interestingly, in five separate canine samples, we found a mutation of Gln370 to Arg, until now detected only in isolates from pandas. The phylogenetic analysis showed clear distinctions between epidemic isolates and vaccine strains and between Chinese CPV-2c strains and CPV-2c strains found in other countries. Monitoring recent incidence of CPV strains enables evaluation and implementation of disease control strategies. © 2015 Blackwell Verlag GmbH.

  14. Isolation and phylogenetic characterization of Canine distemper virus from India.

    Science.gov (United States)

    Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

    2015-09-01

    Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

  15. Rotavirus A strains obtained from children with acute gastroenteritis in Mozambique, 2012-2013: G and P genotypes and phylogenetic analysis of VP7 and partial VP4 genes.

    Science.gov (United States)

    João, Eva Dora; Strydom, Amy; O'Neill, Hester G; Cuamba, Assa; Cassocera, Marta; Acácio, Sozinho; Mandomando, Inácio; Motanyane, Lithabiso; Page, Nicola; de Deus, Nilsa

    2018-01-01

    In Mozambique rotavirus (RV) was shown to be the greatest cause of acute diarrhoea in infants from 0 to 11 months, and in 2015, national rotavirus vaccination was introduced. As with other developing countries, there is very limited active strain characterisation. Rotavirus positive clinical specimens, collected between 2012 and 2013, have now provided information on the genotypes circulating in southern Mozambique prior to vaccine introduction. Genotypes G2 (32.4%), G12 (28.0%), P[4] (41.4%) and P[6] (22.9%) (n = 157) strains were commonly detected with G2P[4] (42.3%) RVs being predominant, specifically during 2013. Phylogenetic evaluation of the VP7 and VP8* encoding genes showed, for the majority of the Mozambican strains, that they clustered with other African strains based on genotype. RVA/Human-wt/MOZ/0153/2013/G2P[4], RVA/Human-wt/MOZ/0308/2012/G2P[4] and RVA/Human-wt/MOZ/0288/2012/G12P[8] formed separate clusters from the other Mozambican strains with similar genotypes, suggesting possible reassortment. Amino acid substitutions in selected epitope regions also supported phylogenetic clustering. As expected, the VP7 and VP8* genes from the Mozambican strains differed from both the RotaTeq ® (SC2-9) G2P[5] and Rotarix ® (A41CB052A) G1P[8] genes. This study provides information on the genetic diversity of rotavirus strains prior to vaccine introduction and generates baseline data for future monitoring of any changes in rotavirus strains in response to vaccine pressure.

  16. Disentangling the phylogenetic and ecological components of spider phenotypic variation.

    Science.gov (United States)

    Gonçalves-Souza, Thiago; Diniz-Filho, José Alexandre Felizola; Romero, Gustavo Quevedo

    2014-01-01

    An understanding of how the degree of phylogenetic relatedness influences the ecological similarity among species is crucial to inferring the mechanisms governing the assembly of communities. We evaluated the relative importance of spider phylogenetic relationships and ecological niche (plant morphological variables) to the variation in spider body size and shape by comparing spiders at different scales: (i) between bromeliads and dicot plants (i.e., habitat scale) and (ii) among bromeliads with distinct architectural features (i.e., microhabitat scale). We partitioned the interspecific variation in body size and shape into phylogenetic (that express trait values as expected by phylogenetic relationships among species) and ecological components (that express trait values independent of phylogenetic relationships). At the habitat scale, bromeliad spiders were larger and flatter than spiders associated with the surrounding dicots. At this scale, plant morphology sorted out close related spiders. Our results showed that spider flatness is phylogenetically clustered at the habitat scale, whereas it is phylogenetically overdispersed at the microhabitat scale, although phylogenic signal is present in both scales. Taken together, these results suggest that whereas at the habitat scale selective colonization affect spider body size and shape, at fine scales both selective colonization and adaptive evolution determine spider body shape. By partitioning the phylogenetic and ecological components of phenotypic variation, we were able to disentangle the evolutionary history of distinct spider traits and show that plant architecture plays a role in the evolution of spider body size and shape. We also discussed the relevance in considering multiple scales when studying phylogenetic community structure.

  17. The kinetics of oocyst shedding and sporulation in two immunologically distinct strains of Eimeria maxima, GS and M6.

    Science.gov (United States)

    Al-Badri, Riadh; Barta, John Robert

    2012-11-01

    The kinetics of oocyst shedding and sporulation of two immunologically distinct strains of Eimeria maxima (GS and M6) were compared. Both strains had a prepatent period of approximately 120 h followed by peak oocyst shedding at 144-150 h post inoculation. Mean total oocyst output determined for each strain demonstrated that the fecundity of the M6 strain (12.8 × 10(3) ± 1.95) of E. maxima was roughly twice that of the GS strain (6.9 × 10(3) ± 3.33) when inoculated at the rate of 1,000 infective oocysts per bird. The process of oocyst sporulation was followed by repetitive sampling of sporulating oocysts at 26 °C with aeration over a 138 hour period. Sporulation was divided into five morphologically distinguishable stages whose abundance peaked at the following times during sporulation: unsporulated oocysts at 0 h; sporoblast anlagen at 18 h; sporoblasts without sporocyst walls at 22 h; and sporocysts without mature sporozoites at 38 h. The time to 50 % sporulation of E. maxima oocysts observed in the present study was approximately 53 h for both strains and all viable oocysts had completed sporulation by 60 h. In the present study, the prepatent periods, duration of oocyst shedding, and the relative kinetics of sporulation of the GS and M6 strains of E. maxima were found to be virtually identical despite the immunological distinctiveness of these two parasite strains.

  18. Albinism in phylogenetically and geographically distinct populations of Astyanax cavefish arises through the same loss-of-function Oca2 allele

    Science.gov (United States)

    Gross, J B; Wilkens, H

    2013-01-01

    The Mexican tetra, Astyanax mexicanus, comprises 29 populations of cave-adapted fish distributed across a vast karst region in northeastern Mexico. These populations have a complex evolutionary history, having descended from ‘old' and ‘young' ancestral surface-dwelling stocks that invaded the region ∼6.7 and ∼2.8 MYa, respectively. This study investigates a set of captive, pigmented Astyanax cavefish collected from the Micos cave locality in 1970, in which albinism appeared over the past two decades. We combined novel coloration analyses, coding sequence comparisons and mRNA expression level studies to investigate the origin of albinism in captive-bred Micos cavefish. We discovered that albino Micos cavefish harbor two copies of a loss-of-function ocular and cutaneous albinism type II (Oca2) allele previously identified in the geographically distant Pachón cave population. This result suggests that phylogenetically young Micos cavefish and phylogenetically old Pachón cave fish inherited this Oca2 allele from the ancestral surface-dwelling taxon. This likely resulted from the presence of the loss-of-function Oca2 haplotype in the ‘young' ancestral surface-dwelling stock that colonized the Micos cave and also introgressed into the ancient Pachón cave population. The appearance of albinism in captive Micos cavefish, caused by the same loss-of-function allele present in Pachón cavefish, implies that geographically and phylogenetically distinct cave populations can evolve the same troglomorphic phenotype from standing genetic variation present in the ancestral taxon. PMID:23572122

  19. Cephalosporium maydis is a distinct species in the Gaeumannomyces-Harpophora species complex.

    Science.gov (United States)

    Saleh, Amgad A; Leslie, John F

    2004-01-01

    Cephalosporium maydis is an important plant pathogen whose phylogenetic position relative to other fungi has not been established clearly. We compared strains of C. maydis, strains from several other plant-pathogenic Cephalosporium spp. and several possible relatives within the Gaeumannomyces-Harpophora species complex, to which C. maydis has been suggested to belong based on previous preliminary DNA sequence analyses. DNA sequences of the nuclear genes encoding the rDNA ITS region, β-tubulin, histone H3, and MAT-2 support the hypothesis that C. maydis is a distinct taxon within the Gaeumannomyces-Harpophora species complex. Based on amplified fragment length polymorphism (AFLP) profiles, C. maydis also is distinct from the other tested species of Cephalosporium, Phialophora sensu lato and members of Gaeumannomyces-Harpophora species complex, which supports its classification as Harpophora maydis. Oligonucleotide primers for H. maydis were developed that can be used in a PCR diagnostic protocol to rapidly and reliably detect and identify this pathogen. These diagnostic PCR primers will aid the detection of H. maydis in diseased maize because this fungus can be difficult to detect and isolate, and the movement of authentic cultures may be limited by quarantine restrictions.

  20. Bayesian nonparametric clustering in phylogenetics: modeling antigenic evolution in influenza.

    Science.gov (United States)

    Cybis, Gabriela B; Sinsheimer, Janet S; Bedford, Trevor; Rambaut, Andrew; Lemey, Philippe; Suchard, Marc A

    2018-01-30

    Influenza is responsible for up to 500,000 deaths every year, and antigenic variability represents much of its epidemiological burden. To visualize antigenic differences across many viral strains, antigenic cartography methods use multidimensional scaling on binding assay data to map influenza antigenicity onto a low-dimensional space. Analysis of such assay data ideally leads to natural clustering of influenza strains of similar antigenicity that correlate with sequence evolution. To understand the dynamics of these antigenic groups, we present a framework that jointly models genetic and antigenic evolution by combining multidimensional scaling of binding assay data, Bayesian phylogenetic machinery and nonparametric clustering methods. We propose a phylogenetic Chinese restaurant process that extends the current process to incorporate the phylogenetic dependency structure between strains in the modeling of antigenic clusters. With this method, we are able to use the genetic information to better understand the evolution of antigenicity throughout epidemics, as shown in applications of this model to H1N1 influenza. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  1. Different bacteriocin activities of Streptococcus mutans reflect distinct phylogenetic lineages

    DEFF Research Database (Denmark)

    Balakrishnan, M; Simmonds, RS; Kilian, Mogens

    2002-01-01

    Bacteriocins produced by mutans streptococci are known as mutacins. In this study 16 broadly active mutacin-producing Streptococcus mutans strains from New Zealand, North America and Europe were classified into four groups (A-D) on the basis of differences in their activity in deferred antagonism...... described by Caufield and co-workers. One of the New Zealand isolates of group A (S. mutans strain N) appeared to produce inhibitory activity similar to that of the group I prototype strain UA140. Four other New Zealand isolates of group B (S. mutans strains M19, M34, B34 and D14) had mutacin II......-like activity. The group B mutacin producers differed from the group A mutacin producers in their additional activity against Staph. aureus 46. Seven S. mutans strains (M46, B46, B57, M12, M28, B28 and 13M) were distinguished from the group A and group B mutacin producers in that they inhibited E. faecium TE1...

  2. Phylogenetic analysis of Puumala virus strains from Central Europe highlights the need for a full-genome perspective on hantavirus evolution.

    Science.gov (United States)

    Szabó, Róbert; Radosa, Lukáš; Ličková, Martina; Sláviková, Monika; Heroldová, Marta; Stanko, Michal; Pejčoch, Milan; Osterberg, Anja; Laenen, Lies; Schex, Susanne; Ulrich, Rainer G; Essbauer, Sandra; Maes, Piet; Klempa, Boris

    2017-12-01

    Puumala virus (PUUV), carried by bank voles (Myodes glareolus), is the medically most important hantavirus in Central and Western Europe. In this study, a total of 523 bank voles (408 from Germany, 72 from Slovakia, and 43 from Czech Republic) collected between the years 2007-2012 were analyzed for the presence of hantavirus RNA. Partial PUUV genome segment sequences were obtained from 51 voles. Phylogenetic analyses of all three genome segments showed that the newfound strains cluster with other Central and Western European PUUV strains. The new sequences from Šumava (Bohemian Forest), Czech Republic, are most closely related to the strains from the neighboring Bavarian Forest, a known hantavirus disease outbreak region. Interestingly, the Slovak strains clustered with the sequences from Bohemian and Bavarian Forests only in the M but not S segment analyses. This well-supported topological incongruence suggests a segment reassortment event or, as we analyzed only partial sequences, homologous recombination. Our data highlight the necessity of sequencing all three hantavirus genome segments and of a broader bank vole screening not only in recognized endemic foci but also in regions with no reported human hantavirus disease cases.

  3. Phylogenetic position of Leishmania isolates from Khyber Pakhtunkhwa province of Pakistan.

    Science.gov (United States)

    Khan, Nazma Habib; Messenger, Louisa A; Wahid, Sobia; Sutherland, Colin J

    2016-08-01

    Several species of the genus Leishmania are causative agents of cutaneous leishmaniasis in Pakistan. This study aimed to determine phylogenetic placement of Leishmania species causing cutaneous leishmaniasis in Khyber Pakhtunkhwa province, Pakistan (34 Leishmania tropica, 3 Leishmania infantum), in-relation to species from other geographical areas using gene sequences encoding cytochrome b (cytb) and internal transcribed spacer 2 (its2). Based on cytochrome b sequence analysis, L. tropica strains from Pakistan and other geographical regions were differentiated into two genotype groups, A and B. Within the province, five distinct L. tropica genotypes were recognized; two in group A, three in group B. Two L. infantum isolates from the province were closely associated with both Afro-Eurasian and American species of the Leishmania donovani complex, including Leishmania chagasi, L. infantum and L. donovani from Sudan and Ethiopia; while a third L. infantum isolate could not be differentiated from visceralizing Kenyan and Indian L. donovani. We observed apposite phylogenetic placement of CL-causing L. tropica and L. infantum from Khyber Pakhtunkhwa. Affinities ascribed to Leishmania spp. From the region are valuable in tracing potential importation of leishmaniasis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. From the Macro to the Micro: Gel Mapping to Differentiate between Sporozoites of Two Immunologically Distinct Strains of Eimeria maxima (Strains M6 and Guelph).

    Science.gov (United States)

    El-Ashram, Saeed; Yin, Qing; Liu, Hongbin; Al Nasr, Ibrahim; Liu, Xianyong; Suo, Xun; Barta, John

    2015-01-01

    Two immunologically distinct strains of E. maxima were examined in this study: the M6 strain and the Guelph strain. The differential expression between the sporozoites of the two strains of E. maxima was determined by image analysis of 100 μg of protein from each strain separated by standard one- and conventional two-dimensional polyacrylamide gel electrophoresis. In addition to differences in both molecular weight and the electrophoretic mobility, differences in the intensity of polypeptide bands for example, GS 136.4 and M6 169 were explored. Pooled gels were prepared from each strain. A representative 2D-PAGE gel spanning a non-linear pH range of 3-10 of E. maxima strain M6 consisted of approximately 694 polypeptide spots with about 67 (9.6%) of the polypeptide spots being unique relative to the other strain. E. maxima strain GS had about 696 discernable polypeptide spots with 69 spots (9.9%) that differed from those of the M6 strain. In-depth characterization of the variable polypeptide spots; unique polypeptide spots (absence or presence) and shared polypeptide spots with modifications may lead to novel vaccine target in the form of multi-component, multi-stage, multi-immunovariant strains, multi-species subunit vaccine, and diagnostic probe for E. maxima.

  5. Legionella clemsonensis sp. nov.: a green fluorescing Legionella strain from a patient with pneumonia.

    Science.gov (United States)

    Palmer, Allison; Painter, Joseph; Hassler, Hayley; Richards, Vincent P; Bruce, Terri; Morrison, Shatavia; Brown, Ellen; Kozak-Muiznieks, Natalia A; Lucas, Claressa; McNealy, Tamara L

    2016-10-01

    A novel Legionella species was identified based on sequencing, cellular fatty acid analysis, biochemical reactions, and biofilm characterization. Strain D5610 was originally isolated from the bronchial wash of a patient in Ohio, USA. The bacteria were gram-negative, rod-shaped, and exhibited green fluorescence under long wave UV light. Phylogenetic analysis and fatty acid composition revealed a distinct separation within the genus. The strain grows between 26-45°C and forms biofilms equivalent to L. pneumophila Philadelphia 1. These characteristics suggest that this isolate is a novel Legionella species, for which the name Legionella clemsonensis sp nov. is proposed. © 2016 The Societies and John Wiley & Sons Australia, Ltd.

  6. Phylogenetically distinct bacteria involve extensive dechlorination of aroclor 1260 in sediment-free cultures.

    Directory of Open Access Journals (Sweden)

    Shanquan Wang

    Full Text Available Microbial reductive dechlorination of the persistent polychlorinated biphenyls (PCBs is attracting much attention in cleanup of the contaminated environment. Nevertheless, most PCB dechlorinating cultures require presence of sediment or sediment substitutes to maintain their dechlorination activities which hinders subsequent bacterial enrichment and isolation processes. The information on enriching sediment-free PCB dechlorinating cultures is still limited. In this study, 18 microcosms established with soils and sediments were screened for their dechlorination activities on a PCB mixture - Aroclor 1260. After one year of incubation, 10 out of 18 microcosms showed significant PCB dechlorination with distinct dechlorination patterns (e.g., Process H, N and T classified based on profiles of PCB congeners loss and new congeners formation. Through serial transfers in defined medium, six sediment-free PCB dechlorinating cultures (i.e., CW-4, CG-1, CG-3, CG-4, CG-5 and SG-1 were obtained without amending any sediment or sediment-substitutes. PCB dechlorination Process H was the most frequently observed dechlorination pattern, which was found in four sediment-free cultures (CW-4, CG-3, CG-4 and SG-1. Sediment-free culture CG-5 showed the most extensive PCB dechlorination among the six cultures, which was mediated by Process N, resulting in the accumulation of penta- (e.g., 236-24-CB and tetra-chlorobiphenyls (tetra-CBs (e.g., 24-24-CB, 24-25-CB, 24-26-CB and 25-26-CB via dechlorinating 30.44% hepta-CBs and 59.12% hexa-CBs after three months of incubation. For culture CG-1, dechlorinators mainly attacked double flanked meta-chlorines and partially ortho-chlorines, which might represent a novel dechlorination pattern. Phylogenetic analysis showed distinct affiliation of PCB dechlorinators in the microcosms, including Dehalogenimonas and Dehalococcoides species. This study broadens our knowledge in microbial reductive dechlorination of PCBs, and provides

  7. Gene expression profiling in the striatum of inbred mouse strains with distinct opioid-related phenotypes

    Directory of Open Access Journals (Sweden)

    Piechota Marcin

    2006-06-01

    Full Text Available Abstract Background Mouse strains with a contrasting response to morphine provide a unique model for studying the genetically determined diversity of sensitivity to opioid reward, tolerance and dependence. Four inbred strains selected for this study exhibit the most distinct opioid-related phenotypes. C57BL/6J and DBA/2J mice show remarkable differences in morphine-induced antinociception, self-administration and locomotor activity. 129P3/J mice display low morphine tolerance and dependence in contrast to high sensitivity to precipitated withdrawal observed in SWR/J and C57BL/6J strains. In this study, we attempted to investigate the relationships between genetic background and basal gene expression profile in the striatum, a brain region involved in the mechanism of opioid action. Results Gene expression was studied by Affymetrix Mouse Genome 430v2.0 arrays with probes for over 39.000 transcripts. Analysis of variance with the control for false discovery rate (q Khdrbs1 and ATPase Na+/K+ alpha2 subunit (Atp1a2 with morphine self-administration and analgesic effects, respectively. Finally, the examination of transcript structure demonstrated a possible inter-strain variability of expressed mRNA forms as for example the catechol-O-methyltransferase (Comt gene. Conclusion The presented study led to the recognition of differences in the gene expression that may account for distinct phenotypes. Moreover, results indicate strong contribution of genetic background to differences in gene transcription in the mouse striatum. The genes identified in this work constitute promising candidates for further animal studies and for translational genetic studies in the field of addictive and analgesic properties of opioids.

  8. 16S rRNA phylogenetic analysis of actinomycetes isolated from ...

    African Journals Online (AJOL)

    Subsequently, phylogenetic tree was constructed using suitable bioinformatics tools to identify the similarity which showed 97% similarity between strains. Moreover, all the selected strains of actinomycetes were subjected to study the protein and plasmid DNA expression profiles which showed prominent bands with ...

  9. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    Science.gov (United States)

    2013-01-01

    VNTR numbers that occurred over the course of one year. Conclusions The comparative genomic analysis of the SAG clarifies the phylogenetics of these bacteria and supports the distinct species classification. Numerous potential virulence determinants were identified and provide a foundation for further studies into SAG pathogenesis. Furthermore, the data may be used to enable the development of rapid diagnostic assays and therapeutics for these pathogens. PMID:24341328

  10. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

    1999-07-01

    Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

  11. Phylogenetics and differentiation of Salmonella Newport lineages by whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Guojie Cao

    Full Text Available Salmonella Newport has ranked in the top three Salmonella serotypes associated with foodborne outbreaks from 1995 to 2011 in the United States. In the current study, we selected 26 S. Newport strains isolated from diverse sources and geographic locations and then conducted 454 shotgun pyrosequencing procedures to obtain 16-24 × coverage of high quality draft genomes for each strain. Comparative genomic analysis of 28 S. Newport strains (including 2 reference genomes and 15 outgroup genomes identified more than 140,000 informative SNPs. A resulting phylogenetic tree consisted of four sublineages and indicated that S. Newport had a clear geographic structure. Strains from Asia were divergent from those from the Americas. Our findings demonstrated that analysis using whole genome sequencing data resulted in a more accurate picture of phylogeny compared to that using single genes or small sets of genes. We selected loci around the mutS gene of S. Newport to differentiate distinct lineages, including those between invH and mutS genes at the 3' end of Salmonella Pathogenicity Island 1 (SPI-1, ste fimbrial operon, and Clustered, Regularly Interspaced, Short Palindromic Repeats (CRISPR associated-proteins (cas. These genes in the outgroup genomes held high similarity with either S. Newport Lineage II or III at the same loci. S. Newport Lineages II and III have different evolutionary histories in this region and our data demonstrated genetic flow and homologous recombination events around mutS. The findings suggested that S. Newport Lineages II and III diverged early in the serotype evolution and have evolved largely independently. Moreover, we identified genes that could delineate sublineages within the phylogenetic tree and that could be used as potential biomarkers for trace-back investigations during outbreaks. Thus, whole genome sequencing data enabled us to better understand the genetic background of pathogenicity and evolutionary history of S

  12. Phylogenetic evidence of a new canine distemper virus lineage among domestic dogs in Colombia, South America.

    Science.gov (United States)

    Espinal, Maria A; Díaz, Francisco J; Ruiz-Saenz, Julian

    2014-08-06

    Canine distemper virus (CDV) is a highly contagious viral disease of carnivores affecting both wild and domestic populations. The hemagglutinin gene, encoding for the attachment protein that determines viral tropism, shows high heterogeneity among strains, allowing for the distinction of ten different lineages distributed worldwide according to a geographic pattern. We obtained the sequences of the full-length H gene of 15 wild-type CDV strains circulating in domestic dog populations from the Aburrá Valley, Colombia. A phylogenetic analysis of H gene nucleotide sequences from Colombian CDV viruses along with field isolates from different geographic regions and vaccine strains was performed. Colombian wild-type viruses formed a distinct monophyletic cluster clearly separated from the previously identified wild-type and vaccine lineages, suggesting that a novel genetic variant, quite different from vaccines and other lineages, is circulating among dog populations in the Aburrá Valley. We propose naming this new lineage as "South America 3". This information indicates that there are at least three different CDV lineages circulating in domestic and wild carnivore populations in South America. The first one, renamed Europe/South America 1, circulates in Brazil and Uruguay; the second, South America 2, appears to be restricted to Argentina; and the third, South America 3, which comprises all the strains characterized in this study, may also be circulating in other northern countries of South America. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Phylogenetic analysis of canine parvovirus isolates from Sichuan and Gansu provinces of China in 2011.

    Science.gov (United States)

    Xu, J; Guo, H-C; Wei, Y-Q; Shu, L; Wang, J; Li, J-S; Cao, S-Z; Sun, S-Q

    2015-02-01

    Canine parvovirus causes serious disease in dogs. Study of the genetic variation in emerging CPV strains is important for disease control strategy. The antigenic property of CPV is connected with specific amino acid changes, mainly in the capsid protein VP2. This study was carried out to characterize VP2 gene of CPV viruses from two provinces of China in 2011. The complete VP2 genes of the CPV-positive samples were amplified and sequenced. Genetic analysis based on the VP2 genes of CPV was conducted. All of the isolates screened and sequenced in this study were typed as CPV-2a except GS-K11 strain, which was typed as CPV-2b. Sequence comparison showed nucleotide identities of 98.8-100% among CPV strains, whereas the Aa similarities were 99.6-100%. Compared with the reference strains, there are three distinctive amino acid changes at VP2 gene residue 267, 324 and 440 of the strains isolated in this study. Of the 27 strains, fourteen (51.85%) had the 267 (Phe-Tyr) and 440 (Thr-Ala) substitution, all the 27 (100%) had 324 (Tyr-Ile) substitution. Phylogenetically, all of the strains isolated in this study formed a major monophyletic cluster together with one South Korean isolate, two Thailand isolates and four Chinese former isolates. © 2013 Blackwell Verlag GmbH.

  14. Phylogenetic and genome-wide deep-sequencing analyses of canine parvovirus reveal co-infection with field variants and emergence of a recent recombinant strain.

    Directory of Open Access Journals (Sweden)

    Ruben Pérez

    Full Text Available Canine parvovirus (CPV, a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population and a major recombinant strain (86.7%. The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity.

  15. Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

    Science.gov (United States)

    Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofia; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martín; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina

    2014-01-01

    Canine parvovirus (CPV), a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c) with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population) and a major recombinant strain (86.7%). The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity. PMID:25365348

  16. Phylogenetic analysis of Tomato spotted wilt virus (TSWV) NSs protein demonstrates the isolated emergence of resistance-breaking strains in pepper.

    Science.gov (United States)

    Almási, Asztéria; Csilléry, Gábor; Csömör, Zsófia; Nemes, Katalin; Palkovics, László; Salánki, Katalin; Tóbiás, István

    2015-02-01

    Resurgence of Tomato spotted wilt virus (TSWV) worldwide as well as in Hungary causing heavy economic losses directed the attention to the factors contributing to the outbreak of this serious epidemics. The introgression of Tsw resistance gene into various pepper cultivars seemed to solve TSWV control, but widely used resistant pepper cultivars bearing the same, unique resistance locus evoked the rapid emergence of resistance-breaking (RB) TSWV strains. In Hungary, the sporadic appearance of RB strains in pepper-producing region was first observed in 2010-2011, but in 2012 it was detected frequently. Previously, the non-structural protein (NSs) encoded by small RNA (S RNA) of TSWV was verified as the avirulence factor for Tsw resistance, therefore we analyzed the S RNA of the Hungarian RB and wild type (WT) isolates and compared to previously analyzed TSWV strains with RB properties from different geographical origins. Phylogenetic analysis demonstrated that the different RB strains had the closest relationship with the local WT isolates and there is no conserved mutation present in all the NSs genes of RB isolates from different geographical origins. According to these results, we concluded that the RB isolates evolved separately in geographic point of view, and also according to the RB mechanism.

  17. Distinct virulence of Rift Valley fever phlebovirus strains from different genetic lineages in a mouse model.

    Directory of Open Access Journals (Sweden)

    Tetsuro Ikegami

    Full Text Available Rift Valley fever phlebovirus (RVFV causes high rates of abortions and fetal malformations in ruminants, and hemorrhagic fever, encephalitis, or blindness in humans. Viral transmission occurs via mosquito vectors in endemic areas, which necessitates regular vaccination of susceptible livestock animals to prevent the RVF outbreaks. Although ZH501 strain has been used as a challenge strain for past vaccine efficacy studies, further characterization of other RVFV strains is important to optimize ruminant and nonhuman primate RVFV challenge models. This study aimed to characterize the virulence of wild-type RVFV strains belonging to different genetic lineages in outbred CD1 mice. Mice were intraperitoneally infected with 1x103 PFU of wild-type ZH501, Kenya 9800523, Kenya 90058, Saudi Arabia 200010911, OS1, OS7, SA75, Entebbe, or SA51 strains. Among them, mice infected with SA51, Entebbe, or OS7 strain showed rapid dissemination of virus in livers and peracute necrotic hepatitis at 2-3 dpi. Recombinant SA51 (rSA51 and Zinga (rZinga strains were recovered by reverse genetics, and their virulence was also tested in CD1 mice. The rSA51 strain reproduced peracute RVF disease in mice, whereas the rZinga strain showed a similar virulence with that of rZH501 strain. This study showed that RVFV strains in different genetic lineages display distinct virulence in outbred mice. Importantly, since wild-type RVFV strains contain defective-interfering RNA or various genetic subpopulations during passage from original viral isolations, recombinant RVFV strains generated by reverse genetics will be better suitable for reproducible challenge studies for vaccine development as well as pathological studies.

  18. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Molecular phylogenetics of the genus Costularia (Schoeneae, Cyperaceae) reveals multiple distinct evolutionary lineages.

    Science.gov (United States)

    Larridon, Isabel; Bauters, Kenneth; Semmouri, Ilias; Viljoen, Jan-Adriaan; Prychid, Christina J; Muasya, A Muthama; Bruhl, Jeremy J; Wilson, Karen L; Senterre, Bruno; Goetghebeur, Paul

    2018-04-19

    We investigated the monophyly of Costularia (25 species), a genus of tribe Schoeneae (Cyperaceae) that illustrates a remarkable distribution pattern from southeastern Africa, over Madagascar, the Mascarenes and Seychelles, to Malesia and New Caledonia. A further species, Tetraria borneensis, has been suggested to belong to Costularia. Relationships and divergence times were inferred using an existing four marker phylogeny of Cyperaceae tribe Schoeneae expanded with newly generated sequence data mainly for Costularia s.l. species. Phylogenetic reconstruction was executed using Bayesian inference and maximum likelihood approaches. Divergence times were estimated using a relaxed molecular clock model, calibrated with fossil data. Based on our results, Tetraria borneensis is not related to the species of Costularia. Costularia s.l. is composed of four distinct evolutionary lineages. Two lineages, one including the type species, are part of the Oreobolus clade, i.e. a much reduced genus Costularia restricted to southeastern Africa, Madagascar, the Mascarenes and Seychelles, and a small endemic genus from New Caledonia for which a new genus Chamaedendron is erected based on Costularia subgenus Chamaedendron. The other two lineages are part of the Tricostularia clade, i.e. a separate single-species lineage from the Seychelles for which a new genus (Xyroschoenus) is described, and Costularia subgenus Lophoschoenus. For the latter, more research is needed to test whether they are congeneric with the species placed in the reticulate-sheathed Tetraria clade. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Distinct colicin M-like bacteriocin-immunity pairs in Burkholderia.

    Science.gov (United States)

    Ghequire, Maarten G K; De Mot, René

    2015-11-27

    The Escherichia coli bacteriocin colicin M (ColM) acts via degradation of the cell wall precursor lipid II in target cells. ColM producers avoid self-inhibition by a periplasmic immunity protein anchored in the inner membrane. In this study, we identified colM-like bacteriocin genes in genomes of several β-proteobacterial strains belonging to the Burkholderia cepacia complex (Bcc) and the Burkholderia pseudomallei group. Two selected Burkholderia ambifaria proteins, designated burkhocins M1 and M2, were produced recombinantly and showed antagonistic activity against Bcc strains. In their considerably sequence-diverged catalytic domain, a conserved aspartate residue equally proved pivotal for cytotoxicity. Immunity to M-type burkhocins is conferred upon susceptible strains by heterologous expression of a cognate gene located either upstream or downstream of the toxin gene. These genes lack homology with currently known ColM immunity genes and encode inner membrane-associated proteins of two distinct types, differing in predicted transmembrane topology and moiety exposed to the periplasm. The addition of burkhocins to the bacteriocin complement of Burkholderia reveals a wider phylogenetic distribution of ColM-like bacteriotoxins, beyond the γ-proteobacterial genera Escherichia, Pectobacterium and Pseudomonas, and illuminates the diversified nature of immunity-providing proteins.

  1. Morphological characterization and phylogenetic distance among ...

    African Journals Online (AJOL)

    The genetic diversity was calculated with Nei and Li's index, and the phylogenetic tree (dendrogram) was generated with a neighbor-joining program. The dendrogram indicates the diversity of the genotypes, which are grouped into three distinctive large groups. The largest group includes species from the Mediolobivia and ...

  2. Global phylogenetic analysis of contemporary aleutian mink disease viruses (AMDVs)

    DEFF Research Database (Denmark)

    Ryt-Hansen, Pia; Hagberg, E. E.; Chriél, Mariann

    2017-01-01

    a strain originating from Sweden. In contrast, we did not identify any potential source for the other and more widespread outbreak strain. To the authors knowledge this is the first major global phylogenetic study of contemporary AMDV partial NS1 sequences. The study proved that partial NS1 sequencing can...

  3. Genetic diversity and geographic distribution of genetically distinct rabies viruses in the Philippines.

    Directory of Open Access Journals (Sweden)

    Mariko Saito

    Full Text Available BACKGROUND: Rabies continues to be a major public health problem in the Philippines, where 200-300 human cases were reported annually between 2001 and 2011. Understanding the phylogeography of rabies viruses is important for establishing a more effective and feasible control strategy. METHODS: We performed a molecular analysis of rabies viruses in the Philippines using rabied animal brain samples. The samples were collected from 11 of 17 regions, which covered three island groups (Luzon, Visayas, and Mindanao. Partial nucleoprotein (N gene sequencing was performed on 57 samples and complete glycoprotein (G gene sequencing was performed on 235 samples collected between 2004 and 2010. RESULTS: The Philippine strains of rabies viruses were included in a distinct phylogenetic cluster, previously named Asian 2b, which appeared to have diverged from the Chinese strain named Asian 2a. The Philippine strains were further divided into three major clades, which were found exclusively in different island groups: clades L, V, and M in Luzon, Visayas, and Mindanao, respectively. Clade L was subdivided into nine subclades (L1-L9 and clade V was subdivided into two subclades (V1 and V2. With a few exceptions, most strains in each subclade were distributed in specific geographic areas. There were also four strains that were divided into two genogroups but were not classified into any of the three major clades, and all four strains were found in the island group of Luzon. CONCLUSION: We detected three major clades and two distinct genogroups of rabies viruses in the Philippines. Our data suggest that viruses of each clade and subclade evolved independently in each area without frequent introduction into other areas. An important implication of these data is that geographically targeted dog vaccination using the island group approach may effectively control rabies in the Philippines.

  4. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  5. Diversity and Adaptation of Human Respiratory Syncytial Virus Genotypes Circulating in Two Distinct Communities: Public Hospital and Day Care Center

    Directory of Open Access Journals (Sweden)

    Gustavo Rocha Garcia

    2012-10-01

    Full Text Available HRSV is one of the most important pathogens causing acute respiratory tract diseases as bronchiolitis and pneumonia among infants. HRSV was isolated from two distinct communities, a public day care center and a public hospital in São José do Rio Preto – SP, Brazil. We obtained partial sequences from G gene that were used on phylogenetic and selection pressure analysis. HRSV accounted for 29% of respiratory infections in hospitalized children and 7.7% in day care center children. On phylogenetic analysis of 60 HRSV strains, 48 (80% clustered within or adjacent to the GA1 genotype; GA5, NA1, NA2, BA-IV and SAB1 were also observed. SJRP GA1 strains presented variations among deduced amino acids composition and lost the potential O-glycosilation site at amino acid position 295, nevertheless this resulted in an insertion of two potential O-glycosilation sites at positions 296 and 297. Furthermore, a potential O-glycosilation site insertion, at position 293, was only observed for hospital strains. Using SLAC and MEME methods, only amino acid 274 was identified to be under positive selection. This is the first report on HRSV circulation and genotypes classification derived from a day care center community in Brazil.

  6. Incorporating phylogenetic information for the definition of floristic districts in hyper-diverse Amazon forests: implications for conservation

    NARCIS (Netherlands)

    Guevara, J.E.; Pitman, N.C.A.; ter Steege, H.; Mogollón, H.; Ceron, C.; Palacios, W.; Oleas, N.; Fine, P.V.A.

    2017-01-01

    Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the

  7. Identification of the distinctive type i/XhoI+ strain of Epstein-Barr virus in gastric carcinoma in Peru.

    Science.gov (United States)

    Ordonez, Paula; Koriyama, Chihaya; Ding, Shan; Yoshiwara, Elena; Corvalan, Alejandro H; Takano, Juan; Chirinos, Jesus L; Watanabe, Jose; Miyagui, Juan; Hidalgo, Heriberto; Chacon, Pedro; Linares, Victor; Eizuru, Yoshito; Akiba, Suminori

    2011-10-01

    To clarify the reason for the low frequency of Epstein-Barr virus-associated gastric carcinoma (EBVaGC) in Peru, despite the high frequency reported in neighboring countries, the distribution of the distinctive EBV (type i/XhoI+) strain in EBVaGC and a healthy population was examined. EBV polymorphisms in BamHI W1/I1 and XhoI restriction site of the latent membrane protein 1 gene (LMP1) were examined among 11 EBVaGCs and 172 healthy controls from Peru, and these frequencies were compared with those in a previous study of Chile and Colombia (n=303). The frequency of the distinctive EBV strain in EBVaGCs (55%) was significantly higher than that in controls (7%). Furthermore, the frequency of this EBV type in Peruvian controls was significantly lower than that in controls from Chile and Colombia (27%, pPeru, as compared with neighboring countries.

  8. Ecological and phylogenetic influences on maxillary dentition in snakes

    Directory of Open Access Journals (Sweden)

    Kate Jackson

    2010-12-01

    Full Text Available The maxillary dentition of snakes was used as a system with which to investigate the relative importance of the interacting forces of ecological selective pressures and phylogenetic constraints indetermining morphology. The maxillary morphology of three groups of snakes having different diets, with each group comprising two distinct lineages — boids and colubroids — was examined. Our results suggest that dietary selective pressures may be more significantthan phylogenetic history in shaping maxillary morphology.

  9. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  10. Phylogenetic analysis reveals a high prevalence of Sporothrix brasiliensis in feline sporotrichosis outbreaks.

    Science.gov (United States)

    Rodrigues, Anderson Messias; de Melo Teixeira, Marcus; de Hoog, G Sybren; Schubach, Tânia Maria Pacheco; Pereira, Sandro Antonio; Fernandes, Geisa Ferreira; Bezerra, Leila Maria Lopes; Felipe, Maria Sueli; de Camargo, Zoilo Pires

    2013-01-01

    Sporothrix schenckii, previously assumed to be the sole agent of human and animal sporotrichosis, is in fact a species complex. Recently recognized taxa include S. brasiliensis, S. globosa, S. mexicana, and S. luriei, in addition to S. schenckii sensu stricto. Over the last decades, large epidemics of sporotrichosis occurred in Brazil due to zoonotic transmission, and cats were pointed out as key susceptible hosts. In order to understand the eco-epidemiology of feline sporotrichosis and its role in human sporotrichosis a survey was conducted among symptomatic cats. Prevalence and phylogenetic relationships among feline Sporothrix species were investigated by reconstructing their phylogenetic origin using the calmodulin (CAL) and the translation elongation factor-1 alpha (EF1α) loci in strains originated from Rio de Janeiro (RJ, n = 15), Rio Grande do Sul (RS, n = 10), Paraná (PR, n = 4), São Paulo (SP, n =3) and Minas Gerais (MG, n = 1). Our results showed that S. brasiliensis is highly prevalent among cats (96.9%) with sporotrichosis, while S. schenckii was identified only once. The genotype of Sporothrix from cats was found identical to S. brasiliensis from human sources confirming that the disease is transmitted by cats. Sporothrix brasiliensis presented low genetic diversity compared to its sister taxon S. schenckii. No evidence of recombination in S. brasiliensis was found by split decomposition or PHI-test analysis, suggesting that S. brasiliensis is a clonal species. Strains recovered in states SP, MG and PR share the genotype of the RJ outbreak, different from the RS clone. The occurrence of separate genotypes among strains indicated that the Brazilian S. brasiliensis epidemic has at least two distinct sources. We suggest that cats represent a major host and the main source of cat and human S. brasiliensis infections in Brazil.

  11. Whole genome sequencing as a tool for phylogenetic analysis of clinical strains of Mitis group streptococci

    DEFF Research Database (Denmark)

    Rasmusen, L. H.; Dargis, R.; Iversen, Katrine Højholt

    2016-01-01

    observed in single gene analyses. Species identification based on single gene analysis showed their limitations when more strains were included. In contrast, analyses incorporating more sequence data, like MLSA, SNPs and core-genome analyses, provided more distinct clustering. The core-genome tree showed......Identification of Mitis group streptococci (MGS) to the species level is challenging for routine microbiology laboratories. Correct identification is crucial for the diagnosis of infective endocarditis, identification of treatment failure, and/or infection relapse. Eighty MGS from Danish patients...

  12. The limitations of ontogenetic data in phylogenetic analyses

    NARCIS (Netherlands)

    Koenemann, Stefan; Schram, Frederick R.

    2002-01-01

    The analysis of consecutive ontogenetic stages, or events, introduces a new class of data to phylogenetic systematics that are distinctly different from traditional morphological characters and molecular sequence data. Ontogenetic event sequences are distinguished by varying degrees of both a

  13. Phylogenetic diversity analysis of Trichoderma species based on ...

    African Journals Online (AJOL)

    vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...

  14. Deciphering the recent phylogenetic expansion of the originally deeply rooted Mycobacterium tuberculosis lineage 7.

    Science.gov (United States)

    Yimer, Solomon A; Namouchi, Amine; Zegeye, Ephrem Debebe; Holm-Hansen, Carol; Norheim, Gunnstein; Abebe, Markos; Aseffa, Abraham; Tønjum, Tone

    2016-06-30

    A deeply rooted phylogenetic lineage of Mycobacterium tuberculosis (M. tuberculosis) termed lineage 7 was discovered in Ethiopia. Whole genome sequencing of 30 lineage 7 strains from patients in Ethiopia was performed. Intra-lineage genome variation was defined and unique characteristics identified with a focus on genes involved in DNA repair, recombination and replication (3R genes). More than 800 mutations specific to M. tuberculosis lineage 7 strains were identified. The proportion of non-synonymous single nucleotide polymorphisms (nsSNPs) in 3R genes was higher after the recent expansion of M. tuberculosis lineage 7 strain started. The proportion of nsSNPs in genes involved in inorganic ion transport and metabolism was significantly higher before the expansion began. A total of 22346 bp deletions were observed. Lineage 7 strains also exhibited a high number of mutations in genes involved in carbohydrate transport and metabolism, transcription, energy production and conversion. We have identified unique genomic signatures of the lineage 7 strains. The high frequency of nsSNP in 3R genes after the phylogenetic expansion may have contributed to recent variability and adaptation. The abundance of mutations in genes involved in inorganic ion transport and metabolism before the expansion period may indicate an adaptive response of lineage 7 strains to enable survival, potentially under environmental stress exposure. As lineage 7 strains originally were phylogenetically deeply rooted, this may indicate fundamental adaptive genomic pathways affecting the fitness of M. tuberculosis as a species.

  15. Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

    Science.gov (United States)

    Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

    2004-08-01

    Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

  16. Genetic Characterization of Spondweni and Zika Viruses and Susceptibility of Geographically Distinct Strains of Aedes aegypti, Aedes albopictus and Culex quinquefasciatus (Diptera: Culicidae to Spondweni Virus.

    Directory of Open Access Journals (Sweden)

    Andrew D Haddow

    2016-10-01

    Full Text Available Zika virus (ZIKV has extended its known geographic distribution to the New World and is now responsible for severe clinical complications in a subset of patients. While substantial genetic and vector susceptibility data exist for ZIKV, less is known for the closest related flavivirus, Spondweni virus (SPONV. Both ZIKV and SPONV have been known to circulate in Africa since the mid-1900s, but neither has been genetically characterized by gene and compared in parallel. Furthermore, the susceptibility of peridomestic mosquito species incriminated or suspected in the transmission of ZIKV to SPONV was unknown.In this study, two geographically distinct strains of SPONV were genetically characterized and compared to nine genetically and geographically distinct ZIKV strains. Additionally, the susceptibility of both SPONV strains was determined in three mosquito species. The open reading frame (ORF of the SPONV 1952 Nigerian Chuku strain, exhibited a nucleotide and amino acid identity of 97.8% and 99.2%, respectively, when compared to the SPONV 1954 prototype South African SA Ar 94 strain. The ORF of the SPONV Chuku strain exhibited a nucleotide and amino acid identity that ranged from 68.3% to 69.0% and 74.6% to 75.0%, respectively, when compared to nine geographically and genetically distinct strains of ZIKV. The ORF of the nine African and Asian lineage ZIKV strains exhibited limited nucleotide divergence. Aedes aegypti, Ae. albopictus and Culex quinquefasciatus susceptibility and dissemination was low or non-existent following artificial infectious blood feeding of moderate doses of both SPONV strains.SPONV and ZIKV nucleotide and amino acid divergence coupled with differences in geographic distribution, ecology and vector species support previous reports that these viruses are separate species. Furthermore, the low degree of SPONV infection or dissemination in Ae. albopictus, Ae. aegypti and Cx. quinquefasciatus following exposure to two

  17. Isolation of an H5N8 Highly Pathogenic Avian Influenza Virus Strain from Wild Birds in Seoul, a Highly Urbanized Area in South Korea.

    Science.gov (United States)

    Kwon, Jung-Hoon; Lee, Dong-Hun; Jeong, Jei-Hyun; Yuk, Seong-Su; Erdene-Ochir, Tseren-Ochir; Noh, Jin-Yong; Hong, Woo-Tack; Jeong, Sol; Gwon, Gyeong-Bin; Lee, Sang-Won; Choi, In-Soo; Song, Chang-Seon

    2017-07-01

    Asian-lineage H5 highly pathogenic avian influenza viruses (HPAIV) have caused recurrent outbreaks in poultry and wild birds. In January 2014, H5N8 HPAIV caused outbreaks in South Korea and subsequently spread to East Asia, Europe, and North America. We report the isolation of an H5N8 HPAIV strain from wild birds in Seoul, the most-developed city in South Korea. We analyzed the complete genome sequence of this isolate and estimated its origin using a phylogenetic analysis. The Seoul H5N8 isolate clustered phylogenetically with strains isolated from migratory wild birds but was distinct from Korean poultry isolates. This H5N8 virus was likely introduced into the urbanized city by migratory wild birds. Therefore, wild bird habitats in urbanized areas should be carefully monitored for HPAIV.

  18. Genetic Diversity of Tick-Borne Rickettsial Pathogens; Insights Gained from Distant Strains

    Directory of Open Access Journals (Sweden)

    Sebastián Aguilar Pierlé

    2014-01-01

    Full Text Available The ability to capture genetic variation with unprecedented resolution improves our understanding of bacterial populations and their ability to cause disease. The goal of the pathogenomics era is to define genetic diversity that results in disease. Despite the economic losses caused by vector-borne bacteria in the Order Rickettsiales, little is known about the genetic variants responsible for observed phenotypes. The tick-transmitted rickettsial pathogen Anaplasma marginale infects cattle in tropical and subtropical regions worldwide, including Australia. Genomic analysis of North American A. marginale strains reveals a closed core genome defined by high levels of Single Nucleotide Polymorphisms (SNPs. Here we report the first genome sequences and comparative analysis for Australian strains that differ in virulence and transmissibility. A list of genetic differences that segregate with phenotype was evaluated for the ability to distinguish the attenuated strain from virulent field strains. Phylogenetic analyses of the Australian strains revealed a marked evolutionary distance from all previously sequenced strains. SNP analysis showed a strikingly reduced genetic diversity between these strains, with the smallest number of SNPs detected between any two A. marginale strains. The low diversity between these phenotypically distinct bacteria presents a unique opportunity to identify the genetic determinants of virulence and transmission.

  19. Genetic characterization of L-Zagreb mumps vaccine strain.

    Science.gov (United States)

    Ivancic, Jelena; Gulija, Tanja Kosutic; Forcic, Dubravko; Baricevic, Marijana; Jug, Renata; Mesko-Prejac, Majda; Mazuran, Renata

    2005-04-01

    Eleven mumps vaccine strains, all containing live attenuated virus, have been used throughout the world. Although L-Zagreb mumps vaccine has been licensed since 1972, only its partial nucleotide sequence was previously determined (accession numbers , and ). Therefore, we sequenced the entire genome of L-Zagreb vaccine strain (Institute of Immunology Inc., Zagreb, Croatia). In order to investigate the genetic stability of the vaccine, sequences of both L-Zagreb master seed and currently produced vaccine batch were determined and no difference between them was observed. A phylogenetic analysis based on SH gene sequence has shown that L-Zagreb strain does not belong to any of established mumps genotypes and that it is most similar to old, laboratory preserved European strains (1950s-1970s). L-Zagreb nucleotide and deduced protein sequences were compared with other mumps virus sequences obtained from the GenBank. Emphasis was put on functionally important protein regions and known antigenic epitopes. The extensive comparisons of nucleotide and deduced protein sequences between L-Zagreb vaccine strain and other previously determined mumps virus sequences have shown that while the functional regions of HN, V, and L proteins are well conserved among various mumps strains, there can be a substantial amino acid difference in antigenic epitopes of all proteins and in functional regions of F protein. No molecular pattern was identified that can be used as a distinction marker between virulent and attenuated strains.

  20. Protein clustering and RNA phylogenetic reconstruction of the influenza A [corrected] virus NS1 protein allow an update in classification and identification of motif conservation.

    Science.gov (United States)

    Sevilla-Reyes, Edgar E; Chavaro-Pérez, David A; Piten-Isidro, Elvira; Gutiérrez-González, Luis H; Santos-Mendoza, Teresa

    2013-01-01

    The non-structural protein 1 (NS1) of influenza A virus (IAV), coded by its third most diverse gene, interacts with multiple molecules within infected cells. NS1 is involved in host immune response regulation and is a potential contributor to the virus host range. Early phylogenetic analyses using 50 sequences led to the classification of NS1 gene variants into groups (alleles) A and B. We reanalyzed NS1 diversity using 14,716 complete NS IAV sequences, downloaded from public databases, without host bias. Removal of sequence redundancy and further structured clustering at 96.8% amino acid similarity produced 415 clusters that enhanced our capability to detect distinct subgroups and lineages, which were assigned a numerical nomenclature. Maximum likelihood phylogenetic reconstruction using RNA sequences indicated the previously identified deep branching separating group A from group B, with five distinct subgroups within A as well as two and five lineages within the A4 and A5 subgroups, respectively. Our classification model proposes that sequence patterns in thirteen amino acid positions are sufficient to fit >99.9% of all currently available NS1 sequences into the A subgroups/lineages or the B group. This classification reduces host and virus bias through the prioritization of NS1 RNA phylogenetics over host or virus phenetics. We found significant sequence conservation within the subgroups and lineages with characteristic patterns of functional motifs, such as the differential binding of CPSF30 and crk/crkL or the availability of a C-terminal PDZ-binding motif. To understand selection pressures and evolution acting on NS1, it is necessary to organize the available data. This updated classification may help to clarify and organize the study of NS1 interactions and pathogenic differences and allow the drawing of further functional inferences on sequences in each group, subgroup and lineage rather than on a strain-by-strain basis.

  1. PhyTB: Phylogenetic tree visualisation and sample positioning for M. tuberculosis

    KAUST Repository

    Benavente, Ernest D

    2015-05-13

    Background Phylogenetic-based classification of M. tuberculosis and other bacterial genomes is a core analysis for studying evolutionary hypotheses, disease outbreaks and transmission events. Whole genome sequencing is providing new insights into the genomic variation underlying intra- and inter-strain diversity, thereby assisting with the classification and molecular barcoding of the bacteria. One roadblock to strain investigation is the lack of user-interactive solutions to interrogate and visualise variation within a phylogenetic tree setting. Results We have developed a web-based tool called PhyTB (http://pathogenseq.lshtm.ac.uk/phytblive/index.php webcite) to assist phylogenetic tree visualisation and identification of M. tuberculosis clade-informative polymorphism. Variant Call Format files can be uploaded to determine a sample position within the tree. A map view summarises the geographical distribution of alleles and strain-types. The utility of the PhyTB is demonstrated on sequence data from 1,601 M. tuberculosis isolates. Conclusion PhyTB contextualises M. tuberculosis genomic variation within epidemiological, geographical and phylogenic settings. Further tool utility is possible by incorporating large variants and phenotypic data (e.g. drug-resistance profiles), and an assessment of genotype-phenotype associations. Source code is available to develop similar websites for other organisms (http://sourceforge.net/projects/phylotrack webcite).

  2. Comparative genome analysis of VSP-II and SNPs reveals heterogenic variation in contemporary strains of Vibrio cholerae O1 isolated from cholera patients in Kolkata, India.

    Science.gov (United States)

    Imamura, Daisuke; Morita, Masatomo; Sekizuka, Tsuyoshi; Mizuno, Tamaki; Takemura, Taichiro; Yamashiro, Tetsu; Chowdhury, Goutam; Pazhani, Gururaja P; Mukhopadhyay, Asish K; Ramamurthy, Thandavarayan; Miyoshi, Shin-Ichi; Kuroda, Makoto; Shinoda, Sumio; Ohnishi, Makoto

    2017-02-01

    Cholera is an acute diarrheal disease and a major public health problem in many developing countries in Asia, Africa, and Latin America. Since the Bay of Bengal is considered the epicenter for the seventh cholera pandemic, it is important to understand the genetic dynamism of Vibrio cholerae from Kolkata, as a representative of the Bengal region. We analyzed whole genome sequence data of V. cholerae O1 isolated from cholera patients in Kolkata, India, from 2007 to 2014 and identified the heterogeneous genomic region in these strains. In addition, we carried out a phylogenetic analysis based on the whole genome single nucleotide polymorphisms to determine the genetic lineage of strains in Kolkata. This analysis revealed the heterogeneity of the Vibrio seventh pandemic island (VSP)-II in Kolkata strains. The ctxB genotype was also heterogeneous and was highly related to VSP-II types. In addition, phylogenetic analysis revealed the shifts in predominant strains in Kolkata. Two distinct lineages, 1 and 2, were found between 2007 and 2010. However, the proportion changed markedly in 2010 and lineage 2 strains were predominant thereafter. Lineage 2 can be divided into four sublineages, I, II, III and IV. The results of this study indicate that lineages 1 and 2-I were concurrently prevalent between 2007 and 2009, and lineage 2-III observed in 2010, followed by the predominance of lineage 2-IV in 2011 and continued until 2014. Our findings demonstrate that the epidemic of cholera in Kolkata was caused by several distinct strains that have been constantly changing within the genetic lineages of V. cholerae O1 in recent years.

  3. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  4. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  5. Diversity of Micromonospora strains from the deep Mediterranean Sea and their potential to produce bioactive compounds

    Directory of Open Access Journals (Sweden)

    Andrea Gärtner

    2016-06-01

    Full Text Available During studies on bacteria from the Eastern Mediterranean deep-sea, incubation under in situ conditions (salinity, temperature and pressure and heat treatment were used to selectively enrich representatives of Micromonospora. From sediments of the Ierapetra Basin (4400 m depth and the Herodotos Plain (2800 m depth, 21 isolates were identified as members of the genus Micromonospora. According to phylogenetic analysis of 16S rRNA gene sequences, the Micromonospora isolates could be assigned to 14 different phylotypes with an exclusion limit of ≥ 99.5% sequence similarity. They formed 7 phylogenetic clusters. Two of these clusters, which contain isolates obtained after enrichment under pressure incubation and phylogenetically are distinct from representative reference organism, could represent bacteria specifically adapted to the conditions in situ and to life in these deep-sea sediments. The majority of the Micromonospora isolates (90% contained at least one gene cluster for biosynthesis of secondary metabolites for non-ribosomal polypeptides and polyketides (polyketide synthases type I and type II. The determination of biological activities of culture extracts revealed that almost half of the strains produced substances inhibitory to the growth of Gram-positive bacteria. Chemical analyses of culture extracts demonstrated the presence of different metabolite profiles also in closely related strains. Therefore, deep-sea Micromonospora isolates are considered to have a large potential for the production of new antibiotic compounds.

  6. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Science.gov (United States)

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  7. Molecular Epidemiology and Phylogenetic Analyses of Influenza B Virus in Thailand during 2010 to 2014

    Science.gov (United States)

    Tewawong, Nipaporn; Suwannakarn, Kamol; Prachayangprecha, Slinporn; Korkong, Sumeth; Vichiwattana, Preeyaporn; Vongpunsawad, Sompong; Poovorawan, Yong

    2015-01-01

    Influenza B virus remains a major contributor to the seasonal influenza outbreak and its prevalence has increased worldwide. We investigated the epidemiology and analyzed the full genome sequences of influenza B virus strains in Thailand between 2010 and 2014. Samples from the upper respiratory tract were collected from patients diagnosed with influenza like-illness. All samples were screened for influenza A/B viruses by one-step multiplex real-time RT-PCR. The whole genome of 53 influenza B isolates were amplified, sequenced, and analyzed. From 14,418 respiratory samples collected during 2010 to 2014, a total of 3,050 tested positive for influenza virus. Approximately 3.27% (471/14,418) were influenza B virus samples. Fifty three isolates of influenza B virus were randomly chosen for detailed whole genome analysis. Phylogenetic analysis of the HA gene showed clusters in Victoria clades 1A, 1B, 3, 5 and Yamagata clades 2 and 3. Both B/Victoria and B/Yamagata lineages were found to co-circulate during this time. The NA sequences of all isolates belonged to lineage II and consisted of viruses from both HA Victoria and Yamagata lineages, reflecting possible reassortment of the HA and NA genes. No significant changes were seen in the NA protein. The phylogenetic trees generated through the analysis of the PB1 and PB2 genes closely resembled that of the HA gene, while trees generated from the analysis of the PA, NP, and M genes showed similar topology. The NS gene exhibited the pattern of genetic reassortment distinct from those of the PA, NP or M genes. Thus, antigenic drift and genetic reassortment among the influenza B virus strains were observed in the isolates examined. Our findings indicate that the co-circulation of two distinct lineages of influenza B viruses and the limitation of cross-protection of the current vaccine formulation provide support for quadrivalent influenza vaccine in this region. PMID:25602617

  8. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Genomic and phylogenetic evidence that Maize rough dwarf and Rice black-streaked dwarf fijiviruses should be classified as different geographic strains of a single species.

    Science.gov (United States)

    Xie, L; Lv, M-F; Yang, J; Chen, J-P; Zhang, H-M

    Maize rough dwarf disease (MRDD) has long been known as one of the most devastating viral diseases of maize worldwide and is caused by single or complex infection by four fijiviruses: Maize rough dwarf virus (MRDV) in Europe and the Middle East, Mal de Rio Cuarto virus (MRCV) in South America, rice black-streaked dwarf virus (RBSDV), and Southern rice black-streaked dwarf virus (SRBSDV or Rice black-streaked dwarf virus 2, RBSDV-2) in East Asia. These are currently classified as four distinct species in the genus Fijivirus, family Reoviridae, but their taxonomic status has been questioned. To help resolve this, the nucleotide sequences of the ten genomic segments of an Italian isolate of MRDV have been determined, providing the first complete genomic sequence of this virus. Its genome has 29144 nucleotides and is similar in organization to those of RBSDV, SRBSDV, and MRCV. The 13 ORFs always share highest identities (81.3-97.2%) with the corresponding ORFs of RBSDV and phylogenetic analyses of the different genome segments and ORFs all confirm that MRDV clusters most closely with RBSDV and that MRCV and SRBSDV are slightly more distantly related. The results suggest that MRDV and RBSDV should be classified as different geographic strains of the same virus species and we suggest the name cereal black-streaked dwarf fijivirus (CBSDV) for consideration.

  10. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Directory of Open Access Journals (Sweden)

    Nicolás Sarute

    Full Text Available Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  11. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Science.gov (United States)

    Sarute, Nicolás; Calderón, Marina Gallo; Pérez, Ruben; La Torre, José; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

    2013-01-01

    Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus) is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H) gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp) coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  12. An axenic culture system for fruiting body formation by an edible bolete phylogenetically related to culinary-medicinal penny bun mushroom, Boletus edulis Bull.:Fr. strains from China.

    Science.gov (United States)

    Fu, Shao Chun; Zhang, Mei Yan; Shang, Xiao Dong; Chen, Ming Jie; Tan, Qi

    2011-01-01

    The ability of two freshly isolated Boletus stains to fruit under axenic conditions was tested using different solid and liquid nutrient media. One strain (YNCX04) produced numerous primordia from which fruiting bodies, 12 mm and 10 mm in length, with grey, convex pilei, and yellow-white, clavate stipes developed between 15 and 30 d after inoculation of fungal mycelium onto a solid medium consisting of mineral salts, thiamine, glucose, potato, an extract of Cunninghamia lanceolata root, and agar. The other strain (YNB200) produced numerous primordia but no sporophores. Strain YNCX04 lost the ability to form fruiting bodies in axenic culture 6 mo after initial isolation but retained the ability to form primordia for up to 18 mo. Based on internal transcribed spacer sequencing data, strains YNB200 and YNCX04 formed a sub-cluster together with four previously designated Boletus edulis strains from China. Phylogenetic analysis placed the Chinese strains closer to B. aestivalis than to European and North American strains of B. edulis, although a 29-bp fragment specific to all the B. aestivalis strains was absent from all the Chinese strains. Furthermore, partial 18S rDNA sequences from strains YNB200 and YNCX04 exhibited 98% similarity with an 18S rDNA sequence from B. edulis strain Be3. Further molecular studies are indicated to more accurately establish the taxonomic positions ofF3 and F4-3, as well as the Chinese strains designated as B. edulis.

  13. Isolation and characterization of a new Pseudomonas-related strain ...

    African Journals Online (AJOL)

    % with Pseudomonas putida ()AB680847). The phylogenetic tree formed by 16S rDNA sequences from both strain SKDP-1 and its most related bacteria also proved strain SKDP-1 to be one member of the genus Pseudomonas. Strain SKDP-1 ...

  14. Visualizing differences in phylogenetic information content of alignments and distinction of three classes of long-branch effects

    Directory of Open Access Journals (Sweden)

    Mayer Christoph

    2007-08-01

    Full Text Available Abstract Background Published molecular phylogenies are usually based on data whose quality has not been explored prior to tree inference. This leads to errors because trees obtained with conventional methods suppress conflicting evidence, and because support values may be high even if there is no distinct phylogenetic signal. Tools that allow an a priori examination of data quality are rarely applied. Results Using data from published molecular analyses on the phylogeny of crustaceans it is shown that tree topologies and popular support values do not show existing differences in data quality. To visualize variations in signal distinctness, we use network analyses based on split decomposition and split support spectra. Both methods show the same differences in data quality and the same clade-supporting patterns. Both methods are useful to discover long-branch effects. We discern three classes of long branch effects. Class I effects consist of attraction of terminal taxa caused by symplesiomorphies, which results in a false monophyly of paraphyletic groups. Addition of carefully selected taxa can fix this effect. Class II effects are caused by drastic signal erosion. Long branches affected by this phenomenon usually slip down the tree to form false clades that in reality are polyphyletic. To recover the correct phylogeny, more conservative genes must be used. Class III effects consist of attraction due to accumulated chance similarities or convergent character states. This sort of noise can be reduced by selecting less variable portions of the data set, avoiding biases, and adding slower genes. Conclusion To increase confidence in molecular phylogenies an exploratory analysis of the signal to noise ratio can be conducted with split decomposition methods. If long-branch effects are detected, it is necessary to discern between three classes of effects to find the best approach for an improvement of the raw data.

  15. Genomic and Phylogenetic Characterization of Novel, Recombinant H5N2 Avian Influenza Virus Strains Isolated from Vaccinated Chickens with Clinical Symptoms in China

    Directory of Open Access Journals (Sweden)

    Huaiying Xu

    2015-02-01

    Full Text Available Infection of poultry with diverse lineages of H5N2 avian influenza viruses has been documented for over three decades in different parts of the world, with limited outbreaks caused by this highly pathogenic avian influenza virus. In the present study, three avian H5N2 influenza viruses, A/chicken/Shijiazhuang/1209/2013, A/chicken/Chiping/0321/2014, and A/chicken/Laiwu/0313/2014, were isolated from chickens with clinical symptoms of avian influenza. Complete genomic and phylogenetic analyses demonstrated that all three isolates are novel recombinant viruses with hemagglutinin (HA and matrix (M genes derived from H5N1, and remaining genes derived from H9N2-like viruses. The HA cleavage motif in all three strains (PQIEGRRRKR/GL is characteristic of a highly pathogenic avian influenza virus strain. These results indicate the occurrence of H5N2 recombination and highlight the importance of continued surveillance of the H5N2 subtype virus and reformulation of vaccine strains.

  16. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  17. Genotypic homogeneity of multidrug resistant S. Typhimurium infecting distinct adult and childhood susceptibility groups in Blantyre, Malawi.

    Directory of Open Access Journals (Sweden)

    Chisomo L Msefula

    Full Text Available Nontyphoidal Salmonella (NTS serovars are a common cause of bacteraemia in young children and HIV-infected adults in Malawi and elsewhere in sub-Saharan Africa. These patient populations provide diverse host-immune environments that have the potential to drive bacterial adaptation and evolution. We therefore investigated the diversity of 27 multidrug resistant (MDR Salmonella Typhimurium strains isolated over 6 years (2002-2008 from HIV-infected adults and children and HIV-uninfected children. Sequence reads from whole-genome sequencing of these isolates using the Illumina GA platform were mapped to the genome of the laboratory strain S. Typhimurium SL1344 excluding homoplastic regions that contained prophage and insertion elements. A phylogenetic tree generated from single nucleotide polymorphisms showed that all 27 strains clustered with the prototypical MDR strain D23580. There was no clustering of strains based on host HIV status or age, suggesting that these susceptible populations acquire S. Typhimurium from common sources or that isolates are transmitted freely between these populations. However, 7/14 of the most recent isolates (2006/2008 formed a distinct clade that branched off 22 SNPs away from the cluster containing earlier isolates. These data suggest that the MDR bacterial population is not static, but is undergoing microevolution which might result in further epidemiology change.

  18. Implementation of a National Measles Elimination Program in Iran: Phylogenetic Analysis of Measles Virus Strains Isolated during 2010–2012 Outbreaks

    Science.gov (United States)

    Salimi, Vahid; Abbasi, Simin; Zahraei, Seyed Mohsen; Fatemi-Nasab, Ghazal; Adjaminezhad-Fard, Fatemeh; Shadab, Azadeh; Ghavami, Nastaran; Zareh-Khoshchehre, Raziyeh; Soltanshahi, Rambod; Bont, Louis; Mokhtari-Azad, Talat

    2014-01-01

    Measles virus (MV) causes small and large outbreaks in Iran. Molecular assays allow identifying and the sources of measles imported from neighboring countries. We carried out a phylogenetic analysis of measles virus circulating in Iran over the period 2010–2012. Specimens from suspected cases of measles were collected from different regions of Iran. Virus isolation was performed on urine and throat swabs. Partial nucleoprotein gene segments of MV were amplified by RT-PCR. PCR products of 173 samples were sequenced and analyzed. The median age of confirmed cases was 2 years. Among all confirmed cases, 32% had unknown vaccination status, 20% had been vaccinated, and 48% had not been vaccinated. Genotypes B3 and D8 (for the first time), H1 and D4 were detected mainly in unvaccinated toddlers and young children. Genotype B3 became predominant in 2012 and was closely related to African strains. H1 strains were also found in small and large outbreaks during 2012 but were not identical to Iranian H1-2009 strains. A majority of the Iranian D4 strains during 2010–2012 outbreaks were linked to the D4 strain identified in the Pakistan in 2007. We identified a single case in 2010 belonging to D8 genotype with 99.7% identity to Indian isolates. Although the vaccination program is currently good enough to prevent nationwide epidemics and successfully decreased measles incidence in Iran, the fraction of protected individuals in the population was not high enough to prevent continuous introduction of cases from abroad. Due to increasing number of susceptible individuals in some areas, sustained transmission of the newly introduced viral genotype remains possible. PMID:24736720

  19. Distinctive mitochondrial genome of Calanoid copepod Calanus sinicus with multiple large non-coding regions and reshuffled gene order: Useful molecular markers for phylogenetic and population studies

    Science.gov (United States)

    2011-01-01

    Background Copepods are highly diverse and abundant, resulting in extensive ecological radiation in marine ecosystems. Calanus sinicus dominates continental shelf waters in the northwest Pacific Ocean and plays an important role in the local ecosystem by linking primary production to higher trophic levels. A lack of effective molecular markers has hindered phylogenetic and population genetic studies concerning copepods. As they are genome-level informative, mitochondrial DNA sequences can be used as markers for population genetic studies and phylogenetic studies. Results The mitochondrial genome of C. sinicus is distinct from other arthropods owing to the concurrence of multiple non-coding regions and a reshuffled gene arrangement. Further particularities in the mitogenome of C. sinicus include low A + T-content, symmetrical nucleotide composition between strands, abbreviated stop codons for several PCGs and extended lengths of the genes atp6 and atp8 relative to other copepods. The monophyletic Copepoda should be placed within the Vericrustacea. The close affinity between Cyclopoida and Poecilostomatoida suggests reassigning the latter as subordinate to the former. Monophyly of Maxillopoda is rejected. Within the alignment of 11 C. sinicus mitogenomes, there are 397 variable sites harbouring three 'hotspot' variable sites and three microsatellite loci. Conclusion The occurrence of the circular subgenomic fragment during laboratory assays suggests that special caution should be taken when sequencing mitogenomes using long PCR. Such a phenomenon may provide additional evidence of mitochondrial DNA recombination, which appears to have been a prerequisite for shaping the present mitochondrial profile of C. sinicus during its evolution. The lack of synapomorphic gene arrangements among copepods has cast doubt on the utility of gene order as a useful molecular marker for deep phylogenetic analysis. However, mitochondrial genomic sequences have been valuable markers for

  20. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  1. Incorporating phylogenetic information for the definition of floristic districts in hyperdiverse Amazon forests: Implications for conservation

    OpenAIRE

    Guevara Andino, Juan Ernesto; Pitman, Nigel C. A.; ter Steege, Hans; Mogollón, Hugo; Ceron, Carlos; Palacios, Walter; Oleas, Nora; Fine, Paul V. A.

    2017-01-01

    Abstract Using complementary metrics to evaluate phylogenetic diversity can facilitate the delimitation of floristic units and conservation priority areas. In this study, we describe the spatial patterns of phylogenetic alpha and beta diversity, phylogenetic endemism, and evolutionary distinctiveness of the hyperdiverse Ecuador Amazon forests and define priority areas for conservation. We established a network of 62 one‐hectare plots in terra firme forests of Ecuadorian Amazon. In these plots...

  2. Comparative genomics of 12 strains of Erwinia amylovora identifies a pan-genome with a large conserved core.

    Directory of Open Access Journals (Sweden)

    Rachel A Mann

    Full Text Available The plant pathogen Erwinia amylovora can be divided into two host-specific groupings; strains infecting a broad range of hosts within the Rosaceae subfamily Spiraeoideae (e.g., Malus, Pyrus, Crataegus, Sorbus and strains infecting Rubus (raspberries and blackberries. Comparative genomic analysis of 12 strains representing distinct populations (e.g., geographic, temporal, host origin of E. amylovora was used to describe the pan-genome of this major pathogen. The pan-genome contains 5751 coding sequences and is highly conserved relative to other phytopathogenic bacteria comprising on average 89% conserved, core genes. The chromosomes of Spiraeoideae-infecting strains were highly homogeneous, while greater genetic diversity was observed between Spiraeoideae- and Rubus-infecting strains (and among individual Rubus-infecting strains, the majority of which was attributed to variable genomic islands. Based on genomic distance scores and phylogenetic analysis, the Rubus-infecting strain ATCC BAA-2158 was genetically more closely related to the Spiraeoideae-infecting strains of E. amylovora than it was to the other Rubus-infecting strains. Analysis of the accessory genomes of Spiraeoideae- and Rubus-infecting strains has identified putative host-specific determinants including variation in the effector protein HopX1(Ea and a putative secondary metabolite pathway only present in Rubus-infecting strains.

  3. Characterization of two recent Japanese field isolates of canine distemper virus and examination of the avirulent strain utility as an attenuated vaccine.

    Science.gov (United States)

    Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko

    2014-12-05

    Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Geographic and habitat partitioning of genetically distinct zooxanthellae (Symbiodinium) in Acropora corals on the Great Barrier Reef.

    Science.gov (United States)

    Ulstrup, K E; Van Oppen, M J H

    2003-12-01

    Intra- and intercolony diversity and distribution of zooxanthellae in acroporid corals is largely uncharted. In this study, two molecular methods were applied to determine the distribution of zooxanthellae in the branching corals Acropora tenuis and A. valida at several reef locations in the central section of the Great Barrier Reef. Sun-exposed and shaded parts of all colonies were examined. Single-stranded conformational polymorphism analysis showed that individual colonies of A. tenuis at two locations harbour two strains of Symbiodinium belonging to clade C (C1 and C2), whereas conspecific colonies at two other reefs harboured a single zooxanthella strain. A. valida was found to simultaneously harbour strains belonging to two distinct phylogenetic clades (C and D) at all locations sampled. A novel method with improved sensitivity (quantitative polymerase chain reaction using Taqman fluorogenic probes) was used to map the relative abundance distribution of the two zooxanthella clades. At two of the five sampling locations both coral species were collected. At these two locations, composition of the zooxanthella communities showed the same pattern in both coral species, i.e. correlation with ambient light in Pioneer Bay and an absence thereof in Nelly Bay. The results show that the distribution of genetically distinct zooxanthellae is correlated with light regime and possibly temperature in some (but not all) colonies of A. tenuis and A. valida and at some reef locations, which we interpret as acclimation to local environmental conditions.

  5. Comparative genomics identifies distinct lineages of S. Enteritidis from Queensland, Australia.

    Science.gov (United States)

    Graham, Rikki M A; Hiley, Lester; Rathnayake, Irani U; Jennison, Amy V

    2018-01-01

    Salmonella enterica is a major cause of gastroenteritis and foodborne illness in Australia where notification rates in the state of Queensland are the highest in the country. S. Enteritidis is among the five most common serotypes reported in Queensland and it is a priority for epidemiological surveillance due to concerns regarding its emergence in Australia. Using whole genome sequencing, we have analysed the genomic epidemiology of 217 S. Enteritidis isolates from Queensland, and observed that they fall into three distinct clades, which we have differentiated as Clades A, B and C. Phage types and MLST sequence types differed between the clades and comparative genomic analysis has shown that each has a unique profile of prophage and genomic islands. Several of the phage regions present in the S. Enteritidis reference strain P125109 were absent in Clades A and C, and these clades also had difference in the presence of pathogenicity islands, containing complete SPI-6 and SPI-19 regions, while P125109 does not. Antimicrobial resistance markers were found in 39 isolates, all but one of which belonged to Clade B. Phylogenetic analysis of the Queensland isolates in the context of 170 international strains showed that Queensland Clade B isolates group together with the previously identified global clade, while the other two clades are distinct and appear largely restricted to Australia. Locally sourced environmental isolates included in this analysis all belonged to Clades A and C, which is consistent with the theory that these clades are a source of locally acquired infection, while Clade B isolates are mostly travel related.

  6. Rabbit haemorrhagic disease virus 2 (RHDV2) outbreak in Azores: Disclosure of common genetic markers and phylogenetic segregation within the European strains.

    Science.gov (United States)

    Duarte, Margarida; Carvalho, Carina; Bernardo, Susana; Barros, Sílvia Vanessa; Benevides, Sandra; Flor, Lídia; Monteiro, Madalena; Marques, Isabel; Henriques, Margarida; Barros, Sílvia C; Fagulha, Teresa; Ramos, Fernanda; Luís, Tiago; Fevereiro, Miguel

    2015-10-01

    Rabbit haemorrhagic disease virus 2 (RHDV2) is widespread in several countries of Western Europe, but it has not been introduced to other continents. However, between late 2014 and early 2015, the presence of RHDV2 was confirmed outside of the European continent, in the Azores, initially in the islands of Graciosa, Flores, S. Jorge and Terceira. In this study we report the subsequent detection of RHDV2 in wild rabbits from the islands of Faial, St. Maria and S. Miguel, and display the necropsy and microscopic examination data obtained, which showed lesions similar to those induced by classical strains of RHDV, with severe affection of lungs and liver. We also disclose the result of a genetic investigation carried out with RHDV2 positive samples from wild rabbits found dead in the seven islands. Partial vp60 sequences were amplified from 27 tissue samples. Nucleotide analysis showed that the Azorean strains are closely related to each other, sharing a high genetic identity (>99.15%). None of the obtained sequences were identical to any RHDV2 sequence publically known, hampering a clue for the source of the outbreaks. However, Bayesian and maximum likelihood phylogenetic analyses disclosed that Azorean strains are more closely related to a few strains from Southern Portugal than with any others presently known. In the analysed region comprising the terminal 942 nucleotides of the vp60 gene, four new single nucleotide polymorphisms (SNP) were identified. Based on the present data, these four SNPs, which are unique in the strains from Azores, may constitute putative molecular geographic markers for Azorean RHDV2 strains, if they persist in the future. One of these variations is a non-synonymous substitution that involves the replacement of one amino acid in a hypervariable region of the capsid protein. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. A comparative test of phylogenetic diversity indices.

    Science.gov (United States)

    Schweiger, Oliver; Klotz, Stefan; Durka, Walter; Kühn, Ingolf

    2008-09-01

    Traditional measures of biodiversity, such as species richness, usually treat species as being equal. As this is obviously not the case, measuring diversity in terms of features accumulated over evolutionary history provides additional value to theoretical and applied ecology. Several phylogenetic diversity indices exist, but their behaviour has not yet been tested in a comparative framework. We provide a test of ten commonly used phylogenetic diversity indices based on 40 simulated phylogenies of varying topology. We restrict our analysis to a topological fully resolved tree without information on branch lengths and species lists with presence-absence data. A total of 38,000 artificial communities varying in species richness covering 5-95% of the phylogenies were created by random resampling. The indices were evaluated based on their ability to meet a priori defined requirements. No index meets all requirements, but three indices turned out to be more suitable than others under particular conditions. Average taxonomic distinctness (AvTD) and intensive quadratic entropy (J) are calculated by averaging and are, therefore, unbiased by species richness while reflecting phylogeny per se well. However, averaging leads to the violation of set monotonicity, which requires that species extinction cannot increase the index. Total taxonomic distinctness (TTD) sums up distinctiveness values for particular species across the community. It is therefore strongly linked to species richness and reflects phylogeny per se weakly but satisfies set monotonicity. We suggest that AvTD and J are best applied to studies that compare spatially or temporally rather independent communities that potentially vary strongly in their phylogenetic composition-i.e. where set monotonicity is a more negligible issue, but independence of species richness is desired. In contrast, we suggest that TTD be used in studies that compare rather interdependent communities where changes occur more gradually by

  8. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. Phenotypic and genetic diversity of chlorine-resistant Methylobacterium strains isolated from various environments.

    Science.gov (United States)

    Hiraishi, A; Furuhata, K; Matsumoto, A; Koike, K A; Fukuyama, M; Tabuchi, K

    1995-01-01

    Strains of pink-pigmented facultative methylotrophs which were isolated previously from various environments and assigned tentatively to the genus Methylobacterium were characterized in comparison with authentic strains of previously known species of this genus. Most of the isolates derived from chlorinated water supplies exhibited resistance to chlorine, whereas 29 to 40% of the isolates from air, natural aquatic environments, and clinical materials were chlorine resistant. None of the tested authentic strains of Methylobacterium species obtained from culture collections exhibited chlorine resistance. Numerical analysis of phenotypic profiles showed that the test organisms tested were separated from each other except M. organophilum and M. rhodesianum. The chlorine-resistant isolates were randomly distributed among all clusters. The 16S ribosomal DNA (rDNA) sequence-based phylogenetic analyses showed that representatives of the isolates together with known Methylobacterium species formed a line of descent distinct from that of members of related genera in the alpha-2 subclass of the Proteobacteria and were divided into three subclusters within the Methylobacterium group. These results demonstrate that there is phenotypic and genetic diversity among chlorine-resistant Methylobacterium strains within the genus. PMID:7793931

  10. Phenotypic and genetic diversity of chlorine-resistant Methylobacterium strains isolated from various environments.

    Science.gov (United States)

    Hiraishi, A; Furuhata, K; Matsumoto, A; Koike, K A; Fukuyama, M; Tabuchi, K

    1995-06-01

    Strains of pink-pigmented facultative methylotrophs which were isolated previously from various environments and assigned tentatively to the genus Methylobacterium were characterized in comparison with authentic strains of previously known species of this genus. Most of the isolates derived from chlorinated water supplies exhibited resistance to chlorine, whereas 29 to 40% of the isolates from air, natural aquatic environments, and clinical materials were chlorine resistant. None of the tested authentic strains of Methylobacterium species obtained from culture collections exhibited chlorine resistance. Numerical analysis of phenotypic profiles showed that the test organisms tested were separated from each other except M. organophilum and M. rhodesianum. The chlorine-resistant isolates were randomly distributed among all clusters. The 16S ribosomal DNA (rDNA) sequence-based phylogenetic analyses showed that representatives of the isolates together with known Methylobacterium species formed a line of descent distinct from that of members of related genera in the alpha-2 subclass of the Proteobacteria and were divided into three subclusters within the Methylobacterium group. These results demonstrate that there is phenotypic and genetic diversity among chlorine-resistant Methylobacterium strains within the genus.

  11. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  12. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  13. Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from breeding foxes, raccoon dogs and minks in China.

    Science.gov (United States)

    Zhao, Jian-Jun; Yan, Xi-Jun; Chai, Xiu-Li; Martella, Vito; Luo, Guo-Liang; Zhang, Hai-Ling; Gao, Han; Liu, Ying-Xue; Bai, Xue; Zhang, Lei; Chen, Tao; Xu, Lei; Zhao, Chun-Fei; Wang, Feng-Xue; Shao, Xi-Qun; Wu, Wei; Cheng, Shi-Peng

    2010-01-06

    Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. Genetic/antigenic heterogeneity has been observed among the various CDV strains, notably in the haemagglutinin (H) gene, that appears as a good target to gather epidemiological information. Based on sequence analysis of the H gene, wild-type CDV strains cluster into distinct geographic lineages (genotypes), irrespective of the species of isolation. The sequence of the H gene of 28 CDV strains detected from both vaccinated and non-vaccinated breeding foxes, raccoon dogs and minks from different geographical areas of China during the years 2004-2008 was determined. All the CDV strains but two (strains HL and HLJ2) were characterized as Asia-1 genotype and were highly similar to each other (96.2-99.7% at the amino acid [aa] level) and to other Asia-1 strains (96.1-99.5% aa) previously detected in China. The CDV strains HL and HLJ2 were both collected from foxes in Heilongjiang province in 2005. Strain HL resembled CDVs of the Arctic genotype (GR88-like) and displayed high aa identity (98.0%) to the Chinese canine strain Liu. By converse, strain HLJ2 was barely related to CDVs of the Asia-2 genotype (88.7-90.3% aa identity), and could represent a novel CDV genotype, tentatively proposed as Asia-3. These results suggest that at least three different CDV genotypes, distantly related (81.8-91.6% aa identity) to the vaccine strains, Onderstepoort-like (America-1 genotype), are currently circulating in breeding foxes, raccoon dogs and minks in China, and that the genotype Asia-1 is predominant. Whether the diversity between wild-type CDVs and the vaccine strains may affect, to some extent, the efficacy of the vaccines deserves further investigations.

  14. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  15. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  16. Using tree diversity to compare phylogenetic heuristics.

    Science.gov (United States)

    Sul, Seung-Jin; Matthews, Suzanne; Williams, Tiffani L

    2009-04-29

    Evolutionary trees are family trees that represent the relationships between a group of organisms. Phylogenetic heuristics are used to search stochastically for the best-scoring trees in tree space. Given that better tree scores are believed to be better approximations of the true phylogeny, traditional evaluation techniques have used tree scores to determine the heuristics that find the best scores in the fastest time. We develop new techniques to evaluate phylogenetic heuristics based on both tree scores and topologies to compare Pauprat and Rec-I-DCM3, two popular Maximum Parsimony search algorithms. Our results show that although Pauprat and Rec-I-DCM3 find the trees with the same best scores, topologically these trees are quite different. Furthermore, the Rec-I-DCM3 trees cluster distinctly from the Pauprat trees. In addition to our heatmap visualizations of using parsimony scores and the Robinson-Foulds distance to compare best-scoring trees found by the two heuristics, we also develop entropy-based methods to show the diversity of the trees found. Overall, Pauprat identifies more diverse trees than Rec-I-DCM3. Overall, our work shows that there is value to comparing heuristics beyond the parsimony scores that they find. Pauprat is a slower heuristic than Rec-I-DCM3. However, our work shows that there is tremendous value in using Pauprat to reconstruct trees-especially since it finds identical scoring but topologically distinct trees. Hence, instead of discounting Pauprat, effort should go in improving its implementation. Ultimately, improved performance measures lead to better phylogenetic heuristics and will result in better approximations of the true evolutionary history of the organisms of interest.

  17. Comparative genomics analysis of Streptococcus agalactiae reveals that isolates from cultured tilapia in China are closely related to the human strain A909.

    Science.gov (United States)

    Liu, Guangjin; Zhang, Wei; Lu, Chengping

    2013-11-11

    Streptococcus agalactiae, also referred to as Group B Streptococcus (GBS), is a frequent resident of the rectovaginal tract in humans, and a major cause of neonatal infection. In addition, S. agalactiae is a known fish pathogen, which compromises food safety and represents a zoonotic hazard. The complete genome sequence of the piscine S. agalactiae isolate GD201008-001 was compared with 14 other piscine, human and bovine strains to explore their virulence determinants, evolutionary relationships and the genetic basis of host tropism in S. agalactiae. The pan-genome of S. agalactiae is open and its size increases with the addition of newly sequenced genomes. The core genes shared by all isolates account for 50 ~ 70% of any single genome. The Chinese piscine isolates GD201008-001 and ZQ0910 are phylogenetically distinct from the Latin American piscine isolates SA20-06 and STIR-CD-17, but are closely related to the human strain A909, in the context of the clustered regularly interspaced short palindromic repeats (CRISPRs), prophage, virulence-associated genes and phylogenetic relationships. We identified a unique 10 kb gene locus in Chinese piscine strains. Isolates from cultured tilapia in China have a close genomic relationship with the human strain A909. Our findings provide insight into the pathogenesis and host-associated genome content of piscine S. agalactiae isolated in China.

  18. Vibrio cholerae classical biotype strains reveal distinct signatures in Mexico.

    Science.gov (United States)

    Alam, Munirul; Islam, M Tarequl; Rashed, Shah Manzur; Johura, Fatema-tuz; Bhuiyan, Nurul A; Delgado, Gabriela; Morales, Rosario; Mendez, Jose Luis; Navarro, Armando; Watanabe, Haruo; Hasan, Nur-A; Colwell, Rita R; Cravioto, Alejandro

    2012-07-01

    Vibrio cholerae O1 classical (CL) biotype caused the fifth and sixth pandemics, and probably the earlier cholera pandemics, before the El Tor (ET) biotype initiated the seventh pandemic in Asia in the 1970s by completely displacing the CL biotype. Although the CL biotype was thought to be extinct in Asia and although it had never been reported from Latin America, V. cholerae CL and ET biotypes, including a hybrid ET, were found associated with areas of cholera endemicity in Mexico between 1991 and 1997. In this study, CL biotype strains isolated from areas of cholera endemicity in Mexico between 1983 and 1997 were characterized in terms of major phenotypic and genetic traits and compared with CL biotype strains isolated in Bangladesh between 1962 and 1989. According to sero- and biotyping data, all V. cholerae strains tested had the major phenotypic and genotypic characteristics specific for the CL biotype. Antibiograms revealed the majority of the Bangladeshi strains to be resistant to trimethoprim-sulfamethoxazole, furazolidone, ampicillin, and gentamicin, while the Mexican strains were sensitive to all of these drugs, as well as to ciprofloxacin, erythromycin, and tetracycline. Pulsed-field gel electrophoresis (PFGE) of NotI-digested genomic DNA revealed characteristic banding patterns for all of the CL biotype strains although the Mexican strains differed from the Bangladeshi strains in 1 to 2 DNA bands. The difference was subtle but consistent, as confirmed by the subclustering patterns in the PFGE-based dendrogram, and can serve as a regional signature, suggesting the pre-1991 existence and evolution of the CL biotype strains in the Americas, independent from Asia.

  19. Multiple gene analyses identify distinct “bois noir” phytoplasma genotypes in the Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Emilija KOSTADINOVSKA

    2015-01-01

    Full Text Available “Bois noir” (BN is a grapevine yellows disease, associated with phytoplasma strains related to ‘Candidatus Phytoplasma solani’, that causes severe losses to viticulture in the Euro-Mediterranean basin. Due to the complex ecological cycle of its etiological agent, BN epidemiology is only partially known, and no effective control strategies have been developed. Numerous studies have focused on molecular characterization of BN phytoplasma strains, to identify molecular markers useful to accurately describe their genetic diversity, geographic distribution and host range. In the present study, a multiple gene analysess were carried out on 16S rRNA, tuf, vmp1, and stamp genes to study the genetic variability among 18 BN phytoplasma strains detected in diverse regions of the Republic of Macedonia. Restriction fragment length polymorphism (RFLP assays showed the presence of one 16S rRNA (16SrXII-A, two tuf (tuf-type a, tuf-type b, five vmp1 (V2-TA, V3, V4, V14, V18, and three stamp (S1, S2, S3 gene patterns among the examined strains. Based on the collective RFLP patterns, seven genotypes (Mac1 to Mac7 were described as evidence for genetic heterogeneity, and highlighting their prevalence and distribution in the investigated regions. Phylogenetic analyses on vmp1 and stamp genes underlined the affiliation of Macedonian BN phytoplasma strains to clusters associated with distinct ecologies.

  20. Occurrence and characterization of plum pox virus strain D isolates from European Russia and Crimea.

    Science.gov (United States)

    Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna; Kudryavtseva, Anna; Prikhodko, Yuri; Mitrofanova, Irina

    2016-02-01

    Numerous plum pox virus (PPV) strain D isolates have been found in geographically distant regions of European Russia and the Crimean peninsula on different stone fruit hosts. Phylogenetic analysis of their partial and complete genomes suggests multiple introductions of PPV-D into Russia. Distinct natural isolates from Prunus tomentosa were found to bear unique amino acid substitutions in the N-terminus of the coat protein (CP) that may contribute to the adaptation of PPV-D to this host. Serological analysis using the PPV-D-specific monoclonal antibody 4DG5 provided further evidence that mutations at positions 58 and 59 of the CP are crucial for antibody binding.

  1. Short beak and dwarfism syndrome of mule duck is caused by a distinct lineage of goose parvovirus.

    Science.gov (United States)

    Palya, Vilmos; Zolnai, Anna; Benyeda, Zsófia; Kovács, Edit; Kardi, Veronika; Mató, Tamás

    2009-04-01

    From the early 1970s to the present, numerous cases of short beak and dwarfism syndrome (SBDS) have been reported in mule ducks from France. The animals showed strong growth retardation with smaller beak and tarsus. It was suggested that the syndrome was caused by goose parvovirus on the basis of serological investigation, but the causative agent has not been isolated and the disease has not so far been reproduced by experimental infection. The aim of the present study was to characterize the virus strains isolated from field cases of SBDS, and to reproduce the disease experimentally. Phylogenetic analysis proved that the parvovirus isolates obtained from SBDS of mule duck belonged to a distinct lineage of goose parvovirus-related group of waterfowl parvoviruses. The authors carried out experimental infections of 1-day-old, 2-week-old and 3-week-old mule ducks by the oral route with three different parvovirus strains: strain D17/99 of goose parvovirus from Derzsy's disease, strain FM of Muscovy duck parvovirus from the parvovirus disease of Muscovy ducks, and strain D176/02 isolated from SBDS of mule duck. The symptoms of SBDS of the mule duck could only be reproduced with the mule duck isolate (strain D176/02) following 1-day-old inoculation. Infection with a genetically different strain of goose parvovirus isolated from classical Derzsy's disease (D17/99) or with the Muscovy duck parvovirus strain (FM) did not cause any clinical symptoms or pathological lesions in mule ducks.

  2. Polyphasic taxonomic analysis establishes Mycobacterium indicus pranii as a distinct species.

    Directory of Open Access Journals (Sweden)

    Vikram Saini

    Full Text Available BACKGROUND: Mycobacterium indicus pranii (MIP, popularly known as Mw, is a cultivable, non-pathogenic organism, which, based on its growth and metabolic properties, is classified in Runyon Group IV along with M. fortuitum, M. smegmatis and M. vaccae. The novelty of this bacterium was accredited to its immunological ability to undergo antigen driven blast transformation of leukocytes and delayed hypersensitivity skin test in leprosy patients, a disease endemic in the Indian sub-continent. Consequently, MIP has been extensively evaluated for its biochemical and immunological properties leading to its usage as an immunomodulator in leprosy and tuberculosis patients. However, owing to advances in sequencing and culture techniques, the citing of new strains with almost 100% similarity in the sequences of marker genes like 16S rRNA, has compromised the identity of MIP as a novel species. Hence, to define its precise taxonomic position, we have carried out polyphasic taxonomic studies on MIP that integrate its phenotypic, chemotaxonomic and molecular phylogenetic attributes. METHODOLOGY/PRINCIPAL FINDINGS: The comparative analysis of 16S rRNA sequence of MIP by using BLAST algorithm at NCBI (nr database revealed a similarity of > or =99% with M. intracellulare, M. arosiense, M. chimaera, M. seoulense, M. avium subsp. hominissuis, M. avium subsp. paratuberculosis and M. bohemicum. Further analysis with other widely used markers like rpoB and hsp65 could resolve the phylogenetic relationship between MIP and other closely related mycobacteria apart from M. intracellulare and M. chimaera, which shares > or =99% similarity with corresponding MIP orthologues. Molecular phylogenetic analysis, based on the concatenation of candidate orthologues of 16S rRNA, hsp65 and rpoB, also substantiated its distinctiveness from all the related organisms used in the analysis excluding M. intracellulare and M. chimaera with which it exhibited a close proximity. This

  3. Antimicrobial properties of Pseudomonas strains producing the antibiotic mupirocin.

    Science.gov (United States)

    Matthijs, Sandra; Vander Wauven, Corinne; Cornu, Bertrand; Ye, Lumeng; Cornelis, Pierre; Thomas, Christopher M; Ongena, Marc

    2014-10-01

    Mupirocin is a polyketide antibiotic with broad antibacterial activity. It was isolated and characterized about 40 years ago from Pseudomonas fluorescens NCIMB 10586. To study the phylogenetic distribution of mupirocin producing strains in the genus Pseudomonas a large collection of Pseudomonas strains of worldwide origin, consisting of 117 Pseudomonas type strains and 461 strains isolated from different biological origins, was screened by PCR for the mmpD gene of the mupirocin gene cluster. Five mmpD(+) strains from different geographic and biological origin were identified. They all produced mupirocin and were strongly antagonistic against Staphylococcus aureus. Phylogenetic analysis showed that mupirocin production is limited to a single species. Inactivation of mupirocin production leads to complete loss of in vitro antagonism against S. aureus, except on certain iron-reduced media where the siderophore pyoverdine is responsible for the in vitro antagonism of a mupirocin-negative mutant. In addition to mupirocin some of the strains produced lipopeptides of the massetolide group. These lipopeptides do not play a role in the observed in vitro antagonism of the mupirocin producing strains against S. aureus. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  4. Phylogenetic diversity of bacteria associated with toxic and non-toxic ...

    African Journals Online (AJOL)

    Phylogenetic diversity of bacteria associated with toxic and non-toxic strains of Alexandrium minutum. L Palacios, B Reguera, J Franco, I Marín. Abstract. Marine planktonic dinoflagellates are usually associated with bacteria, some of which seem to have a symbiotic relation with the dinoflagellate cells. The role of bacteria in ...

  5. TreeScaper: Visualizing and Extracting Phylogenetic Signal from Sets of Trees.

    Science.gov (United States)

    Huang, Wen; Zhou, Guifang; Marchand, Melissa; Ash, Jeremy R; Morris, David; Van Dooren, Paul; Brown, Jeremy M; Gallivan, Kyle A; Wilgenbusch, Jim C

    2016-12-01

    Modern phylogenomic analyses often result in large collections of phylogenetic trees representing uncertainty in individual gene trees, variation across genes, or both. Extracting phylogenetic signal from these tree sets can be challenging, as they are difficult to visualize, explore, and quantify. To overcome some of these challenges, we have developed TreeScaper, an application for tree set visualization as well as the identification of distinct phylogenetic signals. GUI and command-line versions of TreeScaper and a manual with tutorials can be downloaded from https://github.com/whuang08/TreeScaper/releases TreeScaper is distributed under the GNU General Public License. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  7. Phylogenetically-informed priorities for amphibian conservation.

    Science.gov (United States)

    Isaac, Nick J B; Redding, David W; Meredith, Helen M; Safi, Kamran

    2012-01-01

    The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list) for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  8. Phylogenetically-informed priorities for amphibian conservation.

    Directory of Open Access Journals (Sweden)

    Nick J B Isaac

    Full Text Available The amphibian decline and extinction crisis demands urgent action to prevent further large numbers of species extinctions. Lists of priority species for conservation, based on a combination of species' threat status and unique contribution to phylogenetic diversity, are one tool for the direction and catalyzation of conservation action. We describe the construction of a near-complete species-level phylogeny of 5713 amphibian species, which we use to create a list of evolutionarily distinct and globally endangered species (EDGE list for the entire class Amphibia. We present sensitivity analyses to test the robustness of our priority list to uncertainty in species' phylogenetic position and threat status. We find that both sources of uncertainty have only minor impacts on our 'top 100' list of priority species, indicating the robustness of the approach. By contrast, our analyses suggest that a large number of Data Deficient species are likely to be high priorities for conservation action from the perspective of their contribution to the evolutionary history.

  9. Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

    Science.gov (United States)

    Riley, Matthew C; Wilkes, Rebecca P

    2015-12-18

    Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine

  10. GenNon-h: Generating multiple sequence alignments on nonhomogeneous phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Kedzierska Anna M

    2012-08-01

    Full Text Available Abstract Background A number of software packages are available to generate DNA multiple sequence alignments (MSAs evolved under continuous-time Markov processes on phylogenetic trees. On the other hand, methods of simulating the DNA MSA directly from the transition matrices do not exist. Moreover, existing software restricts to the time-reversible models and it is not optimized to generate nonhomogeneous data (i.e. placing distinct substitution rates at different lineages. Results We present the first package designed to generate MSAs evolving under discrete-time Markov processes on phylogenetic trees, directly from probability substitution matrices. Based on the input model and a phylogenetic tree in the Newick format (with branch lengths measured as the expected number of substitutions per site, the algorithm produces DNA alignments of desired length. GenNon-h is publicly available for download. Conclusion The software presented here is an efficient tool to generate DNA MSAs on a given phylogenetic tree. GenNon-h provides the user with the nonstationary or nonhomogeneous phylogenetic data that is well suited for testing complex biological hypotheses, exploring the limits of the reconstruction algorithms and their robustness to such models.

  11. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  12. Phytoplasma phylogenetics based on analysis of secA and 23S rRNA gene sequences for improved resolution of candidate species of 'Candidatus Phytoplasma'.

    Science.gov (United States)

    Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew

    2008-08-01

    Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.

  13. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Science.gov (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.

    Science.gov (United States)

    Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo

    2016-10-24

    Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Phylogenetic analysis of Escherichia coli isolates from healthy and diarrhoeic calves in Mashhad, Iran

    Directory of Open Access Journals (Sweden)

    M. Barzan

    2017-03-01

    Full Text Available Escherichia coli is a normal inhabitant of the gastrointestinal tract of vertebrates. Certain Escherichia coli strains have been associated with neonatal diarrhoea in ruminants. These strains can be assigned to one of the four main phylogenetic groups, A, B1, B2 and D. Several studies have shown the rela-tionship between phylogeny and pathogenicity of E. coli, a great deal can be obtained by determining the phylogroup of unknown E. coli strains. In this study, we aimed to evaluate the influence of diar-rhoea on the genetic composition of E. coli populations isolated from calves. A total of 80 Es-cherichia coli isolates were obtained from healthy and diarrhoeic calves. Phylogenetic grouping was done based on the Clermont triplex PCR method using primers targeted at three genetic markers, chuA, yjaA and TspE4.C2. According to our results, phylogenetic group A strains was the most prevalent in both healthy (37.5% and diarrhoeic calves (55%. Group B1 contained 27.5% of isolates in healthy calves, followed by group B2 (17.5%, and group D (7.5%. Also, four isolates from healthy calves were not included in the major phylogenetic groups or subgroups. A total of 14% and 4% of isolates from diarrhoeic calves beloned to phylogroups B2 and D respectively. Although no isolate from diarrhoeic calves was found to belong to group B1, there was no significant difference between healthy and diarrhoeic calves for other phylogroups. There was not a dramatic shift in E. coli phylogroup/subgroup due to occurrence of diarrhoea in calves, except for phylogroup B1 which was higher in healthy calves. This can be due to the difference in secretions of digestive system in diarrhoeic calves which can prevent the conditions for instability of Escherichia coli isolates of phy-logroup B1. The majority of isolates from both healthy and diarrhoeic calves belonged to non-pathogenic phylogentic group A and B1.

  16. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Science.gov (United States)

    Alfonso-Morales, Abdulahi; Rios, Liliam; Martínez-Pérez, Orlando; Dolz, Roser; Valle, Rosa; Perera, Carmen L; Bertran, Kateri; Frías, Maria T; Ganges, Llilianne; Díaz de Arce, Heidy; Majó, Natàlia; Núñez, José I; Pérez, Lester J

    2015-01-01

    Infectious bursal disease (IBD) is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV) strains worldwide. Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population. This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for molecular

  17. A new genus of athecate interstitial dinoflagellates, Togula gen. nov., previously encompassed within Amphidinium sensu lato: Inferred from light and electron microscopy and phylogenetic analyses of partial large subunit ribosomal DNA sequences

    DEFF Research Database (Denmark)

    Jørgensen, Mårten Flø; Murray, Shauna; Daugbjerg, Niels

    2004-01-01

    was not closely related to other genera included in the molecular phylogenetic analyses, but formed a highly supported clade in Bayesian analysis together with the six small-sized strains. The six strains also formed a highly supported clade, consisting of two closely related, albeit distinct, clades. Light......The recent emendation of Amphidinium (Dinophyceae), which now only consists of species with minute left-deflected epicone, has left more than 100 species without a clear generic affiliation. In the present study, a strain identified as one of the species with a divergent epicone type, Amphidinium...... subunit ribosomal DNA as well as in size and shape. Based on morphological similarity and partial large subunit ribosomal DNA evidence, we erect the new genus, Togula gen. nov. with the emended type species Togula britannica (Herdman) comb. nov. Based on differences in division pattern and partial large...

  18. HIV forensics: pitfalls and acceptable standards in the use of phylogenetic analysis as evidence in criminal investigations of HIV transmission.

    Science.gov (United States)

    Bernard, E J; Azad, Y; Vandamme, A M; Weait, M; Geretti, A M

    2007-09-01

    Phylogenetic analysis - the study of the genetic relatedness between HIV strains - has recently been used in criminal prosecutions as evidence of responsibility for HIV transmission. In these trials, the expert opinion of virologists has been of critical importance. Phylogenetic analysis of HIV gene sequences is complex and its findings do not achieve the levels of certainty obtained with the forensic analysis of human DNA. Although two individuals may carry HIV strains that are closely related, these will not necessarily be unique to the two parties and could extend to other persons within the same transmission network. For forensic purposes, phylogenetic analysis should be conducted under strictly controlled conditions by laboratories with relevant expertise applying rigorous methods. It is vitally important to include the right controls, which should be epidemiologically and temporally relevant to the parties under investigation. Use of inappropriate controls can exaggerate any relatedness between the virus strains of the complainant and defendant as being strikingly unique. It will be often difficult to obtain the relevant controls. If convenient but less appropriate controls are used, interpretation of the findings should be tempered accordingly. Phylogenetic analysis cannot prove that HIV transmission occurred directly between two individuals. However, it can exonerate individuals by demonstrating that the defendant carries a virus strain unrelated to that of the complainant. Expert witnesses should acknowledge the limitations of the inferences that might be made and choose the correct language in both written and verbal testimony.

  19. Comparative genomic characterization of three Streptococcus parauberis strains in fish pathogen, as assessed by wide-genome analyses.

    Directory of Open Access Journals (Sweden)

    Seong-Won Nho

    Full Text Available Streptococcus parauberis, which is the main causative agent of streptococcosis among olive flounder (Paralichthys olivaceus in northeast Asia, can be distinctly divided into two groups (type I and type II by an agglutination test. Here, the whole genome sequences of two Japanese strains (KRS-02083 and KRS-02109 were determined and compared with the previously determined genome of a Korean strain (KCTC 11537. The genomes of S. parauberis are intermediate in size and have lower GC contents than those of other streptococci. We annotated 2,236 and 2,048 genes in KRS-02083 and KRS-02109, respectively. Our results revealed that the three S. parauberis strains contain different genomic insertions and deletions. In particular, the genomes of Korean and Japanese strains encode different factors for sugar utilization; the former encodes the phosphotransferase system (PTS for sorbose, whereas the latter encodes proteins for lactose hydrolysis, respectively. And the KRS-02109 strain, specifically, was the type II strain found to be able to resist phage infection through the clustered regularly interspaced short palindromic repeats (CRISPR/Cas system and which might contribute valuably to serologically distribution. Thus, our genome-wide association study shows that polymorphisms can affect pathogen responses, providing insight into biological/biochemical pathways and phylogenetic diversity.

  20. Phylogenetic Distinctiveness of Middle Eastern and Southeast Asian Village Dog Y Chromosomes Illuminates Dog Origins

    Science.gov (United States)

    Brown, Sarah K.; Pedersen, Niels C.; Jafarishorijeh, Sardar; Bannasch, Danika L.; Ahrens, Kristen D.; Wu, Jui-Te; Okon, Michaella; Sacks, Benjamin N.

    2011-01-01

    Modern genetic samples are commonly used to trace dog origins, which entails untested assumptions that village dogs reflect indigenous ancestry or that breed origins can be reliably traced to particular regions. We used high-resolution Y chromosome markers (SNP and STR) and mitochondrial DNA to analyze 495 village dogs/dingoes from the Middle East and Southeast Asia, along with 138 dogs from >35 modern breeds to 1) assess genetic divergence between Middle Eastern and Southeast Asian village dogs and their phylogenetic affinities to Australian dingoes and gray wolves (Canis lupus) and 2) compare the genetic affinities of modern breeds to regional indigenous village dog populations. The Y chromosome markers indicated that village dogs in the two regions corresponded to reciprocally monophyletic clades, reflecting several to many thousand years divergence, predating the Neolithic ages, and indicating long-indigenous roots to those regions. As expected, breeds of the Middle East and East Asia clustered within the respective regional village dog clade. Australian dingoes also clustered in the Southeast Asian clade. However, the European and American breeds clustered almost entirely within the Southeast Asian clade, even sharing many haplotypes, suggesting a substantial and recent influence of East Asian dogs in the creation of European breeds. Comparison to 818 published breed dog Y STR haplotypes confirmed this conclusion and indicated that some African breeds reflect another distinct patrilineal origin. The lower-resolution mtDNA marker consistently supported Y-chromosome results. Both marker types confirmed previous findings of higher genetic diversity in dogs from Southeast Asia than the Middle East. Our findings demonstrate the importance of village dogs as windows into the past and provide a reference against which ancient DNA can be used to further elucidate origins and spread of the domestic dog. PMID:22194840

  1. Aspergillus niger contains the cryptic phylogenetic species A. awamori.

    Science.gov (United States)

    Perrone, Giancarlo; Stea, Gaetano; Epifani, Filomena; Varga, János; Frisvad, Jens C; Samson, Robert A

    2011-11-01

    Aspergillus section Nigri is an important group of species for food and medical mycology, and biotechnology. The Aspergillus niger 'aggregate' represents its most complicated taxonomic subgroup containing eight morphologically indistinguishable taxa: A. niger, Aspergillus tubingensis, Aspergillus acidus, Aspergillus brasiliensis, Aspergillus costaricaensis, Aspergillus lacticoffeatus, Aspergillus piperis, and Aspergillus vadensis. Aspergillus awamori, first described by Nakazawa, has been compared taxonomically with other black aspergilli and recently it has been treated as a synonym of A. niger. Phylogenetic analyses of sequences generated from portions of three genes coding for the proteins β-tubulin (benA), calmodulin (CaM), and the translation elongation factor-1 alpha (TEF-1α) of a population of A. niger strains isolated from grapes in Europe revealed the presence of a cryptic phylogenetic species within this population, A. awamori. Morphological, physiological, ecological and chemical data overlap occurred between A. niger and the cryptic A. awamori, however the splitting of these two species was also supported by AFLP analysis of the full genome. Isolates in both phylospecies can produce the mycotoxins ochratoxin A and fumonisin B₂, and they also share the production of pyranonigrin A, tensidol B, funalenone, malformins, and naphtho-γ-pyrones. In addition, sequence analysis of four putative A. awamori strains from Japan, used in the koji industrial fermentation, revealed that none of these strains belong to the A. awamori phylospecies. Copyright © 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  2. Applying a multiobjective metaheuristic inspired by honey bees to phylogenetic inference.

    Science.gov (United States)

    Santander-Jiménez, Sergio; Vega-Rodríguez, Miguel A

    2013-10-01

    The development of increasingly popular multiobjective metaheuristics has allowed bioinformaticians to deal with optimization problems in computational biology where multiple objective functions must be taken into account. One of the most relevant research topics that can benefit from these techniques is phylogenetic inference. Throughout the years, different researchers have proposed their own view about the reconstruction of ancestral evolutionary relationships among species. As a result, biologists often report different phylogenetic trees from a same dataset when considering distinct optimality principles. In this work, we detail a multiobjective swarm intelligence approach based on the novel Artificial Bee Colony algorithm for inferring phylogenies. The aim of this paper is to propose a complementary view of phylogenetics according to the maximum parsimony and maximum likelihood criteria, in order to generate a set of phylogenetic trees that represent a compromise between these principles. Experimental results on a variety of nucleotide data sets and statistical studies highlight the relevance of the proposal with regard to other multiobjective algorithms and state-of-the-art biological methods. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Coalescent methods for estimating phylogenetic trees.

    Science.gov (United States)

    Liu, Liang; Yu, Lili; Kubatko, Laura; Pearl, Dennis K; Edwards, Scott V

    2009-10-01

    We review recent models to estimate phylogenetic trees under the multispecies coalescent. Although the distinction between gene trees and species trees has come to the fore of phylogenetics, only recently have methods been developed that explicitly estimate species trees. Of the several factors that can cause gene tree heterogeneity and discordance with the species tree, deep coalescence due to random genetic drift in branches of the species tree has been modeled most thoroughly. Bayesian approaches to estimating species trees utilizes two likelihood functions, one of which has been widely used in traditional phylogenetics and involves the model of nucleotide substitution, and the second of which is less familiar to phylogeneticists and involves the probability distribution of gene trees given a species tree. Other recent parametric and nonparametric methods for estimating species trees involve parsimony criteria, summary statistics, supertree and consensus methods. Species tree approaches are an appropriate goal for systematics, appear to work well in some cases where concatenation can be misleading, and suggest that sampling many independent loci will be paramount. Such methods can also be challenging to implement because of the complexity of the models and computational time. In addition, further elaboration of the simplest of coalescent models will be required to incorporate commonly known issues such as deviation from the molecular clock, gene flow and other genetic forces.

  4. Phylogenetic multilocus sequence analysis of indigenous slow-growing rhizobia nodulating cowpea (Vigna unguiculata L.) in Greece.

    Science.gov (United States)

    Tampakaki, Anastasia P; Fotiadis, Christos T; Ntatsi, Georgia; Savvas, Dimitrios

    2017-04-01

    Cowpea (Vigna unguiculata) is a promiscuous grain legume, capable of establishing efficient symbiosis with diverse symbiotic bacteria, mainly slow-growing rhizobial species belonging to the genus Bradyrhizobium. Although much research has been done on cowpea-nodulating bacteria in various countries around the world, little is known about the genetic and symbiotic diversity of indigenous cowpea rhizobia in European soils. In the present study, the genetic and symbiotic diversity of indigenous rhizobia isolated from field-grown cowpea nodules in three geographically different Greek regions were studied. Forty-five authenticated strains were subjected to a polyphasic approach. ERIC-PCR based fingerprinting analysis grouped the isolates into seven groups and representative strains of each group were further analyzed. The analysis of the rrs gene showed that the strains belong to different species of the genus Bradyrhizobium. The analysis of the 16S-23S IGS region showed that the strains from each geographic region were characterized by distinct IGS types which may represent novel phylogenetic lineages, closely related to the type species of Bradyrhizobium pachyrhizi, Bradyrhizobium ferriligni and Bradyrhizobium liaoningense. MLSA analysis of three housekeeping genes (recA, glnII, and gyrB) showed the close relatedness of our strains with B. pachyrhizi PAC48 T and B. liaoningense USDA 3622 T and confirmed that the B. liaoningense-related isolate VUEP21 may constitute a novel species within Bradyrhizobium. Moreover, symbiotic gene phylogenies, based on nodC and nifH genes, showed that the B. pachyrhizi-related isolates belonged to symbiovar vignae, whereas the B. liaoningense-related isolates may represent a novel symbiovar. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. Some Like it High! Phylogenetic Diversity of High-Elevation Cyanobacterial Community from Biological Soil Crusts of Western Himalaya.

    Science.gov (United States)

    Čapková, Kateřina; Hauer, Tomáš; Řeháková, Klára; Doležal, Jiří

    2016-01-01

    The environment of high-altitudinal cold deserts of Western Himalaya is characterized by extensive development of biological soil crusts, with cyanobacteria as dominant component. The knowledge of their taxonomic composition and dependency on soil chemistry and elevation is still fragmentary. We studied the abundance and the phylogenetic diversity of the culturable cyanobacteria and eukaryotic microalgae in soil crusts along altitudinal gradients (4600-5900 m) at two sites in the dry mountains of Ladakh (SW Tibetan Plateau and Eastern Karakoram), using both microscopic and molecular approaches. The effects of environmental factors (altitude, mountain range, and soil physico-chemical parameters) on the composition and biovolume of phototrophs were tested by multivariate redundancy analysis and variance partitioning. Both phylogenetic diversity and composition of morphotypes were similar between Karakorum and Tibetan Plateau. Phylogenetic analysis of 16S rRNA gene revealed strains belonging to at least five genera. Besides clusters of common soil genera, e.g., Microcoleus, Nodosilinea, or Nostoc, two distinct clades of simple trichal taxa were newly discovered. The most abundant cyanobacterial orders were Oscillatoriales and Nostacales, whose biovolume increased with increasing elevation, while that of Chroococales decreased. Cyanobacterial species richness was low in that only 15 morphotypes were detected. The environmental factors accounted for 52 % of the total variability in microbial data, 38.7 % of which was explained solely by soil chemical properties, 14.5 % by altitude, and 8.4 % by mountain range. The elevation, soil phosphate, and magnesium were the most important predictors of soil phototrophic communities in both mountain ranges despite their different bedrocks and origin. The present investigation represents a first record on phylogenetic diversity of the cyanobacterial community of biological soil crusts from Western Himalayas and first record

  6. Re-evaluation of the taxonomy of the Mitis group of the genus Streptococcus based on whole genome phylogenetic analyses, and proposed reclassification of Streptococcus dentisani as Streptococcus oralis subsp. dentisani comb. nov., Streptococcus tigurinus as Streptococcus oralis subsp. tigurinus comb. nov., and Streptococcus oligofermentans as a later synonym of Streptococcus cristatus.

    Science.gov (United States)

    Jensen, Anders; Scholz, Christian F P; Kilian, Mogens

    2016-11-01

    The Mitis group of the genus Streptococcus currently comprises 20 species with validly published names, including the pathogen S. pneumoniae. They have been the subject of much taxonomic confusion, due to phenotypic overlap and genetic heterogeneity, which has hampered a full appreciation of their clinical significance. The purpose of this study was to critically re-examine the taxonomy of the Mitis group using 195 publicly available genomes, including designated type strains for phylogenetic analyses based on core genomes, multilocus sequences and 16S rRNA gene sequences, combined with estimates of average nucleotide identity (ANI) and in silico and in vitro analyses of specific phenotypic characteristics. Our core genomic phylogenetic analyses revealed distinct clades that, to some extent, and from the clustering of type strains represent known species. However, many of the genomes have been incorrectly identified adding to the current confusion. Furthermore, our data show that 16S rRNA gene sequences and ANI are unsuitable for identifying and circumscribing new species of the Mitis group of the genus Streptococci. Based on the clustering patterns resulting from core genome phylogenetic analysis, we conclude that S. oligofermentans is a later synonym of S. cristatus. The recently described strains of the species Streptococcus dentisani includes one previously referred to as 'S. mitis biovar 2'. Together with S. oralis, S. dentisani and S. tigurinus form subclusters within a coherent phylogenetic clade. We propose that the species S. oralis consists of three subspecies: S. oralis subsp. oralis subsp. nov., S. oralis subsp. tigurinus comb. nov., and S. oralis subsp. dentisani comb. nov.

  7. 16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

    African Journals Online (AJOL)

    ... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

  8. Phylogenetic characterisation of naturally occurring feline immunodeficiency virus in the United Kingdom.

    Science.gov (United States)

    Samman, A; McMonagle, E L; Logan, N; Willett, B J; Biek, R; Hosie, M J

    2011-06-02

    Feline immunodeficiency virus (FIV) is a significant pathogen of domestic and non-domestic felids worldwide. In domestic cats, FIV is classified into five distinct subtypes (A-E) with subtypes A and B distributed most widely. However, little is known about the degree of intrasubtype viral diversity and this may prove critical in determining whether monovalent vaccines are likely to protect against FIV strains within a single subtype. Here, we characterise novel env sequences from 47 FIV strains recovered from infected cats in the United Kingdom and its environs. Phylogenetic analyses revealed that all bar one sequence belonged to subtype A, the predominant subtype in Western Europe. A single sequence was identified as a likely subtype A/C recombinant, intriguing given that subtype C does not appear to exist in either the UK or North Western Europe and suggestive of a recombination event predating its introduction into the UK. Subtype A strains from the UK were not significantly differentiated from representative subtype A isolates found elsewhere suggesting multiple introductions of FIV into the country. Divergence among isolates was comparable to that observed for subtype A isolates worldwide, indicating that FIV in the UK covers the full spectrum of subtype A diversity seen globally. This study demonstrates that while subtype A is predominant in the UK, novel introductions may result in the emergence of novel subtypes or intersubtype recombinants, potentially circumventing vaccine strategies. However, the dominance of subtype A suggests that the development of a regional or subtype-specific protective vaccine for the UK could be achievable. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. The Mobilome; A Major Contributor to Escherichia coli stx2-Positive O26:H11 Strains Intra-Serotype Diversity

    Directory of Open Access Journals (Sweden)

    Sabine Delannoy

    2017-09-01

    Full Text Available Shiga toxin-producing Escherichia coli of serotype O26:H11/H- constitute a diverse group of strains and several clones with distinct genetic characteristics have been identified and characterized. Whole genome sequencing was performed using Illumina and PacBio technologies on eight stx2-positive O26:H11 strains circulating in France. Comparative analyses of the whole genome of the stx2-positive O26:H11 strains indicate that several clones of EHEC O26:H11 are co-circulating in France. Phylogenetic analysis of the French strains together with stx2-positive and stx-negative E. coli O26:H11 genomes obtained from Genbank indicates the existence of four clonal complexes (SNP-CCs separated in two distinct lineages, one of which comprises the “new French clone” (SNP-CC1 that appears genetically closely related to stx-negative attaching and effacing E. coli (AEEC strains. Interestingly, the whole genome SNP (wgSNP phylogeny is summarized in the cas gene phylogeny, and a simple qPCR assay targeting the CRISPR array specific to SNP-CC1 (SP_O26-E can distinguish between the two main lineages. The PacBio sequencing allowed a detailed analysis of the mobile genetic elements (MGEs of the strains. Numerous MGEs were identified in each strain, including a large number of prophages and up to four large plasmids, representing overall 8.7–19.8% of the total genome size. Analysis of the prophage pool of the strains shows a considerable diversity with a complex history of recombination. Each clonal complex (SNP-CC is characterized by a unique set of plasmids and phages, including stx-prophages, suggesting evolution through separate acquisition events. Overall, the MGEs appear to play a major role in O26:H11 intra-serotype clonal diversification.

  10. The Mobilome; A Major Contributor to Escherichia coli stx2-Positive O26:H11 Strains Intra-Serotype Diversity.

    Science.gov (United States)

    Delannoy, Sabine; Mariani-Kurkdjian, Patricia; Webb, Hattie E; Bonacorsi, Stephane; Fach, Patrick

    2017-01-01

    Shiga toxin-producing Escherichia coli of serotype O26:H11/H- constitute a diverse group of strains and several clones with distinct genetic characteristics have been identified and characterized. Whole genome sequencing was performed using Illumina and PacBio technologies on eight stx2 -positive O26:H11 strains circulating in France. Comparative analyses of the whole genome of the stx2 -positive O26:H11 strains indicate that several clones of EHEC O26:H11 are co-circulating in France. Phylogenetic analysis of the French strains together with stx2 -positive and stx -negative E. coli O26:H11 genomes obtained from Genbank indicates the existence of four clonal complexes (SNP-CCs) separated in two distinct lineages, one of which comprises the "new French clone" (SNP-CC1) that appears genetically closely related to stx -negative attaching and effacing E. coli (AEEC) strains. Interestingly, the whole genome SNP (wgSNP) phylogeny is summarized in the cas gene phylogeny, and a simple qPCR assay targeting the CRISPR array specific to SNP-CC1 (SP_O26-E) can distinguish between the two main lineages. The PacBio sequencing allowed a detailed analysis of the mobile genetic elements (MGEs) of the strains. Numerous MGEs were identified in each strain, including a large number of prophages and up to four large plasmids, representing overall 8.7-19.8% of the total genome size. Analysis of the prophage pool of the strains shows a considerable diversity with a complex history of recombination. Each clonal complex (SNP-CC) is characterized by a unique set of plasmids and phages, including stx -prophages, suggesting evolution through separate acquisition events. Overall, the MGEs appear to play a major role in O26:H11 intra-serotype clonal diversification.

  11. A new support measure to quantify the impact of local optima in phylogenetic analyses.

    KAUST Repository

    Brammer, Grant; Sul, Seung-Jin; Williams, Tiffani L

    2011-01-01

    Phylogentic analyses are often incorrectly assumed to have stabilized to a single optimum. However, a set of trees from a phylogenetic analysis may contain multiple distinct local optima with each optimum providing different levels of support

  12. Phylogenetic and structural diversity in the feline leukemia virus env gene.

    Directory of Open Access Journals (Sweden)

    Shinya Watanabe

    Full Text Available Feline leukemia virus (FeLV belongs to the genus Gammaretrovirus, and causes a variety of neoplastic and non-neoplastic diseases in cats. Alteration of viral env sequences is thought to be associated with disease specificity, but the way in which genetic diversity of FeLV contributes to the generation of such variants in nature is poorly understood. We isolated FeLV env genes from naturally infected cats in Japan and analyzed the evolutionary dynamics of these genes. Phylogenetic reconstructions separated our FeLV samples into three distinct genetic clusters, termed Genotypes I, II, and III. Genotype I is a major genetic cluster and can be further classified into Clades 1-7 in Japan. Genotypes were correlated with geographical distribution; Genotypes I and II were distributed within Japan, whilst FeLV samples from outside Japan belonged to Genotype III. These results may be due to geographical isolation of FeLVs in Japan. The observed structural diversity of the FeLV env gene appears to be caused primarily by mutation, deletion, insertion and recombination, and these variants may be generated de novo in individual cats. FeLV interference assay revealed that FeLV genotypes did not correlate with known FeLV receptor subgroups. We have identified the genotypes which we consider to be reliable for evaluating phylogenetic relationships of FeLV, which embrace the high structural diversity observed in our sample. Overall, these findings extend our understanding of Gammaretrovirus evolutionary patterns in the field, and may provide a useful basis for assessing the emergence of novel strains and understanding the molecular mechanisms of FeLV transmission in cats.

  13. Descriptive distribution and phylogenetic analysis of feline infectious peritonitis virus isolates of Malaysia.

    Science.gov (United States)

    Sharif, Saeed; Arshad, Siti S; Hair-Bejo, Mohd; Omar, Abdul R; Zeenathul, Nazariah A; Fong, Lau S; Rahman, Nor-Alimah; Arshad, Habibah; Shamsudin, Shahirudin; Isa, Mohd-Kamarudin A

    2010-01-06

    The descriptive distribution and phylogeny of feline coronaviruses (FCoVs) were studied in cats suspected of having feline infectious peritonitis (FIP) in Malaysia. Ascitic fluids and/or biopsy samples were subjected to a reverse transcription polymerase chain reaction (RT-PCR) targeted for a conserved region of 3'untranslated region (3'UTR) of the FCoV genome. Eighty nine percent of the sampled animals were positive for the presence of FCoV. Among the FCoV positive cats, 80% of cats were males and 64% were below 2 years of age. The FCoV positive cases included 56% domestic short hair (DSH), 40% Persian, and 4% Siamese cats. The nucleotide sequences of 10 selected amplified products from FIP cases were determined. The sequence comparison revealed that the field isolates had 96% homology with a few point mutations. The extent of homology decreased to 93% when compared with reference strains. The overall branching pattern of phylogenetic tree showed two distinct clusters, where all Malaysian isolates fall into one main genetic cluster. These findings provided the first genetic information of FCoV in Malaysia.

  14. NGS combined with phylogenetic analysis to detect HIV-1 dual infection in Romanian people who inject drugs.

    Science.gov (United States)

    Popescu, Bogdan; Banica, Leontina; Nicolae, Ionelia; Radu, Eugen; Niculescu, Iulia; Abagiu, Adrian; Otelea, Dan; Paraschiv, Simona

    2018-04-04

    Dual HIV infections are possible and likely in people who inject drugs (PWID). Thirty-eight newly diagnosed patients, 19 PWID and 19 heterosexually HIV infected were analysed. V2-V3 loop of HIV-1 env gene was sequenced on the NGS platform 454 GSJunior (Roche). HIV-1 dual/multiple infections were identified in five PWID. For three of these patients, the reconstructed variants belonged to pure F1 subtype and CRF14_BG strains according to phylogenetic analysis. New recombinant forms between these parental strains were identified in two PWID samples. NGS data can provide, with the help of phylogenetic analysis, important insights about the intra-host sub-population structure. Copyright © 2018. Published by Elsevier Masson SAS.

  15. Complete Genome Sequence of Porcine Parvovirus N Strain Isolated from Guangxi, China

    OpenAIRE

    Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

    2015-01-01

    We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety.

  16. Phylogenetic analysis of canine distemper virus in domestic dogs in Nanjing, China.

    Science.gov (United States)

    Bi, Zhenwei; Wang, Yongshan; Wang, Xiaoli; Xia, Xingxia

    2015-02-01

    Canine distemper virus (CDV) infects a broad range of carnivores, including wild and domestic Canidae. The hemagglutinin gene, which encodes the attachment protein that determines viral tropism, has been widely used to determine the relationship between CDV strains of different lineages circulating worldwide. We determined the full-length H gene sequences of seven CDV field strains detected in domestic dogs in Nanjing, China. A phylogenetic analysis of the H gene sequences of CDV strains from different geographic regions and vaccine strains was performed. Four of the seven CDV strains were grouped in the same cluster of the Asia-1 lineage to which the vast majority of Chinese CDV strains belong, whereas the other three were clustered within the Asia-4 lineage, which has never been detected in China. This represents the first record of detection of strains of the Asia-4 lineage in China since this lineage was reported in Thailand in 2013.

  17. Distinct Mutations Led to Inactivation of Type 1 Fimbriae Expression in Shigella spp.

    Science.gov (United States)

    Bravo, Verónica; Puhar, Andrea; Sansonetti, Philippe; Parsot, Claude; Toro, Cecilia S.

    2015-01-01

    Shigella spp. are responsible for bacillary dysentery in humans. The acquisition or the modification of the virulence plasmid encoding factors promoting entry of bacteria into and dissemination within epithelial cells was a critical step in the evolution of these bacteria from their Escherichia coli ancestor(s). Incorporation of genomic islands (GI) and gene inactivation also shaped interactions between these pathogens and their human host. Sequence analysis of the GI inserted next to the leuX tRNA gene in S. boydii, S. dysenteriae, S. flexneri, S. sonnei and enteroinvasive E. coli (EIEC) suggests that this region initially carried the fec, yjhATS and fim gene clusters. The fim cluster encoding type I fimbriae is systematically inactivated in both reference strains and clinical isolates and distinct mutations are responsible for this inactivation in at least three phylogenetic groups. To investigate consequences of the presence of fimbriae on the outcome of the interaction of Shigella with host cells, we used a S. flexneri strain harboring a plasmid encoding the E. coli fim operon. Production of fimbriae by this recombinant strain increased the ability of bacteria to adhere to and enter into epithelial cells and had no effect on their ability to disseminate from cell to cell. The observations that production of type I fimbriae increases invasion of epithelial cells and that independent mutations abolish fimbriae production in Shigella suggest that these mutations correspond to pathoadaptive events. PMID:25811616

  18. Distinct mutations led to inactivation of type 1 fimbriae expression in Shigella spp.

    Directory of Open Access Journals (Sweden)

    Verónica Bravo

    Full Text Available Shigella spp. are responsible for bacillary dysentery in humans. The acquisition or the modification of the virulence plasmid encoding factors promoting entry of bacteria into and dissemination within epithelial cells was a critical step in the evolution of these bacteria from their Escherichia coli ancestor(s. Incorporation of genomic islands (GI and gene inactivation also shaped interactions between these pathogens and their human host. Sequence analysis of the GI inserted next to the leuX tRNA gene in S. boydii, S. dysenteriae, S. flexneri, S. sonnei and enteroinvasive E. coli (EIEC suggests that this region initially carried the fec, yjhATS and fim gene clusters. The fim cluster encoding type I fimbriae is systematically inactivated in both reference strains and clinical isolates and distinct mutations are responsible for this inactivation in at least three phylogenetic groups. To investigate consequences of the presence of fimbriae on the outcome of the interaction of Shigella with host cells, we used a S. flexneri strain harboring a plasmid encoding the E. coli fim operon. Production of fimbriae by this recombinant strain increased the ability of bacteria to adhere to and enter into epithelial cells and had no effect on their ability to disseminate from cell to cell. The observations that production of type I fimbriae increases invasion of epithelial cells and that independent mutations abolish fimbriae production in Shigella suggest that these mutations correspond to pathoadaptive events.

  19. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  20. Prevalence of pathogens from Mollicutes class in cattle affected by respiratory diseases and molecular characteristics of Mycoplasma bovis field strains

    Directory of Open Access Journals (Sweden)

    Szacawa Ewelina

    2016-12-01

    Full Text Available Introduction: Mycoplasma bovis is one of the main pathogens involved in cattle pneumonia. Other mycoplasmas have also been directly implicated in respiratory diseases in cattle. The prevalence of different Mycoplasma spp. in cattle affected by respiratory diseases and molecular characteristics of M. bovis field strains were evaluated. Material and Methods: In total, 713 nasal swabs from 73 cattle herds were tested. The uvrC gene fragment was amplified by PCR and PCR products were sequenced. PCR/DGGE and RAPD were performed. Results: It was found that 39 (5.5% samples were positive for M. bovis in the PCR and six field strains had point nucleotide mutations. Additionally, the phylogenetic analysis of 20 M. bovis field strains tested with RAPD showed two distinct groups of M. bovis strains sharing only 3.8% similarity. PCR/DGGE analysis demonstrated the presence of bacteria belonging to the Mollicutes class in 79.1% of DNA isolates. The isolates were identified as: Mycoplasma bovirhinis, M. dispar, M. bovis, M. canis, M. arginini, M. canadense, M. bovoculi, M. alkalescens, and Ureaplasma diversum. Conclusion: Different Mycoplasma spp. strains play a crucial role in inducing respiratory diseases in cattle.

  1. Antibody induced by immunization with the Jeryl Lynn mumps vaccine strain effectively neutralizes a heterologous wild-type mumps virus associated with a large outbreak.

    Science.gov (United States)

    Rubin, Steven A; Qi, Li; Audet, Susette A; Sullivan, Bradley; Carbone, Kathryn M; Bellini, William J; Rota, Paul A; Sirota, Lev; Beeler, Judy

    2008-08-15

    Recent mumps outbreaks in older vaccinated populations were caused primarily by genotype G viruses, which are phylogenetically distinct from the genotype A vaccine strains used in the countries affected by the outbreaks. This finding suggests that genotype A vaccine strains could have reduced efficacy against heterologous mumps viruses. The remote history of vaccination also suggests that waning immunity could have contributed to susceptibility. To examine these issues, we obtained consecutive serum samples from children at different intervals after vaccination and assayed the ability of these samples to neutralize the genotype A Jeryl Lynn mumps virus vaccine strain and a genotype G wild-type virus obtained during the mumps outbreak that occurred in the United States in 2006. Although the geometric mean neutralizing antibody titers against the genotype G virus were approximately one-half the titers measured against the vaccine strain, and although titers to both viruses decreased with time after vaccination, antibody induced by immunization with the Jeryl Lynn mumps vaccine strain effectively neutralized the outbreak-associated virus at all time points tested.

  2. The Mechanism for Type I Interferon Induction by Mycobacterium tuberculosis is Bacterial Strain-Dependent.

    Directory of Open Access Journals (Sweden)

    Kirsten E Wiens

    2016-08-01

    Full Text Available Type I interferons (including IFNαβ are innate cytokines that may contribute to pathogenesis during Mycobacterium tuberculosis (Mtb infection. To induce IFNβ, Mtb must gain access to the host cytosol and trigger stimulator of interferon genes (STING signaling. A recently proposed model suggests that Mtb triggers STING signaling through bacterial DNA binding cyclic GMP-AMP synthase (cGAS in the cytosol. The aim of this study was to test the generalizability of this model using phylogenetically distinct strains of the Mtb complex (MTBC. We infected bone marrow derived macrophages with strains from MTBC Lineages 2, 4 and 6. We found that the Lineage 6 strain induced less IFNβ, and that the Lineage 2 strain induced more IFNβ, than the Lineage 4 strain. The strains did not differ in their access to the host cytosol and IFNβ induction by each strain required both STING and cGAS. We also found that the three strains shed similar amounts of bacterial DNA. Interestingly, we found that the Lineage 6 strain was associated with less mitochondrial stress and less mitochondrial DNA (mtDNA in the cytosol compared with the Lineage 4 strain. Treating macrophages with a mitochondria-specific antioxidant reduced cytosolic mtDNA and inhibited IFNβ induction by the Lineage 2 and 4 strains. We also found that the Lineage 2 strain did not induce more mitochondrial stress than the Lineage 4 strain, suggesting that additional pathways contribute to higher IFNβ induction. These results indicate that the mechanism for IFNβ by Mtb is more complex than the established model suggests. We show that mitochondrial dynamics and mtDNA contribute to IFNβ induction by Mtb. Moreover, we show that the contribution of mtDNA to the IFNβ response varies by MTBC strain and that additional mechanisms exist for Mtb to induce IFNβ.

  3. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  4. Inferring influenza global transmission networks without complete phylogenetic information.

    Science.gov (United States)

    Aris-Brosou, Stéphane

    2014-03-01

    Influenza is one of the most severe respiratory infections affecting humans throughout the world, yet the dynamics of its global transmission network are still contentious. Here, I describe a novel combination of phylogenetics, time series, and graph theory to analyze 14.25 years of data stratified in space and in time, focusing on the main target of the human immune response, the hemagglutinin gene. While bypassing the complete phylogenetic inference of huge data sets, the method still extracts information suggesting that waves of genetic or of nucleotide diversity circulate continuously around the globe for subtypes that undergo sustained transmission over several seasons, such as H3N2 and pandemic H1N1/09, while diversity of prepandemic H1N1 viruses had until 2009 a noncontinuous transmission pattern consistent with a source/sink model. Irrespective of the shift in the structure of H1N1 diversity circulation with the emergence of the pandemic H1N1/09 strain, US prevalence peaks during the winter months when genetic diversity is at its lowest. This suggests that a dominant strain is generally responsible for epidemics and that monitoring genetic and/or nucleotide diversity in real time could provide public health agencies with an indirect estimate of prevalence.

  5. Evaluation of a Phylogenetic Marker Based on Genomic Segment B of Infectious Bursal Disease Virus: Facilitating a Feasible Incorporation of this Segment to the Molecular Epidemiology Studies for this Viral Agent.

    Directory of Open Access Journals (Sweden)

    Abdulahi Alfonso-Morales

    Full Text Available Infectious bursal disease (IBD is a highly contagious and acute viral disease, which has caused high mortality rates in birds and considerable economic losses in different parts of the world for more than two decades and it still represents a considerable threat to poultry. The current study was designed to rigorously measure the reliability of a phylogenetic marker included into segment B. This marker can facilitate molecular epidemiology studies, incorporating this segment of the viral genome, to better explain the links between emergence, spreading and maintenance of the very virulent IBD virus (vvIBDV strains worldwide.Sequences of the segment B gene from IBDV strains isolated from diverse geographic locations were obtained from the GenBank Database; Cuban sequences were obtained in the current work. A phylogenetic marker named B-marker was assessed by different phylogenetic principles such as saturation of substitution, phylogenetic noise and high consistency. This last parameter is based on the ability of B-marker to reconstruct the same topology as the complete segment B of the viral genome. From the results obtained from B-marker, demographic history for both main lineages of IBDV regarding segment B was performed by Bayesian skyline plot analysis. Phylogenetic analysis for both segments of IBDV genome was also performed, revealing the presence of a natural reassortant strain with segment A from vvIBDV strains and segment B from non-vvIBDV strains within Cuban IBDV population.This study contributes to a better understanding of the emergence of vvIBDV strains, describing molecular epidemiology of IBDV using the state-of-the-art methodology concerning phylogenetic reconstruction. This study also revealed the presence of a novel natural reassorted strain as possible manifest of change in the genetic structure and stability of the vvIBDV strains. Therefore, it highlights the need to obtain information about both genome segments of IBDV for

  6. Complete genome sequence of porcine parvovirus N strain isolated from guangxi, china.

    Science.gov (United States)

    Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

    2015-01-08

    We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety. Copyright © 2015 Su et al.

  7. Comparative analysis of antibiotic resistance and phylogenetic group patterns in human and porcine urinary tract infectious Escherichia coli

    DEFF Research Database (Denmark)

    Hancock, Viktoria; Nielsen, E.M.; Krag, L.

    2009-01-01

    Urinary tract infections (UTIs) are one of the most common infectious diseases in humans and domestic animals such as pigs. The most frequent infectious agent in such infections is Escherichia coli. Virulence characteristics of E. coli UTI strains range from highly virulent pyelonephritis strains...... to relatively benign asymptomatic bacteriuria strains. Here we analyse a spectrum of porcine and human UTI E. coli strains with respect to their antibiotic resistance patterns and their phylogenetic groups, determined by multiplex PCR. The clonal profiles of the strains differed profoundly; whereas human...

  8. Polyphasic characterization of Trichocoleus desertorum sp. nov. (Pseudanabaenales, Cyanobacteria) from desert soils and phylogenetic placement of the genus Trichocoleus

    Science.gov (United States)

    Radka Muhlsteinova; Jeffrey R. Johansen; Nicole Pietrasiak; Michael P. Martin; Karina Osorio-Santos; Steven D. Warren

    2014-01-01

    Little is known about the taxonomic diversity of cyanobacteria in deserts, despite their important ecological roles in these ecosystems. In this study, cyanobacterial strains from the Atacama, Colorado, and Mojave Deserts were isolated and characterized using molecular, morphological, and ecological information. Phylogenetic placement of these strains was revealed...

  9. Phylogenetic analysis of hepatitis B virus in pakistan

    International Nuclear Information System (INIS)

    Baig, S.; Hasnain, N.U.

    2008-01-01

    To identify the distribution pattern of Hepatitis B Virus (HBV) genotype in a group of patients and to study its phylogenetic divergence. Two hundred and one HBV infected patients were genotyped for this study. All HbsAg positive individuals, either healthy carriers or suffering from conditions such as acute or chronic hepatitis, cirrhosis and hepatocellular carcinoma were included. Hepatitis B patients co-infected with other hepatic viruses were excluded. Hepatitis B virus DNA was extracted from serum, and subjected to a nested PCR, using the primers type-specific for genotype detection. Phylogenetic analysis was performed in the pre-S1 through S genes of HBV. The divergence was studied through 15 sequences of 967bp submitted to the DBJ/EMBL/GenBank databases accessible under accession number EF584640 through EF584654. Out of 201 patients tested, 156 were males and 45 were females. Genotype D was the predominant type found in 128 (64%) patients followed by A in 47 (23%) and mixed A/D in 26 (13%). Phylogenetic analysis confirmed the dominance of genotype D and subtype ayw2. There was dominance of genotype D subtype ayw2. It had a close resemblance with HBV strains that circulate in Iran, India and Japan. (author)

  10. The Genetically Remote Pathogenic Strain NVH391-98 of the Bacillus cereus Group Represents the Cluster of Thermophilic Strains

    Energy Technology Data Exchange (ETDEWEB)

    Auger, Sandrine; Galleron, Nathalie; Bidnenko, Elena; Ehrlich, S. Dusko; Lapidus, Alla; Sorokin, Alexei

    2007-10-02

    Bacteria of the Bacillus cereus group are known to cause food poisoning. A rare phylogenetically remote strain, NVH391-98, was recently characterized to encode a particularly efficient cytotoxin K presumably responsible for food poisoning. This pathogenic strain and its close relatives can be phenotypically distinguished from other strains of the B. cereus group by the inability to grow at temperatures below 17 degrees C and by the ability to grow at temperatures from 48 to 53 degrees C. A temperate phage, phBC391A2, residing in the genome of NVH391-98 allows us to distinguish the three known members of this thermophilic strain cluster.

  11. Phylogenetic and genomic characterization of a novel atypical porcine pestivirus in China.

    Science.gov (United States)

    Zhang, H; Wen, W; Hao, G; Hu, Y; Chen, H; Qian, P; Li, X

    2018-02-01

    Atypical porcine pestivirus (APPV) has been considered a novel pestivirus and causative agent of congenital tremor type A-II. An APPV CH-GX2016 strain was characterized from newly born piglets with clinical symptoms of congenital tremor in Guangxi, China. The genome of APPV CH-GX 2016 strain was 11,475 bp in length and encoded a polyprotein composed of the 3,635 amino acids. This genome sequence exhibited 88.0% to 90.8% nucleotide sequence homology with other APPV reference sequences in GenBank. Phylogenetic analysis further showed that APPV CH-GX is a novel pestivirus compared with previously described classical pestivirus strains. Therefore, APPV is present in pigs in China. © 2017 Blackwell Verlag GmbH.

  12. Phylogenetic reconstruction and polymorphism analysis of BK virus VP2 gene isolated from renal transplant recipients in China.

    Science.gov (United States)

    Wang, Zhang-Yang; Hong, Wei-Long; Zhu, Zhe-Hui; Chen, Yun-Hao; Ye, Wen-LE; Chu, Guang-Yu; Li, Jia-Lin; Chen, Bi-Cheng; Xia, Peng

    2015-11-01

    BK polyomavirus (BKV) is important pathogen for kidney transplant recipients, as it is frequently re-activated, leading to nephropathy. The aim of this study was to investigate the phylogenetic reconstruction and polymorphism of the VP2 gene in BKV isolated from Chinese kidney transplant recipients. Phylogenetic analysis was carried out in the VP2 region from 135 BKV-positive samples and 28 reference strains retrieved from GenBank. The unweighted pair-group method with arithmetic mean (UPGMA) grouped all strains into subtypes, but failed to subdivide strains into subgroups. Among the plasma and urine samples, all plasma (23/23) and 82 urine samples (82/95) were identified to contain subtype I; the other 10 urine samples contained subtype IV. A 86-bp fragment was identified as a highly conserved sequence. Following alignment with 36 published BKV sequences from China, 92 sites of polymorphism were identified, including 11 single nucleotide polymorphisms (SNPs) prevalent in Chinese individuals and 30 SNPs that were specific to the two predominant subtypes I and IV. The limitations of the VP2 gene segment in subgrouping were confirmed by phylogenetic analysis. The conserved sequence and polymorphism identified in this study may be helpful in the detection and genotyping of BKV.

  13. Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

    Science.gov (United States)

    Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

    2016-01-01

    The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

  14. Draft genome comparison of representatives of the three dominant genotype groups of dairy Bacillus licheniformis strains.

    Science.gov (United States)

    Dhakal, Rajat; Seale, R Brent; Deeth, Hilton C; Craven, Heather; Turner, Mark S

    2014-06-01

    The spore-forming bacterium Bacillus licheniformis is a common contaminant of milk and milk products. Strains of this species isolated from dairy products can be differentiated into three major groups, namely, G, F1, and F2, using random amplification of polymorphic DNA (RAPD) analysis; however, little is known about the genomic differences between these groups and the identity of the fragments that make up their RAPD profiles. In this work we obtained high-quality draft genomes of representative strains from each of the three RAPD groups (designated strain G-1, strain F1-1, and strain F2-1) and compared them to each other and to B. licheniformis ATCC 14580 and Bacillus subtilis 168. Whole-genome comparison and multilocus sequence typing revealed that strain G-1 contains significant sequence variability and belongs to a lineage distinct from the group F strains. Strain G-1 was found to contain genes coding for a type I restriction modification system, urease production, and bacitracin synthesis, as well as the 8-kbp plasmid pFL7, and these genes were not present in strains F1-1 and F2-1. In agreement with this, all isolates of group G, but no group F isolates, were found to possess urease activity and antimicrobial activity against Micrococcus. Identification of RAPD band sequences revealed that differences in the RAPD profiles were due to differences in gene lengths, 3' ends of predicted primer binding sites, or gene presence or absence. This work provides a greater understanding of the phylogenetic and phenotypic differences observed within the B. licheniformis species.

  15. Morphologic, Phylogenetic and Chemical Characterization of a Brackish Colonial Picocyanobacterium (Coelosphaeriaceae with Bioactive Properties

    Directory of Open Access Journals (Sweden)

    Kerstin Häggqvist

    2016-04-01

    Full Text Available Despite their cosmopolitan distribution, knowledge on cyanobacteria in the family Coelosphaeriaceae is limited. In this study, a single species culture of a coelosphaeran cyanobacterium isolated from a brackish rock pool in the Baltic Sea was established. The strain was characterized by morphological features, partial 16S rRNA sequence and nonribosomal oligopeptide profile. The bioactivity of fractionated extracts against several serine proteases, as well as protein-serine/threonine phosphatases was studied. Phylogenetic analyses of the strain suggested a close relationship with Snowella litoralis, but its morphology resembled Woronichinia compacta. The controversial morphologic and phylogenetic results demonstrated remaining uncertainties regarding species division in this cyanobacteria family. Chemical analyses of the strain indicated production of nonribosomal oligopeptides. In fractionated extracts, masses and ion fragmentation spectra of seven possible anabaenopeptins were identified. Additionally, fragmentation spectra of cyanopeptolin-like peptides were collected in several of the fractions. The nonribosomal oligopeptide profile adds another potential identification criterion in future inter- and intraspecies comparisons of coelosphaeran cyanobacteria. The fractionated extracts showed significant activity against carboxypeptidase A and trypsin. Inhibition of these important metabolic enzymes might have impacts at the ecosystem level in aquatic habitats with high cyanobacteria densities.

  16. Phylogenetic analysis of Bacillus subtilis strains applicable to natto (fermented soybean) production

    Science.gov (United States)

    Spore-forming Bacillus strains that produce extracellular poly-'-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 365 strains, including B. subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting n...

  17. A natural M RNA reassortant arising from two distinct tospovirus species

    Science.gov (United States)

    The complete nucleotide sequence of a tospovirus isolate from south Florida tomatoes was determined. Phylogenetic reconstructions of each genomic RNA segment showed that this isolate was produced by reassortment of segments from two distinct tospovirus species. The S and L segments are most closel...

  18. European Origin of Bradyrhizobium Populations Infecting Lupins and Serradella in Soils of Western Australia and South Africa† ‡

    OpenAIRE

    Stępkowski, Tomasz; Moulin, Lionel; Krzyżańska, Agnieszka; McInnes, Alison; Law, Ian J.; Howieson, John

    2005-01-01

    We applied a multilocus phylogenetic approach to elucidate the origin of serradella and lupin Bradyrhizobium strains that persist in soils of Western Australia and South Africa. The selected strains belonged to different randomly amplified polymorphic DNA (RAPD)-PCR clusters that were distinct from RAPD clusters of applied inoculant strains. Phylogenetic analyses were performed with nodulation genes (nodA, nodZ, nolL, noeI), housekeeping genes (dnaK, recA, glnII, atpD), and 16S-23S rRNA inter...

  19. Antimicrobial Resistance Characteristics and Phylogenetic Groups of Escherichia coli Isolated From Diarrheic Calves in Southeast of Iran

    Directory of Open Access Journals (Sweden)

    Zahedeh Naderi

    2016-11-01

    Full Text Available Background: Antimicrobial resistance is one of the main challenges in diarrheal diseases in human and animals. Regardless to the main reason of the disease, approximately all antimicrobial actions including treatment, control and prevention are mostly centralized against Escherichia coli (E. coli strains. Objectives: This work purposed to antimicrobial resistance (AR and determinate virulence genes and phylogenetic groups in E. coli isolates (n=170 obtained from calves with diarrhea. Materials and methods: Isolates were molecular characterized for 17 AR genes and 3 phylogenetic sequences. AR phenotyping were performed on all strains for 12 antimicrobial agents by using disc diffusion method. Results: All AR genes but qnrS were identified with different prevalence in E. coli isolates that the most common genes were aadA (20%, blaTEM (11.7% and sulII (11.2 % belonging to aminoglycoside, β-lactamase and sulphonamide families, respectively. Resistance to the penicillin and sulphamethoxazole drugs was found in 100% of isolates and followed by tetracycline (73.5%, streptomycin (60%, trimethoprim sulphamethoxazole (56.5% and kanamycin (53.5%. The phylogenetic groups A and B1 considerably surrounded the majority of isolates with the frequency of 65.8% and 30.6%, respectively. Conclusions: In Iran, diarrheic calves have an important role as reservoir of resistant E. coli strains against the some drugs which are registered for treatment of calf diarrhea.

  20. Serological and virological survey of hepatitis E virus (HEV) in animal reservoirs from Uruguay reveals elevated prevalences and a very close phylogenetic relationship between swine and human strains.

    Science.gov (United States)

    Mirazo, Santiago; Gardinali, Noemí R; Cecilia, D'Albora; Verger, Lorenzo; Ottonelli, Florencia; Ramos, Natalia; Castro, Gustavo; Pinto, Marcelo A; Ré, Viviana; Pisano, Belén; Lozano, Alejandra; de Oliveira, Jaqueline Mendes; Arbiza, Juan

    2018-01-01

    Hepatitis E virus (HEV) infection is an issue of public health concern in high-income and non-endemic countries. Increasing evidence supports the hypothesis of a zoonotic route as the main mode of infection in this epidemiological setting, since the transmission of genotypes HEV-3 and HEV-4 from reservoirs to humans has been demonstrated. In America, studies have confirmed the circulation of HEV in pig herds but the zoonotic role of wild boars has never been evaluated. Uruguay has a high burden of HEV- associated acute hepatitis, and a close phylogenetic relationship was observed among human HEV-3 strains and European isolates detected in swine. However in this context, swine herds have never been surveyed. Herein is reported a survey of HEV in swine herds, pigs at slaughter-house and free-living wild boar populations. Two-hundred and twenty sera and 150 liver tissue samples from domestic pigs, and 140 sera from wild boars were tested for HEV by ELISA and PCR-based approaches. All tested swine farms resulted seropositive with an overall rate of 46.8%. In turn, 22.1% of the wild boars had anti-HEV antibodies. HEV RNA was detected in 16.6% and 9.3% of liver samples from slaughter-age pigs and adult wild boars sera, respectively. Three strains from domestic pig were also amplified by nested-PCR approaches. By contrast, none of the positive samples obtained from wild boars could be confirmed by nested-PCR. Phylogenetic analysis revealed a very high nucleotide identity among swine strains and sequences obtained from humans in Uruguay. Results showed that HEV is widely distributed among swine herds in Uruguay. Additionally, this study evidences for the first time in the American continent that wild boar populations are a reservoir for HEV, though its zoonotic role remains to be elucidated. Altogether, data presented here suggest a high zoonotic risk of HEV transmission from swine to humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Morphological characteristics and phylogenetic analyses of unusual morphospecies of Microcystis novacekii forming bloom in the Cheffia Dam (Algeria

    Directory of Open Access Journals (Sweden)

    Noureddine BOUAÏCHA

    2009-08-01

    Full Text Available The toxicological potential and morphological characteristics and phylogenetic analysis based on the 16S rDNA sequence and the 16S-23S rDNA internal transcribed spacer (ITS were investigated in unusual morphospecies of Microcystis (MCYS-CH01 isolated from the Cheffia Dam in Algeria. The presence of microcystin synthetase genes (mcyA, -B, and -C in isolated colonies of this morphospecies, and the fact that serine/threonine phosphatase (PP2A was inhibited by its crude extract indicated that this morphospecies was microcystin-producer. The morphological features of this unusual morphospecies were very different from any of those described in the literature of all known species of Microcystis. The phylogenic tree based on 16S rDNA sequences shows that this morphospecies is indistinguishable from the reference strain Microcystis aeruginosa PCC 7806 and from many other known Microcystis species and, therefore, this tree did not necessarily correlate to the distinctions between morphospecies. However, phylogenetic analysis based on the 16S-23S rRNA spacer region could be an effective way to assign this unusual morphospecies MCYS-CH01 to the Asian species Microcystis novacekii. Comparison of the ITS sequence of this morphospecies with sequences available in the GenBank database showed that some highly conserved genotypes are found throughout the world.

  2. Culture and hybridization experiments on an ulva clade including the Qingdao strain blooming in the yellow sea.

    Directory of Open Access Journals (Sweden)

    Masanori Hiraoka

    2011-05-01

    Full Text Available In the summer of 2008, immediately prior to the Beijing Olympics, a massive green tide of the genus Ulva covered the Qingdao coast of the Yellow Sea in China. Based on molecular analyses using the nuclear encoded rDNA internal transcribed spacer (ITS region, the Qingdao strains dominating the green tide were reported to be included in a single phylogenetic clade, currently regarded as a single species. On the other hand, our detailed phylogenetic analyses of the clade, using a higher resolution DNA marker, suggested that two genetically separate entities could be included within the clade. However, speciation within the Ulva clade has not yet been examined. We examined the occurrence of an intricate speciation within the clade, including the Qingdao strains, via combined studies of culture, hybridization and phylogenetic analysis. The two entities separated by our phylogenetic analyses of the clade were simply distinguished as U. linza and U. prolifera morphologically by the absence or presence of branches in cultured thalli. The inclusion of sexual strains and several asexual strains were found in each taxon. Hybridizations among the sexual strains also supported the separation by a partial gamete incompatibility. The sexually reproducing Qingdao strains crossed with U. prolifera without any reproductive boundary, but a complete reproductive isolation to U. linza occurred by gamete incompatibility. The results demonstrate that the U. prolifera group includes two types of sexual strains distinguishable by crossing affinity to U. linza. Species identification within the Ulva clade requires high resolution DNA markers and/or hybridization experiments and is not possible by reliance on the ITS markers alone.

  3. Culture and Hybridization Experiments on an Ulva Clade Including the Qingdao Strain Blooming in the Yellow Sea

    Science.gov (United States)

    Hiraoka, Masanori; Ichihara, Kensuke; Zhu, Wenrong; Ma, Jiahai; Shimada, Satoshi

    2011-01-01

    In the summer of 2008, immediately prior to the Beijing Olympics, a massive green tide of the genus Ulva covered the Qingdao coast of the Yellow Sea in China. Based on molecular analyses using the nuclear encoded rDNA internal transcribed spacer (ITS) region, the Qingdao strains dominating the green tide were reported to be included in a single phylogenetic clade, currently regarded as a single species. On the other hand, our detailed phylogenetic analyses of the clade, using a higher resolution DNA marker, suggested that two genetically separate entities could be included within the clade. However, speciation within the Ulva clade has not yet been examined. We examined the occurrence of an intricate speciation within the clade, including the Qingdao strains, via combined studies of culture, hybridization and phylogenetic analysis. The two entities separated by our phylogenetic analyses of the clade were simply distinguished as U. linza and U. prolifera morphologically by the absence or presence of branches in cultured thalli. The inclusion of sexual strains and several asexual strains were found in each taxon. Hybridizations among the sexual strains also supported the separation by a partial gamete incompatibility. The sexually reproducing Qingdao strains crossed with U. prolifera without any reproductive boundary, but a complete reproductive isolation to U. linza occurred by gamete incompatibility. The results demonstrate that the U. prolifera group includes two types of sexual strains distinguishable by crossing affinity to U. linza. Species identification within the Ulva clade requires high resolution DNA markers and/or hybridization experiments and is not possible by reliance on the ITS markers alone. PMID:21573216

  4. Unique Strain of Rickettsia parkeri Associated with the Hard Tick Dermacentor parumapertus Neumann in the Western United States.

    Science.gov (United States)

    Paddock, Christopher D; Allerdice, Michelle E J; Karpathy, Sandor E; Nicholson, William L; Levin, Michael L; Smith, Travis C; Becker, Tom; Delph, Robert J; Knight, Robert N; Ritter, Jana M; Sanders, Jeanine H; Goddard, Jerome

    2017-05-01

    In 1953, investigators at the Rocky Mountain Laboratories in Hamilton, MT, described the isolation of a spotted fever group Rickettsia (SFGR) species from Dermacentor parumapertus ticks collected from black-tailed jackrabbits ( Lepus californicus ) in northern Nevada. Several decades later, investigators characterized this SFGR (designated the parumapertus agent) by using mouse serotyping methods and determined that it represented a distinct rickettsial serotype closely related to Rickettsia parkeri ; nonetheless, the parumapertus agent was not further characterized or studied. To our knowledge, no isolates of the parumapertus agent remain in any rickettsial culture collection, which precludes contemporary phylogenetic placement of this enigmatic SFGR. To rediscover the parumapertus agent, adult-stage D. parumapertus ticks were collected from black-tailed jackrabbits shot or encountered as roadkills in Arizona, Utah, or Texas from 2011 to 2016. A total of 339 ticks were collected and evaluated for infection with Rickettsia species. Of 112 D. parumapertus ticks collected in south Texas, 16 (14.3%) contained partial ompA sequences with the closest identity (99.6%) to Rickettsia sp. strain Atlantic rainforest Aa46, an SFGR that is closely related or identical to an SFGR species that causes a mild rickettsiosis in several states of Brazil. A pure isolate, designated strain Black Gap, was cultivated in Vero E6 cells, and sequence analysis of the rrs , gltA , sca0 , sca5 , and sca4 genes also revealed the closest genetic identity to Rickettsia sp. Atlantic rainforest Aa46. Phylogenetic analysis of the five concatenated rickettsial genes place Rickettsia sp. strain Black Gap and Rickettsia sp. Atlantic rainforest Aa46 with R. parkeri in a distinct and well-supported clade. IMPORTANCE We suggest that Rickettsia sp. Black Gap and Rickettsia sp. Atlantic rainforest Aa46 represent nearly identical strains of R. parkeri and that Rickettsia sp. Black Gap or a very similar

  5. Comparative genomic analysis of coffee-infecting Xylella fastidiosa strains isolated from Brazil.

    Science.gov (United States)

    Barbosa, Deibs; Alencar, Valquíria Campos; Santos, Daiene Souza; de Freitas Oliveira, Ana Cláudia; de Souza, Alessandra A; Coletta-Filho, Helvecio D; de Oliveira, Regina Souza; Nunes, Luiz R

    2015-05-01

    Strains of Xylella fastidiosa constitute a complex group of bacteria that develop within the xylem of many plant hosts, causing diseases of significant economic importance, such as Pierce's disease in North American grapevines and citrus variegated chlorosis in Brazil. X. fastidiosa has also been obtained from other host plants, in direct correlation with the development of diseases, as in the case of coffee leaf scorch (CLS)--a disease with potential to cause severe economic losses to the Brazilian coffee industry. This paper describes a thorough genomic characterization of coffee-infecting X. fastidiosa strains, initially performed through a microarray-based approach, which demonstrated that CLS strains could be subdivided in two phylogenetically distinct subgroups. Whole-genomic sequencing of two of these bacteria (one from each subgroup) allowed identification of ORFs and horizontally transferred elements (HTEs) that were specific to CLS-related X. fastidiosa strains. Such analyses confirmed the size and importance of HTEs as major mediators of chromosomal evolution amongst these bacteria, and allowed identification of differences in gene content, after comparisons were made with previously sequenced X. fastidiosa strains, isolated from alternative hosts. Although direct experimentation still needs to be performed to elucidate the biological consequences associated with such differences, it was interesting to verify that CLS-related bacteria display variations in genes that produce toxins, as well as surface-related factors (such as fimbrial adhesins and LPS) that have been shown to be involved with recognition of specific host factors in different pathogenic bacteria. © 2015 The Authors.

  6. Genotypic comparison of Pantoea agglomerans plant and clinical strains

    Directory of Open Access Journals (Sweden)

    Frey Jürg E

    2009-09-01

    Full Text Available Abstract Background Pantoea agglomerans strains are among the most promising biocontrol agents for a variety of bacterial and fungal plant diseases, particularly fire blight of apple and pear. However, commercial registration of P. agglomerans biocontrol products is hampered because this species is currently listed as a biosafety level 2 (BL2 organism due to clinical reports as an opportunistic human pathogen. This study compares plant-origin and clinical strains in a search for discriminating genotypic/phenotypic markers using multi-locus phylogenetic analysis and fluorescent amplified fragment length polymorphisms (fAFLP fingerprinting. Results Majority of the clinical isolates from culture collections were found to be improperly designated as P. agglomerans after sequence analysis. The frequent taxonomic rearrangements underwent by the Enterobacter agglomerans/Erwinia herbicola complex may be a major problem in assessing clinical associations within P. agglomerans. In the P. agglomerans sensu stricto (in the stricter sense group, there was no discrete clustering of clinical/biocontrol strains and no marker was identified that was uniquely associated to clinical strains. A putative biocontrol-specific fAFLP marker was identified only in biocontrol strains. The partial ORF located in this band corresponded to an ABC transporter that was found in all P. agglomerans strains. Conclusion Taxonomic mischaracterization was identified as a major problem with P. agglomerans, and current techniques removed a majority of clinical strains from this species. Although clear discrimination between P. agglomerans plant and clinical strains was not obtained with phylogenetic analysis, a single marker characteristic of biocontrol strains was identified which may be of use in strain biosafety determinations. In addition, the lack of Koch's postulate fulfilment, rare retention of clinical strains for subsequent confirmation, and the polymicrobial nature of P

  7. On the origin of the treponematoses: a phylogenetic approach.

    Directory of Open Access Journals (Sweden)

    Kristin N Harper

    2008-01-01

    Full Text Available Since the first recorded epidemic of syphilis in 1495, controversy has surrounded the origins of the bacterium Treponema pallidum subsp. pallidum and its relationship to the pathogens responsible for the other treponemal diseases: yaws, endemic syphilis, and pinta. Some researchers have argued that the syphilis-causing bacterium, or its progenitor, was brought from the New World to Europe by Christopher Columbus and his men, while others maintain that the treponematoses, including syphilis, have a much longer history on the European continent.We applied phylogenetics to this problem, using data from 21 genetic regions examined in 26 geographically disparate strains of pathogenic Treponema. Of all the strains examined, the venereal syphilis-causing strains originated most recently and were more closely related to yaws-causing strains from South America than to other non-venereal strains. Old World yaws-causing strains occupied a basal position on the tree, indicating that they arose first in human history, and a simian strain of T. pallidum was found to be indistinguishable from them.Our results lend support to the Columbian theory of syphilis's origin while suggesting that the non-sexually transmitted subspecies arose earlier in the Old World. This study represents the first attempt to address the problem of the origin of syphilis using molecular genetics, as well as the first source of information regarding the genetic make-up of non-venereal strains from the Western hemisphere.

  8. Comparative Genomics and Characterization of Hybrid Shigatoxigenic and Enterotoxigenic Escherichia coli (STEC/ETEC) Strains.

    Science.gov (United States)

    Nyholm, Outi; Halkilahti, Jani; Wiklund, Gudrun; Okeke, Uche; Paulin, Lars; Auvinen, Petri; Haukka, Kaisa; Siitonen, Anja

    2015-01-01

    Shigatoxigenic Escherichia coli (STEC) and enterotoxigenic E. coli (ETEC) cause serious foodborne infections in humans. These two pathogroups are defined based on the pathogroup-associated virulence genes: stx encoding Shiga toxin (Stx) for STEC and elt encoding heat-labile and/or est encoding heat-stable enterotoxin (ST) for ETEC. The study investigated the genomics of STEC/ETEC hybrid strains to determine their phylogenetic position among E. coli and to define the virulence genes they harbor. The whole genomes of three STEC/ETEC strains possessing both stx and est genes were sequenced using PacBio RS sequencer. Two of the strains were isolated from the patients, one with hemolytic uremic syndrome, and one with diarrhea. The third strain was of bovine origin. Core genome analysis of the shared chromosomal genes and comparison with E. coli and Shigella spp. reference genomes was performed to determine the phylogenetic position of the STEC/ETEC strains. In addition, a set of virulence genes and ETEC colonization factors were extracted from the genomes. The production of Stx and ST were studied. The human STEC/ETEC strains clustered with strains representing ETEC, STEC, enteroaggregative E. coli, and commensal and laboratory-adapted E. coli. However, the bovine STEC/ETEC strain formed a remote cluster with two STECs of bovine origin. All three STEC/ETEC strains harbored several other virulence genes, apart from stx and est, and lacked ETEC colonization factors. Two STEC/ETEC strains produced both toxins and one strain Stx only. This study shows that pathogroup-associated virulence genes of different E. coli can co-exist in strains originating from different phylogenetic lineages. The possibility of virulence genes to be associated with several E. coli pathogroups should be taken into account in strain typing and in epidemiological surveillance. Development of novel hybrid E. coli strains may cause a new public health risk, which challenges the traditional diagnostics

  9. Comparative Genomics and Characterization of Hybrid Shigatoxigenic and Enterotoxigenic Escherichia coli (STEC/ETEC Strains.

    Directory of Open Access Journals (Sweden)

    Outi Nyholm

    Full Text Available Shigatoxigenic Escherichia coli (STEC and enterotoxigenic E. coli (ETEC cause serious foodborne infections in humans. These two pathogroups are defined based on the pathogroup-associated virulence genes: stx encoding Shiga toxin (Stx for STEC and elt encoding heat-labile and/or est encoding heat-stable enterotoxin (ST for ETEC. The study investigated the genomics of STEC/ETEC hybrid strains to determine their phylogenetic position among E. coli and to define the virulence genes they harbor.The whole genomes of three STEC/ETEC strains possessing both stx and est genes were sequenced using PacBio RS sequencer. Two of the strains were isolated from the patients, one with hemolytic uremic syndrome, and one with diarrhea. The third strain was of bovine origin. Core genome analysis of the shared chromosomal genes and comparison with E. coli and Shigella spp. reference genomes was performed to determine the phylogenetic position of the STEC/ETEC strains. In addition, a set of virulence genes and ETEC colonization factors were extracted from the genomes. The production of Stx and ST were studied.The human STEC/ETEC strains clustered with strains representing ETEC, STEC, enteroaggregative E. coli, and commensal and laboratory-adapted E. coli. However, the bovine STEC/ETEC strain formed a remote cluster with two STECs of bovine origin. All three STEC/ETEC strains harbored several other virulence genes, apart from stx and est, and lacked ETEC colonization factors. Two STEC/ETEC strains produced both toxins and one strain Stx only.This study shows that pathogroup-associated virulence genes of different E. coli can co-exist in strains originating from different phylogenetic lineages. The possibility of virulence genes to be associated with several E. coli pathogroups should be taken into account in strain typing and in epidemiological surveillance. Development of novel hybrid E. coli strains may cause a new public health risk, which challenges the

  10. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure.

    Science.gov (United States)

    Zappi, Daniela C; Moro, Marcelo F; Meagher, Thomas R; Nic Lughadha, Eimear

    2017-01-01

    Old, climate-buffered infertile landscapes (Ocbils) have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil's campos rupestres (rupestrian grasslands) are home to almost 15% of Brazil's native flora in less than 0.8% of Brazil's territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ) and on ironstone substrates, commonly termed canga . Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC), which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be effective

  11. Plant Biodiversity Drivers in Brazilian Campos Rupestres: Insights from Phylogenetic Structure

    Directory of Open Access Journals (Sweden)

    Daniela C. Zappi

    2017-12-01

    Full Text Available Old, climate-buffered infertile landscapes (Ocbils have attracted increasing levels of interest in recent years because of their exceptionally diverse plant communities. Brazil’s campos rupestres (rupestrian grasslands are home to almost 15% of Brazil’s native flora in less than 0.8% of Brazil’s territory: an ideal study system for exploring variation in floristic diversity and phylogenetic structure in sites differing in geology and phytophysiognomy. We found significant differences in floristic diversity and phylogenetic structure across a range of study sites encompassing open vegetation and forest on quartzite (FQ and on ironstone substrates, commonly termed canga. Substrate and physiognomy were key in structuring floristic diversity in the Espinhaço and physiognomy was more important than substrate in structuring phylogenetic diversity, with neither substrate nor its interaction with physiognomy accounting for significant variation in phylogenetic structure. Phylogenetic clustering was significant in open vegetation on both canga and quartzite, reflecting the potential role of environmental filtering in these exposed montane communities adapted to multiple environmental stressors. In forest communities, phylogenetic clustering was significant only at relatively deep nodes of the phylogeny in FQ while no significant phylogenetic clustering was detected across forest on canga (FC, which may be attributable to proximity to the megadiverse Atlantic forest biome and/or comparatively benign environmental conditions in FC with relatively deep, nutrient-rich soils and access to edaphic water reliable in comparison to those for open vegetation on canga and open or forest communities on quartzite. Clades representing relatively old lineages are significantly over-represented in campos rupestres on quartzite, consistent with the Gondwanan Heritage Hypothesis of Ocbil theory. In contrast, forested sites on canga are recognized as Yodfels. To be

  12. [Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

    Science.gov (United States)

    Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

    2013-07-04

    Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

  13. Pyroprinting: a rapid and flexible genotypic fingerprinting method for typing bacterial strains.

    Science.gov (United States)

    Black, Michael W; VanderKelen, Jennifer; Montana, Aldrin; Dekhtyar, Alexander; Neal, Emily; Goodman, Anya; Kitts, Christopher L

    2014-10-01

    Bacterial strain typing is commonly employed in studies involving epidemiology, population ecology, and microbial source tracking to identify sources of fecal contamination. Methods for differentiating strains generally use either a collection of phenotypic traits or rely on some interrogation of the bacterial genotype. This report introduces pyroprinting, a novel genotypic strain typing method that is rapid, inexpensive, and discriminating compared to the most sensitive methods already in use. Pyroprinting relies on the simultaneous pyrosequencing of polymorphic multicopy loci, such as the intergenic transcribed spacer regions of rRNA operons in bacterial genomes. Data generated by sequencing combinations of variable templates are reproducible and intrinsically digitized. The theory and development of pyroprinting in Escherichia coli, including the selection of similarity thresholds to define matches between isolates, are presented. The pyroprint-based strain differentiation limits and phylogenetic relevance compared to other typing methods are also explored. Pyroprinting is unique in its simplicity and, paradoxically, in its intrinsic complexity. This new approach serves as an excellent alternative to more cumbersome or less phylogenetically relevant strain typing methods. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Orenia metallireducens sp. nov. Strain Z6, a Novel Metal-Reducing Member of the Phylum Firmicutes from the Deep Subsurface

    Science.gov (United States)

    Sanford, Robert A.; Boyanov, Maxim I.; Kemner, Kenneth M.; O'Loughlin, Edward J.; Chang, Yun-juan; Locke, Randall A.; Weber, Joseph R.; Egan, Sheila M.; Mackie, Roderick I.; Cann, Isaac; Fouke, Bruce W.

    2016-01-01

    ABSTRACT A novel halophilic and metal-reducing bacterium, Orenia metallireducens strain Z6, was isolated from briny groundwater extracted from a 2.02 km-deep borehole in the Illinois Basin, IL. This organism shared 96% 16S rRNA gene similarity with Orenia marismortui but demonstrated physiological properties previously unknown for this genus. In addition to exhibiting a fermentative metabolism typical of the genus Orenia, strain Z6 reduces various metal oxides [Fe(III), Mn(IV), Co(III), and Cr(VI)], using H2 as the electron donor. Strain Z6 actively reduced ferrihydrite over broad ranges of pH (6 to 9.6), salinity (0.4 to 3.5 M NaCl), and temperature (20 to 60°C). At pH 6.5, strain Z6 also reduced more crystalline iron oxides, such as lepidocrocite (γ-FeOOH), goethite (α-FeOOH), and hematite (α-Fe2O3). Analysis of X-ray absorption fine structure (XAFS) following Fe(III) reduction by strain Z6 revealed spectra from ferrous secondary mineral phases consistent with the precipitation of vivianite [Fe3(PO4)2] and siderite (FeCO3). The draft genome assembled for strain Z6 is 3.47 Mb in size and contains 3,269 protein-coding genes. Unlike the well-understood iron-reducing Shewanella and Geobacter species, this organism lacks the c-type cytochromes for typical Fe(III) reduction. Strain Z6 represents the first bacterial species in the genus Orenia (order Halanaerobiales) reported to reduce ferric iron minerals and other metal oxides. This microbe expands both the phylogenetic and physiological scopes of iron-reducing microorganisms known to inhabit the deep subsurface and suggests new mechanisms for microbial iron reduction. These distinctions from other Orenia spp. support the designation of strain Z6 as a new species, Orenia metallireducens sp. nov. IMPORTANCE A novel iron-reducing species, Orenia metallireducens sp. nov., strain Z6, was isolated from groundwater collected from a geological formation located 2.02 km below land surface in the Illinois Basin, USA

  15. Herbicide and fertilizers promote analogous phylogenetic responses but opposite functional responses in plant communities

    International Nuclear Information System (INIS)

    Pellissier, Loïc; Wisz, Mary S; Strandberg, Beate; Damgaard, Christian

    2014-01-01

    Throughout the world, herbicides and fertilizers change species composition in agricultural communities, but how do the cumulative effects of these chemicals impact the functional and phylogenetic structure of non-targeted communities when they drift into adjacent semi-natural habitats? Based on long-term experiment we show that fertilizer and herbicides (glyphosate) have contrasting effects on functional structure, but can increase phylogenetic diversity in semi-natural plant communities. We found that an increase in nitrogen promoted an increase in the average specific leaf area and canopy height at the community level, but an increase in glyphosate promoted a decrease in those traits. Phylogenetic diversity of plant communities increased when herbicide and fertilizer were applied together, likely because functional traits facilitating plant success in those conditions were not phylogenetically conserved. Species richness also decreased with increasing levels of nitrogen and glyphosate. Our results suggest that predicting the cumulative effects of agrochemicals is more complex than anticipated due to their distinct selection of traits that may or may not be conserved phylogenetically. Precautionary efforts to mitigate drift of agricultural chemicals into semi-natural habitats are warranted to prevent unforeseeable biodiversity shifts. (paper)

  16. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  17. High prevalence of hepatitis e virus in Swedish moose--a phylogenetic characterization and comparison of the virus from different regions.

    Directory of Open Access Journals (Sweden)

    Jay Lin

    Full Text Available Hepatitis E virus (HEV infects a range of species, including humans, pigs, wild boars and deer. Zoonotic transmission may contribute to the high HEV seroprevalence in the human population of many countries. A novel divergent HEV from moose (Alces alces in Sweden was recently identified by partial genome sequencing. Since only one strain was found, its classification within the HEV family, prevalence in moose and zoonotic potential was unclear. We therefore investigated samples from 231 moose in seven Swedish counties for HEV, and sequenced a near complete moose HEV genome. Phylogenetic analysis to classify this virus within the family Hepeviridae and to explore potential host specific determinants was performed.The HEV prevalence of moose was determined by PCR (marker for active infection and serological assays (marker of past infection of sera and 51 fecal samples from 231 Swedish moose. Markers of active and past infection were found in 67 (29% animals, while 34 (15% were positive for HEV RNA, 43 (19% were seropositive for anti-HEV antibodies, and 10 (4% had both markers. The number of young individuals positive for HEV RNA was larger than for older individuals, and the number of anti-HEV antibody positive individuals increased with age. The high throughput sequenced moose HEV genome was 35-60% identical to existing HEVs. Partial ORF1 sequences from 13 moose strains showed high similarity among them, forming a distinct monophyletic clade with a common ancestor to HEV genotype 1-6 group, which includes members known for zoonotic transmission.This study demonstrates a high frequency of HEV in moose in Sweden, with markers of current and past infection demonstrated in 30% of the animals. Moose is thus an important animal reservoir of HEV. The phylogenetic relationship demonstrated that the moose HEV belonged to the genotype 1-6 group, which includes strains that also infect humans, and therefore may signify a potential for zoonotic transmission

  18. Isolation and identification of a novel radio-resistant strain

    International Nuclear Information System (INIS)

    Zhang Zhidong; Mao Jun; Wang Wei; Tang Qiyong; Shi Yuhu

    2008-01-01

    A novel radio-resistant strain named RL2 was studied polyphasically, which was isolated from the soils in the Gurban-Tunggut Desert, Xinjiang. The strain is Gam-positive, sphere-shaped and pink pigmented; The DNA (G+C) contents of RL2 is 71.62mo1%; The 16S rDNA genes of RL2 and D. radiodurans type strain DSM20539 shows a high level of similarity (97.2%). According to phenotypic characteristics and phylogenetic analysis, it can be suggested that the strain RL2 has been identified as Deinococcus. sp and it may be a novel species. (authors)

  19. Molecular characterization and phylogenetic analysis of small ruminant lentiviruses isolated from Canadian sheep and goats

    Directory of Open Access Journals (Sweden)

    Bertoni Giuseppe

    2011-06-01

    Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.

  20. A duplex PCR assay for the detection of Ralstonia solanacearum phylotype II strains in Musa spp.

    Directory of Open Access Journals (Sweden)

    Gilles Cellier

    Full Text Available Banana wilt outbreaks that are attributable to Moko disease-causing strains of the pathogen Ralstonia solanacearum (Rs remain a social and economic burden for both multinational corporations and subsistence farmers. All known Moko strains belong to the phylotype II lineage, which has been previously recognized for its broad genetic basis. Moko strains are paraphyletic and are distributed among seven related but distinct phylogenetic clusters (sequevars that are potentially major threats to Musaceae, Solanaceae, and ornamental crops in many countries. Although clustered within the Moko IIB-4 sequevar, strains of the epidemiologically variant IIB-4NPB do not cause wilt on Cavendish or plantain bananas; instead, they establish a latent infection in the vascular tissues of plantains and demonstrate an expanded host range and high aggressiveness toward Solanaceae and Cucurbitaceae. Although most molecular diagnostic methods focus on strains that wilt Solanaceae (particularly potato, no relevant protocol has been described that universally detects strains of the Musaceae-infecting Rs phylotype II. Thus, a duplex PCR assay targeting Moko and IIB-4NPB variant strains was developed, and its performance was assessed using an extensive collection of 111 strains representing the known diversity of Rs Moko-related strains and IIB-4NPB variant strains along with certain related strains and families. The proposed diagnostic protocol demonstrated both high accuracy (inclusivity and exclusivity and high repeatability, detected targets on either pure culture or spiked plant extracts. Although they did not belong to the Moko clusters described at the time of the study, recently discovered banana-infecting strains from Brazil were also detected. According to our comprehensive evaluation, this duplex PCR assay appears suitable for both research and diagnostic laboratories and provides reliable detection of phylotype II Rs strains that infect Musaceae.

  1. Descriptive distribution and phylogenetic analysis of feline infectious peritonitis virus isolates of Malaysia

    Directory of Open Access Journals (Sweden)

    Arshad Habibah

    2010-01-01

    Full Text Available Abstract The descriptive distribution and phylogeny of feline coronaviruses (FCoVs were studied in cats suspected of having feline infectious peritonitis (FIP in Malaysia. Ascitic fluids and/or biopsy samples were subjected to a reverse transcription polymerase chain reaction (RT-PCR targeted for a conserved region of 3'untranslated region (3'UTR of the FCoV genome. Eighty nine percent of the sampled animals were positive for the presence of FCoV. Among the FCoV positive cats, 80% of cats were males and 64% were below 2 years of age. The FCoV positive cases included 56% domestic short hair (DSH, 40% Persian, and 4% Siamese cats. The nucleotide sequences of 10 selected amplified products from FIP cases were determined. The sequence comparison revealed that the field isolates had 96% homology with a few point mutations. The extent of homology decreased to 93% when compared with reference strains. The overall branching pattern of phylogenetic tree showed two distinct clusters, where all Malaysian isolates fall into one main genetic cluster. These findings provided the first genetic information of FCoV in Malaysia.

  2. Ixodes ricinus tick lipocalins: identification, cloning, phylogenetic analysis and biochemical characterization.

    Directory of Open Access Journals (Sweden)

    Jérôme Beaufays

    Full Text Available BACKGROUND: During their blood meal, ticks secrete a wide variety of proteins that interfere with their host's defense mechanisms. Among these proteins, lipocalins play a major role in the modulation of the inflammatory response. METHODOLOGY/PRINCIPAL FINDINGS: Screening a cDNA library in association with RT-PCR and RACE methodologies allowed us to identify 14 new lipocalin genes in the salivary glands of the Ixodes ricinus hard tick. A computational in-depth structural analysis confirmed that LIRs belong to the lipocalin family. These proteins were called LIR for "Lipocalin from I. ricinus" and numbered from 1 to 14 (LIR1 to LIR14. According to their percentage identity/similarity, LIR proteins may be assigned to 6 distinct phylogenetic groups. The mature proteins have calculated pM and pI varying from 21.8 kDa to 37.2 kDa and from 4.45 to 9.57 respectively. In a western blot analysis, all recombinant LIRs appeared as a series of thin bands at 50-70 kDa, suggesting extensive glycosylation, which was experimentally confirmed by treatment with N-glycosidase F. In addition, the in vivo expression analysis of LIRs in I. ricinus, examined by RT-PCR, showed homogeneous expression profiles for certain phylogenetic groups and relatively heterogeneous profiles for other groups. Finally, we demonstrated that LIR6 codes for a protein that specifically binds leukotriene B4. CONCLUSIONS/SIGNIFICANCE: This work confirms that, regarding their biochemical properties, expression profile, and sequence signature, lipocalins in Ixodes hard tick genus, and more specifically in the Ixodes ricinus species, are segregated into distinct phylogenetic groups suggesting potential distinct function. This was particularly demonstrated by the ability of LIR6 to scavenge leukotriene B4. The other LIRs did not bind any of the ligands tested, such as 5-hydroxytryptamine, ADP, norepinephrine, platelet activating factor, prostaglandins D2 and E2, and finally leukotrienes B4 and C

  3. Mesorhizobium shonense sp. nov., Mesorhizobium hawassense sp. nov. and Mesorhizobium abyssinicae sp. nov., isolated from root nodules of different agroforestry legume trees.

    Science.gov (United States)

    Degefu, Tulu; Wolde-Meskel, Endalkachew; Liu, Binbin; Cleenwerck, Ilse; Willems, Anne; Frostegård, Åsa

    2013-05-01

    A total of 18 strains, representing members of the genus Mesorhizobium, obtained from root nodules of woody legumes growing in Ethiopia, have been previously shown, by multilocus sequence analysis (MLSA) of five housekeeping genes, to form three novel genospecies. In the present study, the phylogenetic relationship between representative strains of these three genospecies and the type strains of their closest phylogenetic neighbours Mesorhizobium plurifarium, Mesorhizobium amorphae, Mesorhizobium septentrionale and Mesorhizobium huakuii was further evaluated using a polyphasic taxonomic approach. In line with our earlier MLSA of other housekeeping genes, the phylogenetic trees derived from the atpD and glnII genes grouped the test strains into three well-supported, distinct lineages that exclude all defined species of the genus Mesorhizobium. The DNA-DNA relatedness between the representative strains of genospecies I-III and the type strains of their closest phylogenetic neighbours was low (≤59 %). They differed from each other and from their closest phylogenetic neighbours by the presence/absence of several fatty acids, or by large differences in the relative amounts of particular fatty acids. While showing distinctive features, they were generally able to utilize a wide range of substrates as sole carbon and nitrogen sources. The strains belonging to genospecies I, II and III therefore represent novel species for which we propose the names Mesorhizobium shonense sp. nov., Mesorhizobium hawassense sp. nov. and Mesorhizobium abyssinicae sp. nov. The isolates AC39a(T) ( = LMG 26966(T) = HAMBI 3295(T)), AC99b(T) ( = LMG 26968(T) = HAMBI 3301(T)) and AC98c(T) ( = LMG 26967(T) = HAMBI 3306(T)) are proposed as type strains for the respective novel species.

  4. Global patterns of evolutionary distinct and globally endangered amphibians and mammals.

    Science.gov (United States)

    Safi, Kamran; Armour-Marshall, Katrina; Baillie, Jonathan E M; Isaac, Nick J B

    2013-01-01

    Conservation of phylogenetic diversity allows maximising evolutionary information preserved within fauna and flora. The "EDGE of Existence" programme is the first institutional conservation initiative that prioritises species based on phylogenetic information. Species are ranked in two ways: one according to their evolutionary distinctiveness (ED) and second, by including IUCN extinction status, their evolutionary distinctiveness and global endangerment (EDGE). Here, we describe the global patterns in the spatial distribution of priority ED and EDGE species, in order to identify conservation areas for mammalian and amphibian communities. In addition, we investigate whether environmental conditions can predict the observed spatial pattern in ED and EDGE globally. Priority zones with high concentrations of ED and EDGE scores were defined using two different methods. The overlap between mammal and amphibian zones was very small, reflecting the different phylo-biogeographic histories. Mammal ED zones were predominantly found on the African continent and the neotropical forests, whereas in amphibians, ED zones were concentrated in North America. Mammal EDGE zones were mainly in South-East Asia, southern Africa and Madagascar; for amphibians they were in central and south America. The spatial pattern of ED and EDGE was poorly described by a suite of environmental variables. Mapping the spatial distribution of ED and EDGE provides an important step towards identifying priority areas for the conservation of mammalian and amphibian phylogenetic diversity in the EDGE of existence programme.

  5. Phylogeny of Mycobacterium tuberculosis Beijing strains constructed from polymorphisms in genes involved in DNA replication, recombination and repair.

    Science.gov (United States)

    Mestre, Olga; Luo, Tao; Dos Vultos, Tiago; Kremer, Kristin; Murray, Alan; Namouchi, Amine; Jackson, Céline; Rauzier, Jean; Bifani, Pablo; Warren, Rob; Rasolofo, Voahangy; Mei, Jian; Gao, Qian; Gicquel, Brigitte

    2011-01-20

    The Beijing family is a successful group of M. tuberculosis strains, often associated with drug resistance and widely distributed throughout the world. Polymorphic genetic markers have been used to type particular M. tuberculosis strains. We recently identified a group of polymorphic DNA repair replication and recombination (3R) genes. It was shown that evolution of M. tuberculosis complex strains can be studied using 3R SNPs and a high-resolution tool for strain discrimination was developed. Here we investigated the genetic diversity and propose a phylogeny for Beijing strains by analyzing polymorphisms in 3R genes. A group of 3R genes was sequenced in a collection of Beijing strains from different geographic origins. Sequence analysis and comparison with the ones of non-Beijing strains identified several SNPs. These SNPs were used to type a larger collection of Beijing strains and allowed identification of 26 different sequence types for which a phylogeny was constructed. Phylogenetic relationships established by sequence types were in agreement with evolutionary pathways suggested by other genetic markers, such as Large Sequence Polymorphisms (LSPs). A recent Beijing genotype (Bmyc10), which included 60% of strains from distinct parts of the world, appeared to be predominant. We found SNPs in 3R genes associated with the Beijing family, which enabled discrimination of different groups and the proposal of a phylogeny. The Beijing family can be divided into different groups characterized by particular genetic polymorphisms that may reflect pathogenic features. These SNPs are new, potential genetic markers that may contribute to better understand the success of the Beijing family.

  6. Phylogeny of Mycobacterium tuberculosis Beijing strains constructed from polymorphisms in genes involved in DNA replication, recombination and repair.

    Directory of Open Access Journals (Sweden)

    Olga Mestre

    2011-01-01

    Full Text Available The Beijing family is a successful group of M. tuberculosis strains, often associated with drug resistance and widely distributed throughout the world. Polymorphic genetic markers have been used to type particular M. tuberculosis strains. We recently identified a group of polymorphic DNA repair replication and recombination (3R genes. It was shown that evolution of M. tuberculosis complex strains can be studied using 3R SNPs and a high-resolution tool for strain discrimination was developed. Here we investigated the genetic diversity and propose a phylogeny for Beijing strains by analyzing polymorphisms in 3R genes.A group of 3R genes was sequenced in a collection of Beijing strains from different geographic origins. Sequence analysis and comparison with the ones of non-Beijing strains identified several SNPs. These SNPs were used to type a larger collection of Beijing strains and allowed identification of 26 different sequence types for which a phylogeny was constructed. Phylogenetic relationships established by sequence types were in agreement with evolutionary pathways suggested by other genetic markers, such as Large Sequence Polymorphisms (LSPs. A recent Beijing genotype (Bmyc10, which included 60% of strains from distinct parts of the world, appeared to be predominant.We found SNPs in 3R genes associated with the Beijing family, which enabled discrimination of different groups and the proposal of a phylogeny. The Beijing family can be divided into different groups characterized by particular genetic polymorphisms that may reflect pathogenic features. These SNPs are new, potential genetic markers that may contribute to better understand the success of the Beijing family.

  7. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  8. Genetic characterization and phylogenetic analysis of porcine circovirus type 2 (PCV2) in Serbia.

    Science.gov (United States)

    Savic, Bozidar; Milicevic, Vesna; Jakic-Dimic, Dobrila; Bojkovski, Jovan; Prodanovic, Radisa; Kureljusic, Branislav; Potkonjak, Aleksandar; Savic, Borivoje

    2012-01-01

    Porcine circovirus type 2 (PCV2) is the main causative agent of postweaning multisystemic wasting syndrome (PMWS). To characterize and determine the genetic diversity of PCV2 in the porcine population of Serbia, nucleotide and deduced amino acid sequences of the open reading frame 2 (ORF2) of PCV2 collected from the tissues of pigs that either had died as a result of PMWS or did not exhibit disease symptoms were analyzed. Sequencing and phylogenetic analysis showed considerable diversity among PCV2 ORF2 sequences and the existence of two main PCV2 genotypes, PCV2b and PCV2a, with at least three clusters, 1A/B, 1C and 2D. In order to provide further proof that the 1C strain is circulating in the porcine population, the whole viral genome of one PCV2 isolate was sequenced. Genotyping and phylogenetic analysis using the entire viral genome sequences confirmed that there was a PMWS-associated 1C strain emerging in Serbia. Our analysis also showed that PCV2b is dominant in the porcine population, and that it is exclusively associated with PMWS occurrences in the country. These data constitute a useful basis for further epidemiological studies regarding the heterogeneity of PCV2 strains on the European continent.

  9. Clinical and Molecular Characteristics of Human Rotavirus G8P[8] Outbreak Strain, Japan, 2014.

    Science.gov (United States)

    Kondo, Kenji; Tsugawa, Takeshi; Ono, Mayumi; Ohara, Toshio; Fujibayashi, Shinsuke; Tahara, Yasuo; Kubo, Noriaki; Nakata, Shuji; Higashidate, Yoshihito; Fujii, Yoshiki; Katayama, Kazuhiko; Yoto, Yuko; Tsutsumi, Hiroyuki

    2017-06-01

    During March-July 2014, rotavirus G8P[8] emerged as the predominant cause of rotavirus gastroenteritis among children in Hokkaido Prefecture, Japan. Clinical characteristics were similar for infections caused by G8 and non-G8 strains. Sequence and phylogenetic analyses suggest the strains were generated by multiple reassortment events between DS-1-like P[8] strains and bovine strains from Asia.

  10. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  11. Antibody responses in humans infected with newly emerging strains of West Nile Virus in Europe.

    Directory of Open Access Journals (Sweden)

    Stefan Chabierski

    Full Text Available Infection with West Nile Virus (WNV affects an increasing number of countries worldwide. Although most human infections result in no or mild flu-like symptoms, the elderly and those with a weakened immune system are at higher risk for developing severe neurological disease. Since its introduction into North America in 1999, WNV has spread across the continental United States and caused annual outbreaks with a total of 36,000 documented clinical cases and ∼1,500 deaths. In recent years, outbreaks of neuroinvasive disease also have been reported in Europe. The WNV strains isolated during these outbreaks differ from those in North America, as sequencing has revealed that distinct phylogenetic lineages of WNV concurrently circulate in Europe, which has potential implications for the development of vaccines, therapeutics, and diagnostic tests. Here, we studied the human antibody response to European WNV strains responsible for outbreaks in Italy and Greece in 2010, caused by lineage 1 and 2 strains, respectively. The WNV structural proteins were expressed as a series of overlapping fragments fused to a carrier-protein, and binding of IgG in sera from infected persons was analyzed. The results demonstrate that, although the humoral immune response to WNV in humans is heterogeneous, several dominant peptides are recognized.

  12. The Genomic Sequence of the Oral Pathobiont Strain NI1060 Reveals Unique Strategies for Bacterial Competition and Pathogenicity.

    Directory of Open Access Journals (Sweden)

    Youssef Darzi

    Full Text Available Strain NI1060 is an oral bacterium responsible for periodontitis in a murine ligature-induced disease model. To better understand its pathogenicity, we have determined the complete sequence of its 2,553,982 bp genome. Although closely related to Pasteurella pneumotropica, a pneumonia-associated rodent commensal based on its 16S rRNA, the NI1060 genomic content suggests that they are different species thriving on different energy sources via alternative metabolic pathways. Genomic and phylogenetic analyses showed that strain NI1060 is distinct from the genera currently described in the family Pasteurellaceae, and is likely to represent a novel species. In addition, we found putative virulence genes involved in lipooligosaccharide synthesis, adhesins and bacteriotoxic proteins. These genes are potentially important for host adaption and for the induction of dysbiosis through bacterial competition and pathogenicity. Importantly, strain NI1060 strongly stimulates Nod1, an innate immune receptor, but is defective in two peptidoglycan recycling genes due to a frameshift mutation. The in-depth analysis of its genome thus provides critical insights for the development of NI1060 as a prime model system for infectious disease.

  13. Comparison of the Pathogenesis of the Angola and Ravn Strains of Marburg Virus in the Outbred Guinea Pig Model.

    Science.gov (United States)

    Cross, Robert W; Fenton, Karla A; Geisbert, Joan B; Ebihara, Hideki; Mire, Chad E; Geisbert, Thomas W

    2015-10-01

    Phylogenetic comparisons of known Marburg virus (MARV) strains reveal 2 distinct genetic lineages: Ravn and the Lake Victoria Marburg complex (eg, Musoke, Popp, and Angola strains). Nucleotide variances of >20% between Ravn and other MARV genomes suggest that differing virulence between lineages may accompany this genetic divergence. To date, there exists limited systematic experimental evidence of pathogenic differences between MARV strains. Uniformly lethal outbred guinea pig models of MARV-Angola (MARV-Ang) and MARV-Ravn (MARV-Rav) were developed by serial adaptation. Changes in genomic sequence, weight, temperature, histopathologic findings, immunohistochemical findings, hematologic profiles, circulating biochemical enzyme levels, coagulation parameters, viremia levels, cytokine levels, eicanosoid levels, and nitric oxide production were compared between strains. MARV-Rav infection resulted in delayed increases in circulating inflammatory and prothrombotic elements, notably lower viremia levels, less severe histologic alterations, and a delay in mean time to death, compared with MARV-Ang infection. Both strains produced more marked coagulation abnormalities than previously seen in MARV-infected mice or inbred guinea pigs. Although both strains exhibit great similarity to pathogenic markers of human and nonhuman primate MARV infection, these data highlight several key differences in pathogenicity that may serve to guide the choice of strain and model used for development of vaccines or therapeutics for Marburg hemorrhagic fever. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  14. A phylogenetic transform enhances analysis of compositional microbiota data.

    Science.gov (United States)

    Silverman, Justin D; Washburne, Alex D; Mukherjee, Sayan; David, Lawrence A

    2017-02-15

    Surveys of microbial communities (microbiota), typically measured as relative abundance of species, have illustrated the importance of these communities in human health and disease. Yet, statistical artifacts commonly plague the analysis of relative abundance data. Here, we introduce the PhILR transform, which incorporates microbial evolutionary models with the isometric log-ratio transform to allow off-the-shelf statistical tools to be safely applied to microbiota surveys. We demonstrate that analyses of community-level structure can be applied to PhILR transformed data with performance on benchmarks rivaling or surpassing standard tools. Additionally, by decomposing distance in the PhILR transformed space, we identified neighboring clades that may have adapted to distinct human body sites. Decomposing variance revealed that covariation of bacterial clades within human body sites increases with phylogenetic relatedness. Together, these findings illustrate how the PhILR transform combines statistical and phylogenetic models to overcome compositional data challenges and enable evolutionary insights relevant to microbial communities.

  15. Detection, molecular characterization and phylogenetic analysis of full-length equine infectious anemia (EIAV) gag genes isolated from Shackleford Banks wild horses.

    Science.gov (United States)

    Capomaccio, S; Willand, Z A; Cook, S J; Issel, C J; Santos, E M; Reis, J K P; Cook, R F

    2012-06-15

    The genetically distinct wild horse herds inhabiting Shackleford Banks, North Carolina are probably the direct descendents of Spanish stock abandoned after failed attempts to settle mid-Atlantic coastal regions of North America in the Sixteenth Century. In a 1996 island survey, 41% of the gathered horses were discovered seropositive for Equine Infectious Anemia Virus (EIAV) with additional cases identified in 1997 and 1998. As a result of their unique genetic heritage, EIAV seropositive individuals identified in the two latter surveys were transferred to a quarantine facility on the mainland. In September 2008 two of the horses SB1 and SB2 after 10 and 11 years in quarantine respectively, developed clinical signs of EIA. In the case of SB2 these were so severe that the only humane option was euthanasia. Although SB1, survived it experienced a second clinical episode one month later. In May 2009, a third horse in quarantine, SB3, developed extremely severe clinical EIA and was euthanized. This demonstrates naturally infected long-term inapparent carriers can experience recrudescence of very severe disease many years after initial exposure to EIAV. Phylogenetic analysis of complete EIAV gag gene sequences obtained from each of three Shackleford horses demonstrated they were infected with very closely related viruses. Although these were distinguishable from all other strains examined, they belong to a monophyletic group comprising almost exclusively of New World isolates that is distinct from a number of recently characterized Central European EIAV strains. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. EvolView, an online tool for visualizing, annotating and managing phylogenetic trees.

    Science.gov (United States)

    Zhang, Huangkai; Gao, Shenghan; Lercher, Martin J; Hu, Songnian; Chen, Wei-Hua

    2012-07-01

    EvolView is a web application for visualizing, annotating and managing phylogenetic trees. First, EvolView is a phylogenetic tree viewer and customization tool; it visualizes trees in various formats, customizes them through built-in functions that can link information from external datasets, and exports the customized results to publication-ready figures. Second, EvolView is a tree and dataset management tool: users can easily organize related trees into distinct projects, add new datasets to trees and edit and manage existing trees and datasets. To make EvolView easy to use, it is equipped with an intuitive user interface. With a free account, users can save data and manipulations on the EvolView server. EvolView is freely available at: http://www.evolgenius.info/evolview.html.

  17. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  18. Use of phylogenetic and phenotypic analyses to identify nonhemolytic streptococci isolated from bacteremic patients.

    Science.gov (United States)

    Hoshino, Tomonori; Fujiwara, Taku; Kilian, Mogens

    2005-12-01

    The aim of this study was to evaluate molecular and phenotypic methods for the identification of nonhemolytic streptococci. A collection of 148 strains consisting of 115 clinical isolates from cases of infective endocarditis, septicemia, and meningitis and 33 reference strains, including type strains of all relevant Streptococcus species, were examined. Identification was performed by phylogenetic analysis of nucleotide sequences of four housekeeping genes, ddl, gdh, rpoB, and sodA; by PCR analysis of the glucosyltransferase (gtf) gene; and by conventional phenotypic characterization and identification using two commercial kits, Rapid ID 32 STREP and STREPTOGRAM and the associated databases. A phylogenetic tree based on concatenated sequences of the four housekeeping genes allowed unequivocal differentiation of recognized species and was used as the reference. Analysis of single gene sequences revealed deviation clustering in eight strains (5.4%) due to homologous recombination with other species. This was particularly evident in S. sanguinis and in members of the anginosus group of streptococci. The rate of correct identification of the strains by both commercial identification kits was below 50% but varied significantly between species. The most significant problems were observed with S. mitis and S. oralis and 11 Streptococcus species described since 1991. Our data indicate that identification based on multilocus sequence analysis is optimal. As a more practical alternative we recommend identification based on sodA sequences with reference to a comprehensive set of sequences that is available for downloading from our server. An analysis of the species distribution of 107 nonhemolytic streptococci from bacteremic patients showed a predominance of S. oralis and S. anginosus with various underlying infections.

  19. Potentials and limitations of histone repeat sequences for phylogenetic reconstruction of Sophophora.

    Science.gov (United States)

    Baldo, A M; Les, D H; Strausbaugh, L D

    1999-11-01

    Simplified DNA sequence acquisition has provided many new data sets that are useful for phylogenetic reconstruction, including single- and multiple-copy nuclear and organellar genes. Although transcribed regions receive much attention, nontranscribed regions have recently been added to the repertoire of sequences suitable for phylogenetic studies, especially for closely related taxa. We evaluated the efficacy of a small portion of the histone repeat for phylogenetic reconstruction among Drosophila species. Histone repeats in invertebrates offer distinct advantages similar to those of widely used ribosomal repeats. First, the units are tandemly repeated and undergo concerted evolution. Second, histone repeats include both highly conserved coding and variable intergenic regions. This composition facilitates application of "universal" primers spanning potentially informative sites. We examined a small region of the histone repeat, including the intergenic spacer segments of coding regions from the divergently transcribed H2A and H2B histone genes. The spacer (about 230 bp) exists as a mosaic with highly conserved functional motifs interspersed with rapidly diverging regions; the former aid in alignment of the spacer. There are no ambiguities in alignment of coding regions. Coding and noncoding regions were analyzed together and separately for phylogenetic information. Parsimony, distance, and maximum-likelihood methods successfully retrieve the corroborated phylogeny for the taxa examined. This study demonstrates the resolving power of a small histone region which may now be added to the growing collection of phylogenetically useful DNA sequences.

  20. Phylogenetic history demonstrates two different lineages of dengue type 1 virus in Colombia

    Directory of Open Access Journals (Sweden)

    Mendez Jairo A

    2010-09-01

    Full Text Available Abstract Background Dengue Fever is one of the most important viral re-emergent diseases affecting about 50 million people around the world especially in tropical and sub-tropical countries. In Colombia, the virus was first detected in the earliest 70's when the disease became a major public health concern. Since then, all four serotypes of the virus have been reported. Although most of the huge outbreaks reported in this country have involved dengue virus serotype 1 (DENV-1, there are not studies about its origin, genetic diversity and distribution. Results We used 224 bp corresponding to the carboxyl terminus of envelope (E gene from 74 Colombian isolates in order to reconstruct phylogenetic relationships and to estimate time divergences. Analyzed DENV-1 Colombian isolates belonged to the formerly defined genotype V. Only one virus isolate was clasified in the genotype I, likely representing a sole introduction that did not spread. The oldest strains were closely related to those detected for the first time in America in 1977 from the Caribbean and were detected for two years until their disappearance about six years later. Around 1987, a split up generated 2 lineages that have been evolving separately, although not major aminoacid changes in the analyzed region were found. Conclusion DENV-1 has been circulating since 1978 in Colombia. Yet, the phylogenetic relationships between strains isolated along the covered period of time suggests that viral strains detected in some years, although belonging to the same genotype V, have different recent origins corresponding to multiple re-introduction events of viral strains that were circulating in neighbor countries. Viral strains used in the present study did not form a monophyletic group, which is evidence of a polyphyletic origin. We report the rapid spread patterns and high evolution rate of the different DENV-1 lineages.

  1. Sequence-based comparative study of classical swine fever virus genogroup 2.2 isolate with pestivirus reference strains.

    Science.gov (United States)

    Kumar, Ravi; Rajak, Kaushal Kishor; Chandra, Tribhuwan; Muthuchelvan, Dhanavelu; Saxena, Arpit; Chaudhary, Dheeraj; Kumar, Ajay; Pandey, Awadh Bihari

    2015-09-01

    This study was undertaken with the aim to compare and establish the genetic relatedness between classical swine fever virus (CSFV) genogroup 2.2 isolate and pestivirus reference strains. The available complete genome sequences of CSFV/IND/UK/LAL-290 strain and other pestivirus reference strains were retrieved from GenBank. The complete genome sequence, complete open reading frame, 5' and 3' non-coding region (NCR) sequences were analyzed and compared with reference pestiviruses strains. Clustal W model in MegAlign program of Lasergene 6.0 software was used for analysis of genetic heterogeneity. Phylogenetic analysis was carried out using MEGA 6.06 software package. The complete genome sequence alignment of CSFV/IND/UK/LAL-290 isolate and reference pestivirus strains showed 58.9-72% identities at the nucleotide level and 50.3-76.9% at amino acid level. Sequence homology of 5' and 3' NCRs was found to be 64.1-82.3% and 22.9-71.4%, respectively. In phylogenetic analysis, overall tree topology was found similar irrespective of sequences used in this study; however, whole genome phylogeny of pestivirus formed two main clusters, which further distinguished into the monophyletic clade of each pestivirus species. CSFV/IND/UK/LAL-290 isolate placed with the CSFV Eystrup strain in the same clade with close proximity to border disease virus and Aydin strains. CSFV/IND/UK/LAL-290 exhibited the analogous genomic organization to those of all reference pestivirus strains. Based on sequence identity and phylogenetic analysis, the isolate showed close homology to Aydin/04-TR virus and distantly related to Bungowannah virus.

  2. New Introductions of Enterovirus 71 Subgenogroup C4 Strains, France, 2012

    Science.gov (United States)

    Henquell, Cécile; Mirand, Audrey; Coste-Burel, Marianne; Marque-Juillet, Stéphanie; Desbois, Delphine; Lagathu, Gisèle; Bornebusch, Laure; Bailly, Jean-Luc; Lina, Bruno

    2014-01-01

    In France during 2012, human enterovirus 71 (EV-A71) subgenogroup C4 strains were detected in 4 children hospitalized for neonatal fever or meningitis. Phylogenetic analysis showed novel and independent EV-A71 introductions, presumably from China, and suggested circulation of C4 strains throughout France. This observation emphasizes the need for monitoring EV-A71 infections in Europe. PMID:25061698

  3. New introductions of enterovirus 71 subgenogroup C4 strains, France, 2012.

    Science.gov (United States)

    Schuffenecker, Isabelle; Henquell, Cécile; Mirand, Audrey; Coste-Burel, Marianne; Marque-Juillet, Stéphanie; Desbois, Delphine; Lagathu, Gisèle; Bornebusch, Laure; Bailly, Jean-Luc; Lina, Bruno

    2014-08-01

    In France during 2012, human enterovirus 71 (EV-A71) subgenogroup C4 strains were detected in 4 children hospitalized for neonatal fever or meningitis. Phylogenetic analysis showed novel and independent EV-A71 introductions, presumably from China, and suggested circulation of C4 strains throughout France. This observation emphasizes the need for monitoring EV-A71 infections in Europe.

  4. The Widespread Multidrug-Resistant Serotype O12 Pseudomonas aeruginosa Clone Emerged through Concomitant Horizontal Transfer of Serotype Antigen and Antibiotic Resistance Gene Clusters

    DEFF Research Database (Denmark)

    Thrane, Sandra Wingaard; Taylor, Véronique L.; Freschi, Luca

    2015-01-01

    . aeruginosa O12 OSA gene cluster, an antibiotic resistance determinant (gyrAC248T), and other genes that have been transferred between P. aeruginosa strains with distinct core genome architectures. We showed that these genes were likely acquired from an O12 serotype strain that is closely related to P...... in clinical settings and outbreaks. These serotype O12 isolates exhibit high levels of resistance to various classes of antibiotics. Here, we explore how the P. aeruginosa OSA biosynthesis gene clusters evolve in the population by investigating the association between the phylogenetic relationships among 83 P....... aeruginosa strains and their serotypes. While most serotypes were closely linked to the core genome phylogeny, we observed horizontal exchange of OSA biosynthesis genes among phylogenetically distinct P. aeruginosa strains. Specifically, we identified a "serotype island" ranging from 62 kb to 185 kb containing the P...

  5. Application of the major capsid protein as a marker of the phylogenetic diversity of Emiliania huxleyi viruses.

    Science.gov (United States)

    Rowe, Janet M; Fabre, Marie-Françoise; Gobena, Daniel; Wilson, William H; Wilhelm, Steven W

    2011-05-01

    Studies of the Phycodnaviridae have traditionally relied on the DNA polymerase (pol) gene as a biomarker. However, recent investigations have suggested that the major capsid protein (MCP) gene may be a reliable phylogenetic biomarker. We used MCP gene amplicons gathered across the North Atlantic to assess the diversity of Emiliania huxleyi-infecting Phycodnaviridae. Nucleotide sequences were examined across >6000 km of open ocean, with comparisons between concentrates of the virus-size fraction of seawater and of lysates generated by exposing host strains to these same virus concentrates. Analyses revealed that many sequences were only sampled once, while several were over-represented. Analyses also revealed nucleotide sequences distinct from previous coastal isolates. Examination of lysed cultures revealed a new richness in phylogeny, as MCP sequences previously unrepresented within the existing collection of E. huxleyi viruses (EhV) were associated with viruses lysing cultures. Sequences were compared with previously described EhV MCP sequences from the North Sea and a Norwegian Fjord, as well as from the Gulf of Maine. Principal component analysis indicates that location-specific distinctions exist despite the presence of sequences common across these environments. Overall, this investigation provides new sequence data and an assessment on the use of the MCP gene. © 2011 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved.

  6. Comparative Genomic Characterization of the Highly Persistent and Potentially Virulent Cronobacter sakazakii ST83, CC65 Strain H322 and Other ST83 Strains

    Directory of Open Access Journals (Sweden)

    Hannah R. Chase

    2017-06-01

    Full Text Available Cronobacter (C. sakazakii is an opportunistic pathogen and has been associated with serious infections with high mortality rates predominantly in pre-term, low-birth weight and/or immune compromised neonates and infants. Infections have been epidemiologically linked to consumption of intrinsically and extrinsically contaminated lots of reconstituted powdered infant formula (PIF, thus contamination of such products is a challenging task for the PIF producing industry. We present the draft genome of C. sakazakii H322, a highly persistent sequence type (ST 83, clonal complex (CC 65, serotype O:7 strain obtained from a batch of non-released contaminated PIF product. The presence of this strain in the production environment was traced back more than 4 years. Whole genome sequencing (WGS of this strain together with four more ST83 strains (PIF production environment-associated confirmed a high degree of sequence homology among four of the five strains. Phylogenetic analysis using microarray (MA and WGS data showed that the ST83 strains were highly phylogenetically related and MA showed that between 5 and 38 genes differed from one another in these strains. All strains possessed the pESA3-like virulence plasmid and one strain possessed a pESA2-like plasmid. In addition, a pCS1-like plasmid was also found. In order to assess the potential in vivo pathogenicity of the ST83 strains, each strain was subjected to infection studies using the recently developed zebrafish embryo model. Our results showed a high (90–100% zebrafish mortality rate for all of these strains, suggesting a high risk for infections and illness in neonates potentially exposed to PIF contaminated with ST83 C. sakazakii strains. In summary, virulent ST83, CC65, serotype CsakO:7 strains, though rarely found intrinsically in PIF, can persist within a PIF manufacturing facility for years and potentially pose significant quality assurance challenges to the PIF manufacturing industry.

  7. Detection of virulence genes and the phylogenetic groups of Escherichia coli isolated from dogs in Brazil

    Directory of Open Access Journals (Sweden)

    Fernanda Morcatti Coura

    2018-02-01

    Full Text Available ABSTRACT: This study identified the virulence genes, pathovars, and phylogenetic groups of Escherichia coli strains obtained from the feces of dogs with and without diarrhea. Virulence genes and phylogenetic group identification were studied using polymerase chain reaction. Thirty-seven E. coli isolates were positive for at least one virulence factor gene. Twenty-one (57.8% of the positive isolates were isolated from diarrheal feces and sixteen (43.2% were from the feces of non-diarrheic dogs. Enteropathogenic E. coli (EPEC were the most frequently (62.2% detected pathovar in dog feces and were mainly from phylogroup B1 and E. Necrotoxigenic E. coli were detected in 16.2% of the virulence-positive isolates and these contained the cytotoxic necrotizing factor 1 (cnf1 gene and were classified into phylogroups B2 and D. All E. coli strains were negative for the presence of enterotoxigenic E. coli (ETEC enterotoxin genes, but four strains were positive for ETEC-related fimbriae 987P and F18. Two isolates were Shiga toxin-producing E. coli strains and contained the toxin genesStx2 or Stx2e, both from phylogroup B1. Our data showed that EPEC was the most frequent pathovar and B1 and E were the most common phylogroups detected in E. coli isolated from the feces of diarrheic and non-diarrheic dogs.

  8. Genome comparison and physiological characterization of eight Streptococcus thermophilus strains isolated from Italian dairy products

    DEFF Research Database (Denmark)

    Vendramin, Veronica; Treu, Laura; Campanaro, Stefano

    2017-01-01

    to identify the core and the variable genes, which vary among strains from 196 to 265. Additionally, correlation between the isolation site and the genetic distance was investigated at genomic level. Results highlight that the phylogenetic reconstruction differs from the geographical strain distribution...

  9. Morphological and Phylogenetic Characterization of New Gephyrocapsa Isolates Suggests Introgressive Hybridization in the Emiliania/Gephyrocapsa Complex (Haptophyta).

    Science.gov (United States)

    Bendif, El Mahdi; Probert, Ian; Young, Jeremy R; von Dassow, Peter

    2015-07-01

    The coccolithophore genus Gephyrocapsa contains a cosmopolitan assemblage of pelagic species, including the bloom-forming Gephyrocapsa oceanica, and is closely related to the emblematic coccolithophore Emiliania huxleyi within the Noëlaerhabdaceae. These two species have been extensively studied and are well represented in culture collections, whereas cultures of other species of this family are lacking. We report on three new strains of Gephyrocapsa isolated into culture from samples from the Chilean coastal upwelling zone using a novel flow cytometric single-cell sorting technique. The strains were characterized by morphological analysis using scanning electron microscopy and phylogenetic analysis of 6 genes (nuclear 18S and 28S rDNA, plastidial 16S and tufA, and mitochondrial cox1 and cox3 genes). Morphometric features of the coccoliths indicate that these isolates are distinct from G. oceanica and best correspond to G. muellerae. Surprisingly, both plastidial and mitochondrial gene phylogenies placed these strains within the E. huxleyi clade and well separated from G. oceanica isolates, making Emiliania appear polyphyletic. The only nuclear sequence difference, 1bp in the 28S rDNA region, also grouped E. huxleyi with the new Gephyrocapsa isolates and apart from G. oceanica. Specifically, the G. muellerae morphotype strains clustered with the mitochondrial β clade of E. huxleyi, which, like G. muellerae, has been associated with cold (temperate and sub-polar) waters. Among putative evolutionary scenarios that could explain these results we discuss the possibility that E. huxleyi is not a valid taxonomic unit, or, alternatively the possibility of past hybridization and introgression between each E. huxleyi clade and older Gephyrocapsa clades. In either case, the results support the transfer of Emiliania to Gephyrocapsa. These results have important implications for relating morphological species concepts to ecological and evolutionary units of diversity

  10. Haemophilus ducreyi Cutaneous Ulcer Strains Are Nearly Identical to Class I Genital Ulcer Strains.

    Directory of Open Access Journals (Sweden)

    Dharanesh Gangaiah

    Full Text Available Although cutaneous ulcers (CU in the tropics is frequently attributed to Treponema pallidum subspecies pertenue, the causative agent of yaws, Haemophilus ducreyi has emerged as a major cause of CU in yaws-endemic regions of the South Pacific islands and Africa. H. ducreyi is generally susceptible to macrolides, but CU strains persist after mass drug administration of azithromycin for yaws or trachoma. H. ducreyi also causes genital ulcers (GU and was thought to be exclusively transmitted by microabrasions that occur during sex. In human volunteers, the GU strain 35000HP does not infect intact skin; wounds are required to initiate infection. These data led to several questions: Are CU strains a new variant of H. ducreyi or did they evolve from GU strains? Do CU strains contain additional genes that could allow them to infect intact skin? Are CU strains susceptible to azithromycin?To address these questions, we performed whole-genome sequencing and antibiotic susceptibility testing of 5 CU strains obtained from Samoa and Vanuatu and 9 archived class I and class II GU strains. Except for single nucleotide polymorphisms, the CU strains were genetically almost identical to the class I strain 35000HP and had no additional genetic content. Phylogenetic analysis showed that class I and class II strains formed two separate clusters and CU strains evolved from class I strains. Class I strains diverged from class II strains ~1.95 million years ago (mya and CU strains diverged from the class I strain 35000HP ~0.18 mya. CU and GU strains evolved under similar selection pressures. Like 35000HP, the CU strains were highly susceptible to antibiotics, including azithromycin.These data suggest that CU strains are derivatives of class I strains that were not recognized until recently. These findings require confirmation by analysis of CU strains from other regions.

  11. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  12. Global patterns of evolutionary distinct and globally endangered amphibians and mammals.

    Directory of Open Access Journals (Sweden)

    Kamran Safi

    Full Text Available BACKGROUND: Conservation of phylogenetic diversity allows maximising evolutionary information preserved within fauna and flora. The "EDGE of Existence" programme is the first institutional conservation initiative that prioritises species based on phylogenetic information. Species are ranked in two ways: one according to their evolutionary distinctiveness (ED and second, by including IUCN extinction status, their evolutionary distinctiveness and global endangerment (EDGE. Here, we describe the global patterns in the spatial distribution of priority ED and EDGE species, in order to identify conservation areas for mammalian and amphibian communities. In addition, we investigate whether environmental conditions can predict the observed spatial pattern in ED and EDGE globally. METHODS AND PRINCIPAL FINDINGS: Priority zones with high concentrations of ED and EDGE scores were defined using two different methods. The overlap between mammal and amphibian zones was very small, reflecting the different phylo-biogeographic histories. Mammal ED zones were predominantly found on the African continent and the neotropical forests, whereas in amphibians, ED zones were concentrated in North America. Mammal EDGE zones were mainly in South-East Asia, southern Africa and Madagascar; for amphibians they were in central and south America. The spatial pattern of ED and EDGE was poorly described by a suite of environmental variables. CONCLUSIONS: Mapping the spatial distribution of ED and EDGE provides an important step towards identifying priority areas for the conservation of mammalian and amphibian phylogenetic diversity in the EDGE of existence programme.

  13. IS3 profiling identifies the enterohaemorrhagic Escherichia coli O-island 62 in a distinct enteroaggregative E. coli lineage

    Directory of Open Access Journals (Sweden)

    Okeke Iruka N

    2011-03-01

    Full Text Available Abstract Background Enteroaggregative Escherichia coli (EAEC are important diarrhoeal pathogens that are defined by a HEp-2 adherence assay performed in specialist laboratories. Multilocus sequence typing (MLST has revealed that aggregative adherence is convergent, providing an explanation for why not all EAEC hybridize with the plasmid-derived probe for this category, designated CVD432. Some EAEC lineages are globally disseminated or more closely associated with disease. Results To identify genetic loci conserved within significant EAEC lineages, but absent from non-EAEC, IS3-based PCR profiles were generated for 22 well-characterised EAEC strains. Six bands that were conserved among, or missing from, specific EAEC lineages were cloned and sequenced. One band corresponded to the aggR gene, a plasmid-encoded regulator that has been used as a diagnostic target but predominantly detects EAEC bearing the plasmid already marked by CVD432. The sequence from a second band was homologous to an open-reading frame within the cryptic enterohaemorrhagic E. coli (EHEC O157 genomic island, designated O-island 62. Screening of an additional 46 EAEC strains revealed that the EHEC O-island 62 was only present in those EAEC strains belonging to the ECOR phylogenetic group D, largely comprised of sequence type (ST complexes 31, 38 and 394. Conclusions The EAEC 042 gene orf1600, which lies within the EAEC equivalent of O-island 62 island, can be used as a marker for EAEC strains belonging to the ECOR phylogenetic group D. The discovery of EHEC O-island 62 in EAEC validates the genetic profiling approach for identifying conserved loci among phylogenetically related strains.

  14. Phylogenetic and physiological diversity of microorganisms isolated from a deep greenland glacier ice core

    Science.gov (United States)

    Miteva, V. I.; Sheridan, P. P.; Brenchley, J. E.

    2004-01-01

    We studied a sample from the GISP 2 (Greenland Ice Sheet Project) ice core to determine the diversity and survival of microorganisms trapped in the ice at least 120,000 years ago. Previously, we examined the phylogenetic relationships among 16S ribosomal DNA (rDNA) sequences in a clone library obtained by PCR amplification from genomic DNA extracted from anaerobic enrichments. Here we report the isolation of nearly 800 aerobic organisms that were grouped by morphology and amplified rDNA restriction analysis patterns to select isolates for further study. The phylogenetic analyses of 56 representative rDNA sequences showed that the isolates belonged to four major phylogenetic groups: the high-G+C gram-positives, low-G+C gram-positives, Proteobacteria, and the Cytophaga-Flavobacterium-Bacteroides group. The most abundant and diverse isolates were within the high-G+C gram-positive cluster that had not been represented in the clone library. The Jukes-Cantor evolutionary distance matrix results suggested that at least 7 isolates represent new species within characterized genera and that 49 are different strains of known species. The isolates were further categorized based on the isolation conditions, temperature range for growth, enzyme activity, antibiotic resistance, presence of plasmids, and strain-specific genomic variations. A significant observation with implications for the development of novel and more effective cultivation methods was that preliminary incubation in anaerobic and aerobic liquid prior to plating on agar media greatly increased the recovery of CFU from the ice core sample.

  15. Evidence of Increased Antibiotic Resistance in Phylogenetically-Diverse Aeromonas Isolates from Semi-Intensive Fish Ponds Treated with Antibiotics.

    Science.gov (United States)

    Patil, Hemant J; Benet-Perelberg, Ayana; Naor, Alon; Smirnov, Margarita; Ofek, Tamir; Nasser, Ahmed; Minz, Dror; Cytryn, Eddie

    2016-01-01

    The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain the effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically to fingerling stocks and water column-associated Aeromonas were monitored periodically over an 11-month fish fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a 3-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas isolates were initially screened for sulfadiazine resistance and further screened against five additional antimicrobials. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamicin, and chloramphenicol resistances were low. Multidrug resistant strains as well as sul1, tetA , and intI1 gene-harboring strains were significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically distinct Aeromonas clusters were identified using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were identified, including an A. salmonicida

  16. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  17. Phylogenetic diversity and community structure of sponge-associated bacteria from mangroves of the Caribbean Sea

    KAUST Repository

    Yang, Jiangke

    2011-02-08

    To gain insight into the species richness and phylogeny of the microbial communities associated with sponges in mangroves, we performed an extensive phylogenetic analysis, based on terminal restriction fragment length polymorphism profiling and 16S ribosomal RNA gene sequences, of the 4 sponge species Aplysina fulva, Haliclona hogarthi, Tedania ignis and Ircinia strobilina as well as of ambient seawater. The sponge-associated bacterial communities contained 13 phyla, including Poribacteria and an unclassified group not found in the ambient seawater community, 98% of which comprised Proteobacteria, Cyanobacteria and Bacteroidetes. Although the sponges themselves were phylogenetically distant and bacterial community variation within the host species was observed, microbial phyla such as Proteobacteria, Acidobacteria, Chloroflexi and the unclassified group were consistently observed as the dominant populations within the communities. The sponge-associated bacterial communities resident in the Caribbean Sea mangroves are phylogenetically similar but significantly distinct from communities found in other biogeographical sites such as the deep-water environments of the Caribbean Sea, the South China Sea and Australia. The interspecific variation within the host species and the distinct biogeographical characteristics that the sponge-associated bacteria exhibited indicate that the acquisition, establishment and formation of functional sponge-associated bacterial communities may initially be the product of both vertical and horizontal transmission, and is then shaped by the internal environment created by the sponge species and certain external environmental factors. © Inter-Research 2011.

  18. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  19. Isolation and characterization of butachlor-catabolizing bacterial strain Stenotrophomonas acidaminiphila JS-1 from soil and assessment of its biodegradation potential.

    Science.gov (United States)

    Dwivedi, S; Singh, B R; Al-Khedhairy, A A; Alarifi, S; Musarrat, J

    2010-07-01

    Isolation, characterization and assessment of butachlor-degrading potential of bacterial strain JS-1 in soil. Butachlor-degrading bacteria were isolated using enrichment culture technique. The morphological, biochemical and genetic characteristics based on 16S rDNA sequence homology and phylogenetic analysis confirmed the isolate as Stenotrophomonas acidaminiphila strain JS-1. The strain JS-1 exhibited substantial growth in M9 mineral salt medium supplemented with 3.2 mmol l(-1) butachlor, as a sole source of carbon and energy. The HPLC analysis revealed almost complete disappearance of butachlor within 20 days in soil at a rate constant of 0.17 day(-1) and half-life (t((1/2))) of 4.0 days, following the first-order rate kinetics. The strain JS-1 in stationary phase of culture also produced 21.0 microg ml(-1) of growth hormone indole acetic acid (IAA) in the presence of 500 microg ml(-1) of tryptophan. The IAA production was stimulated at lower concentrations of butachlor, whereas higher concentrations above 0.8 mmol l(-1) were found inhibitory. The isolate JS-1 characterized as Stenotrophomonas acidaminiphila was capable of utilizing butachlor as sole source of carbon and energy. Besides being an efficient butachlor degrader, it substantially produces IAA. The bacterial strain JS-1 has a potential for butachlor remediation with a distinctive auxiliary attribute of plant growth stimulation.

  20. Mobilomics in Saccharomyces cerevisiae strains.

    Science.gov (United States)

    Menconi, Giulia; Battaglia, Giovanni; Grossi, Roberto; Pisanti, Nadia; Marangoni, Roberto

    2013-03-20

    Mobile Genetic Elements (MGEs) are selfish DNA integrated in the genomes. Their detection is mainly based on consensus-like searches by scanning the investigated genome against the sequence of an already identified MGE. Mobilomics aims at discovering all the MGEs in a genome and understanding their dynamic behavior: The data for this kind of investigation can be provided by comparative genomics of closely related organisms. The amount of data thus involved requires a strong computational effort, which should be alleviated. Our approach proposes to exploit the high similarity among homologous chromosomes of different strains of the same species, following a progressive comparative genomics philosophy. We introduce a software tool based on our new fast algorithm, called regender, which is able to identify the conserved regions between chromosomes. Our case study is represented by a unique recently available dataset of 39 different strains of S.cerevisiae, which regender is able to compare in few minutes. By exploring the non-conserved regions, where MGEs are mainly retrotransposons called Tys, and marking the candidate Tys based on their length, we are able to locate a priori and automatically all the already known Tys and map all the putative Tys in all the strains. The remaining putative mobile elements (PMEs) emerging from this intra-specific comparison are sharp markers of inter-specific evolution: indeed, many events of non-conservation among different yeast strains correspond to PMEs. A clustering based on the presence/absence of the candidate Tys in the strains suggests an evolutionary interconnection that is very similar to classic phylogenetic trees based on SNPs analysis, even though it is computed without using phylogenetic information. The case study indicates that the proposed methodology brings two major advantages: (a) it does not require any template sequence for the wanted MGEs and (b) it can be applied to infer MGEs also for low coverage genomes

  1. Mobilomics in Saccharomyces cerevisiae strains

    Science.gov (United States)

    2013-01-01

    Background Mobile Genetic Elements (MGEs) are selfish DNA integrated in the genomes. Their detection is mainly based on consensus–like searches by scanning the investigated genome against the sequence of an already identified MGE. Mobilomics aims at discovering all the MGEs in a genome and understanding their dynamic behavior: The data for this kind of investigation can be provided by comparative genomics of closely related organisms. The amount of data thus involved requires a strong computational effort, which should be alleviated. Results Our approach proposes to exploit the high similarity among homologous chromosomes of different strains of the same species, following a progressive comparative genomics philosophy. We introduce a software tool based on our new fast algorithm, called regender, which is able to identify the conserved regions between chromosomes. Our case study is represented by a unique recently available dataset of 39 different strains of S.cerevisiae, which regender is able to compare in few minutes. By exploring the non–conserved regions, where MGEs are mainly retrotransposons called Tys, and marking the candidate Tys based on their length, we are able to locate a priori and automatically all the already known Tys and map all the putative Tys in all the strains. The remaining putative mobile elements (PMEs) emerging from this intra–specific comparison are sharp markers of inter–specific evolution: indeed, many events of non–conservation among different yeast strains correspond to PMEs. A clustering based on the presence/absence of the candidate Tys in the strains suggests an evolutionary interconnection that is very similar to classic phylogenetic trees based on SNPs analysis, even though it is computed without using phylogenetic information. Conclusions The case study indicates that the proposed methodology brings two major advantages: (a) it does not require any template sequence for the wanted MGEs and (b) it can be applied to

  2. Nonbinary Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Jetten, Laura; van Iersel, Leo

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can, for example, represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and strictly-tree-based nonbinary phylogenetic networks. We give simple graph-theoretic characterizations of tree-based and strictly-tree-based nonbinary phylogenetic networks. Moreover, we show for each of these two classes that it can be decided in polynomial time whether a given network is contained in the class. Our approach also provides a new view on tree-based binary phylogenetic networks. Finally, we discuss two examples of nonbinary phylogenetic networks in biology and show how our results can be applied to them.

  3. Phylogenetic Variants of Rickettsia africae, and Incidental Identification of "Candidatus Rickettsia Moyalensis" in Kenya.

    Science.gov (United States)

    Kimita, Gathii; Mutai, Beth; Nyanjom, Steven Ger; Wamunyokoli, Fred; Waitumbi, John

    2016-07-01

    Rickettsia africae, the etiological agent of African tick bite fever, is widely distributed in sub-Saharan Africa. Contrary to reports of its homogeneity, a localized study in Asembo, Kenya recently reported high genetic diversity. The present study aims to elucidate the extent of this heterogeneity by examining archived Rickettsia africae DNA samples collected from different eco-regions of Kenya. To evaluate their phylogenetic relationships, archived genomic DNA obtained from 57 ticks a priori identified to contain R. africae by comparison to ompA, ompB and gltA genes was used to amplify five rickettsial genes i.e. gltA, ompA, ompB, 17kDa and sca4. The resulting amplicons were sequenced. Translated amino acid alignments were used to guide the nucleotide alignments. Single gene and concatenated alignments were used to infer phylogenetic relationships. Out of the 57 DNA samples, three were determined to be R. aeschlimanii and not R. africae. One sample turned out to be a novel rickettsiae and an interim name of "Candidatus Rickettsia moyalensis" is proposed. The bonafide R. africae formed two distinct clades. Clade I contained 9% of the samples and branched with the validated R. africae str ESF-5, while clade II (two samples) formed a distinct sub-lineage. This data supports the use of multiple genes for phylogenetic inferences. It is determined that, despite its recent emergence, the R. africae lineage is diverse. This data also provides evidence of a novel Rickettsia species, Candidatus Rickettsia moyalensis.

  4. The Impact of Media, Phylogenetic Classification, and E. coli Pathotypes on Biofilm Formation in Extraintestinal and Commensal E. coli From Humans and Animals.

    Science.gov (United States)

    Nielsen, Daniel W; Klimavicz, James S; Cavender, Tia; Wannemuehler, Yvonne; Barbieri, Nicolle L; Nolan, Lisa K; Logue, Catherine M

    2018-01-01

    Extraintestinal pathogenic Escherichia coli (ExPEC) include avian pathogenic E. coli (APEC), neonatal meningitis E. coli (NMEC), and uropathogenic E. coli (UPEC) and are responsible for significant animal and human morbidity and mortality. This study sought to investigate if biofilm formation by ExPEC likely contributes to these losses since biofilms are associated with recurrent urinary tract infections, antibiotic resistance, and bacterial exchange of genetic material. Therefore, the goal of this study was to examine differences in biofilm formation among a collection of ExPEC and to ascertain if there is a relationship between their ability to produce biofilms and their assignment to phylogenetic groups in three media types - M63, diluted TSB, and BHI. Our results suggest that ExPEC produce relatively different levels of biofilm formation in the media tested as APEC (70.4%, p = 0.0064) and NMEC (84.4%, p = 0.0093) isolates were poor biofilm formers in minimal medium M63 while UPEC isolates produced significantly higher ODs under nutrient-limited conditions with 25% of strains producing strong biofilms in diluted TSB ( p = 0.0204). Additionally, E. coli phylogenetic assignment using Clermont's original and revised typing scheme demonstrated significant differences among the phylogenetic groups in the different media. When the original phylogenetic group isolates previously typed as group D were phylogenetically typed under the revised scheme and examined, they showed substantial variation in their ability to form biofilms, which may explain the significant values of revised phylogenetic groups E and F in M63 ( p = 0.0291, p = 0.0024). Our data indicates that biofilm formation is correlated with phylogenetic classification and subpathotype or commensal grouping of E. coli strains.

  5. PHYLOGENETIC ANALYSIS AND AUTECOLOGY OF SPORE-FORMING BACTERIA FROM HYPERSALINE ENVIRONMENTS.

    Science.gov (United States)

    Gladka, G V; Romanovskaya, V A; Tashyreva, H O; Tashyrev, O B

    2015-01-01

    Multi-resistant to extreme factors spore-forming bacteria of Bacillus genus are isolated from hypersaline environments of the Crimea (Ukraine) and the Dead Sea (Israel). Phylogenetic analysis showed distinction of dominating extremophilic culturable species in studied regions. In Crimean environments they are B. mojavensis and B. simplex, in the Dead Sea ecosystem--B. subtilis subsp. spizizenii, B. subtilis subsp. subtilis, B. licheniformis and B. simplex. Isolates are simultaneously halotolerant and resistant to UV radiation. Strains isolated from the Dead Sea and the Crimea environments were resistant to UV: LD90 and LD99.99 made 100-170 J/m2 and 750-1500 J/m2 respectively. Spores showed higher UV-resistance (LD99.99-2500 J/m2) than the vegetative cells. However the number of spores made 0.02-0.007% of the whole cell population, and should not significantly affect the UV LD99.99 value. Isolates of both environments were halotolerant in the range of 0.1-10% NaCl and thermotolerant in the range of 20-50 °C, and didn't grow at 15 °C. Survival strategy of spore-forming bacteria from hypersaline environments under high UV radiation level can be performed by spore formation which minimize cell damage as well as efficient DNA-repair systems that remove damages.

  6. [Identification of two cyanobacterial strains isolated from the Kotel'nikovskii hot spring of the Baikal rift].

    Science.gov (United States)

    Sorokovnikova, E G; Tikhonova, I V; Belykh, O I; Klimenkov, I V; Likhoshvaĭ, E V

    2008-01-01

    Two cyanobacterial strains, Pseudanabaena sp. 0411 and Synechococcus sp. 0431, were isolated from a sample collected in the Kotel'nikovskii hot spring of the Baikal rift. According to the results of light and transmission electron microscopy, as well as of the phylogenetic analysis of the 16S rRNA gene, these cyanobacteria were classified as Pseudanabaena sp. nov. and Synechococcus bigranulatus Skuja. The constructed phylogenetic tree shows that the studied strains are positioned in the clades of cyanobacteria isolated from hydrothermal vents of Asia and New Zealand, separately from marine and freshwater members of these genera, including those isolated from Lake Baikal.

  7. A remarkable new species of Liparis (Orchidaceae from China and its phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Lin Li

    Full Text Available In the present study, we formally describe Liparis pingxiangensis as a new species from Guangxi, China on the basis of morphological and molecular phylogenetic analyses. It is easily distinguished from closely related species by strongly curved column without column wings, and broadly rhombic-elliptic lip with 2 uncinate calli at the base. In particular, it differs most markedly from its congeners in possessing two pollinia attached by long and prominent caudicles (not stipes, to a distinct sticky disc. This type of pollinarium, as far as we know, is not found in any other species of Liparis, and is also unique among the orchids with waxy pollinia. We then proceeded to a phylogenetic analysis to ascertain the systematic position of this enigmatic species. Molecular study based on nuclear ribosomal ITS and plastid matK DNA sequence data supports L. pingxiangensis as a distinct species, which forms an independent lineage sister to L. nervosa and its allies (93% BS, 1.00 BPP. In the light of previous work, the findings have important implications for a better understanding of the well-supported pattern mainly based on vegetative features in Malaxideae.

  8. Comparative Genomic Analyses of Multiple Pseudomonas Strains Infecting Corylus avellana Trees Reveal the Occurrence of Two Genetic Clusters with Both Common and Distinctive Virulence and Fitness Traits

    Science.gov (United States)

    Marcelletti, Simone; Scortichini, Marco

    2015-01-01

    The European hazelnut (Corylus avellana) is threatened in Europe by several pseudomonads which cause symptoms ranging from twig dieback to tree death. A comparison of the draft genomes of nine Pseudomonas strains isolated from symptomatic C. avellana trees was performed to identify common and distinctive genomic traits. The thorough assessment of genetic relationships among the strains revealed two clearly distinct clusters: P. avellanae and P. syringae. The latter including the pathovars avellanae, coryli and syringae. Between these two clusters, no recombination event was found. A genomic island of approximately 20 kb, containing the hrp/hrc type III secretion system gene cluster, was found to be present without any genomic difference in all nine pseudomonads. The type III secretion system effector repertoires were remarkably different in the two groups, with P. avellanae showing a higher number of effectors. Homologue genes of the antimetabolite mangotoxin and ice nucleation activity clusters were found solely in all P. syringae pathovar strains, whereas the siderophore yersiniabactin was only present in P. avellanae. All nine strains have genes coding for pectic enzymes and sucrose metabolism. By contrast, they do not have genes coding for indolacetic acid and anti-insect toxin. Collectively, this study reveals that genomically different Pseudomonas can converge on the same host plant by suppressing the host defence mechanisms with the use of different virulence weapons. The integration into their genomes of a horizontally acquired genomic island could play a fundamental role in their evolution, perhaps giving them the ability to exploit new ecological niches. PMID:26147218

  9. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  10. Multilocus Sequence Analysis for Typing Leptospira interrogans and Leptospira kirschneri▿ †

    OpenAIRE

    Leon, Albertine; Pronost, Stéphane; Fortier, Guillaume; Andre-Fontaine, Geneviève; Leclercq, Roland

    2009-01-01

    Fifty-three strains belonging to the pathogenic species Leptospira interrogans and Leptospira kirschneri were analyzed by multilocus sequence analysis. The species formed two distinct branches. In the L. interrogans branch, the phylogenetic tree clustered the strains into three subgroups. Genogroups and serogroups were superimposed but not strictly.

  11. Tetrapods on the EDGE: Overcoming data limitations to identify phylogenetic conservation priorities

    Science.gov (United States)

    Gray, Claudia L.; Wearn, Oliver R.; Owen, Nisha R.

    2018-01-01

    The scale of the ongoing biodiversity crisis requires both effective conservation prioritisation and urgent action. As extinction is non-random across the tree of life, it is important to prioritise threatened species which represent large amounts of evolutionary history. The EDGE metric prioritises species based on their Evolutionary Distinctiveness (ED), which measures the relative contribution of a species to the total evolutionary history of their taxonomic group, and Global Endangerment (GE), or extinction risk. EDGE prioritisations rely on adequate phylogenetic and extinction risk data to generate meaningful priorities for conservation. However, comprehensive phylogenetic trees of large taxonomic groups are extremely rare and, even when available, become quickly out-of-date due to the rapid rate of species descriptions and taxonomic revisions. Thus, it is important that conservationists can use the available data to incorporate evolutionary history into conservation prioritisation. We compared published and new methods to estimate missing ED scores for species absent from a phylogenetic tree whilst simultaneously correcting the ED scores of their close taxonomic relatives. We found that following artificial removal of species from a phylogenetic tree, the new method provided the closest estimates of their “true” ED score, differing from the true ED score by an average of less than 1%, compared to the 31% and 38% difference of the previous methods. The previous methods also substantially under- and over-estimated scores as more species were artificially removed from a phylogenetic tree. We therefore used the new method to estimate ED scores for all tetrapods. From these scores we updated EDGE prioritisation rankings for all tetrapod species with IUCN Red List assessments, including the first EDGE prioritisation for reptiles. Further, we identified criteria to identify robust priority species in an effort to further inform conservation action whilst

  12. Forensic application of phylogenetic analyses - Exploration of suspected HIV-1 transmission case.

    Science.gov (United States)

    Siljic, Marina; Salemovic, Dubravka; Cirkovic, Valentina; Pesic-Pavlovic, Ivana; Ranin, Jovan; Todorovic, Marija; Nikolic, Slobodan; Jevtovic, Djordje; Stanojevic, Maja

    2017-03-01

    Transmission of human immunodeficiency virus (HIV) between individuals may have important legal implications and therefore may come to require forensic investigation based upon phylogenetic analysis. In criminal trials results of phylogenetic analyses have been used as evidence of responsibility for HIV transmission. In Serbia, as in many countries worldwide, exposure and deliberate transmission of HIV are criminalized. We present the results of applying state of the art phylogenetic analyses, based on pol and env genetic sequences, in exploration of suspected HIV transmission among three subjects: a man and two women, with presumed assumption of transmission direction from one woman to a man. Phylogenetic methods included relevant neighbor-joining (NJ), maximum likelihood (ML) and Bayesian methods of phylogenetic trees reconstruction and hypothesis testing, that has been shown to be the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. End-point limiting-dilution PCR (EPLD-PCR) assay, generating the minimum of 10 sequences per genetic region per subject, was performed to assess HIV quasispecies distribution and to explore the direction of HIV transmission between three subjects. Phylogenetic analysis revealed that the viral sequences from the three subjects were more genetically related to each other than to other strains circulating in the same area with the similar epidemiological profile, forming strongly supported transmission chain, which could be in favour of a priori hypothesis of one of the women infecting the man. However, in the EPLD based phylogenetic trees for both pol and env genetic region, viral sequences of one subject (man) were paraphyletic to those of two other subjects (women), implying the direction of transmission opposite to the a priori assumption. The dated tree in our analysis confirmed the clustering pattern of query sequences. Still, in the context of unsampled sequences and

  13. Phylogenetic analyses of the polyprotein coding sequences of serotype O foot-and-mouth disease viruses in East Africa: evidence for interserotypic recombination

    Directory of Open Access Journals (Sweden)

    Balinda Sheila N

    2010-08-01

    Full Text Available Abstract Background Foot-and-mouth disease (FMD is endemic in East Africa with the majority of the reported outbreaks attributed to serotype O virus. In this study, phylogenetic analyses of the polyprotein coding region of serotype O FMD viruses from Kenya and Uganda has been undertaken to infer evolutionary relationships and processes responsible for the generation and maintenance of diversity within this serotype. FMD virus RNA was obtained from six samples following virus isolation in cell culture and in one case by direct extraction from an oropharyngeal sample. Following RT-PCR, the single long open reading frame, encoding the polyprotein, was sequenced. Results Phylogenetic comparisons of the VP1 coding region showed that the recent East African viruses belong to one lineage within the EA-2 topotype while an older Kenyan strain, K/52/1992 is a representative of the topotype EA-1. Evolutionary relationships between the coding regions for the leader protease (L, the capsid region and almost the entire coding region are monophyletic except for the K/52/1992 which is distinct. Furthermore, phylogenetic relationships for the P2 and P3 regions suggest that the K/52/1992 is a probable recombinant between serotypes A and O. A bootscan analysis of K/52/1992 with East African FMD serotype A viruses (A21/KEN/1964 and A23/KEN/1965 and serotype O viral isolate (K/117/1999 revealed that the P2 region is probably derived from a serotype A strain while the P3 region appears to be a mosaic derived from both serotypes A and O. Conclusions Sequences of the VP1 coding region from recent serotype O FMDVs from Kenya and Uganda are all representatives of a specific East African lineage (topotype EA-2, a probable indication that hardly any FMD introductions of this serotype have occurred from outside the region in the recent past. Furthermore, evidence for interserotypic recombination, within the non-structural protein coding regions, between FMDVs of serotypes A

  14. Description of Mycobacterium chelonae subsp. bovis subsp. nov., isolated from cattle (Bos taurus coreanae), emended description of Mycobacterium chelonae and creation of Mycobacterium chelonae subsp. chelonae subsp. nov.

    Science.gov (United States)

    Kim, Byoung-Jun; Kim, Ga-Na; Kim, Bo-Ram; Jeon, Che Ok; Jeong, Joseph; Lee, Seon Ho; Lim, Ji-Hun; Lee, Seung-Heon; Kim, Chang Ki; Kook, Yoon-Hoh; Kim, Bum-Joon

    2017-10-01

    Three rapidly growing mycobacterial strains, QIA-37 T , QIA-40 and QIA-41, were isolated from the lymph nodes of three separate Korean native cattle, Hanwoo (Bos taurus coreanae). These strains were previously shown to be phylogenetically distinct but closely related to Mycobacterium chelonae ATCC 35752 T by taxonomic approaches targeting three genes (16S rRNA, hsp6 and rpoB) and were further characterized using a polyphasic approach in this study. The 16S rRNA gene sequences of all three strains showed 99.7 % sequence similarity with that of the M. chelonae type strain. A multilocus sequence typing analysis targeting 10 housekeeping genes, including hsp65 and rpoB, revealed a phylogenetic cluster of these strains with M. chelonae. DNA-DNA hybridization values of 78.2 % between QIA-37 T and M. chelonae indicated that it belongs to M. chelonae but is a novel subspecies distinct from M. chelonae. Phylogenetic analysis based on whole-genome sequences revealed a 95.44±0.06 % average nucleotide identity (ANI) value with M. chelonae, slightly higher than the 95.0 % ANI criterion for determining a novel species. In addition, distinct phenotypic characteristics such as positive growth at 37 °C, at which temperature M. chelonae does not grow, further support the taxonomic status of these strains as representatives of a novel subspecies of M. chelonae. Therefore, we propose an emended description of Mycobacterium chelonae, and descriptions of M. chelonae subsp. chelonae subsp. nov. and M. chelonae subsp. bovis subsp. nov. are presented; strains ATCC 35752 T (=CCUG 47445 T =CIP 104535 T =DSM 43804 T =JCM 6388 T =NCTC 946 T ) and QIA-37 T (=KCTC 39630 T =JCM 30986 T ) are the type strains of the two novel subspecies.

  15. Isolation and characterization of new strains of methanogens from cold terrestrial habitats.

    Science.gov (United States)

    Simankova, Maria V; Kotsyurbenko, Oleg R; Lueders, Tillmann; Nozhevnikova, Alla N; Wagner, Bianca; Conrad, Ralf; Friedrich, Michael W

    2003-06-01

    Five strains of methanogenic archaea (MT, MS, MM, MSP, ZB) were isolated from permanently and periodically cold terrestrial habitats. Physiological and morphological studies, as well as phylogenetic analyses of the new isolates were performed. Based on sequences of the 16S rRNA and methyl-coenzyme M reductase a-subunit (mcrA) genes all new isolates are closely related to known mesophilic and psychrotolerant methanogens. Both, phylogenetic analyses and phenotypic properties allow to classify strains MT, MS, and MM as members of the genus Methanosarcina. Strain MT is a new ecotype of Methanosarcina mazei, whereas strains MM and MS are very similar to each other and can be assigned to the recently described psychrotolerant species Methanosarcina lacustris. The hydrogenotrophic strain MSP is a new ecotype of the genus Methanocorpusculum. The obligately methylotrophic strain ZB is closely related to Methanomethylovorans hollandica and can be classified as new ecotype of this species. All new isolates, including the strains from permanently cold environments, are not true psychrophiles according to their growth temperature characteristics. In spite of the ability of all isolates to grow at temperatures as low as 1-5 degrees C, all of them have their growth optima in the range of moderate temperatures (25-35 degrees C). Thus, they can be regarded as psychrotolerant organisms. Psychrotolerant methanogens are thought to play an important role in methane production in both, habitats under seasonal temperature variations or from permanently cold areas.

  16. [Genetic diversity of extraintestinal Escherichia coli strains producers of beta-lactamases TEM, SHV and CTX-M associated with healthcare].

    Science.gov (United States)

    Varela, Yasmin; Millán, Beatriz; Araque, María

    2017-06-01

    There are few reports from Venezuela describing the genetic basis that sustains the pathogenic potential and phylogenetics of Escherichia coli extraintestinal strains isolated in health care units. To establish the genetic diversity of extraintestinal E. coli strains producers of betalactamases TEM, SHV and CTX-M associated with healthcare. We studied a collection of 12 strains of extraintestinal E. coli with diminished sensitivity to broad-spectrum cephalosporins. Antimicrobial susceptibility was determined by minimum inhibitory concentration. We determined the phylogenetic groups, virulence factors and genes encoding antimicrobial resistance using PCR, and clonal characterization by repetitive element palindromic-PCR rep-PCR. All strains showed resistance to cephalosporins and joint resistance to quinolones and aminoglycosides. The phylogenetic distribution showed that the A and B1 groups were the most frequent, followed by D and B2. We found all the virulence factors analyzed in the B2 group, and fimH gene was the most frequent among them. We found blaCTX-M in all strains,with a higher prevalence of blaCTX-M-8; two of these strains showed coproduction of blaCTX-M-9 and were genetically identified as blaCTXM-65 and blaCTX-M-147 by sequencing. The strains under study showed genetic diversity, hosting a variety of virulence genes, as well as antimicrobial resistance with no particular phylogroup prevalence. This is the first report of blaCTX-M alleles in Venezuela and in the world associated to non-genetically related strains isolated in health care units, a situation that deserves attention, as well as the rationalization of antimicrobials use.

  17. Recombination Blurs Phylogenetic Groups Routine Assignment in Escherichia coli: Setting the Record Straight

    Science.gov (United States)

    Turrientes, María-Carmen; González-Alba, José-María; del Campo, Rosa; Baquero, María-Rosario; Cantón, Rafael; Baquero, Fernando; Galán, Juan Carlos

    2014-01-01

    The characterization of population structures plays a main role for understanding outbreaks and the dynamics of bacterial spreading. In Escherichia coli, the widely used combination of multiplex-PCR scheme together with goeBURST has some limitations. The purpose of this study is to show that the combination of different phylogenetic approaches based on concatenated sequences of MLST genes results in a more precise assignment of E. coli phylogenetic groups, complete understanding of population structure and reconstruction of ancestral clones. A collection of 80 Escherichia coli strains of different origins was analyzed following the Clermont and Doumith's multiplex-PCR schemes. Doumith's multiplex-PCR showed only 1.7% of misassignment, whereas Clermont's-2000 protocol reached 14.0%, although the discrepancies reached 30% and 38.7% respectively when recombinant C, F and E phylogroups were considered. Therefore, correct phylogroup attribution is highly variable and depends on the clonal composition of the sample. As far as population structure of these E. coli strains, including 48 E. coli genomes from GenBank, goeBURST provides a quite dispersed population structure; whereas NeighborNet approach reveals a complex population structure. MLST-based eBURST can infer different founder genotypes, for instance ST23/ST88 could be detected as the founder genotypes for STC23; however, phylogenetic reconstructions might suggest ST410 as the ancestor clone and several evolutionary trajectories with different founders. To improve our routine understanding of E. coli molecular epidemiology, we propose a strategy based on three successive steps; first, to discriminate three main groups A/B1/C, D/F/E and B2 following Doumith's protocol; second, visualization of population structure based on MLST genes according to goeBURST, using NeighborNet to establish more complex relationships among STs; and third, to perform, a cost-free characterization of evolutionary trajectories in variants

  18. Mesorhizobium bacterial strains isolated from the legume Lotus corniculatus are an alternative source for the production of polyhydroxyalkanoates (PHAs) to obtain bioplastics.

    Science.gov (United States)

    Marcos-García, Marta; García-Fraile, Paula; Filipová, Alena; Menéndez, Esther; Mateos, Pedro F; Velázquez, Encarna; Cajthaml, Tomáš; Rivas, Raúl

    2017-07-01

    Polyhydroxyalkanoic acids (PHAs) are natural polyesters that can be used to produce bioplastics which are biodegradable. Numerous microorganisms accumulate PHAs as energy reserves. Combinations of different PHAs monomers lead to the production of bioplastics with very different properties. In the present work, we show the capability of strains belonging to various phylogenetic lineages within the genus Mesorhizobium, isolated from Lotus corniculatus nodules, to produce different PHA monomers. Among our strains, we found the production of 3-hydroxybutyrate, 3-hydroxyvalerate, 3-hydroxydodecanoate, and 3-hydroxyhexadecanoate. Most of the PHA-positive strains were phylogenetically related to the species M. jarvisii. However, our findings suggest that the ability to produce different monomers forming PHAs is strain-dependent.

  19. Transforming phylogenetic networks: Moving beyond tree space

    OpenAIRE

    Huber, Katharina T.; Moulton, Vincent; Wu, Taoyang

    2016-01-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transforme...

  20. Tree phylogenetic diversity promotes host-parasitoid interactions.

    Science.gov (United States)

    Staab, Michael; Bruelheide, Helge; Durka, Walter; Michalski, Stefan; Purschke, Oliver; Zhu, Chao-Dong; Klein, Alexandra-Maria

    2016-07-13

    Evidence from grassland experiments suggests that a plant community's phylogenetic diversity (PD) is a strong predictor of ecosystem processes, even stronger than species richness per se This has, however, never been extended to species-rich forests and host-parasitoid interactions. We used cavity-nesting Hymenoptera and their parasitoids collected in a subtropical forest as a model system to test whether hosts, parasitoids, and their interactions are influenced by tree PD and a comprehensive set of environmental variables, including tree species richness. Parasitism rate and parasitoid abundance were positively correlated with tree PD. All variables describing parasitoids decreased with elevation, and were, except parasitism rate, dependent on host abundance. Quantitative descriptors of host-parasitoid networks were independent of the environment. Our study indicates that host-parasitoid interactions in species-rich forests are related to the PD of the tree community, which influences parasitism rates through parasitoid abundance. We show that effects of tree community PD are much stronger than effects of tree species richness, can cascade to high trophic levels, and promote trophic interactions. As during habitat modification phylogenetic information is usually lost non-randomly, even species-rich habitats may not be able to continuously provide the ecosystem process parasitism if the evolutionarily most distinct plant lineages vanish. © 2016 The Author(s).

  1. Lactobacillus kefiri shows inter-strain variations in the amino acid sequence of the S-layer proteins.

    Science.gov (United States)

    Malamud, Mariano; Carasi, Paula; Bronsoms, Sílvia; Trejo, Sebastián A; Serradell, María de Los Angeles

    2017-04-01

    The S-layer is a proteinaceous envelope constituted by subunits that self-assemble to form a two-dimensional lattice that covers the surface of different species of Bacteria and Archaea, and it could be involved in cell recognition of microbes among other several distinct functions. In this work, both proteomic and genomic approaches were used to gain knowledge about the sequences of the S-layer protein (SLPs) encoding genes expressed by six aggregative and sixteen non-aggregative strains of potentially probiotic Lactobacillus kefiri. Peptide mass fingerprint (PMF) analysis confirmed the identity of SLPs extracted from L. kefiri, and based on the homology with phylogenetically related species, primers located outside and inside the SLP-genes were employed to amplify genomic DNA. The O-glycosylation site SASSAS was found in all L. kefiri SLPs. Ten strains were selected for sequencing of the complete genes. The total length of the mature proteins varies from 492 to 576 amino acids, and all SLPs have a calculated pI between 9.37 and 9.60. The N-terminal region is relatively conserved and shows a high percentage of positively charged amino acids. Major differences among strains are found in the C-terminal region. Different groups could be distinguished regarding the mature SLPs and the similarities observed in the PMF spectra. Interestingly, SLPs of the aggregative strains are 100% homologous, although these strains were isolated from different kefir grains. This knowledge provides relevant data for better understanding of the mechanisms involved in SLPs functionality and could contribute to the development of products of biotechnological interest from potentially probiotic bacteria.

  2. Multilocus Sequence Analysis for Typing Leptospira interrogans and Leptospira kirschneri▿ †

    Science.gov (United States)

    Leon, Albertine; Pronost, Stéphane; Fortier, Guillaume; Andre-Fontaine, Geneviève; Leclercq, Roland

    2010-01-01

    Fifty-three strains belonging to the pathogenic species Leptospira interrogans and Leptospira kirschneri were analyzed by multilocus sequence analysis. The species formed two distinct branches. In the L. interrogans branch, the phylogenetic tree clustered the strains into three subgroups. Genogroups and serogroups were superimposed but not strictly. PMID:19955271

  3. Phylogenetic analysis of some Newcastle disease virus isolates from the Sudan

    Directory of Open Access Journals (Sweden)

    N.A. Elmardi

    2016-06-01

    Full Text Available A reverse transcription-polymerase chain reaction (RT-PCR was used to amplify 1412 bp of the fusion protein gene (F gene of four Newcastle disease virus (NDV isolates; two velogenic (TY-1/90 and DIK-90 and two lentogenic isolates (Dongla 88/1 and GD.S.1. Following sequencing, nucleotide sequences were annotated and 894 bp were compared phylogenetically with those from strains previously reported in the Sudan and the virus strains published on the GenBank. It could be demonstrated that TY-1/90 and DIK-90 strains belong to the genotype VI of NDV and are in close genetic relationship to sub- genotype VIb. TY-1/90 and DIK-90 strains were observed to be genetically unrelated to the earlier Sudanese isolates of 1970/80s and the late of 2000s suggesting a different origin. The close genetic relationship to the European and African pigeon paramyxovirus type 1 (PPMV-1 suggests a common ancestor. Dongola, GD.S.1 strains were classified into genotype II that comprises non-pathogenic lentogenic NDV strains. The present genetic classification of NDV isolates of the Sudan provides valuable information on genotypes of NDV. Further molecular epidemiological investigations of the recent outbreaks of Newcastle disease in the Sudan are needed in order to improve the efficiency of control strategies and vaccine development.

  4. Seroprevalence and genomic divergence of circulating strains of feline immunodeficiency virus among Felidae and Hyaenidae species.

    Science.gov (United States)

    Troyer, Jennifer L; Pecon-Slattery, Jill; Roelke, Melody E; Johnson, Warren; VandeWoude, Sue; Vazquez-Salat, Nuria; Brown, Meredith; Frank, Laurence; Woodroffe, Rosie; Winterbach, Christiaan; Winterbach, Hanlie; Hemson, Graham; Bush, Mitch; Alexander, Kathleen A; Revilla, Eloy; O'Brien, Stephen J

    2005-07-01

    Feline immunodeficiency virus (FIV) infects numerous wild and domestic feline species and is closely related to human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV). Species-specific strains of FIV have been described for domestic cat (Felis catus), puma (Puma concolor), lion (Panthera leo), leopard (Panthera pardus), and Pallas' cat (Otocolobus manul). Here, we employ a three-antigen Western blot screening (domestic cat, puma, and lion FIV antigens) and PCR analysis to survey worldwide prevalence, distribution, and genomic differentiation of FIV based on 3,055 specimens from 35 Felidae and 3 Hyaenidae species. Although FIV infects a wide variety of host species, it is confirmed to be endemic in free-ranging populations of nine Felidae and one Hyaenidae species. These include the large African carnivores (lion, leopard, cheetah, and spotted hyena), where FIV is widely distributed in multiple populations; most of the South American felids (puma, jaguar, ocelot, margay, Geoffroy's cat, and tigrina), which maintain a lower FIV-positive level throughout their range; and two Asian species, the Pallas' cat, which has a species-specific strain of FIV, and the leopard cat, which has a domestic cat FIV strain in one population. Phylogenetic analysis of FIV proviral sequence demonstrates that most species for which FIV is endemic harbor monophyletic, genetically distinct species-specific FIV strains, suggesting that FIV transfer between cat species has occurred in the past but is quite infrequent today.

  5. Seroprevalence and Genomic Divergence of Circulating Strains of Feline Immunodeficiency Virus among Felidae and Hyaenidae Species†

    Science.gov (United States)

    Troyer, Jennifer L.; Pecon-Slattery, Jill; Roelke, Melody E.; Johnson, Warren; VandeWoude, Sue; Vazquez-Salat, Nuria; Brown, Meredith; Frank, Laurence; Woodroffe, Rosie; Winterbach, Christiaan; Winterbach, Hanlie; Hemson, Graham; Bush, Mitch; Alexander, Kathleen A.; Revilla, Eloy; O'Brien, Stephen J.

    2005-01-01

    Feline immunodeficiency virus (FIV) infects numerous wild and domestic feline species and is closely related to human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV). Species-specific strains of FIV have been described for domestic cat (Felis catus), puma (Puma concolor), lion (Panthera leo), leopard (Panthera pardus), and Pallas' cat (Otocolobus manul). Here, we employ a three-antigen Western blot screening (domestic cat, puma, and lion FIV antigens) and PCR analysis to survey worldwide prevalence, distribution, and genomic differentiation of FIV based on 3,055 specimens from 35 Felidae and 3 Hyaenidae species. Although FIV infects a wide variety of host species, it is confirmed to be endemic in free-ranging populations of nine Felidae and one Hyaenidae species. These include the large African carnivores (lion, leopard, cheetah, and spotted hyena), where FIV is widely distributed in multiple populations; most of the South American felids (puma, jaguar, ocelot, margay, Geoffroy's cat, and tigrina), which maintain a lower FIV-positive level throughout their range; and two Asian species, the Pallas' cat, which has a species-specific strain of FIV, and the leopard cat, which has a domestic cat FIV strain in one population. Phylogenetic analysis of FIV proviral sequence demonstrates that most species for which FIV is endemic harbor monophyletic, genetically distinct species-specific FIV strains, suggesting that FIV transfer between cat species has occurred in the past but is quite infrequent today. PMID:15956574

  6. Ghost-tree: creating hybrid-gene phylogenetic trees for diversity analyses.

    Science.gov (United States)

    Fouquier, Jennifer; Rideout, Jai Ram; Bolyen, Evan; Chase, John; Shiffer, Arron; McDonald, Daniel; Knight, Rob; Caporaso, J Gregory; Kelley, Scott T

    2016-02-24

    Fungi play critical roles in many ecosystems, cause serious diseases in plants and animals, and pose significant threats to human health and structural integrity problems in built environments. While most fungal diversity remains unknown, the development of PCR primers for the internal transcribed spacer (ITS) combined with next-generation sequencing has substantially improved our ability to profile fungal microbial diversity. Although the high sequence variability in the ITS region facilitates more accurate species identification, it also makes multiple sequence alignment and phylogenetic analysis unreliable across evolutionarily distant fungi because the sequences are hard to align accurately. To address this issue, we created ghost-tree, a bioinformatics tool that integrates sequence data from two genetic markers into a single phylogenetic tree that can be used for diversity analyses. Our approach starts with a "foundation" phylogeny based on one genetic marker whose sequences can be aligned across organisms spanning divergent taxonomic groups (e.g., fungal families). Then, "extension" phylogenies are built for more closely related organisms (e.g., fungal species or strains) using a second more rapidly evolving genetic marker. These smaller phylogenies are then grafted onto the foundation tree by mapping taxonomic names such that each corresponding foundation-tree tip would branch into its new "extension tree" child. We applied ghost-tree to graft fungal extension phylogenies derived from ITS sequences onto a foundation phylogeny derived from fungal 18S sequences. Our analysis of simulated and real fungal ITS data sets found that phylogenetic distances between fungal communities computed using ghost-tree phylogenies explained significantly more variance than non-phylogenetic distances. The phylogenetic metrics also improved our ability to distinguish small differences (effect sizes) between microbial communities, though results were similar to non-phylogenetic

  7. Phylogenetic analysis of West Nile virus isolated in Italy in 2008.

    Science.gov (United States)

    Savini, G; Monaco, F; Calistri, P; Lelli, R

    2008-11-27

    In Italy the first occurrence of West Nile virus (WNV) infection was reported in Tuscany region during the late summer of 1998. In August 2008, the WNV infection re-emerged in Italy, in areas surrounding the Po river delta, and involving three regions Lombardy, Emilia Romagna and Veneto. WNV was isolated from blood and organs samples of one horse, one donkey, one pigeon (Columba livia) and three magpies (Pica pica). The phylogenetic analysis of the isolates, conducted on 255 bp in the region coding for the E protein, indicates that these isolates belong to the lineage I among the European strains. According to the analysis, both the 1998 and 2008 Italian strains as well as isolates from Romania, Russia, Senegal and Kenya fell in the same sub-cluster.

  8. The Impact of Media, Phylogenetic Classification, and E. coli Pathotypes on Biofilm Formation in Extraintestinal and Commensal E. coli From Humans and Animals

    Directory of Open Access Journals (Sweden)

    Daniel W. Nielsen

    2018-05-01

    Full Text Available Extraintestinal pathogenic Escherichia coli (ExPEC include avian pathogenic E. coli (APEC, neonatal meningitis E. coli (NMEC, and uropathogenic E. coli (UPEC and are responsible for significant animal and human morbidity and mortality. This study sought to investigate if biofilm formation by ExPEC likely contributes to these losses since biofilms are associated with recurrent urinary tract infections, antibiotic resistance, and bacterial exchange of genetic material. Therefore, the goal of this study was to examine differences in biofilm formation among a collection of ExPEC and to ascertain if there is a relationship between their ability to produce biofilms and their assignment to phylogenetic groups in three media types – M63, diluted TSB, and BHI. Our results suggest that ExPEC produce relatively different levels of biofilm formation in the media tested as APEC (70.4%, p = 0.0064 and NMEC (84.4%, p = 0.0093 isolates were poor biofilm formers in minimal medium M63 while UPEC isolates produced significantly higher ODs under nutrient-limited conditions with 25% of strains producing strong biofilms in diluted TSB (p = 0.0204. Additionally, E. coli phylogenetic assignment using Clermont’s original and revised typing scheme demonstrated significant differences among the phylogenetic groups in the different media. When the original phylogenetic group isolates previously typed as group D were phylogenetically typed under the revised scheme and examined, they showed substantial variation in their ability to form biofilms, which may explain the significant values of revised phylogenetic groups E and F in M63 (p = 0.0291, p = 0.0024. Our data indicates that biofilm formation is correlated with phylogenetic classification and subpathotype or commensal grouping of E. coli strains.

  9. European freshwater VHSV genotype Ia isolates divide into two distinct subpopulations

    DEFF Research Database (Denmark)

    Kahns, Søren; Skall, Helle Frank; Kaas, Rolf Sommer

    2012-01-01

    Viral haemorrhagic septicaemia (VHS), caused by the novirhabdovirus VHSV, often leads to significant economic losses to European rainbow trout production. The virus isolates are divided into 4 distinct genotypes with additional subgroups including sublineage Ia, isolates of which are the main...... detected in Denmark since January 2009. Full-length G-genes of all Danish VHSV isolates that were submitted for diagnostic analyses in the period 2004−2009 were sequenced and analysed. All 58 Danish isolates from rainbow trout grouped with sublineage Ia isolates. Furthermore, VHSV isolates from infected...... Danish freshwater catchments appear to have evolved into a distinct clade within sublineage Ia, herein designated clade Ia-1, whereas trout isolates originating from other continental European countries cluster in another distinct clade, designated clade Ia-2. In addition, phylogenetic analyses indicate...

  10. Selection of unusual actinomycetal primary sigma70 factors by plant-colonizing Frankia strains.

    Science.gov (United States)

    Lavire, Céline; Blaha, Didier; Cournoyer, Benoit

    2004-02-01

    Functional adaptations of sigma70 transcriptional factors led to the emergence of several paralogous lineages, each one being specialized for gene transcription under particular growth conditions. Screening of a Frankia strain EaI-12 gene library by sigma70 DNA probing allowed the detection and characterization of a novel actinomycetal primary (housekeeping) sigma70 factor. Phylogenetic analysis positioned this factor in the RpoD cluster of proteobacterial and low-G+C-content gram-positive factors, a cluster previously free of any actinobacterial sequences. sigma70 DNA probing of Frankia total DNA blots and PCR screening detected one or two rpoD-like DNA regions per species. rpoD matched the conserved region in all of the species tested. The other region was found to contain sigA, an alternative primary factor. sigA appeared to be strictly distributed among Frankia species infecting plants by the root hair infection process. Both genes were transcribed by Frankia strain ACN14a grown in liquid cultures. The molecular phylogeny of the sigma70 family determined with Frankia sequences showed that the alternative actinomycetal factors and the essential ones belonged to the same radiation. At least seven distinct paralogous lineages were observed among this radiation, and gene transfers were detected in the HrdB actinomycetal lineage.

  11. Evolution of naturally occurring 5'non-coding region variants of Hepatitis C virus in human populations of the South American region

    Directory of Open Access Journals (Sweden)

    García-Aguirre Laura

    2007-08-01

    Full Text Available Abstract Background Hepatitis C virus (HCV has been the subject of intense research and clinical investigation as its major role in human disease has emerged. Previous and recent studies have suggested a diversification of type 1 HCV in the South American region. The degree of genetic variation among HCV strains circulating in Bolivia and Colombia is currently unknown. In order to get insight into these matters, we performed a phylogenetic analysis of HCV 5' non-coding region (5'NCR sequences from strains isolated in Bolivia, Colombia and Uruguay, as well as available comparable sequences of HCV strains isolated in South America. Methods Phylogenetic tree analysis was performed using the neighbor-joining method under a matrix of genetic distances established under the Kimura-two parameter model. Signature pattern analysis, which identifies particular sites in nucleic acid alignments of variable sequences that are distinctly representative relative to a background set, was performed using the method of Korber & Myers, as implemented in the VESPA program. Prediction of RNA secondary structures was done by the method of Zuker & Turner, as implemented in the mfold program. Results Phylogenetic tree analysis of HCV strains isolated in the South American region revealed the presence of a distinct genetic lineage inside genotype 1. Signature pattern analysis revealed that the presence of this lineage is consistent with the presence of a sequence signature in the 5'NCR of HCV strains isolated in South America. Comparisons of these results with the ones found for Europe or North America revealed that this sequence signature is characteristic of the South American region. Conclusion Phylogentic analysis revealed the presence of a sequence signature in the 5'NCR of type 1 HCV strains isolated in South America. This signature is frequent enough in type 1 HCV populations circulating South America to be detected in a phylogenetic tree analysis as a distinct

  12. The effects of potato virus Y-derived virus small interfering RNAs of three biologically distinct strains on potato (Solanum tuberosum) transcriptome.

    Science.gov (United States)

    Moyo, Lindani; Ramesh, Shunmugiah V; Kappagantu, Madhu; Mitter, Neena; Sathuvalli, Vidyasagar; Pappu, Hanu R

    2017-07-17

    Potato virus Y (PVY) is one of the most economically important pathogen of potato that is present as biologically distinct strains. The virus-derived small interfering RNAs (vsiRNAs) from potato cv. Russet Burbank individually infected with PVY-N, PVY-NTN and PVY-O strains were recently characterized. Plant defense RNA-silencing mechanisms deployed against viruses produce vsiRNAs to degrade homologous viral transcripts. Based on sequence complementarity, the vsiRNAs can potentially degrade host RNA transcripts raising the prospect of vsiRNAs as pathogenicity determinants in virus-host interactions. This study investigated the global effects of PVY vsiRNAs on the host potato transcriptome. The strain-specific vsiRNAs of PVY, expressed in high copy number, were analyzed in silico for their proclivity to target potato coding and non-coding RNAs using psRobot and psRNATarget algorithms. Functional annotation of target coding transcripts was carried out to predict physiological effects of the vsiRNAs on the potato cv. Russet Burbank. The downregulation of selected target coding transcripts was further validated using qRT-PCR. The vsiRNAs derived from biologically distinct strains of PVY displayed diversity in terms of absolute number, copy number and hotspots for siRNAs on their respective genomes. The vsiRNAs populations were derived with a high frequency from 6 K1, P1 and Hc-Pro for PVY-N, P1, Hc-Pro and P3 for PVY-NTN, and P1, 3' UTR and NIa for PVY-O genomic regions. The number of vsiRNAs that displayed interaction with potato coding transcripts and number of putative coding target transcripts were comparable between PVY-N and PVY-O, and were relatively higher for PVY-NTN. The most abundant target non-coding RNA transcripts for the strain specific PVY-derived vsiRNAs were found to be MIR821, 28S rRNA,18S rRNA, snoR71, tRNA-Met and U5. Functional annotation and qRT-PCR validation suggested that the vsiRNAs target genes involved in plant hormone signaling, genetic

  13. Hepatitis a virus genotypes and strains from an endemic area of Europe, Bulgaria 2012-2014.

    Science.gov (United States)

    Bruni, Roberto; Taffon, Stefania; Equestre, Michele; Cella, Eleonora; Lo Presti, Alessandra; Costantino, Angela; Chionne, Paola; Madonna, Elisabetta; Golkocheva-Markova, Elitsa; Bankova, Diljana; Ciccozzi, Massimo; Teoharov, Pavel; Ciccaglione, Anna Rita

    2017-07-14

    Hepatitis A virus (HAV) infection is endemic in Eastern European and Balkan region countries. In 2012, Bulgaria showed the highest rate (67.13 cases per 100,000) in Europe. Nevertheless, HAV genotypes and strains circulating in this country have never been described. The present study reports the molecular characterization of HAV from 105 patients from Bulgaria. Anti-HAV IgM positive serum samples collected in 2012-2014 from different towns and villages in Bulgaria were analysed by nested RT-PCR, sequencing of the VP1/2A region and phylogenetic analysis; the results were analysed together with patient and geographical data. Phylogenetic analysis revealed two main sequence groups corresponding to the IA (78/105, 74%) and IB (27/105, 26%) sub-genotypes. In the IA group, a major and a minor cluster were observed (62 and 16 sequences, respectively). Most sequences from the major cluster (44/62, 71%) belonged to either of two strains, termed "strain 1" and "strain 2", differing only for a single specific nucleotide; the remaining sequences (18/62, 29%) showed few (1 to 4) nucleotide variations respect to strain 1 and 2. Strain 2 is identical to the strain previously responsible for an outbreak in the Czech Republic in 2008 and a large multi-country European outbreak caused by contaminated mixed frozen berries in 2013. Most sequences of the IA minor cluster and the IB group were detected in large/medium centers (LMCs). Overall, sequences from the IA major cluster were more frequent in small centers (SCs), but strain 1 and strain 2 showed an opposite relative frequency in SCs and LMCs (strain 1 more frequent in SCs, strain 2 in LMCs). Genotype IA predominated in Bulgaria in 2012-2014 and phylogenetic analysis identified a major cluster of highly related or identical IA sequences, representing 59% of the analysed cases; these isolates were mostly detected in SCs, in which HAV shows higher endemicity than in LMCs. The distribution of viral sequences suggests the existence

  14. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Science.gov (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  15. Suitability of cuticular pores and sensilla for harpacticoid copepod species delineation and phylogenetic reconstruction.

    Science.gov (United States)

    Karanovic, Tomislav; Kim, Kichoon

    2014-11-01

    Cuticular organs have not been described systematically in harpacticoids until recently, and they haven ever been used as characters for reconstructing phylogenetic relationships in any crustacean group. We survey cuticular pores and sensilla on somites in ten Miraciidae species, belonging to six genera, from Korea, Australia, and Russia. Nine species belong to the subfamily Stenheliinae, while the outgroup belongs to the subfamily Diosaccinae. We aim to compare phylogenetic trees reconstructed for these harpactioids based on: 1) cuticular organs (with 76 characters scored, 71% of them phylogenetically informative); 2) traditionally used macro-morphological characters (66 scored, 77% of them informative);and 3) mtCOI DNA data. All analyses suggest that cuticular organs are useful characters for harpacticoid species delineation, although not as sensitive as some fast-evolving molecular markers. Reconstructed cladograms based on all three datasets show very high bootstrap values for clades representing distinct genera, suggesting that cuticular organs are suitable characters for studying phylogenetic relationships. Bootstrap values for the more basal nodes differ among the different cladograms,as do the sister-group relationships they suggest, indicating that cuticular organs probably have different evolutionary constraints from macro-morphological characters. Cuticular organs could be quite useful in the study of old museum specimens and fossil crustaceans.

  16. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  17. Comparative genomics of Lactobacillus salivarius strains focusing on their host adaptation.

    Science.gov (United States)

    Lee, Jun-Yeong; Han, Geon Goo; Kim, Eun Bae; Choi, Yun-Jaie

    2017-12-01

    Lactobacillus salivarius is an important member of the animal gut microflora and is a promising probiotic bacterium. However, there is a lack of research on the genomic diversity of L. salivarius species. In this study, we generated 21 L. salivarius draft genomes, and investigated the pan-genome of L. salivarius strains isolated from humans, pigs and chickens using all available genomes, focusing on host adaptation. Phylogenetic clustering showed a distinct categorization of L. salivarius strains depending on their hosts. In the pan-genome, 15 host-specific genes and 16 dual-host-shared genes that only one host isolate did not possess were identified. Comparison of 56 extracellular protein encoding genes and 124 orthologs related to exopolysaccharide production in the pan-genome revealed that extracellular components of the assayed bacteria have been globally acquired and mutated under the selection pressure for host adaptation. We also found the three host-specific genes that are responsible for energy production in L. salivarius. These results showed that L. salivarius has evolved to adapt to host habitats in two ways, by gaining the abilities for niche adhesion and efficient utilization of nutrients. Our study offers a deeper understanding of the probiotic species L. salivarius, and provides a basis for future studies on L. salivarius and other mutualistic bacteria. Copyright © 2017 Elsevier GmbH. All rights reserved.

  18. [Characterization of the genetic variability of field strains of Brucella canis isolated in Antioquia].

    Science.gov (United States)

    Vidal Arboleda, Juana L; Ortiz Roman, Luisa F; Olivera Angel, Martha

    2017-12-22

    Brucella canis is a facultative intracellular pathogen responsible for canine brucellosis, a zoonotic disease that affects canines, causing abortions and reproductive failure; and the production of non-specific symptoms in humans. In 2005 the presence of B. canis in Antioquia was demonstrated and the strains were identified as type 2. The sequencing of the genome of a field strain denoted Brucella canis str. Oliveri, showed species-specific indel events, which led us to investigate the genomic characteristics of the B. canis strain isolated and to establish the phylogenetic relationships and the divergence time of B. canis str. Oliveri. Conventional PCR sequencing was performed in 30 field strains identifying 5 indel events recognized in B. canis str. Oliveri. ADN from Brucella suis, Brucella melitensis and vaccine strains from Brucella abortus were used as control, and it was determined that all of the studied field strains shared 4 out of the 5 indels of the sequenced Oliveri strain, indicating the presence of more than one strain circulating in the region. Phylogenetic analysis was performed with 24 strains of Brucella using concatenated sequences of genetic markers for species differentiation. The molecular clock hypothesis and Tajima's relative rate test were tested, showing that the Oliveri strain, similarly to other canis species, diverged from B. suis. The molecular clock hypothesis between Brucella species was rejected and an evolution rate and a similar genetic distance between the B. canis were demonstrated. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Identification and biochemical characterization of Leishmania strains isolated in Peru, Mexico, and Spain.

    Science.gov (United States)

    Rodríguez-González, Isabel; Marín, Clotilde; Vargas, Franklin; Córdova, Ofelia; Barrera, Mario; Gutiérrez-Sánchez, Ramón; Alunda, Jose María; Sánchez-Moreno, Manuel

    2006-01-01

    Eight Leishmania promastigotes were isolated from different geographical areas: three (LP1, LP2, and LP3) from the provincial department La Libertad and the fourth (LP4) from the department of Cajamarca (northern Peru); another three (LM1, LM2, and LM3) in the province of Campeche (Mexico); and the last (LS1) from a clinical case of a dog in Madrid (Spain). The isolates were characterized by carbohydrate cell-surface residues using agglutinations with four purified lectins, by isoenzyme analysis using different isoenzymes, by analysis of kinetoplast DNA (kDNA) restriction fragment length polymorphism using four different restriction endonucleases and by the final metabolite patterns after in vitro culture. These isolates were compared with four reference strains and typified as: Leishmania (Leishmania) donovani, two strains of L. (L.) infantum, and one species of L. (Viania) peruviana. According to our results and the statistical study, the Peruvian isolates represent three different strains: one would be L. (V.) peruviana, another the strain isolated in Cajamarca (LP4) and the third would include the three strains from the department of La Libertad (LP1, LP2, and LP3), these latter three isolates being phylogenetically closer to the reference strain L. (L.) donovani. Meanwhile, the three isolates from Mexico form a group with close phylogenetic relationships to each other. The isolate from Spain belongs to the species L. (L.) infantum. Thus, a close correlation was drawn between the identity of each strain and its geographical origin.

  20. Genetic diversity and symbiotic effectiveness of Bradyrhizobium strains nodulating selected annual grain legumes growing in Ethiopia.

    Science.gov (United States)

    Degefu, Tulu; Wolde-Meskel, Endalkachew; Rasche, Frank

    2018-01-01

    Vigna unguiculata, Vigna radiata and Arachis hypogaea growing in Ethiopia are nodulated by a genetically diverse group of Bradyrhizobium strains. To determine the genetic identity and symbiotic effectiveness of these bacteria, a collection of 36 test strains originating from the root nodules of the three hosts was investigated using multilocus sequence analyses (MLSA) of core genes including 16S rRNA, recA, glnII, gyrB, atpD and dnaK. Sequence analysis of nodA and nifH genes along with tests for symbiotic effectiveness using δ 15 N analysis were also carried out. The phylogenetic trees derived from the MLSA grouped most test strains into four well-supported distinct positions designated as genospecies I-IV. The maximum likelihood (ML) tree that was constructed based on the nodA gene sequences separated the entire test strains into two lineages, where the majority of the test strains were clustered on one of a well-supported large branch that comprise Bradyrhizobium species from the tropics. This clearly suggested the monophyletic origin of the nodA genes within the bradyrhizobia of tropical origin. The δ 15 N-based symbiotic effectiveness test of seven selected strains revealed that strains GN100 (δ 15 N=0.73) and GN102 (δ 15 N=0.79) were highly effective nitrogen fixers when inoculated to cowpea, thus can be considered as inoculants in cowpea production. It was concluded that Ethiopian soils are a hotspot for rhizobial diversity. This calls for further research to unravel as yet unknown bradyrhizobia nodulating legume host species growing in the country. In this respect, prospective research should also address the mechanisms of symbiotic specificity that could lead to high nitrogen fixation in target legumes.

  1. Genetic and phylogenetic analysis of a novel parvovirus isolated from chickens in Guangxi, China.

    Science.gov (United States)

    Feng, Bin; Xie, Zhixun; Deng, Xianwen; Xie, Liji; Xie, Zhiqin; Huang, Li; Fan, Qin; Luo, Sisi; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Wang, Sheng; Wang, Leyi

    2016-11-01

    A previously unidentified chicken parvovirus (ChPV) strain, associated with runting-stunting syndrome (RSS), is now endemic among chickens in China. To explore the genetic diversity of ChPV strains, we determined the first complete genome sequence of a novel ChPV isolate (GX-CH-PV-7) identified in chickens in Guang Xi, China, and showed moderate genome sequence similarity to reference strains. Analysis showed that the viral genome sequence is 86.4 %-93.9 % identical to those of other ChPVs. Genetic and phylogenetic analyses showed that this newly emergent GX-CH-PV-7 is closely related to Gallus gallus enteric parvovirus isolate ChPV 798 from the USA, indicating that they may share a common ancestor. The complete DNA sequence is 4612 bp long with an A+T content of 56.66 %. We determined the first complete genome sequence of a previously unidentified ChPV strain to elucidate its origin and evolutionary status.

  2. Conservation Action Based on Threatened Species Capture Taxonomic and Phylogenetic Richness in Breeding and Wintering Populations of Central Asian Birds

    Science.gov (United States)

    Schweizer, Manuel; Ayé, Raffael; Kashkarov, Roman; Roth, Tobias

    2014-01-01

    Although phylogenetic diversity has been suggested to be relevant from a conservation point of view, its role is still limited in applied nature conservation. Recently, the practice of investing conservation resources based on threatened species was identified as a reason for the slow integration of phylogenetic diversity in nature conservation planning. One of the main arguments is based on the observation that threatened species are not evenly distributed over the phylogenetic tree. However this argument seems to dismiss the fact that conservation action is a spatially explicit process, and even if threatened species are not evenly distributed over the phylogenetic tree, the occurrence of threatened species could still indicate areas with above average phylogenetic diversity and consequently could protect phylogenetic diversity. Here we aim to study the selection of important bird areas in Central Asia, which were nominated largely based on the presence of threatened bird species. We show that although threatened species occurring in Central Asia do not capture phylogenetically more distinct species than expected by chance, the current spatially explicit conservation approach of selecting important bird areas covers above average taxonomic and phylogenetic diversity of breeding and wintering birds. We conclude that the spatially explicit processes of conservation actions need to be considered in the current discussion of whether new prioritization methods are needed to complement conservation action based on threatened species. PMID:25337861

  3. Genetic characterization and phylogenetic position of Echinococcus felidis (Cestoda: Taeniidae) from the African lion.

    Science.gov (United States)

    Hüttner, Marion; Nakao, Minoru; Wassermann, Torsten; Siefert, Ludwig; Boomker, Joop D F; Dinkel, Anke; Sako, Yasuhito; Mackenstedt, Ute; Romig, Thomas; Ito, Akira

    2008-06-01

    Echinococcus felidis had been described in 1937 from African lions, but was later included in Echinococcus granulosus as a subspecies or a strain. In the absence of any genetic characterization, most previous records of this taxon from a variety of large African mammals remained unconfirmed due to the lack of diagnostic criteria and the possible confusion with the sympatric E. granulosus sensu stricto, Echinococcus ortleppi and Echinococcus canadensis. In this study, we obtained taeniid eggs from lion feces in Uganda and amplified DNA from individual eggs. Mitochondrial and nuclear DNA sequences showed similarities with those of other Echinococcus spp., but high values of percentage divergence of mitochondrial genes indicated the presence of a distinct species. In a second step, we compared this material with the preserved specimens of adult E. granulosus felidis, which had been identified morphologically approximately 40 years ago in South Africa. All DNA fragments (<200 bp) that could be amplified from the adults showed 100% similarity with the Ugandan material. In the phylogenetic tree of Echinococcus which was constructed from the mitochondrial genes, E. felidis is positioned as a sister taxon of E. granulosus sensu stricto. The data obtained will facilitate the development of diagnostic tools necessary to study the epidemiology of this enigmatic parasite.

  4. On Nakhleh's metric for reduced phylogenetic networks

    OpenAIRE

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente Feruglio, Gabriel Alejandro

    2009-01-01

    We prove that Nakhleh’s metric for reduced phylogenetic networks is also a metric on the classes of tree-child phylogenetic networks, semibinary tree-sibling time consistent phylogenetic networks, and multilabeled phylogenetic trees. We also prove that it separates distinguishable phylogenetic networks. In this way, it becomes the strongest dissimilarity measure for phylogenetic networks available so far. Furthermore, we propose a generalization of that metric that separates arbitrary phyl...

  5. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  6. Phylogenetic & Physiological Profiling of Microbial Communities of Contaminated Soils/Sediments: Identifying Microbial consortia...

    Energy Technology Data Exchange (ETDEWEB)

    Terence L. Marsh

    2004-05-26

    The goals of this study were: (1) survey the microbial community in soil samples from a site contaminated with heavy metals using new rapid molecular techniques that are culture-independent; (2) identify phylogenetic signatures of microbial populations that correlate with metal ion contamination; and (3) cultivate these diagnostic strains using traditional as well as novel cultivation techniques in order to identify organisms that may be of value in site evaluation/management or bioremediation.

  7. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  8. Phylogenetic and biogeographic analysis of sphaerexochine trilobites.

    Directory of Open Access Journals (Sweden)

    Curtis R Congreve

    Full Text Available BACKGROUND: Sphaerexochinae is a speciose and widely distributed group of cheirurid trilobites. Their temporal range extends from the earliest Ordovician through the Silurian, and they survived the end Ordovician mass extinction event (the second largest mass extinction in Earth history. Prior to this study, the individual evolutionary relationships within the group had yet to be determined utilizing rigorous phylogenetic methods. Understanding these evolutionary relationships is important for producing a stable classification of the group, and will be useful in elucidating the effects the end Ordovician mass extinction had on the evolutionary and biogeographic history of the group. METHODOLOGY/PRINCIPAL FINDINGS: Cladistic parsimony analysis of cheirurid trilobites assigned to the subfamily Sphaerexochinae was conducted to evaluate phylogenetic patterns and produce a hypothesis of relationship for the group. This study utilized the program TNT, and the analysis included thirty-one taxa and thirty-nine characters. The results of this analysis were then used in a Lieberman-modified Brooks Parsimony Analysis to analyze biogeographic patterns during the Ordovician-Silurian. CONCLUSIONS/SIGNIFICANCE: The genus Sphaerexochus was found to be monophyletic, consisting of two smaller clades (one composed entirely of Ordovician species and another composed of Silurian and Ordovician species. By contrast, the genus Kawina was found to be paraphyletic. It is a basal grade that also contains taxa formerly assigned to Cydonocephalus. Phylogenetic patterns suggest Sphaerexochinae is a relatively distinctive trilobite clade because it appears to have been largely unaffected by the end Ordovician mass extinction. Finally, the biogeographic analysis yields two major conclusions about Sphaerexochus biogeography: Bohemia and Avalonia were close enough during the Silurian to exchange taxa; and during the Ordovician there was dispersal between Eastern Laurentia and

  9. Transforming phylogenetic networks: Moving beyond tree space.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Wu, Taoyang

    2016-09-07

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent reticulate evolution. Unrooted phylogenetic networks form a special class of such networks, which naturally generalize unrooted phylogenetic trees. In this paper we define two operations on unrooted phylogenetic networks, one of which is a generalization of the well-known nearest-neighbor interchange (NNI) operation on phylogenetic trees. We show that any unrooted phylogenetic network can be transformed into any other such network using only these operations. This generalizes the well-known fact that any phylogenetic tree can be transformed into any other such tree using only NNI operations. It also allows us to define a generalization of tree space and to define some new metrics on unrooted phylogenetic networks. To prove our main results, we employ some fascinating new connections between phylogenetic networks and cubic graphs that we have recently discovered. Our results should be useful in developing new strategies to search for optimal phylogenetic networks, a topic that has recently generated some interest in the literature, as well as for providing new ways to compare networks. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Characterisation of a rare, reassortant human G10P[14] rotavirus strain detected in Honduras.

    Science.gov (United States)

    Quaye, Osbourne; Roy, Sunando; Rungsrisuriyachai, Kunchala; Esona, Mathew D; Xu, Ziqian; Tam, Ka Ian; Banegas, Dina J Castro; Rey-Benito, Gloria; Bowen, Michael D

    2018-01-01

    Although first detected in animals, the rare rotavirus strain G10P[14] has been sporadically detected in humans in Slovenia, Thailand, United Kingdom and Australia among other countries. Earlier studies suggest that the strains found in humans resulted from interspecies transmission and reassortment between human and bovine rotavirus strains. In this study, a G10P[14] rotavirus genotype detected in a human stool sample in Honduras during the 2010-2011 rotavirus season, from an unvaccinated 30-month old boy who reported at the hospital with severe diarrhea and vomiting, was characterised to determine the possible evolutionary origin of the rare strain. For the sample detected as G10P[14], 10% suspension was prepared and used for RNA extraction and sequence independent amplification. The amplicons were sequenced by next-generation sequencing using the Illumina MiSeq 150 paired end method. The sequence reads were analysed using CLC Genomics Workbench 6.0 and phylogenetic trees were constructed using PhyML version 3.0. The next generation sequencing and phylogenetic analyses of the 11-segmented genome of the G10P[14] strain allowed classification as G10-P[14]-I2-R2-C2-M2-A3-N2-T6-E2-H3. Six of the genes (VP1, VP2, VP3, VP6, NSP2 and NSP4) were DS-1-like. NSP1 and NSP5 were AU-1-like and NSP3 was T6, which suggests that multiple reassortment events occurred in the evolution of the strain. The phylogenetic analyses and genetic distance calculations showed that the VP7, VP4, VP6, VP1, VP3, NSP1, NSP3 and NSP4 genes clustered predominantly with bovine strains. NSP2 and VP2 genes were most closely related to simian and human strains, respectively, and NSP5 was most closely related to a rhesus strain. The genetic characterisation of the G10P[14] strain from Honduras suggests that its genome resulted from multiple reassortment events which were possibly mediated through interspecies transmissions.

  11. Isolation and partial characterization of pigment-like antibiotics produced by a new strain of Streptosporangium isolated from an Algerian soil.

    Science.gov (United States)

    Boudjella, H; Bouti, K; Zitouni, A; Mathieu, F; Lebrihi, A; Sabaou, N

    2007-07-01

    Identification of a new actinomycete strain Sg3, belonging to the genus Streptosporangium and partial characterization of the produced antibacterial activities. The strain Sg3 was isolated from an Algerian Saharan soil and identified by morphological, chemotaxonomic and phylogenetic analyses to the genus Streptosporangium. The comparison of its physiological characteristics with those of known species of Streptosporangium showed significant differences with the nearest species Streptosporangium carneum. Analysis of the 16S rDNA sequence of strain Sg3 showed a similarity level ranging between 97% and 98.8% within Streptosporangium species, with S. carneum the most closely related. Strain Sg3 showed a red coloured antibacterial activity against gram-positive bacteria on several culture media. The purification of the red pigment by chromatographic methods led to the isolation of three active products. The (1)H nuclear magnetic resonance (NMR), mass, infrared (IR) and ultraviolet-visible (UV-VIS) data of these molecules strongly suggested that they belonged to the quinone-anthracycline group with three or more rings. Strain Sg3 represents a distinct phyletic line suggesting a new genomic species. It produces antibacterial activities identified as quinone-anthracycline aromatics. The quinone-anthracycline antibiotics are known for their antimicrobial and antineoplastic activities and are used in chemotherapy for the treatment of many cancer diseases. The present work constitutes the first stage of a whole series of studies to be realized on these antibiotics before arriving at a possible application.

  12. Functional and phylogenetic ecology in R

    CERN Document Server

    Swenson, Nathan G

    2014-01-01

    Functional and Phylogenetic Ecology in R is designed to teach readers to use R for phylogenetic and functional trait analyses. Over the past decade, a dizzying array of tools and methods were generated to incorporate phylogenetic and functional information into traditional ecological analyses. Increasingly these tools are implemented in R, thus greatly expanding their impact. Researchers getting started in R can use this volume as a step-by-step entryway into phylogenetic and functional analyses for ecology in R. More advanced users will be able to use this volume as a quick reference to understand particular analyses. The volume begins with an introduction to the R environment and handling relevant data in R. Chapters then cover phylogenetic and functional metrics of biodiversity; null modeling and randomizations for phylogenetic and functional trait analyses; integrating phylogenetic and functional trait information; and interfacing the R environment with a popular C-based program. This book presents a uni...

  13. Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV strain 220-90

    Directory of Open Access Journals (Sweden)

    LaPatra Scott E

    2010-01-01

    Full Text Available Abstract Background Infectious hematopoietic necrosis virus (IHNV is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939 with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American

  14. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  15. Spodoptera frugiperda (Lepidoptera: Noctuidae) host-plant variants: two host strains or two distinct species?

    Science.gov (United States)

    Dumas, Pascaline; Legeai, Fabrice; Lemaitre, Claire; Scaon, Erwan; Orsucci, Marion; Labadie, Karine; Gimenez, Sylvie; Clamens, Anne-Laure; Henri, Hélène; Vavre, Fabrice; Aury, Jean-Marc; Fournier, Philippe; Kergoat, Gael J; d'Alençon, Emmanuelle

    2015-06-01

    The moth Spodoptera frugiperda is a well-known pest of crops throughout the Americas, which consists of two strains adapted to different host-plants: the first feeds preferentially on corn, cotton and sorghum whereas the second is more associated with rice and several pasture grasses. Though morphologically indistinguishable, they exhibit differences in their mating behavior, pheromone compositions, and show development variability according to the host-plant. Though the latter suggest that both strains are different species, this issue is still highly controversial because hybrids naturally occur in the wild, not to mention the discrepancies among published results concerning mating success between the two strains. In order to clarify the status of the two host-plant strains of S. frugiperda, we analyze features that possibly reflect the level of post-zygotic isolation: (1) first generation (F1) hybrid lethality and sterility; (2) patterns of meiotic segregation of hybrids in reciprocal second generation (F2), as compared to the meiosis of the two parental strains. We found a significant reduction of mating success in F1 in one direction of the cross and a high level of microsatellite markers showing transmission ratio distortion in the F2 progeny. Our results support the existence of post-zygotic reproductive isolation between the two laboratory strains and are in accordance with the marked level of genetic differentiation that was recovered between individuals of the two strains collected from the field. Altogether these results provide additional evidence in favor of a sibling species status for the two strains.

  16. Multiple homoplasious insertions and deletions of a Triticeae (Poaceae DNA transposon: a phylogenetic perspective

    Directory of Open Access Journals (Sweden)

    Mason-Gamer Roberta J

    2007-06-01

    Full Text Available Abstract Background Stowaway elements are short, non-autonomous DNA transposons categorized as miniature inverted-repeat transposable elements (MITEs. The high MITE copy number in grass genomes suggests an active history of amplification and insertion, but ongoing MITE activity has only rarely been seen, and ongoing Stowaway activity has never been observed. Thus, a phylogenetic perspective on presence vs. absence of elements in an aligned data set can provide valuable historical insights into the dynamics of MITE acquisition and loss. Results A Stowaway-like element resides within the fourth intron of a β-amylase gene in representatives of five genera in the wheat tribe, Triticeae. Its presence vs. absence was examined with reference to the β-amylase gene tree topology, and in light of sequence comparisons of the β-amylase elements to Triticeae Stowaway elements in the Entrez nucleotide database. Among the sequences lacking the element, there are five distinct putative excision footprints (one widespread and four restricted to unrelated lineages and two flanking deletions. The sequences that do contain elements are polyphyletic on the β-amylase tree, and their elements are divergent at the sequence level. The β-amylase elements do not form a monophyletic group relative to other Stowaway elements in Entrez; most are more similar to elements from other loci in other Triticeae genomes than they are to one another. Conclusion Combined, the phylogenetic distribution, sequence variation, and Entrez database comparisons indicate that a Stowaway-like element has undergone multiple deletions from and insertions into the same site in β-amylase intron 4 during the history of the tribe. The elements currently at the site represent multiple, distinct lineages that transcend generic boundaries. While patterns of Stowaway polymorphism across a phylogenetic data set do not allow evolutionary mechanisms to be inferred with certainty, they do provide

  17. Complete genome sequence of Kytococcus sedentarius type strain (strain 541T)

    Energy Technology Data Exchange (ETDEWEB)

    Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ovchinnikova, Galina; Pati, Amrita; Ivanova, Natalia; Mavrommatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; D' haeseleer, Patrick; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Schneider, Susanne; Goker, Markus; Pukall, Rudiger; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Kytococcus sedentarius (ZoBell and Upham 1944) Stackebrandt et al. 1995 is the type strain of the species, and is of phylogenetic interest because of its location in the Dermacoccaceae, a poorly studied family within the actinobacterial suborder Micrococcineae. K. sedentarius is known for the production of oligoketide antibiotics as well as for its role as an opportunistic pathogen causing valve endocarditis, hemorrhagic pneumonia, and pitted keratolysis. It is strictly aerobic and can only grow when several amino acids are provided in the medium. The strain described in this report is a free-living, nonmotile, Gram-positive bacterium, originally isolated from a marine environment. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the family Dermacoccaceae and the 2,785,024 bp long single replicon genome with its 2639 protein-coding and 64 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  18. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. Characterization of the genome of a phylogenetically distinct tospovirus and its interactions with the local lesion-induced host Chenopodium quinoa by whole-transcriptome analyses.

    Science.gov (United States)

    Chou, Wan-Chen; Lin, Shih-Shun; Yeh, Shyi-Dong; Li, Siang-Ling; Peng, Ying-Che; Fan, Ya-Hsu; Chen, Tsung-Chi

    2017-01-01

    Chenopodium quinoa is a natural local lesion host of numerous plant viruses, including tospoviruses (family Bunyaviridae). Groundnut chlorotic fan-spot tospovirus (GCFSV) has been shown to consistently induce local lesions on the leaves of C. quinoa 4 days post-inoculation (dpi). To reveal the whole genome of GCFSV and its interactions with C. quinoa, RNA-seq was performed to determine the transcriptome profiles of C. quinoa leaves. The high-throughput reads from infected C. quinoa leaves were used to identify the whole genome sequence of GCFSV and its single nucleotide polymorphisms. Our results indicated that GCFSV is a phylogenetically distinct tospovirus. Moreover, 27,170 coding and 29,563 non-coding sequences of C. quinoa were identified through de novo assembly, mixing reads from mock and infected samples. Several key genes involved in the modulation of hypersensitive response (HR) were identified. The expression levels of 4,893 deduced complete genes annotated using the Arabidopsis genome indicated that several HR-related orthologues of pathogenesis-related proteins, transcription factors, mitogen-activated protein kinases, and defense proteins were significantly expressed in leaves that formed local lesions. Here, we also provide new insights into the replication progression of a tospovirus and the molecular regulation of the C. quinoa response to virus infection.

  20. Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.

    Science.gov (United States)

    Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S

    2016-04-01

    In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.

  1. The transposition distance for phylogenetic trees

    OpenAIRE

    Rossello, Francesc; Valiente, Gabriel

    2006-01-01

    The search for similarity and dissimilarity measures on phylogenetic trees has been motivated by the computation of consensus trees, the search by similarity in phylogenetic databases, and the assessment of clustering results in bioinformatics. The transposition distance for fully resolved phylogenetic trees is a recent addition to the extensive collection of available metrics for comparing phylogenetic trees. In this paper, we generalize the transposition distance from fully resolved to arbi...

  2. Evidence of increased antibiotic resistance in phylogenetically-diverse Aeromonas isolates from semi-intensive fish ponds treated with antibiotics

    Directory of Open Access Journals (Sweden)

    Hemant J Patil

    2016-11-01

    Full Text Available The genus Aeromonas is ubiquitous in aquatic environments encompassing a broad range of fish and human pathogens. Aeromonas strains are known for their enhanced capacity to acquire and exchange antibiotic resistance genes and therefore, are frequently targeted as indicator bacteria for monitoring antimicrobial resistance in aquatic environments. This study evaluated temporal trends in Aeromonas diversity and antibiotic resistance in two adjacent semi-intensive aquaculture facilities to ascertain effects of antibiotic treatment on antimicrobial resistance. In the first facility, sulfadiazine-trimethoprim was added prophylactically upon fingerling stocking and water column-associated Aeromonas were monitored periodically over an eleven-month fish-fattening cycle to assess temporal dynamics in taxonomy and antibiotic resistance. In the second facility, Aeromonas were isolated from fish skin ulcers sampled over a three-year period and from pond water samples to assess associations between pathogenic strains to those in the water column. A total of 1200 Aeromonas spp. were isolated, initially screened for sulfadiazine resistance and further screened against five additional antibiotics. In both facilities, strong correlations were observed between sulfadiazine resistance and trimethoprim and tetracycline resistances, whereas correlations between sulfadiazine resistance and ceftriaxone, gentamycin and chloramphenicol resistances were low. Abundance of multi-drug resistant strains as well as sul1, tetA and intI1 gene-harboring strains was significantly higher in profiles sampled during the fish cycle than those isolated prior to stocking and these genes were extremely abundant in the pathogenic strains. Five phylogenetically-distinct Aeromonas clusters were revealed using partial rpoD gene sequence analysis. Interestingly, prior to fingerling stocking the diversity of water column strains was high, and representatives from all five clusters were

  3. Phylogenetic variation of Aggregatibacter actinomycetemcomitans serotype e reveals an aberrant distinct evolutionary stable lineage

    NARCIS (Netherlands)

    van der Reijden, Wil A.; Brunner, Jorg; Bosch-Tijhof, Carolien J.; van Trappen, Stefanie; Rijnsburger, Martine C.; de Graaff, Marcel P. W.; van Winkelhoff, Arie J.; Cleenwerck, Ilse; de Vos, Paul

    2010-01-01

    The periodontal pathogen Aggregatibacter actinomycetemcomitans that comprises six serotypes (a-f), is often identified by PCR-based techniques targeting the 16S rRNA gene. In this study, 16S rRNA gene sequence analysis revealed an aberrant cluster of 19 strains within serotype e, denoted as serotype

  4. Phylogenetic diversity of ceftriaxone resistance and the presence of extended-spectrum β-lactamase genes in the culturable soil resistome.

    Science.gov (United States)

    Pagaling, Eulyn; Gatica, Joao; Yang, Kun; Cytryn, Eddie; Yan, Tao

    2016-09-01

    The aim of this study was to determine the phylogenetic diversity of ceftriaxone resistance and the presence of known extended-spectrum β-lactamase (ESBL) genes in culturable soil resistomes. Libraries of soil bacterial isolates resistant to ceftriaxone were established from six physicochemically diverse soils collected in Hawaii (USA) and Israel. The phylogenetic affiliation, ceftriaxone and multidrug resistance levels, and presence of known ESBL genes of the isolates were determined. The soil bacterial isolates were phylogenetically grouped with the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes and Bacteroidetes. Ceftriaxone minimum inhibitory concentrations (MICs) largely followed the phylogeny structure and higher levels of ceftriaxone resistance corresponded to higher multidrug resistance. Three distinct blaTEM variants were detected in soil bacterial isolates belonging to nine different genera. In conclusion, the culturable soil resistomes for ceftriaxone exhibited high phylogenetic diversity and multidrug resistance. blaTEM was the only known ESBL detected in the soil resistomes, and its distribution in different phylogenetic groups suggests its ubiquitous presence and/or possible horizontal gene transfer within the soil microbiomes. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  5. Phylogeny and phylogenetic classification of the antbirds, ovenbirds, woodcreepers, and allies (Aves: Passeriformes: Infraorder Furnariides)

    Science.gov (United States)

    Moyle, R.G.; Chesser, R.T.; Brumfield, R.T.; Tello, J.G.; Marchese, D.J.; Cracraft, J.

    2009-01-01

    The infraorder Furnariides is a diverse group of suboscine passerine birds comprising a substantial component of the Neotropical avifauna. The included species encompass a broad array of morphologies and behaviours, making them appealing for evolutionary studies, but the size of the group (ca. 600 species) has limited well-sampled higher-level phylogenetic studies. Using DNA sequence data from the nuclear RAG-1 and RAG-2 exons, we undertook a phylogenetic analysis of the Furnariides sampling 124 (more than 88%) of the genera. Basal relationships among family-level taxa differed depending on phylogenetic method, but all topologies had little nodal support, mirroring the results from earlier studies in which discerning relationships at the base of the radiation was also difficult. In contrast, branch support for family-rank taxa and for many relationships within those clades was generally high. Our results support the Melanopareidae and Grallariidae as distinct from the Rhinocryptidae and Formicariidae, respectively. Within the Furnariides our data contradict some recent phylogenetic hypotheses and suggest that further study is needed to resolve these discrepancies. Of the few genera represented by multiple species, several were not monophyletic, indicating that additional systematic work remains within furnariine families and must include dense taxon sampling. We use this study as a basis for proposing a new phylogenetic classification for the group and in the process erect new family-group names for clades having high branch support across methods. ?? 2009 The Willi Hennig Society.

  6. Phylogenetic placement of two previously described intranuclear bacteria from the ciliate Paramecium bursaria (Protozoa, Ciliophora): 'Holospora acuminata' and 'Holospora curviuscula'.

    Science.gov (United States)

    Rautian, Maria S; Wackerow-Kouzova, Natalia D

    2013-05-01

    'Holospora acuminata' infects micronuclei of Paramecium bursaria (Protozoa, Ciliophora), whereas 'Holospora curviuscula' infects the macronucleus in other clones of the same host species. Because these micro-organisms have not been cultivated, their description has been based only on some morphological properties and host and nuclear specificities. One16S rRNA gene sequence of 'H. curviuscula' is present in databases. The systematic position of the representative strain of 'H. curviuscula', strain MC-3, was determined in this study. Moreover, for the first time, two strains of 'H. acuminata', KBN10-1 and AC61-10, were investigated. Phylogenetic analysis indicated that all three strains belonged to the genus Holospora, family Holosporaceae, order Rickettsiales within the Alphaproteobacteria.

  7. Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas

    Science.gov (United States)

    Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.

    2010-01-01

    Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734

  8. Phylogenetic evidence for lateral gene transfer in the intestine of marine iguanas.

    Directory of Open Access Journals (Sweden)

    David M Nelson

    Full Text Available BACKGROUND: Lateral gene transfer (LGT appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. METHODOLOGY/PRINCIPAL FINDINGS: We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. CONCLUSION: Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas.

  9. Phylogenetic evidence for lateral gene transfer in the intestine of marine iguanas.

    Science.gov (United States)

    Nelson, David M; Cann, Isaac K O; Altermann, Eric; Mackie, Roderick I

    2010-05-24

    Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas.

  10. Sequence and phylogenetic analysis of virulent Newcastle disease virus isolates from Pakistan during 2009–2013 reveals circulation of new sub genotype

    International Nuclear Information System (INIS)

    Siddique, Naila; Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul

    2013-01-01

    Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic 112 GRQGRL 117 and velogenic 112 RRQKRF 117 along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks

  11. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  12. Inclusion of chloroplast genes that have undergone expansion misleads phylogenetic reconstruction in the Chlorophyta.

    Science.gov (United States)

    Novis, Phil M; Smissen, Rob; Buckley, Thomas R; Gopalakrishnan, Kishore; Visnovsky, Gabriel

    2013-11-01

    Chlorophytes comprise a substantial proportion of green plant diversity. However, sister-group relationships and circumscription of the classes Chlorophyceae, Trebouxiophyceae, and Ulvophyceae have been problematic to resolve. Some analyses support a sister relationship between the trebouxiophycean Leptosira and chlorophyceans, potentially altering the circumscription of two classes, also supported by a shared fragmentation in the chloroplast gene rpoB. We sought to determine whether the latter is a synapomorphy or whether the supporting analyses are vulnerable to systematic bias. We sequenced a portion of rpoB spanning the fragmented region in strains for which it had not previously been sampled: four Chlorophyceae, six counterclockwise (CCW) group (ulvophyceans and trebouxiophyceans) and one streptophyte. We then explored the effect of subsampling proteins and taxa on phylogenetic reconstruction from a data set of 41 chloroplast proteins. None of the CCW or streptophyte strains possessed the split in rpoB, including inferred near relatives of Leptosira, but it was found in all chlorophycean strains. We reconstructed alternative phylogenies (Leptosira + Chlorophyceae and Leptosira + Chlorellales) using two different protein groups (Rpo and Rps), both subject to coding-region expansion. A conserved region of RpoB remained suitable for analysis of more recent divergences. The Rps sequences can explain earlier findings linking Leptosira with the Chlorophyceae and should be excluded from phylogenetic analyses attempting to resolve deep nodes because their expansion violates the assumptions of substitution models. We reaffirm that Leptosira is a trebouxiophycean and that fragmentation of rpoB has occurred at least twice in chlorophyte evolution.

  13. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  14. Distinct features of C/N balance regulation in Prochlorococcus sp. strain MIT9313.

    Science.gov (United States)

    Domínguez-Martín, María Agustina; López-Lozano, Antonio; Rangel-Zúñiga, Oriol Alberto; Díez, Jesús; García-Fernández, José Manuel

    2018-02-01

    The abundance and significant contribution to global primary production of the marine cyanobacterium Prochlorococcus have made it one of the main models in marine ecology. Several conditions known to cause strong effects on the regulation of N-related enzymes in other cyanobacteria lacked such effect in Prochlorococcus. Prochlorococcus sp. strain MIT9313 is one of the most early-branching strains among the members of this genus. In order to further understand the C/N control system in this cyanobacterium, we studied the effect of the absence of three key elements in the ocean, namely N, P and Fe, as well as the effect of inhibitors of the N assimilation or photosynthesis on the N metabolism of this strain. Furthermore, we focused our work in the effect of ageing, as the age of cultures has clear effects on the regulation of some enzymes in Prochlorococcus. To reach this goal, expression of the main three regulators involved in N assimilation in cyanobacteria, namely ntcA, glnB and pipX, as well as that of icd (encoding for isocitrate dehydrogenase) were analysed. Our results show that the control of the main proteins involved in the C/N balance in strain MIT9313 differs from other model Prochlorococcus strains. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Phylogenetic analysis of emergent Streptococcus pneumoniae serotype 22F causing invasive pneumococcal disease using whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Walter H B Demczuk

    Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.

  16. Phylogenetic analysis of feline immunodeficiency virus in feral and companion domestic cats of New Zealand.

    Science.gov (United States)

    Hayward, Jessica J; Taylor, John; Rodrigo, Allen G

    2007-03-01

    Nested PCR was used to amplify envelope V3-V6 gene fragments of feline immunodeficiency virus (FIV) from New Zealand cats. Phylogenetic analyses established that subtypes A and C predominate among New Zealand cats, with clear evidence of intersubtype recombination. In addition, 17 sequences were identified that were distinct from all known FIV clades, and we tentatively suggest these belong to a novel subtype.

  17. Locating a tree in a phylogenetic network

    NARCIS (Netherlands)

    Iersel, van L.J.J.; Semple, C.; Steel, M.A.

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster

  18. Novel Method To Identify Source-Associated Phylogenetic Clustering Shows that Listeria monocytogenes Includes Niche-Adapted Clonal Groups with Distinct Ecological Preferences

    DEFF Research Database (Denmark)

    Nightingale, K. K.; Lyles, K.; Ayodele, M.

    2006-01-01

    population are identified (TreeStats test). Analysis of sequence data for 120 L. monocytogenes isolates revealed evidence of clustering between isolates from the same source, based on the phylogenies inferred from actA and inlA (P = 0.02 and P = 0.07, respectively; SourceCluster test). Overall, the Tree...... are biologically valid. Overall, our data show that (i) the SourceCluster and TreeStats tests can identify biologically meaningful source-associated phylogenetic clusters and (ii) L. monocytogenes includes clonal groups that have adapted to infect specific host species or colonize nonhost environments......., including humans, animals, and food. If the null hypothesis that the genetic distances for isolates within and between source populations are identical can be rejected (SourceCluster test), then particular clades in the phylogenetic tree with significant overrepresentation of sequences from a given source...

  19. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  20. Hospitalized Premature Infants Are Colonized by Related Bacterial Strains with Distinct Proteomic Profiles

    Directory of Open Access Journals (Sweden)

    Christopher T. Brown

    2018-04-01

    Full Text Available During the first weeks of life, microbial colonization of the gut impacts human immune system maturation and other developmental processes. In premature infants, aberrant colonization has been implicated in the onset of necrotizing enterocolitis (NEC, a life-threatening intestinal disease. To study the premature infant gut colonization process, genome-resolved metagenomics was conducted on 343 fecal samples collected during the first 3 months of life from 35 premature infants housed in a neonatal intensive care unit, 14 of whom developed NEC, and metaproteomic measurements were made on 87 samples. Microbial community composition and proteomic profiles remained relatively stable on the time scale of a week, but the proteome was more variable. Although genetically similar organisms colonized many infants, most infants were colonized by distinct strains with metabolic profiles that could be distinguished using metaproteomics. Microbiome composition correlated with infant, antibiotics administration, and NEC diagnosis. Communities were found to cluster into seven primary types, and community type switched within infants, sometimes multiple times. Interestingly, some communities sampled from the same infant at subsequent time points clustered with those of other infants. In some cases, switches preceded onset of NEC; however, no species or community type could account for NEC across the majority of infants. In addition to a correlation of protein abundances with organism replication rates, we found that organism proteomes correlated with overall community composition. Thus, this genome-resolved proteomics study demonstrated that the contributions of individual organisms to microbiome development depend on microbial community context.

  1. Hospitalized Premature Infants Are Colonized by Related Bacterial Strains with Distinct Proteomic Profiles

    Science.gov (United States)

    Xiong, Weili; Olm, Matthew R.; Thomas, Brian C.; Baker, Robyn; Firek, Brian; Morowitz, Michael J.; Hettich, Robert L.

    2018-01-01

    ABSTRACT During the first weeks of life, microbial colonization of the gut impacts human immune system maturation and other developmental processes. In premature infants, aberrant colonization has been implicated in the onset of necrotizing enterocolitis (NEC), a life-threatening intestinal disease. To study the premature infant gut colonization process, genome-resolved metagenomics was conducted on 343 fecal samples collected during the first 3 months of life from 35 premature infants housed in a neonatal intensive care unit, 14 of whom developed NEC, and metaproteomic measurements were made on 87 samples. Microbial community composition and proteomic profiles remained relatively stable on the time scale of a week, but the proteome was more variable. Although genetically similar organisms colonized many infants, most infants were colonized by distinct strains with metabolic profiles that could be distinguished using metaproteomics. Microbiome composition correlated with infant, antibiotics administration, and NEC diagnosis. Communities were found to cluster into seven primary types, and community type switched within infants, sometimes multiple times. Interestingly, some communities sampled from the same infant at subsequent time points clustered with those of other infants. In some cases, switches preceded onset of NEC; however, no species or community type could account for NEC across the majority of infants. In addition to a correlation of protein abundances with organism replication rates, we found that organism proteomes correlated with overall community composition. Thus, this genome-resolved proteomics study demonstrated that the contributions of individual organisms to microbiome development depend on microbial community context. PMID:29636439

  2. Distinct signatures of host–microbial meta-metabolome and gut microbiome in two C57BL/6 strains under high-fat diet

    Science.gov (United States)

    Walker, Alesia; Pfitzner, Barbara; Neschen, Susanne; Kahle, Melanie; Harir, Mourad; Lucio, Marianna; Moritz, Franco; Tziotis, Dimitrios; Witting, Michael; Rothballer, Michael; Engel, Marion; Schmid, Michael; Endesfelder, David; Klingenspor, Martin; Rattei, Thomas; Castell, Wolfgang zu; de Angelis, Martin Hrabé; Hartmann, Anton; Schmitt-Kopplin, Philippe

    2014-01-01

    A combinatory approach using metabolomics and gut microbiome analysis techniques was performed to unravel the nature and specificity of metabolic profiles related to gut ecology in obesity. This study focused on gut and liver metabolomics of two different mouse strains, the C57BL/6J (C57J) and the C57BL/6N (C57N) fed with high-fat diet (HFD) for 3 weeks, causing diet-induced obesity in C57N, but not in C57J mice. Furthermore, a 16S-ribosomal RNA comparative sequence analysis using 454 pyrosequencing detected significant differences between the microbiome of the two strains on phylum level for Firmicutes, Deferribacteres and Proteobacteria that propose an essential role of the microbiome in obesity susceptibility. Gut microbial and liver metabolomics were followed by a combinatory approach using Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS) and ultra performance liquid chromatography time of tlight MS/MS with subsequent multivariate statistical analysis, revealing distinctive host and microbial metabolome patterns between the C57J and the C57N strain. Many taurine-conjugated bile acids (TBAs) were significantly elevated in the cecum and decreased in liver samples from the C57J phenotype likely displaying different energy utilization behavior by the bacterial community and the host. Furthermore, several metabolite groups could specifically be associated with the C57N phenotype involving fatty acids, eicosanoids and urobilinoids. The mass differences based metabolite network approach enabled to extend the range of known metabolites to important bile acids (BAs) and novel taurine conjugates specific for both strains. In summary, our study showed clear alterations of the metabolome in the gastrointestinal tract and liver within a HFD-induced obesity mouse model in relation to the host–microbial nutritional adaptation. PMID:24906017

  3. [Prevalence of occult hepatitis B virus infection and its phylogenetic features among mother-teenager pairs].

    Science.gov (United States)

    Dong, Xiao-lian; Yao, Qing-qing; Wang, Xue-cai; Xu, Hai-tao; Wang, Xiao-li; Chen, Sheng-yu; Tang, Zhi-feng; Zheng, Ying-Jie

    2013-03-01

    Prevalence of occult hepatitis B virus (HBV) infection (OBI) was investigated in a paired mother-teenager population and HBV S gene variation including overt and occult HBV, was determined. A follow-up study based on an initial survey of 135 mother-teenager pairs was carried out through collection of questionnaires and blood samples HBsAg were detected by ELISA method, viral load by PCR amplification and HBV S gene by phylogenetic analysis. 102 pairs of subjects were followed-up. Blood samples from 94 mothers and 101 children were collected. OBI prevalence in mothers was 10.0% (6/60), significantly higher than 2.0% (2/101) in teenagers. Medians of viral load were 399.9 IU/ml and 247.6 IU/ml in overt and occult HBV strains, but without significant difference. 1 occult HBV strain belonged to genotype B with serotype adw while the other 7 were genotype C with serotype adr. 15 of the overt HBV strains belonged to genotype B with serotype adw and the other 8 were genotype C with serotype adr. Proportions of genotype-C strains were significantly higher in occult HBV strains than in overt HBV strains. OBI was seen in teenage-mother population.

  4. Exploring the Genomic Traits of Non-toxigenic Vibrio parahaemolyticus Strains Isolated in Southern Chile

    Directory of Open Access Journals (Sweden)

    Daniel Castillo

    2018-02-01

    Full Text Available Vibrio parahaemolyticus is the leading cause of seafood-borne gastroenteritis worldwide. As reported in other countries, after the rise and fall of the pandemic strain in Chile, other post-pandemic strains have been associated with clinical cases, including strains lacking the major toxins TDH and TRH. Since the presence or absence of tdh and trh genes has been used for diagnostic purposes and as a proxy of the virulence of V. parahaemolyticus isolates, the understanding of virulence in V. parahaemolyticus strains lacking toxins is essential to detect these strains present in water and marine products to avoid possible food-borne infection. In this study, we characterized the genome of four environmental and two clinical non-toxigenic strains (tdh-, trh-, and T3SS2-. Using whole-genome sequencing, phylogenetic, and comparative genome analysis, we identified the core and pan-genome of V. parahaemolyticus of strains of southern Chile. The phylogenetic tree based on the core genome showed low genetic diversity but the analysis of the pan-genome revealed that all strains harbored genomic islands carrying diverse virulence and fitness factors or prophage-like elements that encode toxins like Zot and RTX. Interestingly, the three strains carrying Zot-like toxin have a different sequence, although the alignment showed some conserved areas with the zot sequence found in V. cholerae. In addition, we identified an unexpected diversity in the genetic architecture of the T3SS1 gene cluster and the presence of the T3SS2 gene cluster in a non-pandemic environmental strain. Our study sheds light on the diversity of V. parahaemolyticus strains from the southern Pacific which increases our current knowledge regarding the global diversity of this organism.

  5. Draft genome sequence of Agrobacterium sp. strain R89-1, a morphine alkaloid-biotransforming bacterium

    Czech Academy of Sciences Publication Activity Database

    Zahradník, Jiří; Kyslíková, Eva; Kyslík, Pavel

    2016-01-01

    Roč. 4, č. 2 (2016), e00196-16 ISSN 2169-8287 Institutional support: RVO:61388971 Keywords : Agrobacterium sp. strain R89-1 * codeine/morphine * phylogenetic lineage Subject RIV: EE - Microbiology, Virology

  6. [A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].

    Science.gov (United States)

    Shulakov, A A; Egorov, A V; Onipchenko, V G

    2016-01-01

    Phylogenetic analysis of communities is based on the comparison of distances on the phylogenetic tree between species of a community under study and those distances in random samples taken out of local flora. It makes it possible to determine to what extent a community composition is formed by more closely related species (i.e., "clustered") or, on the opposite, it is more even and includes species that are less related with each other. The first case is usually interpreted as a result of strong influence caused by abiotic factors, due to which species with similar ecology, a priori more closely related, would remain: In the second case, biotic factors, such as competition, may come to the fore and lead to forming a community out of distant clades due to divergence of their ecological niches: The aim of this' study Was Ad explore the phylogenetic structure in communities of the northwestern Caucasus at two spatial scales - the scale of area from 4 to 100 m2 and the smaller scale within a community. The list of local flora of the alpine belt has been composed using the database of geobotanic descriptions carried out in Teberda Biosphere Reserve at true altitudes exceeding.1800 m. It includes 585 species of flowering plants belonging to 57 families. Basal groups of flowering plants are.not represented in the list. At the scale of communities of three classes, namely Thlaspietea rotundifolii - commumties formed on screes and pebbles, Calluno-Ulicetea - alpine meadow, and Mulgedio-Aconitetea subalpine meadows, have not demonstrated significant distinction of phylogenetic structure. At intra level, for alpine meadows the larger share of closely related species. (clustered community) is detected. Significantly clustered happen to be those communities developing on rocks (class Asplenietea trichomanis) and alpine (class Juncetea trifidi). At the same time, alpine lichen proved to have even phylogenetic structure at the small scale. Alpine (class Salicetea herbaceae) that

  7. Locating a tree in a phylogenetic network

    OpenAIRE

    van Iersel, Leo; Semple, Charles; Steel, Mike

    2010-01-01

    Phylogenetic trees and networks are leaf-labelled graphs that are used to describe evolutionary histories of species. The Tree Containment problem asks whether a given phylogenetic tree is embedded in a given phylogenetic network. Given a phylogenetic network and a cluster of species, the Cluster Containment problem asks whether the given cluster is a cluster of some phylogenetic tree embedded in the network. Both problems are known to be NP-complete in general. In this article, we consider t...

  8. Nonbinary tree-based phylogenetic networks

    OpenAIRE

    Jetten, Laura; van Iersel, Leo

    2016-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example represent gene transfer events. Such phylogenetic networks are called tree-based. Here, we consider two possible generalizations of this concept to nonbinary networks, which we call tree-based and st...

  9. Encoding phylogenetic trees in terms of weighted quartets.

    Science.gov (United States)

    Grünewald, Stefan; Huber, Katharina T; Moulton, Vincent; Semple, Charles

    2008-04-01

    One of the main problems in phylogenetics is to develop systematic methods for constructing evolutionary or phylogenetic trees. For a set of species X, an edge-weighted phylogenetic X-tree or phylogenetic tree is a (graph theoretical) tree with leaf set X and no degree 2 vertices, together with a map assigning a non-negative length to each edge of the tree. Within phylogenetics, several methods have been proposed for constructing such trees that work by trying to piece together quartet trees on X, i.e. phylogenetic trees each having four leaves in X. Hence, it is of interest to characterise when a collection of quartet trees corresponds to a (unique) phylogenetic tree. Recently, Dress and Erdös provided such a characterisation for binary phylogenetic trees, that is, phylogenetic trees all of whose internal vertices have degree 3. Here we provide a new characterisation for arbitrary phylogenetic trees.

  10. Fatal necrotizing fasciitis due to necrotic toxin-producing Escherichia coli strain

    Directory of Open Access Journals (Sweden)

    C. Gallois

    2015-11-01

    Full Text Available We report a fatal case of necrotizing soft tissues infection caused by an Escherichia coli strain belonging to phylogenetic group C and harbouring numerous virulence factors reported to be part of a pathogenicity island (PAI such as PAI IIJ96 and conserved virulence plasmidic region.

  11. Phylogenetic analysis of Melon chlorotic leaf curl virus from Guatemala: Another emergent species in the Squash leaf curl virus clade

    KAUST Repository

    Brown, J.K.

    2011-06-01

    The genome of a new bipartite begomovirus Melon chlorotic leaf curl virus from Guatemala (MCLCuV-GT) was cloned and the genome sequence was determined. The virus causes distinct symptoms on melons that were not previously observed in melon crops in Guatemala or elsewhere. Phylogenetic analysis of MCLCuV-GT and begomoviruses infecting cucurbits and other host plant species indicated that its closest relative was MCLCuV from Costa Rica (MCLCuV-CR). The DNA-A components of two isolates shared 88.8% nucleotide identity, making them strains of the same species. Further, both MCLCuV-GT and MCLCuV-CR grouped with other Western Hemisphere cucurbit-infecting species in the SLCV-clade making them the most southerly cucurbit-infecting members of the clade to date. Although the common region of the cognate components of MCLCuV-GT and MCLCuV-CR, shared similar to 96.3% nucleotide identity. While DNA-A and DNA-B components of MCLCuV-GT were less than 86% nucleotide identity with the respective DNAA and DNA-B common regions of MCLCuV-CR. The late viral genes of the two strains shared the least nt identity (<88%) while their early genes shared the highest nt identity (>90%). The collective evidence suggests that these two strains of MCLCuV are evolutionarily divergent owing in part to recombination, but also due to the accumulation of a substantial number of mutations. In addition they are differentially host-adapted, as has been documented for other cucurbit-infecting, bean-adapted, species in the SLCV clade. (C) 2011 Elsevier B.V. All rights reserved.

  12. Stomatal cell wall composition: distinctive structural patterns associated with different phylogenetic groups.

    Science.gov (United States)

    Shtein, Ilana; Shelef, Yaniv; Marom, Ziv; Zelinger, Einat; Schwartz, Amnon; Popper, Zoë A; Bar-On, Benny; Harpaz-Saad, Smadar

    2017-04-01

    Stomatal morphology and function have remained largely conserved throughout ∼400 million years of plant evolution. However, plant cell wall composition has evolved and changed. Here stomatal cell wall composition was investigated in different vascular plant groups in attempt to understand their possible effect on stomatal function. A renewed look at stomatal cell walls was attempted utilizing digitalized polar microscopy, confocal microscopy, histology and a numerical finite-elements simulation. The six species of vascular plants chosen for this study cover a broad structural, ecophysiological and evolutionary spectrum: ferns ( Asplenium nidus and Platycerium bifurcatum ) and angiosperms ( Arabidopsis thaliana and Commelina erecta ) with kidney-shaped stomata, and grasses (angiosperms, family Poaceae) with dumbbell-shaped stomata ( Sorghum bicolor and Triticum aestivum ). Three distinct patterns of cellulose crystallinity in stomatal cell walls were observed: Type I (kidney-shaped stomata, ferns), Type II (kidney-shaped stomata, angiosperms) and Type III (dumbbell-shaped stomata, grasses). The different stomatal cell wall attributes investigated (cellulose crystallinity, pectins, lignin, phenolics) exhibited taxon-specific patterns, with reciprocal substitution of structural elements in the end-walls of kidney-shaped stomata. According to a numerical bio-mechanical model, the end walls of kidney-shaped stomata develop the highest stresses during opening. The data presented demonstrate for the first time the existence of distinct spatial patterns of varying cellulose crystallinity in guard cell walls. It is also highly intriguing that in angiosperms crystalline cellulose appears to have replaced lignin that occurs in the stomatal end-walls of ferns serving a similar wall strengthening function. Such taxon-specific spatial patterns of cell wall components could imply different biomechanical functions, which in turn could be a consequence of differences in

  13. Detection and phylogenetic analysis of infectious pancreatic necrosis virus in Chile.

    Science.gov (United States)

    Tapia, D; Eissler, Y; Torres, P; Jorquera, E; Espinoza, J C; Kuznar, J

    2015-10-27

    Infectious pancreatic necrosis virus (IPNV) is the etiological agent of a highly contagious disease that is endemic to salmon farming in Chile and causes great economic losses to the industry. Here we compared different diagnostic methods to detect IPNV in field samples, including 3 real-time reverse transcription PCR (qRT-PCR) assays, cell culture isolation, and indirect fluorescent antibody test (IFAT). Additionally, we performed a phylogenetic analysis to investigate the genogroups prevailing in Chile, as well as their geographic distribution and virulence. The 3 qRT-PCR assays used primers that targeted regions of the VP2 and VP1 genes of the virus and were tested in 46 samples, presenting a fair agreement within their results. All samples were positive for at least 2 of the qRT-PCR assays, 29 were positive for cell culture, and 23 for IFAT, showing less sensitivity for these latter 2 methods. For the phylogenetic analysis, portions of 1180 and 523 bp of the VP2 region of segment A were amplified by RT-PCR, sequenced and compared with sequences from reference strains and from isolates reported by previous studies carried out in Chile. Most of the sequenced isolates belonged to genogroup 5 (European origin), and 5 were classified within genogroup 1 (American origin). Chilean isolates formed clusters within each of the genogroups found, evidencing a clear differentiation from the reference strains. To our knowledge, this is the most extensive study completed for IPNV in Chile, covering isolates from sea- and freshwater salmon farms and showing a high prevalence of this virus in the country.

  14. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...... phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index...

  15. High-Resolution Typing Reveals Distinct Chlamydia trachomatis Strains in an At-Risk Population in Nanjing, China

    NARCIS (Netherlands)

    Bom, Reinier J. M.; van den Hoek, Anneke; Wang, Qianqiu; Long, Fuquan; de Vries, Henry J. C.; Bruisten, Sylvia M.

    2013-01-01

    We investigated Chlamydia trachomatis strains from Nanjing, China, and whether these strains differed from Amsterdam, the Netherlands. C. trachomatis type was determined with multilocus sequence typing. Most strains were specific to Nanjing, but some clustered with strains from Amsterdam. This

  16. Hymenobacter perfusus sp. nov., Hymenobacter flocculans sp. nov. and Hymenobacter metalli sp. nov. three new species isolated from an uranium mine waste water treatment system.

    Science.gov (United States)

    Chung, Ana Paula; Lopes, André; Nobre, M Fernanda; Morais, Paula V

    2010-12-01

    Three red-pink pigmented strains, designated A1-12(T), A2-50A(T) and A2-91(T), were recovered from two different sites in a uranium mine. For all strains, the optimum growth temperature was 25°C, the optimum pH was 6.0-6.5 and the DNA G+C contents were between 60 and 63.4 mol%. The major respiratory quinone was menaquinone 7 (MK-7) and the fatty acid profiles contained iso- and anteiso-branched C15 fatty acids, summed feature 3 (16:1 ω6c and/or ω7c and/or 15:0 iso 2-OH), summed feature 4 (17:1 anteiso B and/or iso I) and the unsaturated fatty acid 16:1 ω5c as the major components. Phylogenetic analysis of the 16S rRNA gene sequences showed that these organisms represented three distinct branches within the family Flexibacteraceae most closely related to the members of the genus Hymenobacter. Strain A1-12(T) formed a distinct phylogenetic line along with H. rigui KCTC 12533(T) and they shared approximately 98.9% 16S rRNA gene sequence similarity. However, these two strains shared only 14.7% pairwise similarity in their genomic DNA. Strains A2-50A(T) and A2-91(T) formed two distinct lineages, related to the species H. soli KCTC 12607(T), sharing about 95.5% 16S rRNA gene sequence similarity between themselves, and 88.3 and 92.0% with other members of the genus Hymenobacter. Based on the phylogenetic analysis and physiological and biochemical characteristics, these isolates were considered to represent three novel species for which we propose the names Hymenobacter perfusus for strain A1-12(T) (=CIP 110166=LMG 26000), Hymenobacter flocculans for strain A2-50A(T) (=CIP 110139=LMG 25699) and Hymenobacter metalli for strain A2-91(T) (=CIP 110140=LMG 25700). Copyright © 2010 Elsevier GmbH. All rights reserved.

  17. Detecting Network Communities: An Application to Phylogenetic Analysis

    Science.gov (United States)

    Andrade, Roberto F. S.; Rocha-Neto, Ivan C.; Santos, Leonardo B. L.; de Santana, Charles N.; Diniz, Marcelo V. C.; Lobão, Thierry Petit; Goés-Neto, Aristóteles; Pinho, Suani T. R.; El-Hani, Charbel N.

    2011-01-01

    This paper proposes a new method to identify communities in generally weighted complex networks and apply it to phylogenetic analysis. In this case, weights correspond to the similarity indexes among protein sequences, which can be used for network construction so that the network structure can be analyzed to recover phylogenetically useful information from its properties. The analyses discussed here are mainly based on the modular character of protein similarity networks, explored through the Newman-Girvan algorithm, with the help of the neighborhood matrix . The most relevant networks are found when the network topology changes abruptly revealing distinct modules related to the sets of organisms to which the proteins belong. Sound biological information can be retrieved by the computational routines used in the network approach, without using biological assumptions other than those incorporated by BLAST. Usually, all the main bacterial phyla and, in some cases, also some bacterial classes corresponded totally (100%) or to a great extent (>70%) to the modules. We checked for internal consistency in the obtained results, and we scored close to 84% of matches for community pertinence when comparisons between the results were performed. To illustrate how to use the network-based method, we employed data for enzymes involved in the chitin metabolic pathway that are present in more than 100 organisms from an original data set containing 1,695 organisms, downloaded from GenBank on May 19, 2007. A preliminary comparison between the outcomes of the network-based method and the results of methods based on Bayesian, distance, likelihood, and parsimony criteria suggests that the former is as reliable as these commonly used methods. We conclude that the network-based method can be used as a powerful tool for retrieving modularity information from weighted networks, which is useful for phylogenetic analysis. PMID:21573202

  18. Phylogenetic evidence that two distinct Trichuris genotypes infect both humans and non-human primates.

    Directory of Open Access Journals (Sweden)

    Damiana F Ravasi

    Full Text Available Although there has been extensive debate about whether Trichuris suis and Trichuris trichiura are separate species, only one species of the whipworm T. trichiura has been considered to infect humans and non-human primates. In order to investigate potential cross infection of Trichuris sp. between baboons and humans in the Cape Peninsula, South Africa, we sequenced the ITS1-5.8S-ITS2 region of adult Trichuris sp. worms isolated from five baboons from three different troops, namely the Cape Peninsula troop, Groot Olifantsbos troop and Da Gama Park troop. This region was also sequenced from T. trichiura isolated from a human patient from central Africa (Cameroon for comparison. By combining this dataset with Genbank records for Trichuris isolated from other humans, non-human primates and pigs from several different countries in Europe, Asia, and Africa, we confirmed the identification of two distinct Trichuris genotypes that infect primates. Trichuris sp. isolated from the Peninsula baboons fell into two distinct clades that were found to also infect human patients from Cameroon, Uganda and Jamaica (named the CP-GOB clade and China, Thailand, the Czech Republic, and Uganda (named the DG clade, respectively. The divergence of these Trichuris clades is ancient and precedes the diversification of T. suis which clustered closely to the CP-GOB clade. The identification of two distinct Trichuris genotypes infecting both humans and non-human primates is important for the ongoing treatment of Trichuris which is estimated to infect 600 million people worldwide. Currently baboons in the Cape Peninsula, which visit urban areas, provide a constant risk of infection to local communities. A reduction in spatial overlap between humans and baboons is thus an important measure to reduce both cross-transmission and zoonoses of helminthes in Southern Africa.

  19. Tree-Based Unrooted Phylogenetic Networks.

    Science.gov (United States)

    Francis, A; Huber, K T; Moulton, V

    2018-02-01

    Phylogenetic networks are a generalization of phylogenetic trees that are used to represent non-tree-like evolutionary histories that arise in organisms such as plants and bacteria, or uncertainty in evolutionary histories. An unrooted phylogenetic network on a non-empty, finite set X of taxa, or network, is a connected, simple graph in which every vertex has degree 1 or 3 and whose leaf set is X. It is called a phylogenetic tree if the underlying graph is a tree. In this paper we consider properties of tree-based networks, that is, networks that can be constructed by adding edges into a phylogenetic tree. We show that although they have some properties in common with their rooted analogues which have recently drawn much attention in the literature, they have some striking differences in terms of both their structural and computational properties. We expect that our results could eventually have applications to, for example, detecting horizontal gene transfer or hybridization which are important factors in the evolution of many organisms.

  20. Microbial network, phylogenetic diversity and community membership in the active layer across a permafrost thaw gradient.

    Science.gov (United States)

    Mondav, Rhiannon; McCalley, Carmody K; Hodgkins, Suzanne B; Frolking, Steve; Saleska, Scott R; Rich, Virginia I; Chanton, Jeff P; Crill, Patrick M

    2017-08-01

    Biogenic production and release of methane (CH 4 ) from thawing permafrost has the potential to be a strong source of radiative forcing. We investigated changes in the active layer microbial community of three sites representative of distinct permafrost thaw stages at a palsa mire in northern Sweden. The palsa site (intact permafrost and low radiative forcing signature) had a phylogenetically clustered community dominated by Acidobacteria and Proteobacteria. The bog (thawing permafrost and low radiative forcing signature) had lower alpha diversity and midrange phylogenetic clustering, characteristic of ecosystem disturbance affecting habitat filtering. Hydrogenotrophic methanogens and Acidobacteria dominated the bog shifting from palsa-like to fen-like at the waterline. The fen (no underlying permafrost, high radiative forcing signature) had the highest alpha, beta and phylogenetic diversity, was dominated by Proteobacteria and Euryarchaeota and was significantly enriched in methanogens. The Mire microbial network was modular with module cores consisting of clusters of Acidobacteria, Euryarchaeota or Xanthomonodales. Loss of underlying permafrost with associated hydrological shifts correlated to changes in microbial composition, alpha, beta and phylogenetic diversity associated with a higher radiative forcing signature. These results support the complex role of microbial interactions in mediating carbon budget changes and climate feedback in response to climate forcing. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics.

    Science.gov (United States)

    Khatri, Indu; Sharma, Shailza; Ramya, T N C; Subramanian, Srikrishna

    2016-01-01

    Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions.

  2. Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

    Directory of Open Access Journals (Sweden)

    Lorena Rosso

    2014-04-01

    Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

  3. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. Nodal distances for rooted phylogenetic trees.

    Science.gov (United States)

    Cardona, Gabriel; Llabrés, Mercè; Rosselló, Francesc; Valiente, Gabriel

    2010-08-01

    Dissimilarity measures for (possibly weighted) phylogenetic trees based on the comparison of their vectors of path lengths between pairs of taxa, have been present in the systematics literature since the early seventies. For rooted phylogenetic trees, however, these vectors can only separate non-weighted binary trees, and therefore these dissimilarity measures are metrics only on this class of rooted phylogenetic trees. In this paper we overcome this problem, by splitting in a suitable way each path length between two taxa into two lengths. We prove that the resulting splitted path lengths matrices single out arbitrary rooted phylogenetic trees with nested taxa and arcs weighted in the set of positive real numbers. This allows the definition of metrics on this general class of rooted phylogenetic trees by comparing these matrices through metrics in spaces M(n)(R) of real-valued n x n matrices. We conclude this paper by establishing some basic facts about the metrics for non-weighted phylogenetic trees defined in this way using L(p) metrics on M(n)(R), with p [epsilon] R(>0).

  5. Colwellia psychrerythraea strains from distant deep sea basins show adaptation to local conditions

    Directory of Open Access Journals (Sweden)

    Stephen M Techtmann

    2016-05-01

    Full Text Available Many studies have shown that microbes, which share nearly identical 16S rRNA genes, can have highly divergent genomes. Microbes from distinct parts of the ocean also exhibit biogeographic patterning. Here we seek to better understand how certain microbes from the same species have adapted for growth under local conditions. The phenotypic and genomic heterogeneity of three strains of Colwellia psychrerythraea was investigated in order to understand adaptions to local environments. Colwellia are psychrophilic heterotrophic marine bacteria ubiquitous in cold marine ecosystems. We have recently isolated two Colwellia strains: ND2E from the Eastern Mediterranean and GAB14E from the Great Australian Bight. The 16S rRNA sequence of these two strains were greater than 98.2% identical to the well-characterized C. psychrerythraea 34H, which was isolated from arctic sediments. Salt tolerance, and carbon source utilization profiles for these strains were determined using Biolog Phenotype Microarrays’. These strains exhibited distinct salt tolerance, which was not associated with the salinity of sites of isolation. The carbon source utilization profiles were distinct with less than half of the tested carbon sources being metabolized by all three strains. Whole genome sequencing revealed that the genomes of these three strains were quite diverse with some genomes having up to 1600 strain-specific genes. Many genes involved in degrading strain-specific carbon sources were identified. There appears to be a link between carbon source utilization and location of isolation with distinctions observed between the Colwellia isolate recovered from sediment compared to water column isolates.

  6. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  7. Ant-Based Phylogenetic Reconstruction (ABPR: A new distance algorithm for phylogenetic estimation based on ant colony optimization

    Directory of Open Access Journals (Sweden)

    Karla Vittori

    2008-12-01

    Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.

  8. Genetic analysis of imported dengue virus strains by Iranian travelers

    Directory of Open Access Journals (Sweden)

    Nariman Shahhosseini

    2016-11-01

    Full Text Available Dengue virus sequences used in this study were obtained from two Iranian patients who were both with a history of traveling to Malaysia. The maximum likelihood phylogenetic tree demonstrated that two sequences were grouped into dengue virus 1. Specifically, strains IranDF1 and Iran-DF2 clustered in genotype I and III, respectively.

  9. Sequence and phylogenetic analysis of virulent Newcastle disease virus isolates from Pakistan during 2009–2013 reveals circulation of new sub genotype

    Energy Technology Data Exchange (ETDEWEB)

    Siddique, Naila, E-mail: naila.nrlpd@gmail.com [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan); Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan)

    2013-09-15

    Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic {sup 112}GRQGRL{sup 117} and velogenic {sup 112}RRQKRF{sup 117} along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks.

  10. Description of Kuraishia piskuri f.a., sp. nov., a new methanol assimilating yeast and transfer of phylogenetically related Candida species to the genera Kuraishia and Nakazawaea as new combinations

    Science.gov (United States)

    The new anamorphic yeast Kuraishia piskuri, f.a., sp. nov. is described for three strains that were isolated from insect frass from trees growing in Florida, USA (type strain, NRRL YB-2544, CBS 13714). Species placement was based on phylogenetic analysis of nuclear gene sequences for the D1/D2 domai...

  11. Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics

    Science.gov (United States)

    Ramya, T. N. C.; Subramanian, Srikrishna

    2016-01-01

    Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions. PMID:27258038

  12. Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics.

    Directory of Open Access Journals (Sweden)

    Indu Khatri

    Full Text Available Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions.

  13. Distinction between infections with European and American/vaccine type PRRS virus after vaccination with a modified-live PRRS virus vaccine

    DEFF Research Database (Denmark)

    Bøtner, Anette; Strandbygaard, Bertel; Sørensen, K. J.

    2000-01-01

    types of PRRSV was made on a serological basis. The immunoperoxidase monolayer assay (IPMA), carried out using a Danish strain (IPMA/DK) and the vaccine strain (IPMA/vac) in parallel, allows the distinction of infections with EU and US strains of PRRSV. In herds infected with the EU type, the titer...... in individual samples is higher in the IPMA/DK compared to the titer in the IPMA/vac, while in herds infected with the vaccine/US type, the titers are highest in the IPMA/vac. Furthermore, a double blocking ELISA has been developed, which enables large scale screening for and simultaneous distinction between...... ELISA-Vac), which enables us to serologically distinguish between EU and US strains of PRRSV infections. In herds infected with the Danish strain of PRRSV, most animals have a ratio below 1, while in herds infected with the vaccine/US strain most animals have a ratio above 2. The distinction between...

  14. Phylogenetic analysis consistent with a clinical history of sexual transmission of HIV-1 from a single donor reveals transmission of highly distinct variants

    Directory of Open Access Journals (Sweden)

    McClure Myra

    2011-07-01

    Full Text Available Abstract Background To combat the pandemic of human immunodeficiency virus 1 (HIV-1, a successful vaccine will need to cope with the variability of transmissible viruses. Human hosts infected with HIV-1 potentially harbour many viral variants but very little is known about viruses that are likely to be transmitted, or even if there are viral characteristics that predict enhanced transmission in vivo. We show for the first time that genetic divergence consistent with a single transmission event in vivo can represent several years of pre-transmission evolution. Results We describe a highly unusual case consistent with a single donor transmitting highly related but distinct HIV-1 variants to two individuals on the same evening. We confirm that the clustering of viral genetic sequences, present within each recipient, is consistent with the history of a single donor across the viral env, gag and pol genes by maximum likelihood and Bayesian Markov Chain Monte Carlo based phylogenetic analyses. Based on an uncorrelated, lognormal relaxed clock of env gene evolution calibrated with other datasets, the time since the most recent common ancestor is estimated as 2.86 years prior to transmission (95% confidence interval 1.28 to 4.54 years. Conclusion Our results show that an effective design for a preventative vaccine will need to anticipate extensive HIV-1 diversity within an individual donor as well as diversity at the population level.

  15. Phylogenetic analysis of methanogens from the bovine rumen

    Directory of Open Access Journals (Sweden)

    Forster Robert J

    2001-05-01

    Full Text Available Abstract Background Interest in methanogens from ruminants has resulted from the role of methane in global warming and from the fact that cattle typically lose 6 % of ingested energy as methane. Several species of methanogens have been isolated from ruminants. However they are difficult to culture, few have been consistently found in high numbers, and it is likely that major species of rumen methanogens are yet to be identified. Results Total DNA from clarified bovine rumen fluid was amplified using primers specific for Archaeal 16S rRNA gene sequences (rDNA. Phylogenetic analysis of 41 rDNA sequences identified three clusters of methanogens. The largest cluster contained two distinct subclusters with rDNA sequences similar to Methanobrevibacter ruminantium 16S rDNA. A second cluster contained sequences related to 16S rDNA from Methanosphaera stadtmanae, an organism not previously described in the rumen. The third cluster contained rDNA sequences that may form a novel group of rumen methanogens. Conclusions The current set of 16S rRNA hybridization probes targeting methanogenic Archaea does not cover the phylogenetic diversity present in the rumen and possibly other gastro-intestinal tract environments. New probes and quantitative PCR assays are needed to determine the distribution of the newly identified methanogen clusters in rumen microbial communities.

  16. [Analysis of phylogenetic criteria for estimation of the rank of taxa in methane-oxidizing bacteria].

    Science.gov (United States)

    Romanovskaia, V A; Rokitko, P V

    2011-01-01

    To determine a possibility of application of phylogenetic criteria for estimating the taxa rank, the intra- and interspecies, as well as intergeneric relatedness of methanotrophs on the basis of 16S rRNA gene sequences was estimated. We used sequences of 16S rRNA genes of the studied isolates of obligate methanotrophs which have been deposited in UCM (Ukrainian Collection of Microorganisms), and of type strains of other obligate methanotrophs species (from GenBank database). It is shown, that the levels of interspecies and intergeneric relatedness in different families of methanotrophs are not identical, and therefore they can be used for differentiation of taxa only within one family. The carried out analysis has shown, that it is necessary to reconsider taxonomic position: (1) of two phenotypically similar species of Methylomonas (M. aurantiaca and M. fodinarum), similarity of 16S rRNA genes which is 99.4%, similarity of their total DNA--up to 80% that rather testifies to strain differences, than to species differences; (2) of species Methylomicrobium agile and M album which are phylogenetically more related to genus Methylobacter (97% of affinity), than Methylomicrobium (94% of affinity); (3) of genera of the family Beijerinckiaceae (Methylocella and Methylocapsa), and also genera of the family Methylocystaceae (Methylosinus and Methylocystis), whereas high level of relatedness (97% and more) of these bacteria with other methanotrophic genera (within one family) practically corresponds to a range of relatedness of species (within some genera) in the family Methylococcaceae. When determining phylogenetic criteria which can characterize the ranks of taxa, it was revealed, that the levels of interspecies relatedness of methanotrophic genera of the families Methylocystaceae and Beijerinckiaceae (97.8-99.1% and 97.8%, accordingly) considerably exceed the level of genera formation in the family Methylococcaceae (94.0-98.2%) and, moreover, approach the value of

  17. Bacillus subtilis strain specificity affects performance improvement in broilers.

    Science.gov (United States)

    Rhayat, L; Jacquier, V; Brinch, K S; Nielsen, P; Nelson, A; Geraert, P-A; Devillard, E

    2017-07-01

    The study reports the effects on broiler performance of a newly isolated Bacillus subtilis strain, which is phylogenetically not closely related to already well-described strains of B. subtilis. In the first experiment, birds were reared in battery cages and exposed to C. perfringens. An increase in growth performance was observed with the strain when compared to the challenged animals. Three additional growth trials were conducted to 35 d of age, in different rearing conditions (genetic breeds, corn-soybean meal-based diet with or without animal proteins, in presence or absence of phytase, on fresh or used litter) to investigate the efficacy and the specificity of this new B. subtilis strain on the improvement of BWG and FCR of broilers in comparison with a B. subtilis-based DFM already used in the field. Whatever the rearing conditions tested, the new B. subtilis strain led to an average 3.2% improvement in feed conversion ratio or bodyweight. Comparatively, the commercial Bacillus strain significantly improved broiler performance in only one trial out of 3 with an average improvement reaching 2%. All these results indicate that this new B. subtilis strain consistently improves broiler performances. © 2017 Poultry Science Association Inc.

  18. On Tree-Based Phylogenetic Networks.

    Science.gov (United States)

    Zhang, Louxin

    2016-07-01

    A large class of phylogenetic networks can be obtained from trees by the addition of horizontal edges between the tree edges. These networks are called tree-based networks. We present a simple necessary and sufficient condition for tree-based networks and prove that a universal tree-based network exists for any number of taxa that contains as its base every phylogenetic tree on the same set of taxa. This answers two problems posted by Francis and Steel recently. A byproduct is a computer program for generating random binary phylogenetic networks under the uniform distribution model.

  19. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  20. Epidemiological study of phylogenetic transmission clusters in a local HIV-1 epidemic reveals distinct differences between subtype B and non-B infections.

    Science.gov (United States)

    Chalmet, Kristen; Staelens, Delfien; Blot, Stijn; Dinakis, Sylvie; Pelgrom, Jolanda; Plum, Jean; Vogelaers, Dirk; Vandekerckhove, Linos; Verhofstede, Chris

    2010-09-07

    The number of HIV-1 infected individuals in the Western world continues to rise. More in-depth understanding of regional HIV-1 epidemics is necessary for the optimal design and adequate use of future prevention strategies. The use of a combination of phylogenetic analysis of HIV sequences, with data on patients' demographics, infection route, clinical information and laboratory results, will allow a better characterization of individuals responsible for local transmission. Baseline HIV-1 pol sequences, obtained through routine drug-resistance testing, from 506 patients, newly diagnosed between 2001 and 2009, were used to construct phylogenetic trees and identify transmission-clusters. Patients' demographics, laboratory and clinical data, were retrieved anonymously. Statistical analysis was performed to identify subtype-specific and transmission-cluster-specific characteristics. Multivariate analysis showed significant differences between the 59.7% of individuals with subtype B infection and the 40.3% non-B infected individuals, with regard to route of transmission, origin, infection with Chlamydia (p = 0.01) and infection with Hepatitis C virus (p = 0.017). More and larger transmission-clusters were identified among the subtype B infections (p HIV (p = 0.017). Combination of phylogenetics with demographic information, laboratory and clinical data, revealed that HIV-1 subtype B infected Caucasian men-who-have-sex-with-men with high prevalence of sexually transmitted diseases, account for the majority of local HIV-transmissions. This finding elucidates observed epidemiological trends through molecular analysis, and justifies sustained focus in prevention on this high risk group.

  1. Genetic diversity and distribution of a distinct strain of Chili leaf curl virus and associated betasatellite infecting tomato and pepper in Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Al-Zaidi, Amal M; Singh, Achuit K; Briddon, Rob W

    2013-10-01

    Tomato and pepper are widely grown in Oman for local consumption. A countrywide survey was conducted during 2010-2011 to collect samples and assess the diversity of begomoviruses associated with leaf curl disease of tomato and pepper. A virus previously only identified on the Indian subcontinent, chili leaf curl virus (ChLCV), was found associated with tomato and pepper diseases in all vegetable grown areas of Oman. Some of the infected plant samples were also found to contain a betasatellite. A total of 19 potentially full-length begomovirus and eight betasatellite clones were sequenced. The begomovirus clones showed >96% nucleotide sequence identity, showing them to represent a single species. Comparisons to sequences available in the databases showed the highest levels of nucleotide sequence identity (88.0-91.1%) to isolates of the "Pakistan" strain of ChLCV (ChLCV-PK), indicating the virus from Oman to be a distinct strain, for which the name Oman strain (ChLCV-OM) is proposed. An analysis for recombination showed ChLCV-OM likely to have originated by recombination between ChLCV-PK (the major parent), pepper leaf curl Lahore virus and a third strain of ChLCV. The betasatellite sequences obtained were shown to have high levels of identity to isolates of tomato leaf curl betasatellite (ToLCB) previous shown to be present in Oman. For the disease in tomato Koch's postulates were satisfied by Agrobacterium-mediated inoculation of virus and betasatellites clones. This showed the symptoms induced by the virus in the presence of the betasatellite to be enhanced, although viral DNA levels were not affected. ChLCV-OM is the fourth begomovirus identified in tomato in Oman and the first in Capsicum. The significance of these findings is discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Genetic and antigenic relationship of foot-and-mouth disease virus serotype O isolates with the vaccine strain O1/BFS.

    Science.gov (United States)

    Xu, Wanhong; Zhang, Zhidong; Nfon, Charles; Yang, Ming

    2018-05-15

    Foot-and-mouth disease serotype O viruses (FMDV/O) are responsible for the most outbreaks in FMD endemic countries. O1/BFS is one of the recommended FMD/O vaccine strains by World Reference Laboratory for FMD. In the current study, FMDV/O1 BFS vaccine strain and serotype O field isolates (45) were analyzed phylogenetically and antigenically to gain more insight into the genetic and antigenic characteristics of the vaccine strain and field isolates. O1/BFS showed similarity with 89% of the field isolates using a virus neutralization test (VNT). The P1 region encoding the FMDV capsid was sequenced and analysed for 46 strains of FMDV/O. Phylogenetic analysis showed these viruses originated from five continents and covered eight of 11 reported topotypes. Five isolates that demonstrated low antigenic similarities with O1/BFS were analyzed for their antigenic variation at the known neutralizing antigenic sites. Three of the five isolates demonstrated unique amino acid substitutions at various antigenic sites. No unique amino acid substitutions were observed for the other two unmatched isolates. Positively selected residues were identified on the surface of the FMD virus capsid supporting that it is important to continuously monitor field isolates for their antigenic and phenotypic changes. In conclusion, the vaccine strain O1/BFS is likely to confer protection against 89% of the 45 FMDV/O isolates based on VNT. Thus O1/BFS vaccine strain is still suitable for use in global FMD serotype O outbreak control. Combining data from phylogenetic, molecular and antigenic analysis can provide improvements in the process of vaccine selection. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

  3. Phylogenetic and molecular epidemiological studies reveal evidence of multiple past recombination events between infectious laryngotracheitis viruses.

    Directory of Open Access Journals (Sweden)

    Sang-Won Lee

    Full Text Available In contrast to the RNA viruses, the genome of large DNA viruses such as herpesviruses have been considered to be relatively stable. Intra-specific recombination has been proposed as an important, but underestimated, driving force in herpesvirus evolution. Recently, two distinct field strains of infectious laryngotracheitis virus (ILTV have been shown to have arisen from independent recombination events between different commercial ILTV vaccines. In this study we sequenced the genomes of additional ILTV strains and also utilized other recently updated complete genome sequences of ILTV to confirm the existence of a number of ILTV recombinants in nature. Multiple recombination events were detected in the unique long and repeat regions of the genome, but not in the unique short region. Most recombinants contained a pair of crossover points between two distinct lineages of ILTV, corresponding to the European origin and the Australian origin vaccine strains of ILTV. These results suggest that there are two distinct genotypic lineages of ILTV and that these commonly recombine in the field.

  4. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    Science.gov (United States)

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  5. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Xiuqing Zhang

    Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality

  6. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  7. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  8. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  9. Genetic structure of human A/H1N1 and A/H3N2 influenza virus on Corsica Island: phylogenetic analysis and vaccine strain match, 2006-2010.

    Directory of Open Access Journals (Sweden)

    Alessandra Falchi

    Full Text Available BACKGROUND: The aim of this study was to analyse the genetic patterns of Hemagglutinin (HA genes of influenza A strains circulating on Corsica Island during the 2006-2009 epidemic seasons and the 2009-2010 pandemic season. METHODS: Nasopharyngeal samples from 371 patients with influenza-like illness (ILI were collected by General Practitioners (GPs of the Sentinelles Network through a randomised selection routine. RESULTS: Phylogenetic analysis of HA revealed that A/H3N2 strains circulating on Corsica were closely related to the WHO recommended vaccine strains in each analyzed season (2006-2007 to 2008-2009. Seasonal Corsican influenza A/H1N1 isolated during the 2007-2008 season had drifted towards the A/Brisbane/59/2007 lineage, the A/H1N1 vaccine strain for the 2008-2009 season. The A/H1N1 2009 (A/H1N1pdm strains isolated on Corsica Island were characterized by the S220T mutation specific to clade 7 isolates. It should be noted that Corsican isolates formed a separate sub-clade of clade 7 as a consequence of the presence of the fixed substitution D222E. The percentages of the perfect match vaccine efficacy, estimated by using the p(epitope model, against influenza viruses circulating on Corsica Island varied substantially across the four seasons analyzed, and tend to be highest for A/H1N1 compared with A/H3N2 vaccines, suggesting that cross-immunity seems to be stronger for the H1 HA gene. CONCLUSION: The molecular analysis of the HA gene of influenza viruses that circulated on Corsica Island between 2006-2010 showed for each season the presence of a dominant lineage characterized by at least one fixed mutation. The A/H3N2 and A/H1N1pdm isolates were characterized by multiples fixation at antigenic sites. The fixation of specific mutations at each outbreak could be explained by the combination of a neutral phenomenon and a founder effect, favoring the presence of a dominant lineage in a closed environment such as Corsica Island.

  10. Distinctive characters of Nostoc genomes in cyanolichens.

    Science.gov (United States)

    Gagunashvili, Andrey N; Andrésson, Ólafur S

    2018-06-05

    Cyanobacteria of the genus Nostoc are capable of forming symbioses with a wide range of organism, including a diverse assemblage of cyanolichens. Only certain lineages of Nostoc appear to be able to form a close, stable symbiosis, raising the question whether symbiotic competence is determined by specific sets of genes and functionalities. We present the complete genome sequencing, annotation and analysis of two lichen Nostoc strains. Comparison with other Nostoc genomes allowed identification of genes potentially involved in symbioses with a broad range of partners including lichen mycobionts. The presence of additional genes necessary for symbiotic competence is likely reflected in larger genome sizes of symbiotic Nostoc strains. Some of the identified genes are presumably involved in the initial recognition and establishment of the symbiotic association, while others may confer advantage to cyanobionts during cohabitation with a mycobiont in the lichen symbiosis. Our study presents the first genome sequencing and genome-scale analysis of lichen-associated Nostoc strains. These data provide insight into the molecular nature of the cyanolichen symbiosis and pinpoint candidate genes for further studies aimed at deciphering the genetic mechanisms behind the symbiotic competence of Nostoc. Since many phylogenetic studies have shown that Nostoc is a polyphyletic group that includes several lineages, this work also provides an improved molecular basis for demarcation of a Nostoc clade with symbiotic competence.

  11. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  12. Flexible piezotronic strain sensor.

    Science.gov (United States)

    Zhou, Jun; Gu, Yudong; Fei, Peng; Mai, Wenjie; Gao, Yifan; Yang, Rusen; Bao, Gang; Wang, Zhong Lin

    2008-09-01

    Strain sensors based on individual ZnO piezoelectric fine-wires (PFWs; nanowires, microwires) have been fabricated by a simple, reliable, and cost-effective technique. The electromechanical sensor device consists of a single electrically connected PFW that is placed on the outer surface of a flexible polystyrene (PS) substrate and bonded at its two ends. The entire device is fully packaged by a polydimethylsiloxane (PDMS) thin layer. The PFW has Schottky contacts at its two ends but with distinctly different barrier heights. The I- V characteristic is highly sensitive to strain mainly due to the change in Schottky barrier height (SBH), which scales linear with strain. The change in SBH is suggested owing to the strain induced band structure change and piezoelectric effect. The experimental data can be well-described by the thermionic emission-diffusion model. A gauge factor of as high as 1250 has been demonstrated, which is 25% higher than the best gauge factor demonstrated for carbon nanotubes. The strain sensor developed here has applications in strain and stress measurements in cell biology, biomedical sciences, MEMS devices, structure monitoring, and more.

  13. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.

  14. Nonbinary Tree-Based Phylogenetic Networks

    NARCIS (Netherlands)

    Jetten, L.; van Iersel, L.J.J.

    2018-01-01

    Rooted phylogenetic networks are used to describe evolutionary histories that contain non-treelike evolutionary events such as hybridization and horizontal gene transfer. In some cases, such histories can be described by a phylogenetic base-tree with additional linking arcs, which can for example

  15. Whole genome characterisation of a porcine-like human reassortant G26P[19] Rotavirus A strain detected in a child hospitalised for diarrhoea in Nepal, 2007.

    Science.gov (United States)

    Agbemabiese, Chantal Ama; Nakagomi, Toyoko; Gauchan, Punita; Sherchand, Jeevan Bahadur; Pandey, Basu Dev; Cunliffe, Nigel A; Nakagomi, Osamu

    2017-10-01

    A rare G26 Rotavirus A strain RVA/Human-wt/NPL/07N1760/2007/G26P[19] was detected in a child hospitalised for acute diarrhoea in Kathmandu, Nepal. The complete genome of 07N1760 was determined in order to explore its evolutionary history as well as examine its relationship to a Vietnamese strain RVA/Human-wt/VNM/30378/2009/G26P[19], the only G26 strain whose complete genotype constellation is known. The genotype constellation of 07N1760 was G26-P[19]-I12-R1-C1-M1-A8-N1-T1-E1-H1, a unique constellation identical to that of the Vietnamese 30378 except the VP6 gene. Phylogenetic analysis revealed that both strains were unrelated at the lineage level despite their similar genotype constellation. The I12 VP6 gene of 07N1760 was highly divergent from the six currently deposited I12 sequences in the GenBank. Except for its NSP2 gene, the remaining genes of 07N1760 shared lineages with porcine and porcine-like human RVA genes. The NSP2 gene belonged to a human RVA N1 lineage which was distinct from typical porcine and porcine-like human lineages. In conclusion, the Nepali G26P[19] strain 07N1760 was a porcine RVA strain which derived an NSP2 gene from a human Wa-like RVA strain by intra-genotype reassortment probably after transmission to the human host. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Genomic diversity of Bombyx mori nucleopolyhedrovirus strains.

    Science.gov (United States)

    Xu, Yi-Peng; Cheng, Ruo-Lin; Xi, Yu; Zhang, Chuan-Xi

    2013-07-01

    Bombyx mori nucleopolyhedrovirus (BmNPV) is a baculovirus that selectively infects the domestic silkworm. In this study, six BmNPV strains were compared at the whole genome level. We found that the number of bro genes and the composition of the homologous regions (hrs) are the two primary areas of divergence within these genomes. When we compared the ORFs of these BmNPV variants, we noticed a high degree of sequence divergence in the ORFs that are not baculovirus core genes. This result is consistent with the results derived from phylogenetic trees and evolutionary pressure analyses of these ORFs, indicating that ORFs that are not core genes likely play important roles in the evolution of BmNPV strains. The evolutionary relationships of these BmNPV strains might be explained by their geographic origins or those of their hosts. In addition, the total number of hr palindromes seems to affect viral DNA replication in Bm5 cells. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Canine caliciviruses of four serotypes from military and research dogs recovered in 1963-1978 belong to two phylogenetic clades in the Vesivirus genus.

    Science.gov (United States)

    Binn, Leonard N; Norby, Erica A; Marchwicki, Ruth H; Jarman, Richard G; Keiser, Paul B; Hang, Jun

    2018-02-23

    Vesiviruses (family Caliciviridae) had been shown capable of invading a variety of host species, raising concern of their zoonotic potential. Since the 1980's, several canine caliciviruses (CaCV) isolates have been reported and are phylogenetically related to the vesiviruses with features distinct from both Vesicular exanthema of swine virus (VESV) and Feline calicivirus (FCV) species in phylogeny, serology and cell culture specificities. Etiological studies of canine diseases in dogs used for military services and laboratory studies were conducted in 1963-1978 at the Walter Reed Army Institute of Research. Multiple known and unknown viral pathogens including caliciviruses were recovered. Four unidentified isolates were recovered in Walter Reed Canine Cells (WRCC) from respiratory, fecal and penile specimens. Physicochemical tests, electron microscopy, viral cultivation in human and animal cells, antibody neutralization assays, and recently the genome sequencing were used to characterize the isolates. Sera from these dogs and their cohorts were tested with the isolates to determine origin and prevalence of the infections. The viral isolates were small non-enveloped spherical RNA virions, 27 to 42 nm in diameter with cup-like structures, indicating they are caliciviruses. They propagated in WRCC and MDCK cells, not in either other canine cells or human and other animal cells. Each isolate is antigenically distinct and react with dog sera in respective cohorts. The genomes have nucleotide identities ranging from 70.3% to 90.7% and encode the non-structural polyprotein (1810 amino acids), major capsid protein (691 amino acids) and minor structural protein (134 amino acids). They belong to two different phylogenetic clades in Vesivirus genus with close relation with canine calicivirus (CaCV). These CaCV isolates have restricted cell tropism, antigenic diversity and genetic variation. Further investigation will shed light on antigenic relation to other vesiviruses, and

  18. The HIV-1 epidemic in Bolivia is dominated by subtype B and CRF12_BF "family" strains.

    Science.gov (United States)

    Guimarães, Monick L; Velarde-Dunois, Ketty G; Segurondo, David; Morgado, Mariza G

    2012-01-16

    Molecular epidemiological studies of HIV-1 in South America have revealed the occurrence of subtypes B, F1 and BF1 recombinants. Even so, little information concerning the HIV-1 molecular epidemiology in Bolivia is available. In this study we performed phylogenetic analyses from samples collected in Bolivia at two different points in time over a 10 year span. We analyzed these samples to estimate the trends in the HIV subtype and recombinant forms over time. Fifty one HIV-1 positive samples were collected in Bolivia over two distinct periods (1996 and 2005). These samples were genetically characterized based on partial pol protease/reverse transcriptase (pr/rt) and env regions. Alignment and neighbor-joining (NJ) phylogenetic analyses were established from partial env (n = 37) and all pol sequences using Mega 4. The remaining 14 env sequences from 1996 were previously characterized based on HMA-env (Heteroduplex mobility assay). The Simplot v.3.5.1 program was used to verify intragenic recombination, and SplitsTree 4.0 was employed to confirm the phylogenetic relationship of the BF1 recombinant samples. Phylogenetic analysis of both env and pol regions confirmed the predominance of "pure" subtype B (72.5%) samples circulating in Bolivia and revealed a high prevalence of BF1 genotypes (27.5%). Eleven out of 14 BF1 recombinants displayed a mosaic structure identical or similar to that described for the CRF12_BF variant, one sample was classified as CRF17_BF, and two others were F1pol/Benv. No "pure" HIV-1 subtype F1 or B" variant of subtype B was detected in the present study. Of note, samples characterized as CRF12_BF-related were depicted only in 2005. HIV-1 genetic diversity in Bolivia is mostly driven by subtype B followed by BF1 recombinant strains from the CRF12_BF "family". No significant temporal changes were detected between the mid-1990s and the mid-2000s for subtype B (76.2% vs 70.0%) or BF1 recombinant (23.8% vs 30.0%) samples from Bolivia.

  19. Short notes and reviews Simplifying hydrozoan classification: inappropriateness of the group Hydroidomedusae in a phylogenetic context

    OpenAIRE

    Marques, Antonio C.

    2001-01-01

    The systematics of Hydrozoa is considered from the viewpoint of logical consistency between phylogeny and classification. The validity of the nominal taxon Hydroidomedusae (including all groups of Hydrozoa except the Siphonophorae) is discussed with regard to its distinctness and inclusive relationships. In general, phylogenetic systematic evidence suggest that the use of the term Hydroidomedusae is inappropriate given our current level of understanding. It is concluded that no new, or resurr...

  20. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  1. Divergent strains of human T-lymphotropic virus type 1 (HTLV-1) within the Cosmopolitan subtype in Argentina.

    Science.gov (United States)

    Eirin, Maria E; Dilernia, Dario A; Berini, Carolina A; Jones, Leandro R; Pando, Maria A; Biglione, Mirna M

    2008-10-01

    HTLV-1 Cosmopolitan subtype Transcontinental subgroup A has been described among aboriginal communities from the northwest endemic area of Argentina. Moreover, Transcontinental subgroup A and the Japanese subgroup B were reported among blood donors from the nonendemic central region of the country. We carried out the first HTLV-1 phylogenetic study in individuals residing in Buenos Aires capital city. Phylogenetic analysis performed on the LTR region showed that all 44 new strains clustered within the Cosmopolitan subtype, with 42 (95.4%) belonging to Transcontinental subgroup A. Of them, 20 (45.5%) strains grouped in the large Latin American cluster and 4 (9.1%) in the small Latin American cluster. The majority of them belonged to individuals of nonblack origin, grouped with Amerindian strains. Three (6.8%) were closely related to South African references and two monophyletic clusters including only HIV/HTLV-1 coinfected individuals were observed. Interestingly, two (4.5%) new sequences (divergent strains) branched off from all five known Cosmopolitan subgroups in a well-supported clade. In summary, these findings show that HTLV-1 Cosmopolitan subtype Transcontinental subgroup A is infecting residents of Buenos Aires, a nonendemic area of Argentina, and confirm the introduction of divergent strains in the country.

  2. Taxonomy of oxalotrophic Methylobacterium strains

    Science.gov (United States)

    Sahin, Nurettin; Kato, Yuko; Yilmaz, Ferah

    2008-10-01

    Most of the oxalotrophic bacteria are facultative methylotrophs and play important ecological roles in soil fertility and cycling of elements. This study gives a detailed picture of the taxonomy and diversity of these bacteria and provides new information about the taxonomical variability within the genus Methylobacterium. Twelve mesophilic, pink-pigmented, and facultatively methylotrophic oxalate-oxidizing strains were included in this work that had been previously isolated from the soil and some plant tissues by the potassium oxalate enrichment method. The isolates were characterized using biochemical tests, cellular lipid profiles, spectral characteristics of carotenoid pigments, G+C content of the DNA, and 16S rDNA sequencing. The taxonomic similarities among the strains were analyzed using the simple matching ( S SM) and Jaccard ( S J) coefficients, and the UPGMA clustering algorithm. The phylogenetic position of the strains was inferred by the neighbor-joining method on the basis of the 16S rDNA sequences. All isolates were Gram-negative, facultatively methylotrophic, oxidase and catalase positive, and required no growth factors. Based on the results of numerical taxonomy, the strains formed four closely related clusters sharing ≥85% similarity. Analysis of the 16S rDNA sequences demonstrated that oxalotrophic, pink-pigmented, and facultatively methylotrophic strains could be identified as members of the genus Methylobacterium. Except for M. variabile and M. aquaticum, all of the Methylobacterium type strains tested had the ability of oxalate utilization. Our results indicate that the capability of oxalate utilization seems to be an uncommon trait and could be used as a valuable taxonomic criterion for differentiation of Methylobacterium species.

  3. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation