WorldWideScience

Sample records for percussion primers design

  1. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  2. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  3. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  4. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  5. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  6. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  7. Using the centre of percussion to design a steering controller for an autonomous race car

    Science.gov (United States)

    Kritayakirana, Krisada; Gerdes, J. Christian

    2012-01-01

    Understanding how a race car driver controls a vehicle at its friction limits can provide insights into the development of vehicle safety systems. In this paper, a race car driver's behaviour inspires the design of an autonomous racing controller. The resulting controller uses the vehicle's centre of percussion (COP) to design feedforward and feedback steering. At the COP, the effects of rotation and translation from the rear tire force cancel each other out; consequently, the feedforward steering command is robust to the disturbances from the rear tire force. Using the COP also simplifies the equations of motion, as the vehicle's lateral motion is decoupled from the vehicle's yaw motion and highlights the challenge of controlling a vehicle when the rear tires are highly saturated. The resulting dynamics can be controlled with a linear state feedback based on a lane-keeping system with additional yaw damping. Utilising Lyapunov theory, the closed-loop system is shown to remain stable even when the rear tires are highly saturated. The experimental results demonstrate that an autonomous vehicle can operate at its limits while maintaining a minimal lateral error.

  8. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  9. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  10. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  11. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  12. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  13. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  14. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  15. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  16. A Primer on Autonomous Aerial Vehicle Design.

    Science.gov (United States)

    Coppejans, Hugo H G; Myburgh, Herman C

    2015-12-02

    There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV), such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM) solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

  17. A Primer on Autonomous Aerial Vehicle Design

    Directory of Open Access Journals (Sweden)

    Hugo H. G. Coppejans

    2015-12-01

    Full Text Available There is a large amount of research currently being done on autonomous micro-aerial vehicles (MAV, such as quadrotor helicopters or quadcopters. The ability to create a working autonomous MAV depends mainly on integrating a simultaneous localization and mapping (SLAM solution with the rest of the system. This paper provides an introduction for creating an autonomous MAV for enclosed environments, aimed at students and professionals alike. The standard autonomous system and MAV automation are discussed, while we focus on the core concepts of SLAM systems and trajectory planning algorithms. The advantages and disadvantages of using remote processing are evaluated, and recommendations are made regarding the viability of on-board processing. Recommendations are made regarding best practices to serve as a guideline for aspirant MAV designers.

  18. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  19. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  20. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  1. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  2. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  3. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  4. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  5. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  6. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  7. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  8. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  9. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  10. Percussive drilling application of translational motion permanent magnet machine

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Shujun

    2012-07-01

    It is clear that percussive drills are very promising since they can increase the rate of penetration in hard rock formations. Any small improvements on the percussive drills can make a big contribution to lowering the drilling costs since drilling a well for the oil and gas industry is very costly. This thesis presents a percussive drilling system mainly driven by a tubular reciprocating translational motion permanent magnet synchronous motor (RTPMSM), which efficiently converts electric energy to kinetic energy for crushing the hard rock since there is no mechanical media. The thesis starts from state-of-the-art of percussive drilling techniques, reciprocating translational motion motors, and self-sensing control of electric motors and its implementation issues. The following chapters present modeling the hard rock, modeling the drill, the design issues of the drill, the RTPMSM and its control. A single-phase RTPMSM prototype is tested for the hard rock drilling. The presented variable voltage variable frequency control is also validated on it. The space vector control and self-sensing control are also explored on a three-phase RTPMSM prototype. The results show that the percussive drill can be implemented to the hard rock drilling applications. A detailed summarisation of contributions and future work is presented at the end of the thesis.(Author)

  11. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  12. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  13. Implementing Clinical Research Using Factorial Designs: A Primer.

    Science.gov (United States)

    Baker, Timothy B; Smith, Stevens S; Bolt, Daniel M; Loh, Wei-Yin; Mermelstein, Robin; Fiore, Michael C; Piper, Megan E; Collins, Linda M

    2017-07-01

    Factorial experiments have rarely been used in the development or evaluation of clinical interventions. However, factorial designs offer advantages over randomized controlled trial designs, the latter being much more frequently used in such research. Factorial designs are highly efficient (permitting evaluation of multiple intervention components with good statistical power) and present the opportunity to detect interactions amongst intervention components. Such advantages have led methodologists to advocate for the greater use of factorial designs in research on clinical interventions (Collins, Dziak, & Li, 2009). However, researchers considering the use of such designs in clinical research face a series of choices that have consequential implications for the interpretability and value of the experimental results. These choices include: whether to use a factorial design, selection of the number and type of factors to include, how to address the compatibility of the different factors included, whether and how to avoid confounds between the type and number of interventions a participant receives, and how to interpret interactions. The use of factorial designs in clinical intervention research poses choices that differ from those typically considered in randomized clinical trial designs. However, the great information yield of the former encourages clinical researchers' increased and careful execution of such designs. Copyright © 2017. Published by Elsevier Ltd.

  14. HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

    Science.gov (United States)

    Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

    2016-01-01

    Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

  15. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  16. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  17. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  18. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  19. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  20. World Percussion Approaches in Collegiate Percussion Programs: A Mixed-Methods Study

    Science.gov (United States)

    Hernly, Patrick

    2012-01-01

    As world percussion has grown in popularity in American colleges and universities, two main problems have emerged. The first problem is that no known source exists detailing how percussion instructors have incorporated world percussion into their collegiate teaching. A review of the literature has highlighted four main approaches to incorporating…

  1. Lightweight Low Force Rotary Percussive Coring Tool for Planetary Applications, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — Alliance Spacesystems, LLC produced a rotary percussive drill designed for space use under a NASA-funded Mars Instrument Development Program (MIDP) project -- the...

  2. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  3. Human-based percussion and self-similarity detection in electroacoustic music

    Science.gov (United States)

    Mills, John Anderson, III

    Electroacoustic music is music that uses electronic technology for the compositional manipulation of sound, and is a unique genre of music for many reasons. Analyzing electroacoustic music requires special measures, some of which are integrated into the design of a preliminary percussion analysis tool set for electroacoustic music. This tool set is designed to incorporate the human processing of music and sound. Models of the human auditory periphery are used as a front end to the analysis algorithms. The audio properties of percussivity and self-similarity are chosen as the focus because these properties are computable and informative. A collection of human judgments about percussion was undertaken to acquire clearly specified, sound-event dimensions that humans use as a percussive cue. A total of 29 participants was asked to make judgments about the percussivity of 360 pairs of synthesized snare-drum sounds. The grouped results indicate that of the dimensions tested rise time is the strongest cue for percussivity. String resonance also has a strong effect, but because of the complex nature of string resonance, it is not a fundamental dimension of a sound event. Gross spectral filtering also has an effect on the judgment of percussivity but the effect is weaker than for rise time and string resonance. Gross spectral filtering also has less effect when the stronger cue of rise time is modified simultaneously. A percussivity-profile algorithm (PPA) is designed to identify those instants in pieces of music that humans also would identify as percussive. The PPA is implemented using a time-domain, channel-based approach and psychoacoustic models. The input parameters are tuned to maximize performance at matching participants' choices in the percussion-judgment collection. After the PPA is tuned, the PPA then is used to analyze pieces of electroacoustic music. Real electroacoustic music introduces new challenges for the PPA, though those same challenges might affect

  4. Impact Dynamics of a Percussive System Based on Rotary-Percussive Ultrasonic Drill

    Directory of Open Access Journals (Sweden)

    Yinchao Wang

    2017-01-01

    Full Text Available This paper presents an impact dynamic analysis of a percussive system based on rotary-percussive ultrasonic drill (RPUD. The RPUD employs vibrations on two sides of one single piezoelectric stack to achieve rotary-percussive motion, which improves drilling efficiency. The RPUD’s percussive system is composed of a percussive horn, a free mass, and a drill tool. The percussive horn enlarges longitudinal vibration from piezoelectric stack and delivers the vibration to the drill tool through the free mass, which forms the percussive motion. Based on the theory of conservation of momentum and Newton’s impact law, collision process of the percussive system under no-load condition is analyzed to establish the collision model between the percussive horn, the free mass, and the drill tool. The collision model shows that free mass transfers high-frequency small-amplitude vibration of percussive horn into low-frequency large-amplitude vibration of drill tool through impact. As an important parameter of free mass, the greater the weight of the free mass, the higher the kinetic energy obtained by drill tool after collision. High-speed camera system and drilling experiments are employed to validate the inference results of collision model by using a prototype of the RPUD.

  5. Development of the RANCOR Rotary-Percussive Coring System for Mars Sample Return

    Science.gov (United States)

    Paulsen, Gale; Indyk, Stephen; Zacny, Kris

    2014-01-01

    A RANCOR drill was designed to fit a Mars Exploration Rover (MER) class vehicle. The low mass of 3 kg was achieved by using the same actuator for three functions: rotation, percussions, and core break-off. Initial testing of the drill exposed an unexpected behavior of an off-the-shelf sprag clutch used to couple and decouple rotary-percussive function from the core break off function. Failure of the sprag was due to the vibration induced during percussive drilling. The sprag clutch would back drive in conditions where it was expected to hold position. Although this did not affect the performance of the drill, it nevertheless reduced the quality of the cores produced. Ultimately, the sprag clutch was replaced with a custom ratchet system that allowed for some angular displacement without advancing in either direction. Replacing the sprag with the ratchet improved the collected core quality. Also, premature failure of a 300-series stainless steel percussion spring was observed. The 300-series percussion spring was ultimately replaced with a music wire spring based on performances of previously designed rotary-percussive drill systems.

  6. Advanced Percussive Drilling Technology for Geothermal Exploration and Development

    Energy Technology Data Exchange (ETDEWEB)

    Su, Jiann [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Raymond, David [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Prasad, Somuri [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Wolfer, Dale [Atlas-Copco Secoroc LLC, Fagersta (Sweden)

    2017-06-12

    Percussive hammers are a promising advance in drilling technology for geothermal since they rely upon rock reduction mechanisms that are well-suited for use in the hard, brittle rock characteristic of geothermal formations. The project research approach and work plan includes a critical path to development of a high-temperature (HT) percussive hammer using a two phase approach. The work completed in Phase I of the project demonstrated the viability of percussive hammers and that solutions to technical challenges in design, material technology, and performance are likely to be resolved. Work completed in Phase II focused on testing the findings from Phase I and evaluating performance of the materials and designs at high operating temperatures. A high-operating temperature (HOT) drilling facility was designed, built, and used to test the performance of the DTH under extreme conditions. Results from the testing indicate that a high-temperature capable hammer can be developed and is a viable alternative for use in the driller’s toolbox.

  7. High-Frequency Percussive Ventilation Revisited

    Science.gov (United States)

    2010-01-01

    be implemented. ‡ Follow the reverse of the ventilation sequence if respiratory alkalosis develops—however, start at ventilation goal sequence 1 not at...High-frequency percussive ventilation (HFPV) has demonstrated a potential role as a rescue option for refractory acute respiratory distress syndrome...frequency percussive ventilation (HFPV) has demon- strated a potential role as a salvage option for refrac- tory acute respiratory distress syndrome

  8. Body Percussion and Team Building through the BAPNE Method

    Directory of Open Access Journals (Sweden)

    Romero-Naranjo A.A.

    2016-01-01

    Full Text Available BAPNE Method is a method based on cognitive stimulation integrating music and movement through body percussion. The aim of this research is to explore its whole potential as a tool to build teams. Team building is a philosophy for work design, and since over two decades ago, it defends that obtaining a high performance and organizing efficiency is more useful to perceive employees as interdependent members in a team of work than individuals ones. From this viewpoint, this research advocates that BAPNE Method’s body percussion practice will have an impact on this vision of team work directly. For its own characteristics, body percussion stimulates ways of contact in movement, which ease social ties and, especially, promote group cohesion. Through social, body and, affective dimension; BAPNE Method is capable of developing a shared vision and a single aim, to stimulate team work identity and an atmosphere of trust; and finally, to improve individual communication and satisfaction levels in group tasks.

  9. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  10. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  11. Percussion use and training: a survey of music therapy clinicians.

    Science.gov (United States)

    Scheffel, Stephanie; Matney, Bill

    2014-01-01

    Percussion instruments are commonly used in music therapy practice; however, the body of published literature regarding music therapy-related percussion training and practice is limited. The purpose of our survey study was to describe: (a) clinician perspectives of their academic percussion training; (b) use of percussion testing during academic training; (c) clinician perspectives on relevance, adequacy, and importance of academic percussion training; (d) clinician perspectives of their nonacademic percussion training; and (e) current use of percussion in clinical practice. Through comparisons of these parameters, we sought to provide information that may inform future percussion use and training. Participants were selected using an email list from the Certification Board for Music Therapists. Board-certified music therapists (MT-BC) were provided with a researcher-created survey about academic percussion training, nonacademic percussion training, and use of percussion in clinical practice. Survey response rate was 14.4% (611/4234). We used demographic data to address potential nonresponse error and ensure population representation for region of residence and region of academic training. Results revealed concerns about perceived adequacy of percussion training received during music therapy education (14.6% reported receiving no academic percussion training; 40.6% reported training was not adequate), and absence of percussion-specific proficiency exams. Of the training received, 62.8% indicated that training was relevant; however, a majority (76.5%) recommended current music therapy students receive more percussion training on instruments and skills most relevant to clinical practice. Comparisons between academic training, perceived needs in academic training, and clinical usage may inform future training and clinical competency. We provide suggestions for developing future training, as well as for furthering clinical implementation and research. © the American

  12. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  13. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  14. Applying Instructional Design Theories to Bioinformatics Education in Microarray Analysis and Primer Design Workshops

    Science.gov (United States)

    Shachak, Aviv; Ophir, Ron; Rubin, Eitan

    2005-01-01

    The need to support bioinformatics training has been widely recognized by scientists, industry, and government institutions. However, the discussion of instructional methods for teaching bioinformatics is only beginning. Here we report on a systematic attempt to design two bioinformatics workshops for graduate biology students on the basis of…

  15. Bridging the Gap: A Manual Primer into Design Computing in the Context of Basic Design Education

    Science.gov (United States)

    Uysal, V. Safak; Topaloglu, Fulden

    2017-01-01

    Design education is in need of a wider restructuring to accommodate new developments and paradigmatic shifts brought forth by the information age, all of which capitalise a move towards complexity theory, systems science and digital technologies. The intention of this article is to approach one particular aspect of this need: that is, how basic…

  16. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  17. Experimental Highlights upon Tangential Percussions in Mechanical Systems

    Directory of Open Access Journals (Sweden)

    Stelian Alaci

    2014-12-01

    Full Text Available The paper presents a proposed method for underlying the presence of tangential percussions occurring in multibody systems. Tangential percussions define a relatively newly introduced concept required by the necessity of explaining the sudden change in the state of motion for two bodies interacting only on a direction from the common tangent plane. In robotics domain, normal and tangential percussions are widely met in the case of robotic hands in the moment of contacting the manipulated object.

  18. The Auto-Gopher: A Wireline Rotary-Percussive Deep Sampler

    Science.gov (United States)

    Bar-Cohen, Yoseph; Zacny, Kris; Badescu, Mircea; Lee, Hyeong Jae; Sherrit, Stewart; Bao, Xiaoqi; Paulsen, Gale L.; Beegle, Luther

    2016-01-01

    Accessing regions on planetary bodies that potentially preserved biosignatures or are presently habitable is vital to meeting NASA solar system "Search for Life" exploration objectives. To address these objectives, a wireline deep rotary-percussive corer called Auto-Gopher was developed. The percussive action provides effective material fracturing and the rotation provides effective cuttings removal. To increase the drill's penetration rate, the percussive and rotary motions are operated simultaneously. Initially, the corer was designed as a percussive mechanism for sampling ice and was demonstrated in 2005 in Antarctica reaching about 2 m deep. The lessons learned suggested the need to use a combination of rotation and hammering to maximize the penetration rate. This lesson was implemented into the Auto-Gopher-I deep drill which was demonstrated to reach 3-meter deep in gypsum. The average drilling power that was used has been in the range of 100-150 Watt, while the penetration rate was approximately 2.4 m/hr. Recently, a task has started with the goal to develop Auto-Gopher-II that is equipped to execute all the necessary functions in a single drilling unit. These functions also include core breaking, retention and ejection in addition drilling. In this manuscript, the Auto-Gopher-II, its predecessors and their capability are described and discussed.

  19. Korean Percussion Ensemble ("Samulnori") in the General Music Classroom

    Science.gov (United States)

    Kang, Sangmi; Yoo, Hyesoo

    2016-01-01

    This article introduces "samulnori" (Korean percussion ensemble), its cultural background, and instructional methods as parts of a classroom approach to teaching upper-level general music. We introduce five of eight sections from "youngnam nong-ak" (a style of samulnori) as a repertoire for teaching Korean percussion music to…

  20. Rotary Percussive Auto-Gopher for Deep Drilling and Sampling

    Science.gov (United States)

    Bar-Cohen, Yoseph; Badescu, Mircea; Sherrit, Stewart

    2009-01-01

    The term "rotary percussive auto-gopher" denotes a proposed addition to a family of apparatuses, based on ultrasonic/ sonic drill corers (USDCs), that have been described in numerous previous NASA Tech Briefs articles. These apparatuses have been designed, variously, for boring into, and/or acquiring samples of, rock or other hard, brittle materials of geological interest. In the case of the rotary percussive autogopher, the emphasis would be on developing an apparatus capable of penetrating to, and acquiring samples at, depths that could otherwise be reached only by use of much longer, heavier, conventional drilling-and-sampling apparatuses. To recapitulate from the prior articles about USDCs: A USDC can be characterized as a lightweight, low-power jackhammer in which a piezoelectrically driven actuator generates ultrasonic vibrations and is coupled to a tool bit through a free mass. The bouncing of the free mass between the actuator horn and the drill bit converts the actuator ultrasonic vibrations into sonic hammering of the drill bit. The combination of ultrasonic and sonic vibrations gives rise to a hammering action (and a resulting chiseling action at the tip of the tool bit) that is more effective for drilling than is the microhammering action of ultrasonic vibrations alone. The hammering and chiseling actions are so effective that the size of the axial force needed to make the tool bit advance into soil, rock, or another material of interest is much smaller than in ordinary rotary drilling, ordinary hammering, or ordinary steady pushing. The predecessor of the rotary percussive auto-gopher is an apparatus, now denoted an ultrasonic/sonic gopher and previously denoted an ultrasonic gopher, described in "Ultrasonic/ Sonic Mechanism for Drilling and Coring" (NPO-30291), NASA Tech Briefs Vol. 27, No. 9 (September 2003), page 65. The ultrasonic/sonic gopher is intended for use mainly in acquiring cores. The name of the apparatus reflects the fact that, like a

  1. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

    Science.gov (United States)

    Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François

    2010-02-01

    QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.

  2. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

    Science.gov (United States)

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

    2018-01-01

    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  3. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  4. PROGRAMMABLE METRONOME FOR PERCUSSION INSTRUMENTS AND AN APPLICATION

    Directory of Open Access Journals (Sweden)

    Hasan Selçuk Selek

    2012-01-01

    Full Text Available Applications of electronics in the music industry have been increasing continuosly. Develpoments in electro music and electro music instruments make this possible. Although it is known that the majority of musicians are against the digital music and techniques, researches show that it would be very benefical for teaching and learning of playing music intruments. This study shows that, music and electronic applications can be useable with together in the same projects. With this equipment people can practice on their own percussion studies. System designed as, speed and hit force in case of faulty users can be warned by program. Warning can be reailized as a visual with LED and also can be done with sound. In this study, at the same time shows that, without using physical metronome, metronome software and designed card can use at applications is may be possible. Based on the study is a software metronome and its card which can be used for all musical intruments. Designed metronome was tested for a electronic drum with a compare circuit. PIC-C compiler was used in order to get the designed card to work compatible with PIC. The circuit designed for the metronome is integrated with compare circuit and has been tested together.

  5. Academic Primer Series: Five Key Papers about Study Designs in Medical Education.

    Science.gov (United States)

    Gottlieb, Michael; Chan, Teresa M; Fredette, Jenna; Messman, Anne; Robinson, Daniel W; Cooney, Robert; Boysen-Osborn, Megan; Sherbino, Jonathan

    2017-06-01

    A proper understanding of study design is essential to creating successful studies. This is also important when reading or peer reviewing publications. In this article, we aimed to identify and summarize key papers that would be helpful for faculty members interested in learning more about study design in medical education research. The online discussions of the 2016-2017 Academic Life in Emergency Medicine Faculty Incubator program included a robust and vigorous discussion about education study design, which highlighted a number of papers on that topic. We augmented this list of papers with further suggestions by expert mentors. Via this process, we created a list of 29 papers in total on the topic of medical education study design. After gathering these papers, our authorship group engaged in a modified Delphi approach to build consensus on the papers that were most valuable for the understanding of proper study design in medical education. We selected the top five most highly rated papers on the topic domain of study design as determined by our study group. We subsequently summarized these papers with respect to their relevance to junior faculty members and to faculty developers. This article summarizes five key papers addressing study design in medical education with discussions and applications for junior faculty members and faculty developers. These papers provide a basis upon which junior faculty members might build for developing and analyzing studies.

  6. Auto-Gopher: A Wireline Deep Sampler Driven by Piezoelectric Percussive Actuator and EM Rotary Motor

    Science.gov (United States)

    Badescu, Mircea; Ressa, Aaron; Jae Lee, Hyeong; Bar-Cohen, Yoseph; Sherrit, Stewart; Zacny, Kris; Paulsen, Gale L.; Beegle, Luther; Bao, Xiaoqi

    2013-01-01

    The ability to penetrate subsurfaces and perform sample acquisition at depth of meters may be critical for future NASA in-situ exploration missions to bodies in the solar system, including Mars and Europa. A corer/sampler was developed with the goal of enabling acquisition of samples from depths of several meters where if used on Mars would be beyond the oxidized and sterilized zone. For this purpose, we developed a rotary-hammering coring drill, called Auto-Gopher, which employs a piezoelectric actuated percussive mechanism for breaking formations and an electric motor that rotates the bit to remove the powdered cuttings. This sampler is a wireline mechanism that can be fed into and retrieved from the drilled hole using a winch and a cable. It includes an inchworm anchoring mechanism allowing the drill advancement and weight on bit control without twisting the reeling and power cables. The penetration rate is being optimized by simultaneously activating the percussive and rotary motions of the Auto-Gopher. The percussive mechanism is based on the Ultrasonic/Sonic Drill/Corer (USDC) mechanism that is driven by piezoelectric stack and that was demonstrated to require low axial preload. The design and fabrication of this device were presented in previous publications. This paper presents the results of laboratory and field tests and lessons learned from this development.

  7. Timing Variations in Two Balkan Percussion Performances

    Directory of Open Access Journals (Sweden)

    Daniel Goldberg

    2016-01-01

    Full Text Available Many songs and dance pieces from the Balkan Peninsula employ aksak meter, in which two categorically different durations, long and short, coexist in the sequence of beats that performers emphasize and listeners move to. This paper analyzes the durations of aksak beats and measures in two recorded percussion performances that use a particular aksak beat sequence, long-short-short. The results suggest that the timing of beats varies in conjunction with factors including melodic grouping and interaction among members of a performing ensemble and audience. Timing variation linked to melodic groups occurs on a solo recording of a Macedonian Romani folk song. The performer, Muzafer Bizlim, taps an ostinato while singing, and the timing of his taps seems to mark some local and large-scale group boundaries. Melodic organization also seems relevant to the timing of beats and measures on a recording of Bulgarian percussionist Mitko Popov playing the tŭpan, a double-headed bass drum, in a small folk music ensemble. In Popov’s performance, however, timing differences might be related to characteristics of the ensemble dynamic, such as the coordination of multiple musical participants. These interpretations generate possibilities for future study of timing variations in relation to rhythm and meter.

  8. Protein folding and non-conventional drug design: a primer for nuclear structure physicists

    International Nuclear Information System (INIS)

    Broglia, R.A.; Tiana, G.; Provasi, D.

    2004-01-01

    Some of the paradigms emerging from the study of the phenomena of phase transitions in finite many-body systems, like e.g. the atomic nucleus can be used at profit to solve the protein folding problem within the framework of simple (although not oversimplified) models. From this solution a paradigm emerges for the design of non-conventional drugs, which inhibit enzymatic action without inducing resistance (mutations). The application of these concepts to the design of an inhibitor to the HIV-protease central in the life cycle of the HIV virus is discussed

  9. Understanding the internet, website design and intranet development: a primer for radiologists

    Energy Technology Data Exchange (ETDEWEB)

    Perriss, R.W. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom); Graham, R.N.J. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom); Scarsbrook, A.F. [Department of Radiology, John Radcliffe Hospital, Headington, Oxford (United Kingdom)]. E-mail: andyscarsbrook1@aol.com

    2006-05-15

    The internet has become an essential part of daily life for almost all radiologists and yet few fully understand how this works or how best to harness the technology within the workplace. This article will explore the basics of computer networking which has allowed the internet to become a valuable resource. In addition, the process of designing and implementing a website or intranet site for the benefit of radiology departmental administration and education will be discussed. The options of how to develop a website, what to include, and how to achieve this using easy to use, freely available and low-cost software will also be explored.

  10. Understanding the internet, website design and intranet development: a primer for radiologists

    International Nuclear Information System (INIS)

    Perriss, R.W.; Graham, R.N.J.; Scarsbrook, A.F.

    2006-01-01

    The internet has become an essential part of daily life for almost all radiologists and yet few fully understand how this works or how best to harness the technology within the workplace. This article will explore the basics of computer networking which has allowed the internet to become a valuable resource. In addition, the process of designing and implementing a website or intranet site for the benefit of radiology departmental administration and education will be discussed. The options of how to develop a website, what to include, and how to achieve this using easy to use, freely available and low-cost software will also be explored

  11. Deep Drilling and Sampling via the Wireline Auto-Gopher Driven by Piezoelectric Percussive Actuator and EM Rotary Motor

    Science.gov (United States)

    Bar-Cohen, Yoseph; Badescu, Mircea; Sherrit, Stewart; Zacny, Kris; Paulsen, Gale L; Beegle, Luther; Bao, Xiaoqi

    2012-01-01

    The ability to penetrate subsurfaces and perform sample acquisition at depths of meters is critical for future NASA in-situ exploration missions to bodies in the solar system, including Mars and Europa. A corer/sampler was developed with the goal of acquiring pristine samples by reaching depths on Mars beyond the oxidized and sterilized zone. To developed rotary-hammering coring drill, called Auto-Gopher, employs a piezoelectric actuated percussive mechanism for breaking formations and an electric motor rotates the bit to remove the powdered cuttings. This sampler is a wireline mechanism that is incorporated with an inchworm mechanism allowing thru cyclic coring and core removal to reach great depths. The penetration rate is being optimized by simultaneously activating the percussive and rotary motions of the Auto-Gopher. The percussive mechanism is based on the Ultrasonic/Sonic Drill/Corer (USDC) mechanism that is driven by piezoelectric stack and that was demonstrated to require low axial preload. The Auto-Gopher has been produced taking into account the a lessons learned from the development of the Ultrasonic/Sonic Gopher that was designed as a percussive ice drill and was demonstrated in Antarctica in 2005 to reach about 2 meters deep. A field demonstration of the Auto-Gopher is currently being planned with objective of reaching as deep as 3 to 5 meters in tufa subsurface.

  12. Quantifying traces of tool use: a novel morphometric analysis of damage patterns on percussive tools.

    Directory of Open Access Journals (Sweden)

    Matthew V Caruana

    Full Text Available Percussive technology continues to play an increasingly important role in understanding the evolution of tool use. Comparing the archaeological record with extractive foraging behaviors in nonhuman primates has focused on percussive implements as a key to investigating the origins of lithic technology. Despite this, archaeological approaches towards percussive tools have been obscured by a lack of standardized methodologies. Central to this issue have been the use of qualitative, non-diagnostic techniques to identify percussive tools from archaeological contexts. Here we describe a new morphometric method for distinguishing anthropogenically-generated damage patterns on percussive tools from naturally damaged river cobbles. We employ a geomatic approach through the use of three-dimensional scanning and geographical information systems software to statistically quantify the identification process in percussive technology research. This will strengthen current technological analyses of percussive tools in archaeological frameworks and open new avenues for translating behavioral inferences of early hominins from percussive damage patterns.

  13. Quantifying Traces of Tool Use: A Novel Morphometric Analysis of Damage Patterns on Percussive Tools

    Science.gov (United States)

    Caruana, Matthew V.; Carvalho, Susana; Braun, David R.; Presnyakova, Darya; Haslam, Michael; Archer, Will; Bobe, Rene; Harris, John W. K.

    2014-01-01

    Percussive technology continues to play an increasingly important role in understanding the evolution of tool use. Comparing the archaeological record with extractive foraging behaviors in nonhuman primates has focused on percussive implements as a key to investigating the origins of lithic technology. Despite this, archaeological approaches towards percussive tools have been obscured by a lack of standardized methodologies. Central to this issue have been the use of qualitative, non-diagnostic techniques to identify percussive tools from archaeological contexts. Here we describe a new morphometric method for distinguishing anthropogenically-generated damage patterns on percussive tools from naturally damaged river cobbles. We employ a geomatic approach through the use of three-dimensional scanning and geographical information systems software to statistically quantify the identification process in percussive technology research. This will strengthen current technological analyses of percussive tools in archaeological frameworks and open new avenues for translating behavioral inferences of early hominins from percussive damage patterns. PMID:25415303

  14. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    Science.gov (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  15. Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

    Science.gov (United States)

    Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

    2018-05-12

    Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Results from Testing of Two Rotary Percussive Drilling Systems

    Science.gov (United States)

    Kriechbaum, Kristopher; Brown, Kyle; Cady, Ian; von der Heydt, Max; Klein, Kerry; Kulczycki, Eric; Okon, Avi

    2010-01-01

    The developmental test program for the MSL (Mars Science Laboratory) rotary percussive drill examined the e ect of various drill input parameters on the drill pene- tration rate. Some of the input parameters tested were drill angle with respect to gravity and percussive impact energy. The suite of rocks tested ranged from a high strength basalt to soft Kaolinite clay. We developed a hole start routine to reduce high sideloads from bit walk. The ongoing development test program for the IMSAH (Integrated Mars Sample Acquisition and Handling) rotary percussive corer uses many of the same rocks as the MSL suite. An additional performance parameter is core integrity. The MSL development test drill and the IMSAH test drill use similar hardware to provide rotation and percussion. However, the MSL test drill uses external stabilizers, while the IMSAH test drill does not have external stabilization. In addition the IMSAH drill is a core drill, while the MSL drill uses a solid powdering bit. Results from the testing of these two related drilling systems is examined.

  17. Emotional and psychophysiological responses to tempo, mode, and percussiveness

    NARCIS (Netherlands)

    van der Zwaag, Marjolein; Westerink, Joyce H.D.M.; van den Broek, Egon

    People often listen to music to influence their emotional state. However, the specific musical characteristics which cause this process are not yet fully understood. We have investigated the influence of the musical characteristics of tempo, mode and percussiveness on our emotions. In a quest

  18. Innovative Comparison of Transient Ignition Temperature at the Booster Interface, New Stainless Steel Pyrovalve Primer Chamber Assembly "V" (PCA) Design Versus the Current Aluminum "Y" PCA Design

    Science.gov (United States)

    Saulsberry, Regor L.; McDougle, Stephen H.; Garcia,Roberto; Johnson, Kenneth L.; Sipes, William; Rickman, Steven; Hosangadi, Ashvin

    2011-01-01

    An assessment of four spacecraft pyrovalve anomalies that occurred during ground testing was conducted by the NASA Engineering & Safety Center (NESC) in 2008. In all four cases, a common aluminum (Al) primer chamber assembly (PCA) was used with dual NASA Standard Initiators (NSIs) and the nearly simultaneous (separated by less than 80 microseconds) firing of both initiators failed to ignite the booster charge. The results of the assessment and associated test program were reported in AIAA Paper AIAA-2008-4798, NESC Independent Assessment of Pyrovalve Ground Test Anomalies. As a result of the four Al PCA anomalies, and the test results and findings of the NESC assessment, the Mars Science Laboratory (MSL) project team decided to make changes to the PCA. The material for the PCA body was changed from aluminum (Al) to stainless steel (SS) to avoid melting, distortion, and potential leakage of the NSI flow passages when the device functioned. The flow passages, which were interconnected in a Y-shaped configuration (Y-PCA) in the original design, were changed to a V-shaped configuration (V-PCA). The V-shape was used to more efficiently transfer energy from the NSIs to the booster. Development and qualification testing of the new design clearly demonstrated faster booster ignition times compared to the legacy AL Y-PCA design. However, the final NESC assessment report recommended that the SS V-PCA be experimentally characterized and quantitatively compared to the Al Y-PCA design. This data was deemed important for properly evaluating the design options for future NASA projects. This test program has successfully quantified the improvement of the SS V-PCA over the Al Y-PCA. A phase B of the project was also conducted and evaluated the effect of firing command skew and enlargement of flame channels to further assist spacecraft applications.

  19. DE-FOA-EE0005502 Advanced Percussive Drilling Technology for Geothermal Exploration and Development Phase II Report.

    Energy Technology Data Exchange (ETDEWEB)

    Su, Jiann-Cherng [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Raymond, David W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Prasad, Somuri V. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Wolfer, Dale R. [Atlas-Copco Secoroc, LLC, Fagersta (Sweden)

    2017-05-01

    Percussive hammers are a promising advance in drilling technology for geothermal since they rely upon rock reduction mechanisms that are well-suited for use in the hard, brittle rock characteristic of geothermal formations. The project research approach and work plan includes a critical path to development of a high-temperature (HT) percussive hammer using a two- phase approach. The work completed in Phase I of the project demonstrated the viability of percussive hammers and that solutions to technical challenges in design, material technology, and performance are likely to be resolved. Work completed in Phase II focused on testing the findings from Phase I and evaluating performance of the materials and designs at high- operating temperatures. A high-operating temperature (HOT) drilling facility was designed, built, and used to test the performance of the DTH under extreme conditions. Results from the testing indicate that a high-temperature capable hammer can be developed and is a viable alternative for user in the driller's toolbox.

  20. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  1. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  2. Quantifying Traces of Tool Use: A Novel Morphometric Analysis of Damage Patterns on Percussive Tools

    OpenAIRE

    Caruana, Matthew V.; Carvalho, Susana; Braun, David R.; Presnyakova, Darya; Haslam, Michael; Archer, Will; Bobe, Rene; Harris, John W. K.

    2014-01-01

    Percussive technology continues to play an increasingly important role in understanding the evolution of tool use. Comparing the archaeological record with extractive foraging behaviors in nonhuman primates has focused on percussive implements as a key to investigating the origins of lithic technology. Despite this, archaeological approaches towards percussive tools have been obscured by a lack of standardized methodologies. Central to this issue have been the use of qualitative, non-diagnost...

  3. EZCA primer

    International Nuclear Information System (INIS)

    Karonis, N.T.

    1995-01-01

    This document provides a quick introduction to EZCA, a library that was designed to provide an easy to use interface to Channel Access (CA). As such, this document is not a user's manual, where a more detailed explanation of EZCA can be found. In short, this document is designed to get users to a state where they can be writing EZCA code as quickly as possible. It is not a document that answers all EZCA questions

  4. VGRAF primer

    Energy Technology Data Exchange (ETDEWEB)

    Padilla, G.C.; Thompson, S.L.

    1980-10-01

    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  5. Limestone percussion tools from the late Early Pleistocene sites of Barranco León and Fuente Nueva 3 (Orce, Spain).

    Science.gov (United States)

    Barsky, Deborah; Vergès, Josep-María; Sala, Robert; Menéndez, Leticia; Toro-Moyano, Isidro

    2015-11-19

    In recent years, there is growing interest in the study of percussion scars and breakage patterns on hammerstones, cores and tools from Oldowan African and Eurasian lithic assemblages. Oldowan stone toolkits generally contain abundant small-sized flakes and their corresponding cores, and are characterized by their structural dichotomy of heavy- and light-duty tools. This paper explores the significance of the lesser known heavy-duty tool component, providing data from the late Lower Pleistocene sites of Barranco León and Fuente Nueva 3 (Orce, Spain), dated 1.4-1.2 Myr. Using quantitative and qualitative data from the large-sized limestone industries from these two major sites, we present a new methodology highlighting their morpho-technological features. In the light of the results, we discuss the shortfalls of extant classificatory methods for interpreting the role of percussive technology in early toolkits. This work is rooted in an experimental program designed to reproduce the wide range of percussion marks observed on the limestone artefacts from these two sites. A visual and descriptive reference is provided as an interpretative aid for future comparative research. Further experiments using a variety of materials and gestures are still needed before the elusive traces yield the secrets of the kinds of percussive activities carried out by hominins at these, and other, Oldowan sites. © 2015 The Author(s).

  6. PENETRATION OF CONICAL INDENTER INTO FOUNDATION MATERIAL AT COMBINED PERCUSSION AND SUBSEQUENT ULTRASONIC IMPACTS

    Directory of Open Access Journals (Sweden)

    M. G. Kiselev

    2012-01-01

    Full Text Available The aim of this paper is theoretical and experimental studys of a percussion and subsequent ultrasonic impacts on the indenter depth penetration into material of rigid-plastic foundation.The obtained results allow us to estimate an influence of percussion (low-frequency and ultrasound (high-frequency component parameters on a charging process.

  7. 49 CFR 178.318 - Specification MC 201; container for detonators and percussion caps.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Specification MC 201; container for detonators and percussion caps. 178.318 Section 178.318 Transportation Other Regulations Relating to Transportation PIPELINE....318 Specification MC 201; container for detonators and percussion caps. ...

  8. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  9. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  10. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  11. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  12. Design of primers for pertussis diagnosis by Real Time PCR and determination of its sensitivity and specificity in comparison with commercial kits.

    Directory of Open Access Journals (Sweden)

    Hamidreza Monavari

    2013-12-01

    Results: Performance of our home made primers for detecting pertussis using Real Time PCR in comparison with those by commercial kit was acceptable based on diagnostic classical guidance (WHO and the (CDC. Conclusions: Real time PCR test with new primers in comparison with culture techniques is more suitable, high sensitivity and can provide more informative values for pertussis detection.

  13. Percussive Augmenter of Rotary Drills for Operating as a Rotary-Hammer Drill

    Science.gov (United States)

    Aldrich, Jack Barron (Inventor); Bar-Cohen, Yoseph (Inventor); Sherrit, Stewart (Inventor); Badescu, Mircea (Inventor); Bao, Xiaoqi (Inventor); Scott, James Samson (Inventor)

    2014-01-01

    A percussive augmenter bit includes a connection shaft for mounting the bit onto a rotary drill. In a first modality, an actuator percussively drives the bit, and an electric slip-ring provides power to the actuator while being rotated by the drill. Hammering action from the actuator and rotation from the drill are applied directly to material being drilled. In a second modality, a percussive augmenter includes an actuator that operates as a hammering mechanism that drives a free mass into the bit creating stress pulses that fracture material that is in contact with the bit.

  14. A Study of Specific Fracture Energy at Percussion Drilling

    Science.gov (United States)

    A, Shadrina; T, Kabanova; V, Krets; L, Saruev

    2014-08-01

    The paper presents experimental studies of rock failure provided by percussion drilling. Quantification and qualitative analysis were carried out to estimate critical values of rock failure depending on the hammer pre-impact velocity, types of drill bits and cylindrical hammer parameters (weight, length, diameter), and turn angle of a drill bit. Obtained data in this work were compared with obtained results by other researchers. The particle-size distribution in granite-cutting sludge was analyzed in this paper. Statistical approach (Spearmen's rank-order correlation, multiple regression analysis with dummy variables, Kruskal-Wallis nonparametric test) was used to analyze the drilling process. Experimental data will be useful for specialists engaged in simulation and illustration of rock failure.

  15. A Study of Specific Fracture Energy at Percussion Drilling

    International Nuclear Information System (INIS)

    Shadrina A; Krets V; Saruev L; Kabanova T

    2014-01-01

    The paper presents experimental studies of rock failure provided by percussion drilling. Quantification and qualitative analysis were carried out to estimate critical values of rock failure depending on the hammer pre-impact velocity, types of drill bits and cylindrical hammer parameters (weight, length, diameter), and turn angle of a drill bit. Obtained data in this work were compared with obtained results by other researchers. The particle-size distribution in granite-cutting sludge was analyzed in this paper. Statistical approach (Spearmen's rank-order correlation, multiple regression analysis with dummy variables, Kruskal-Wallis nonparametric test) was used to analyze the drilling process. Experimental data will be useful for specialists engaged in simulation and illustration of rock failure

  16. Fundamental Research on Percussion Drilling: Improved rock mechanics analysis, advanced simulation technology, and full-scale laboratory investigations

    Energy Technology Data Exchange (ETDEWEB)

    Michael S. Bruno

    2005-12-31

    drilling tests, as well as single impact tests, have been designed and executed. Both Berea sandstone and Mancos shale samples are used. In single impact tests, three impacts are sequentially loaded at the same rock location to investigate rock response to repetitive loadings. The crater depth and width are measured as well as the displacement and force in the rod and the force in the rock. Various pressure differences across the rock-indentor interface (i.e. bore pressure minus pore pressure) are used to investigate the pressure effect on rock penetration. For hammer drilling tests, an industrial fluid hammer is used to drill under both underbalanced and overbalanced conditions. Besides calibrating the modeling tool, the data and cuttings collected from the tests indicate several other important applications. For example, different rock penetrations during single impact tests may reveal why a fluid hammer behaves differently with diverse rock types and under various pressure conditions at the hole bottom. On the other hand, the shape of the cuttings from fluid hammer tests, comparing to those from traditional rotary drilling methods, may help to identify the dominant failure mechanism that percussion drilling relies on. If so, encouraging such a failure mechanism may improve hammer performance. The project is summarized in this report. Instead of compiling the information contained in the previous quarterly or other technical reports, this report focuses on the descriptions of tasks, findings, and conclusions, as well as the efforts on promoting percussion drilling technologies to industries including site visits, presentations, and publications. As a part of the final deliveries, the 3D numerical model for rock mechanics is also attached.

  17. A versatile method to design stem-loop primer-based quantitative PCR assays for detecting small regulatory RNA molecules.

    Directory of Open Access Journals (Sweden)

    Zsolt Czimmerer

    Full Text Available Short regulatory RNA-s have been identified as key regulators of gene expression in eukaryotes. They have been involved in the regulation of both physiological and pathological processes such as embryonal development, immunoregulation and cancer. One of their relevant characteristics is their high stability, which makes them excellent candidates for use as biomarkers. Their number is constantly increasing as next generation sequencing methods reveal more and more details of their synthesis. These novel findings aim for new detection methods for the individual short regulatory RNA-s in order to be able to confirm the primary data and characterize newly identified subtypes in different biological conditions. We have developed a flexible method to design RT-qPCR assays that are very sensitive and robust. The newly designed assays were tested extensively in samples from plant, mouse and even human formalin fixed paraffin embedded tissues. Moreover, we have shown that these assays are able to quantify endogenously generated shRNA molecules. The assay design method is freely available for anyone who wishes to use a robust and flexible system for the quantitative analysis of matured regulatory RNA-s.

  18. Methods for Evaluating the Performance and Human Stress-Factors of Percussive Riveting

    Science.gov (United States)

    Ahn, Jonathan Y.

    The aerospace industry automates portions of their manufacturing and assembly processes. However, mechanics still remain vital to production, especially in areas where automated machines cannot fit, or have yet to match the quality of human craftsmanship. One such task is percussive riveting. Because percussive riveting is associated with a high risk of injury, these tool must be certified prior to release. The major contribution of this thesis is to develop a test bench capable of percussive riveting for ergonomic evaluation purposes. The major issues investigated are: (i) automate the tool evaluation method to be repeatable; (ii) demonstrate use of displacement and force sensors; and (iii) correlate performance and risk exposure of percussive tools. A test bench equipped with servomotors and pneumatic cylinders to control xyz-position of a rivet gun and bucking bar simultaneously, is used to explore this evaluation approach.

  19. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    Science.gov (United States)

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  20. Analysis and meta-analysis of single-case designs with a standardized mean difference statistic: a primer and applications.

    Science.gov (United States)

    Shadish, William R; Hedges, Larry V; Pustejovsky, James E

    2014-04-01

    This article presents a d-statistic for single-case designs that is in the same metric as the d-statistic used in between-subjects designs such as randomized experiments and offers some reasons why such a statistic would be useful in SCD research. The d has a formal statistical development, is accompanied by appropriate power analyses, and can be estimated using user-friendly SPSS macros. We discuss both advantages and disadvantages of d compared to other approaches such as previous d-statistics, overlap statistics, and multilevel modeling. It requires at least three cases for computation and assumes normally distributed outcomes and stationarity, assumptions that are discussed in some detail. We also show how to test these assumptions. The core of the article then demonstrates in depth how to compute d for one study, including estimation of the autocorrelation and the ratio of between case variance to total variance (between case plus within case variance), how to compute power using a macro, and how to use the d to conduct a meta-analysis of studies using single-case designs in the free program R, including syntax in an appendix. This syntax includes how to read data, compute fixed and random effect average effect sizes, prepare a forest plot and a cumulative meta-analysis, estimate various influence statistics to identify studies contributing to heterogeneity and effect size, and do various kinds of publication bias analyses. This d may prove useful for both the analysis and meta-analysis of data from SCDs. Copyright © 2013 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  2. Bayesian methodology for the design and interpretation of clinical trials in critical care medicine: a primer for clinicians.

    Science.gov (United States)

    Kalil, Andre C; Sun, Junfeng

    2014-10-01

    To review Bayesian methodology and its utility to clinical decision making and research in the critical care field. Clinical, epidemiological, and biostatistical studies on Bayesian methods in PubMed and Embase from their inception to December 2013. Bayesian methods have been extensively used by a wide range of scientific fields, including astronomy, engineering, chemistry, genetics, physics, geology, paleontology, climatology, cryptography, linguistics, ecology, and computational sciences. The application of medical knowledge in clinical research is analogous to the application of medical knowledge in clinical practice. Bedside physicians have to make most diagnostic and treatment decisions on critically ill patients every day without clear-cut evidence-based medicine (more subjective than objective evidence). Similarly, clinical researchers have to make most decisions about trial design with limited available data. Bayesian methodology allows both subjective and objective aspects of knowledge to be formally measured and transparently incorporated into the design, execution, and interpretation of clinical trials. In addition, various degrees of knowledge and several hypotheses can be tested at the same time in a single clinical trial without the risk of multiplicity. Notably, the Bayesian technology is naturally suited for the interpretation of clinical trial findings for the individualized care of critically ill patients and for the optimization of public health policies. We propose that the application of the versatile Bayesian methodology in conjunction with the conventional statistical methods is not only ripe for actual use in critical care clinical research but it is also a necessary step to maximize the performance of clinical trials and its translation to the practice of critical care medicine.

  3. High occurrence of Bathyarchaeota (MCG) in the deep-sea sediments of South China Sea quantified using newly designed PCR primers.

    Science.gov (United States)

    Yu, Tiantian; Liang, Qianyong; Niu, Mingyang; Wang, Fengping

    2017-08-01

    The archaeal phylum Bathyarchaeota, which is composed of a large number of diverse lineages, is widespread and abundant in marine sediments. Environmental factors that control the distribution, abundance and evolution of this largely diversified archaeal phylum are currently unclear. In this study, a new pair of specific primers that target the major marine subgroups of bathyarchaeotal 16S rRNA genes was designed and evaluated to investigate the distribution and abundance of Bathyarchaeota in marine sediments. The abundance of Bathyarchaeota along two sediment cores from the deep-sea sediments of South China Sea (SCS, each from the Dongsha and Shenhu area) was determined. A strong correlation was found between the bathyarchaeotal abundance and the content of total organic carbon (TOC), suggesting an important role of Bathyarchaeota in organic matter remineralisation in the sediments of SCS. Furthermore, diversity analysis revealed that subgroups Bathy-2, Bathy-8 and Bathy-10 were dominant bathyarchaeotal members of the deep-sea sediments in the SCS. Bathy-8 was found predominantly within the reducing and deeper sediment layers, while Bathy-10 occurred preferentially in the oxidizing and shallower sediment layers. Our study lays a foundation for the further understanding of the ecological functions and niche differentiation of the important but not well-understood sedimentary archaeal group. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  5. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  6. Percussive technology in human evolution: an introduction to a comparative approach in fossil and living primates.

    Science.gov (United States)

    de la Torre, Ignacio; Hirata, Satoshi

    2015-11-19

    Percussive technology is part of the behavioural suite of several fossil and living primates. Stone Age ancestors used lithic artefacts in pounding activities, which could have been most important in the earliest stages of stone working. This has relevant evolutionary implications, as other primates such as chimpanzees and some monkeys use stone hammer-and-anvil combinations to crack hard-shelled foodstuffs. Parallels between primate percussive technologies and early archaeological sites need to be further explored in order to assess the emergence of technological behaviour in our evolutionary line, and firmly establish bridges between Primatology and Archaeology. What are the anatomical, cognitive and ecological constraints of percussive technology? How common are percussive activities in the Stone Age and among living primates? What is their functional significance? How similar are archaeological percussive tools and those made by non-human primates? This issue of Phil. Trans. addresses some of these questions by presenting case studies with a wide chronological, geographical and disciplinary coverage. The studies presented here cover studies of Brazilian capuchins, captive chimpanzees and chimpanzees in the wild, research on the use of percussive technology among modern humans and recent hunter-gatherers in Australia, the Near East and Europe, and archaeological examples of this behaviour from a million years ago to the Holocene. In summary, the breadth and depth of research compiled here should make this issue of Philosophical Transactions of the Royal Society B, a landmark step forward towards a better understanding of percussive technology, a unique behaviour shared by some modern and fossil primates. © 2015 The Author(s).

  7. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  8. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  9. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  10. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  11. Developmental test report, assessment of XT-70E percussion drill rig operation in tank farms

    International Nuclear Information System (INIS)

    Dougherty, L.F.

    1996-01-01

    The following report documents the testing of the XT-70E percussion drill rig for use in the 241-SX Tank Farm. The test is necessary to support evaluation of the safety and authorization level of the proposed activity of installing up to three new drywells in the 241- SX Tank Farm. The proposed activity plans to install drywells by percussion drilling 7 inch O.D./6 inch I.D. pipe in close proximity of underground storage tanks and associated equipment. The load transmitted from the drill rig's percussion hammer through the ground to the tank structure and equipment is not known and therefore testing is required to ensure the activity is safe and authorized

  12. Automatic Quality Inspection of Percussion Cap Mass Production by Means of 3D Machine Vision and Machine Learning Techniques

    Science.gov (United States)

    Tellaeche, A.; Arana, R.; Ibarguren, A.; Martínez-Otzeta, J. M.

    The exhaustive quality control is becoming very important in the world's globalized market. One of these examples where quality control becomes critical is the percussion cap mass production. These elements must achieve a minimum tolerance deviation in their fabrication. This paper outlines a machine vision development using a 3D camera for the inspection of the whole production of percussion caps. This system presents multiple problems, such as metallic reflections in the percussion caps, high speed movement of the system and mechanical errors and irregularities in percussion cap placement. Due to these problems, it is impossible to solve the problem by traditional image processing methods, and hence, machine learning algorithms have been tested to provide a feasible classification of the possible errors present in the percussion caps.

  13. Designing primers and evaluation of the efficiency of propidium monoazide - Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius.

    Science.gov (United States)

    Lai, Chieh-Hsien; Wu, Sih-Rong; Pang, Jen-Chieh; Ramireddy, Latha; Chiang, Yu-Cheng; Lin, Chien-Ku; Tsen, Hau-Yang

    2017-07-01

    The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA) real-time quantitative polymerase chain reaction (qPCR) to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4-5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable. Copyright © 2016. Published by Elsevier B.V.

  14. Designing primers and evaluation of the efficiency of propidium monoazide – Quantitative polymerase chain reaction for counting the viable cells of Lactobacillus gasseri and Lactobacillus salivarius

    Directory of Open Access Journals (Sweden)

    Chieh-Hsien Lai

    2017-07-01

    Full Text Available The purpose of this study is to evaluate the efficiency of using propidium monoazide (PMA real-time quantitative polymerase chain reaction (qPCR to count the viable cells of Lactobacillus gasseri and Lactobacillus salivarius in probiotic products. Based on the internal transcription spacer and 23S rRNA genes, two primer sets specific for these two Lactobacillus species were designed. For a probiotic product, the total deMan Rogosa Sharpe plate count was 8.65±0.69 log CFU/g, while for qPCR, the cell counts of L. gasseri and L. salivarius were 8.39±0.14 log CFU/g and 8.57±0.24 log CFU/g, respectively. Under the same conditions, for its heat-killed product, qPCR counts for L. gasseri and L. salivarius were 6.70±0.16 log cells/g and 7.67±0.20 log cells/g, while PMA-qPCR counts were 5.33±0.18 log cells/g and 5.05±0.23 log cells/g, respectively. For cell dilutions with a viable cell count of 8.5 log CFU/mL for L. gasseri and L. salivarius, after heat killing, the PMA-qPCR count for both Lactobacillus species was near 5.5 log cells/mL. When the PMA-qPCR counts of these cell dilutions were compared before and after heat killing, although some DNA might be lost during the heat killing, significant qPCR signals from dead cells, i.e., about 4–5 log cells/mL, could not be reduced by PMA treatment. Increasing PMA concentrations from 100 μM to 200 μM or light exposure time from 5 minutes to 15 minutes had no or, if any, only minor effect on the reduction of qPCR signals from their dead cells. Thus, to differentiate viable lactic acid bacterial cells from dead cells using the PMA-qPCR method, the efficiency of PMA to reduce the qPCR signals from dead cells should be notable.

  15. The Use of High-Frequency Percussive Ventilation for Whole-Lung Lavage: A Case Report.

    Science.gov (United States)

    Kinthala, Sudhakar; Liang, Mark; Khusid, Felix; Harrison, Sebron

    2018-04-23

    Whole-lung lavage (WLL) remains the gold standard in the treatment of pulmonary alveolar proteinosis. However, anesthetic management during WLL can be challenging because of the risk of intraoperative hypoxemia and various cardiorespiratory complications of 1-lung ventilation. Here, we describe a novel strategy involving the application of high-frequency percussive ventilation using a volumetric diffusive respirator (VDR-4) during WLL in a 47-year-old woman with pulmonary alveolar proteinosis. Our observations suggest that high-frequency percussive ventilation is a potentially effective ventilation strategy during WLL that may reduce the risk of hypoxemia and facilitate lavage.

  16. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  17. Safety and effectiveness of the high-frequency chest wall oscillation vs intrapulmonary percussive ventilation in patients with severe COPD

    Directory of Open Access Journals (Sweden)

    Nicolini A

    2018-02-01

    Full Text Available Antonello Nicolini,1 Bruna Grecchi,2 Maura Ferrari-Bravo,3 Cornelius Barlascini4 1Respiratory Diseases Unit, Hospital of Sestri Levante, Sestri Levante, Italy; 2Rehabilitation Unit, ASL4 Chiavarese, Chiavari, Italy; 3Statistics Unit, ASL4 Chiavarese, Chiavari, Italy; 4Health Medicine Unit, Hospital of Sestri Levante, Sestri Levante, Italy Purpose: Chest physiotherapy is an important tool in the treatment of COPD. Intrapulmonary percussive ventilation (IPV and high-frequency chest wall oscillation (HFCWO are techniques designed to create a global percussion of the lung which removes secretions and probably clears the peripheral bronchial tree. We tested the hypothesis that adding IPV or HFCWO to the best pharmacological therapy (PT may provide additional clinical benefit over chest physiotherapy in patients with severe COPD. Methods: Sixty patients were randomized into three groups (20 patients in each group: IPV group (treated with PT and IPV, PT group with (treated with PT and HFCWO, and control group (treated with PT alone. Primary outcome measures included results on the dyspnea scale (modified Medical Research Council and Breathlessness, Cough, and Sputum scale (BCSS, as well as an evaluation of daily life activity (COPD Assessment Test [CAT]. Secondary outcome measures were pulmonary function testing, arterial blood gas analysis, and hematological examinations. Moreover, sputum cell counts were performed at the beginning and at the end of the study. Results: Patients in both the IPV group and the HFCWO group showed a significant improvement in the tests of dyspnea and daily life activity evaluations (modified Medical Research Council scale, BCSS, and CAT compared to the control group, as well as in pulmonary function tests (forced vital capacity, forced expiratory volume in 1 second, forced expiratory volume in 1 second/forced vital capacity%, total lung capacity, residual volume, diffusing lung capacity monoxide, maximal inspiratory

  18. Design and Evaluation of Illumina MiSeq-Compatible, 18S rRNA Gene-Specific Primers for Improved Characterization of Mixed Phototrophic Communities.

    Science.gov (United States)

    Bradley, Ian M; Pinto, Ameet J; Guest, Jeremy S

    2016-10-01

    The use of high-throughput sequencing technologies with the 16S rRNA gene for characterization of bacterial and archaeal communities has become routine. However, the adoption of sequencing methods for eukaryotes has been slow, despite their significance to natural and engineered systems. There are large variations among the target genes used for amplicon sequencing, and for the 18S rRNA gene, there is no consensus on which hypervariable region provides the most suitable representation of diversity. Additionally, it is unclear how much PCR/sequencing bias affects the depiction of community structure using current primers. The present study amplified the V4 and V8-V9 regions from seven microalgal mock communities as well as eukaryotic communities from freshwater, coastal, and wastewater samples to examine the effect of PCR/sequencing bias on community structure and membership. We found that degeneracies on the 3' end of the current V4-specific primers impact read length and mean relative abundance. Furthermore, the PCR/sequencing error is markedly higher for GC-rich members than for communities with balanced GC content. Importantly, the V4 region failed to reliably capture 2 of the 12 mock community members, and the V8-V9 hypervariable region more accurately represents mean relative abundance and alpha and beta diversity. Overall, the V4 and V8-V9 regions show similar community representations over freshwater, coastal, and wastewater environments, but specific samples show markedly different communities. These results indicate that multiple primer sets may be advantageous for gaining a more complete understanding of community structure and highlight the importance of including mock communities composed of species of interest. The quantification of error associated with community representation by amplicon sequencing is a critical challenge that is often ignored. When target genes are amplified using currently available primers, differential amplification efficiencies

  19. Development of Young Adults' Fine Motor Skills when Learning to Play Percussion Instruments

    Science.gov (United States)

    Gzibovskis, Talis; Marnauza, Mara

    2012-01-01

    When playing percussion instruments, the main activity is done with the help of a motion or motor skills; to perform it, developed fine motor skills are necessary: the speed and precision of fingers, hands and palms. The aim of the research was to study and test the development of young adults' fine motor skills while learning to play percussion…

  20. Analysis of percussion response of dental implants: An in vitro study

    International Nuclear Information System (INIS)

    Dinh, Andrew; Sheets, Cherilyn G.; Earthman, James C.

    2013-01-01

    The Periometer® quantitative percussion system was used to interrogate the interfacial stability of implants in vitro for comparison with X-ray computer tomography (CT) data. Selected implants were placed as per standard practice in bone stimulant polyurethane blocks. The dimensions of the surgical sites surrounding the implants were analyzed using X-ray computer tomography (CT) to determine the quality of support at the implant–bone interface. In particular, the misfit between the size of the surgical site and the corresponding implant was determined for each sample. The resulting average surgical site error from the CT scans was found to exhibit good agreement with the presence of irregularities found in the percussion data. - Highlights: ► Percussion response versus time exhibited irregularities for some in vitro samples. ► X-Ray CT was used to assess the interface integrity for six implant–bone specimens. ► Irregularities in percussion data correlate well with the CT based assessments

  1. The Schultz MIDI Benchmarking Toolbox for MIDI interfaces, percussion pads, and sound cards

    NARCIS (Netherlands)

    Schultz, Benjamin G

    2018-01-01

    The Musical Instrument Digital Interface (MIDI) was readily adopted for auditory sensorimotor synchronization experiments. These experiments typically use MIDI percussion pads to collect responses, a MIDI-USB converter (or MIDI-PCI interface) to record responses on a PC and manipulate feedback, and

  2. Prophylactic Use of High-Frequency Percussive Ventilation in Patients with Inhalation Injury,

    Science.gov (United States)

    1991-06-01

    Pneumonia ( CPAP ). The duration of the percussive phase and of the return to baseline phase are adjusted to manipulate ox- The diagnosis of pneumonia was...high-frequency ventilation than conventional support. using this form of ventilation in neonates , in which that incidence ap- Dr. Herndon asked about

  3. Electrical and percussive stunning of the common carp (Cyprinus carpio L.): Neurological and behavioural assessment

    NARCIS (Netherlands)

    Lambooij, E.; Pilarczyk, M.; Bialowas, H.; Boogaart, van den J.G.M.; Vis, van de J.W.

    2007-01-01

    The overall objective of the study was to evaluate electrical and percussive stunning methods under laboratory conditions in common carps. The electrical current needed to induce a general epileptiform insult was assessed in 13 carps. The insult was obtained by delivering a current of 0.24 ± 0.03 A

  4. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  5. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  6. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  7. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  8. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  9. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  10. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  11. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  12. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  13. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

    Science.gov (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  14. First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

    Science.gov (United States)

    Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade

  15. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  16. percussions de la libéralisation du commerce des services sur le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    percussions de la libéralisation du commerce des services sur le développement. La documentation économique a démontré l'importance du secteur des services dans le processus de croissance économique et de développement social. Le principal défi auquel sont confrontés aujourd'hui les pays en développement ...

  17. Prise en compte des répercussions socioéconomiques de la culture ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Prise en compte des répercussions socioéconomiques de la culture du coton génétiquement modifié sur les petits agriculteurs du Mercosur. L'Argentine, le Brésil et le Paraguay, membres du Marché commun du cône sud (Mercosur), sont les cinquièmes producteurs de coton au monde, devancés uniquement par la Chine, ...

  18. Better Drumming Through Calibration: Techniques for Pre-Performance Robotic Percussion Optimization

    OpenAIRE

    Murphy, Jim; Kapur, Ajay; Carnegie, Dale

    2012-01-01

    A problem with many contemporary musical robotic percussion systems lies in the fact that solenoids fail to respond lin-early to linear increases in input velocity. This nonlinearity forces performers to individually tailor their compositions to specific robotic drummers. To address this problem, we introduce a method of pre-performance calibration using metaheuristic search techniques. A variety of such techniques are introduced and evaluated and the results of the optimized solenoid-based p...

  19. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  20. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  2. Percussion hemoglobinuria - a novel term for hand trauma-induced mechanical hemolysis: a case report

    Directory of Open Access Journals (Sweden)

    Hariharan Sundaram

    2011-10-01

    Full Text Available Abstract Introduction Extracorpuscular hemolysis caused by mechanical trauma has been well described in relation to lower extremity use, such as in soldiers and runners. Terms such as "march hemoglobinuria", "foot strike hemolysis" and "runners hemoglobinuria" have previously been coined and are easily recalled. Newer cases, however, are being identified in individuals vigorously using their upper extremities, such as drum players who use their hands to strike the instrument. Given the increased recognition of upper extremity-related mechanical hemolysis and hemoglobinuria in drummers, and the use of hand drumming worldwide, we would like introduce a novel term for this condition and call it "percussion hemoglobinuria". Case presentation A 24-year-old Caucasian man presented with reddish brown discoloration of his urine after playing the djembe drum. Urine examination after a rigorous practice session revealed blood on the dipstick, and 0 to 2 red blood cells per high power field microscopically. The urine sample was negative for myoglobulin. Other causes of hemolysis and hematuria were excluded and cessation of drum playing resulted in resolution of his symptoms. Conclusions The association of mechanical trauma-induced hemoglobinuria and playing hand percussion instruments is increasingly being recognized. We, however, feel that the true prevalence is higher than what has been previously recorded in the literature. By coining the term "percussion hemoglobinuria" we hope to raise the awareness of screening for upper extremity trauma-induced mechanical hemolysis in the evaluation of a patient with hemoglobinuria.

  3. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  4. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  5. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  6. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  7. The evolution and cultural transmission of percussive technology: integrating evidence from palaeoanthropology and primatology.

    Science.gov (United States)

    Whiten, Andrew; Schick, Kathy; Toth, Nicholas

    2009-10-01

    We bring together the quite different kinds of evidence available from palaeoanthropology and primatology to better understand the origins of Plio-Pleistocene percussive technology. Accumulated palaeoanthropological discoveries now document the Oldowan Complex as the dominant stone tool making culture between 2.6-1.4 Ma, the earlier part of this contemporaneous with pre-Homo hominins. The principal types of artefacts and other remains from 20 Early Stone Age (Oldowan and earliest Acheulean) localities in Africa and elsewhere are reviewed and described. To better understand the ancestral behavioural foundations of this early lithic culture, we examine a range of recent findings from primatology. In particular, we attempt to identify key shared characteristics of Homo and Pan that support inferences about the preparedness of our common ancestor for the innovation of stone tool culture. Findings of particular relevance include: (i) the discovery of an expanding repertoire of percussive and other tool use based on directed use of force among wild chimpanzees, implicating capacities that include significant innovatory potential and appreciation of relevant causal factors; (ii) evidence of material cultural diversity among wild chimpanzees, indicating a readiness to acquire and transmit tool use innovations; and (iii) experimental studies of social learning in chimpanzees and bonobos that now encompass the acquisition of nut cracking through observation of skilled use of hammers and anvils by conspecifics, the diffusion within and between groups of alternative styles of tool use, and the adoption of free-hand stone-to-stone percussion to create useful flakes for cutting to gain access to food resources. We use the distributions of the inferred cultural traits in the wild to assess how diffusion relates to geographic distances, and find that shared traits drop by 50% from the approximately eight characteristic of close neighbours over a distance of approximately 700 km

  8. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  9. percussions des TIC sur la démocratie locale : transparence et ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    percussions des TIC sur la démocratie locale : transparence et participation des citoyens dans la municipalité de Peñalolén (au Chili). La municipalité de Peñalolén, établie en périphérie de Santiago, au Chili, se caractérise par sa grande diversité socioéconomique et par ses solides réseaux sociaux (clubs réservés aux ...

  10. Catalogue of Wind and Percussion Solos and Ensembles and Recordings. American School Band Directors' Association, Research Committee Reports for the 26th Annual Convention, Oklahoma City, Oklahoma, 1978.

    Science.gov (United States)

    Berndt, William; Berndt, Arnold

    This catalogue lists over 350 phonograph records which feature solo and ensemble music by wind and percussion instruments. Instruments heard on the records include oboe/English horn, flute, clarinet, bassoon, trumpet/cornet, French horn, trombone, baritone, tuba, saxophone, percussion, woodwind ensembles, and brass ensembles. The catalogue is…

  11. Voice Coil Percussive Mechanism Concept for Hammer Drill

    Science.gov (United States)

    Okon, Avi

    2009-01-01

    A hammer drill design of a voice coil linear actuator, spring, linear bearings, and a hammer head was proposed. The voice coil actuator moves the hammer head to produce impact to the end of the drill bit. The spring is used to store energy on the retraction and to capture the rebound energy after each impact for use in the next impact. The maximum actuator stroke is 20 mm with the hammer mass being 200 grams. This unit can create impact energy of 0.4 J with 0.8 J being the maximum. This mechanism is less complex than previous devices meant for the same task, so it has less mass and less volume. Its impact rate and energy are easily tunable without changing major hardware components. The drill can be driven by two half-bridges. Heat is removed from the voice coil via CO2 conduction.

  12. Primer to Design Safe School Projects in Case of Terrorist Attacks and School Shootings. Buildings and Infrastructure Protection Series. FEMA-428/BIPS-07/January 2012. Edition 2

    Science.gov (United States)

    Chipley, Michael; Lyon, Wesley; Smilowitz, Robert; Williams, Pax; Arnold, Christopher; Blewett, William; Hazen, Lee; Krimgold, Fred

    2012-01-01

    This publication, part of the new Building and Infrastructure Protection Series (BIPS) published by the Department of Homeland Security (DHS) Science and Technology Directorate (S&T) Infrastructure Protection and Disaster Management Division (IDD), serves to advance high performance and integrated design for buildings and infrastructure. This…

  13. Experimental studies illuminate the cultural transmission of percussive technologies in Homo and Pan.

    Science.gov (United States)

    Whiten, Andrew

    2015-11-19

    The complexity of Stone Age tool-making is assumed to have relied upon cultural transmission, but direct evidence is lacking. This paper reviews evidence bearing on this question provided through five related empirical perspectives. Controlled experimental studies offer special power in identifying and dissecting social learning into its diverse component forms, such as imitation and emulation. The first approach focuses on experimental studies that have discriminated social learning processes in nut-cracking by chimpanzees. Second come experiments that have identified and dissected the processes of cultural transmission involved in a variety of other force-based forms of chimpanzee tool use. A third perspective is provided by field studies that have revealed a range of forms of forceful, targeted tool use by chimpanzees, that set percussion in its broader cognitive context. Fourth are experimental studies of the development of flint knapping to make functional sharp flakes by bonobos, implicating and defining the social learning and innovation involved. Finally, new and substantial experiments compare what different social learning processes, from observational learning to teaching, afford good quality human flake and biface manufacture. Together these complementary approaches begin to delineate the social learning processes necessary to percussive technologies within the Pan-Homo clade. © 2015 The Author(s).

  14. Variability in an early hominin percussive tradition: the Acheulean versus cultural variation in modern chimpanzee artefacts.

    Science.gov (United States)

    Gowlett, J A J

    2015-11-19

    Percussion makes a vital link between the activities of early human ancestors and other animals in tool-use and tool-making. Far more of the early human actions are preserved as archaeology, since the percussion was largely used for making hard tools of stone, rather than for direct access to food. Both primate tools and early hominin tools, however, offer a means to exploring variability in material culture, a strong focus of interest in recent primate studies. This paper charts such variability in the Acheulean, the longest-lasting tool tradition, extant form about 1.7 to about 0.1 Ma, and well known for its characteristic handaxes. The paper concentrates on the African record, although the Acheulean was also known in Europe and Asia. It uses principal components and discriminant analysis to examine the measurements from 66 assemblages (whole toolkits), and from 18 sets of handaxes. Its review of evidence confirms that there is deep-seated pattern in the variation, with variability within a site complex often matching or exceeding that between sites far distant in space and time. Current techniques of study allow comparisons of handaxes far more easily than for other components, stressing a need to develop common practice in measurement and analysis. The data suggest, however, that a higher proportion of traits recurs widely in Acheulean toolkits than in the chimpanzee record. © 2015 The Author(s).

  15. Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

    Science.gov (United States)

    Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

    2018-06-01

    Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018

  16. Bronquiectasia e fisioterapia desobstrutiva: ênfase em drenagem postural e percussão Bronchiectasis and clearence physiotherapy: emphasis in postural drainage and percussion

    Directory of Open Access Journals (Sweden)

    Neuseli Marino Lamari

    2006-06-01

    Full Text Available Bronquiectasia consiste em dilatação anormal, permanente e irreversível de brônquios e bronquíolos, com infecções recorrentes, inflamações, hipersecreção e redução da limpeza mucociliar. Acomete predominantemente o sexo feminino, entre 28 e 48 anos de idade e afeta com maior freqüência os lobos inferiores bilateralmente. Manifestações clínicas da doença são a tosse crônica, febre e expectoração volumosa, purulenta, com odor fétido. Etiologia é inespecífica e representada pelo estádio final de diversos processos patológicos. Pode ser classificada em cilíndrica, varicosa e sacular, e ainda, em localizada e multissegmentar. Drenagem postural e percussão são técnicas desobstrutivas usuais na prática clínica diária, no entanto, há escassez de estudos comparativos enfatizando-as com amostras populacionais e recursos metodológicos. Tomando por base as considerações, teve-se como objetivo verificar a eficácia da drenagem postural e da percussão na higiene brônquica de pacientes bronquiectásicos, bem como seus efeitos e associação com outras técnicas apontadas pela literatura atual. Os principais achados comprovaram que a drenagem postural e a percussão são efetivas na mobilização da secreção pulmonar, uma vez que aumentam a velocidade do muco transportado, melhoram a função pulmonar e as trocas gasosas. A efetividade requer ajuda de um profissional, o que pode dificultar a prática clínica diária. Por esta razão, fisioterapeutas têm selecionado técnicas que propiciem independência ao paciente.Bronchiectasis consists of abnormal, permanent and irreversible dilation of bronchi and bronchia, with recurrent infections, inflammation, hypersecretion and reduction of mucus clearance. It predominantly affects women of between 28 and 48 years old and more frequently affects the inferior lobes. Clinical manifestations are chronic cough, fever and voluminous expectoration, with a fetid odor. The etiology

  17. A LAN Primer.

    Science.gov (United States)

    Hazari, Sunil I.

    1991-01-01

    Local area networks (LANs) are systems of computers and peripherals connected together for the purposes of electronic mail and the convenience of sharing information and expensive resources. In planning the design of such a system, the components to consider are hardware, software, transmission media, topology, operating systems, and protocols.…

  18. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  19. Adaptation aux répercussions de l'élévation du niveau de la mer ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    , la pollution, l'utilisation intensive des terres, la croissance démographique et la dégradation des écosystèmes. Elles sont par ailleurs exposées aux répercussions de la hausse du niveau de la mer et notamment aux inondations. Réduire la ...

  20. Self-cleaning effect in high quality percussion ablating of cooling hole by picosecond ultra-short pulse laser

    Science.gov (United States)

    Zhao, Wanqin; Yu, Zhishui

    2018-06-01

    Comparing with the trepanning technology, cooling hole could be processed based on the percussion drilling with higher processing efficiency. However, it is widely believed that the ablating precision of hole is lower for percussion drilling than for trepanning, wherein, the melting spatter materials around the hole surface and the recast layer inside the hole are the two main issues for reducing the ablating precision of hole, especially for the recast layer, it can't be eliminated completely even through the trepanning technology. In this paper, the self-cleaning effect which is a particular property just for percussion ablating of holes has been presented in detail. In addition, the reasons inducing the self-cleaning effect have been discussed. At last, based on the self-cleaning effect of percussion drilling, high quality cooling hole without the melting spatter materials around the hole surface and recast layer inside the hole could be ablated in nickel-based superalloy by picosecond ultra-short pulse laser.

  1. A Cobit primer.

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, Philip LaRoche

    2005-06-01

    COBIT is a set of documents that provides guidance for computer security. This report introduces COBIT by answering the following questions, after first defining acronyms and presenting definitions: 1. Why is COBIT valuable? 2. What is COBIT?, and 3. What documents are related to COBIT? (The answer to the last question constitutes the bulk of this report.) This report also provides more detailed review of three documents. The first two documents--COBIT Security Baseline{trademark} and COBIT Quickstart{trademark}--are initial documents, designed to get people started. The third document-Control Practices-is a ''final'' document, so to speak, designed to take people all the way down into the details. Control Practices is the detail.

  2. A primer of statistical methods for correlating parameters and properties of electrospun poly(L-lactide) scaffolds for tissue engineering--PART 1: design of experiments.

    Science.gov (United States)

    Seyedmahmoud, Rasoul; Rainer, Alberto; Mozetic, Pamela; Maria Giannitelli, Sara; Trombetta, Marcella; Traversa, Enrico; Licoccia, Silvia; Rinaldi, Antonio

    2015-01-01

    Tissue engineering scaffolds produced by electrospinning are of enormous interest, but still lack a true understanding about the fundamental connection between the outstanding functional properties, the architecture, the mechanical properties, and the process parameters. Fragmentary results from several parametric studies only render some partial insights that are hard to compare and generally miss the role of parameters interactions. To bridge this gap, this article (Part-1 of 2) features a case study on poly-L-lactide scaffolds to demonstrate how statistical methods such as design of experiments can quantitatively identify the correlations existing between key scaffold properties and control parameters, in a systematic, consistent, and comprehensive manner disentangling main effects from interactions. The morphological properties (i.e., fiber distribution and porosity) and mechanical properties (Young's modulus) are "charted" as a function of molecular weight (MW) and other electrospinning process parameters (the Xs), considering the single effect as well as interactions between Xs. For the first time, the major role of the MW emerges clearly in controlling all scaffold properties. The correlation between mechanical and morphological properties is also addressed. © 2014 Wiley Periodicals, Inc.

  3. A primer of statistical methods for correlating parameters and properties of electrospun poly(l -lactide) scaffolds for tissue engineering-PART 1: Design of experiments

    KAUST Repository

    Seyedmahmoud, Rasoul

    2014-03-20

    Tissue engineering scaffolds produced by electrospinning are of enormous interest, but still lack a true understanding about the fundamental connection between the outstanding functional properties, the architecture, the mechanical properties, and the process parameters. Fragmentary results from several parametric studies only render some partial insights that are hard to compare and generally miss the role of parameters interactions. To bridge this gap, this article (Part-1 of 2) features a case study on poly-l-lactide scaffolds to demonstrate how statistical methods such as design of experiments can quantitatively identify the correlations existing between key scaffold properties and control parameters, in a systematic, consistent, and comprehensive manner disentangling main effects from interactions. The morphological properties (i.e., fiber distribution and porosity) and mechanical properties (Young\\'s modulus) are "charted" as a function of molecular weight (MW) and other electrospinning process parameters (the Xs), considering the single effect as well as interactions between Xs. For the first time, the major role of the MW emerges clearly in controlling all scaffold properties. The correlation between mechanical and morphological properties is also addressed.

  4. Blockchain: A Graph Primer

    OpenAIRE

    Akcora, Cuneyt Gurcan; Gel, Yulia R.; Kantarcioglu, Murat

    2017-01-01

    Bitcoin and its underlying technology Blockchain have become popular in recent years. Designed to facilitate a secure distributed platform without central authorities, Blockchain is heralded as a paradigm that will be as powerful as Big Data, Cloud Computing and Machine learning. Blockchain incorporates novel ideas from various fields such as public key encryption and distributed systems. As such, a reader often comes across resources that explain the Blockchain technology from a certain pers...

  5. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  6. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  7. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  8. Primer on hardware prefetching

    CERN Document Server

    Falsafi, Babak

    2014-01-01

    Since the 1970's, microprocessor-based digital platforms have been riding Moore's law, allowing for doubling of density for the same area roughly every two years. However, whereas microprocessor fabrication has focused on increasing instruction execution rate, memory fabrication technologies have focused primarily on an increase in capacity with negligible increase in speed. This divergent trend in performance between the processors and memory has led to a phenomenon referred to as the "Memory Wall."To overcome the memory wall, designers have resorted to a hierarchy of cache memory levels, whi

  9. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  10. Application of vibratory-percussion crusher for disintegration of supertough materials

    Science.gov (United States)

    Shishkin, E. V.; Kazakov, S. V.

    2017-10-01

    This article describes the results of theoretical and experimental studies of a vibratory-percussion crusher, which is driven from a pair of self-synchronizing vibration exciters, attached to the shell symmetrically about its vertical axis. In addition to that, crusher’s dynamic model is symmetrical and balanced. Forced oscillation laws for crusher working members and their amplitude-frequency characteristics have been inducted. Domains of existence of synchronous opposite-phase oscillations of crusher working members (crusher’s operating mode) and crusher capabilities have been identified. The results of mechanical and technological tests of a pilot crusher presented in the article show that this crusher may be viewed as an advanced machine for disintegration of supertough materials with minimum regrinding of finished products.

  11. 4,300-year-old chimpanzee sites and the origins of percussive stone technology.

    Science.gov (United States)

    Mercader, Julio; Barton, Huw; Gillespie, Jason; Harris, Jack; Kuhn, Steven; Tyler, Robert; Boesch, Christophe

    2007-02-27

    Archaeological research in the African rainforest reveals unexpected results in the search for the origins of hominoid technology. The ancient Panin sites from Côte d'Ivoire constitute the only evidence of prehistoric ape behavior known to date anywhere in the world. Recent archaeological work has yielded behaviorally modified stones, dated by chronometric means to 4,300 years of age, lodging starch residue suggestive of prehistoric dietary practices by ancient chimpanzees. The "Chimpanzee Stone Age" pre-dates the advent of settled farming villages in this part of the African rainforest and suggests that percussive material culture could have been inherited from an common human-chimpanzee clade, rather than invented by hominins, or have arisen by imitation, or resulted from independent technological convergence.

  12. Rhythm histograms and musical meter: A corpus study of Malian percussion music.

    Science.gov (United States)

    London, Justin; Polak, Rainer; Jacoby, Nori

    2017-04-01

    Studies of musical corpora have given empirical grounding to the various features that characterize particular musical styles and genres. Palmer & Krumhansl (1990) found that in Western classical music the likeliest places for a note to occur are the most strongly accented beats in a measure, and this was also found in subsequent studies using both Western classical and folk music corpora (Huron & Ommen, 2006; Temperley, 2010). We present a rhythmic analysis of a corpus of 15 performances of percussion music from Bamako, Mali. In our corpus, the relative frequency of note onsets in a given metrical position does not correspond to patterns of metrical accent, though there is a stable relationship between onset frequency and metrical position. The implications of this non-congruence between simple statistical likelihood and metrical structure for the ways in which meter and metrical accent may be learned and understood are discussed, along with importance of cross-cultural studies for psychological research.

  13. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  14. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  15. Complexity management in engineering design a primer

    CERN Document Server

    Maurer, Maik

    2017-01-01

    The treatise supports understanding the phenomena of complexity in engineering, distinguishes complexity from other challenges and presents an overview of definitions and applied approaches. The historical background of complexity management is explained by highlighting the important epochs, their key actors and their discoveries, findings and developments. Knowing about the appearance of early system awareness in ancient Greece, the creation of mechanical philosophy in the 17th century and the discovery of classic physics enables the reader to better comprehend modern system sciences and management approaches. A classification of complexity management approaches by research fields indicates current focus areas and starting points for future discussions. In a comprehensive map, the classification points out mutual overlaps between engineering disciplines in terms of similar complexity management approaches. Finally, the treatise introduces a generic complexity management framework, which is based on structura...

  16. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  17. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  18. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  19. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  20. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  1. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  2. ["... my friend Leopold was percussing her through her bodice...". Leopold von Auenbrugger in Sigmund Freud's dream of Irma's injection].

    Science.gov (United States)

    Reicheneder, Johann Georg

    2011-01-01

    This paper provides a psychoanalytic interpretation of an element in the Irma dream that Freud had ignored in his own interpretation. The allusion to Leopold von Auenbrugger, the originator of percussion as a method of clinical investigation, which appears in the manifest dream reflects Freud's hopes and fears about how his Interpretation of Dreams and the new human science established there would be received by his medical colleagues.

  3. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  5. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  6. Percussion drilling cone penetrometer with wireless operating in-tip gaschromatograph

    Energy Technology Data Exchange (ETDEWEB)

    Bracht, C.; Matz, G. [Technische Univ. Hamburg-Harburg, Hamburg (Germany)

    2003-07-01

    Percussion drilling cone penetrometric analysis is the fast alternative to soil sampling and laboratory analyses. Online detection enables the characterization of a large variety of contaminants in soil. This becomes very important in the reactivation of contaminated sites. Therefore a new system has been constructed, which avoids tedious harness handling through the penetrometer drill rods and minimizes the time for an analysis down to 30 minutes per drill hole. This system enables the in-situ analysis of soil gases up to a depth of 10 to 15 meters. This system consists of a remote controlled in-tip mounted gaschromatograph, a special gas inlet module and a data transfer unit including a rechargeable battery pack. The modules are shock proved to be suitable for percussion drilling techniques and can be removed easily for maintenance. A PDA (Pocket PC) controls the subsoil gaschromatograph unit, calculates and displays the concentration of the detected compounds and stores the acquired data. The gaschromatograph until is optimized to analyze VOCs e.g. BTEX within 10 seconds per analysis. It consists of a loop inlet, a capillary column and a Photo Ionization Detector. It is microcontroller operated and battery powered. The inlet module is optimized soil gases. It includes a sensor and solenoid valve system for water protection and humidity acquisition while drilling. A completely charged battery pack provides up to three hours of analyses. It could be exchanged fast and easy to enable continuous analyses. Digital data transfer between subsoil unit and surface is provided wireless by IR light through the rods. On surface data is transferred wireless by BLUETOOTH radio link to the PDA. The depth of the penetrometer, global position and local time are acquired on-line onto the surface and are transferred on request by BLUETOOTH radio link to the PDA. The wireless data transfer and battery powered modules avoid time consuming cable handling and enable this cone

  7. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  8. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  9. Modeling for pipe decontamination by means of high-frequency percussive action; Modellerstellung fuer die Rohrdekontamination mittels hochfrequenter Schlagwirkung

    Energy Technology Data Exchange (ETDEWEB)

    Aminy, Akramullah

    2014-07-30

    The formation of persistent scales in pipes causes lower flow rates and therefore represents an economic problem. The contamination of scales - which usually is the case in most industrial applications - also poses a problem with respect to the scales' environmental compatibility. The currently applied techniques for the removal of these scales involve the use of auxiliary materials which accumulate large quantities of secondary waste that is costly to be disposed of. In this research, an environmentally friendly removal method for tubing scales was developed and qualified. The analysis of the currently used technologies formed the basis for the analysis and systematic evaluation of different principles of removal action methods. Consequently, a concept for a new impact based removal method was established. The mechanism of this technique is the application of a high-frequency percussive action by a geometrically defined tool. The impact on the scales cracks their surface and causes their fracture and thus the detachment from the pipes. Compared to alternative removal methods this proposed technique works without any auxiliary material and thus prevents the production of secondary waste. The investigation of the impact process was carried out in a newly developed test rig. In this test rig, the maximum forces of the percussive tool were measured with shear force sensors on the tubing surface and the resulting stress on the tube was obtained. The evaluation of the measured values using the method of descriptive statistics demonstrated that the high dynamic stress of the tubing due to the complex tool motion is based on a normal distribution. Based on this evaluation, the effects of the influencing factors on the stress of the tubings were systematically measured and outlined in a mathematical model. This model describes the dependency of the tool and the process of related factors that influences the tubing stress. According to this model, this stress is

  10. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  11. Characterization of rotary-percussion drilling as a seismic-while-drilling source

    Science.gov (United States)

    Xiao, Yingjian; Hurich, Charles; Butt, Stephen D.

    2018-04-01

    This paper focuses on an evaluation of rotary-percussion drilling (RPD) as a seismic source. Two field experiments were conducted to characterize seismic sources from different rocks with different strengths, i.e. weak shale and hard arkose. Characterization of RPD sources consist of spectral analysis and mean power measurements, along with field measurements of the source radiation patterns. Spectral analysis shows that increase of rock strength increases peak frequency and widens bandwidth, which makes harder rock more viable for seismic-while-drilling purposes. Mean power analysis infers higher magnitude of body waves in RPD than in conventional drillings. Within the horizontal plane, the observed P-wave energy radiation pattern partially confirms the theoretical radiation pattern under a single vertical bit vibration. However a horizontal lobe of energy is observed close to orthogonal to the axial bit vibration. From analysis, this lobe is attributed to lateral bit vibration, which is not documented elsewhere during RPD. Within the horizontal plane, the observed radiation pattern of P-waves is generally consistent with a spherically-symmetric distribution of energy. In addition, polarization analysis is conducted on P-waves recorded at surface geophones for understanding the particle motions. P-wave particle motions are predominantly in the vertical direction showing the interference of the free-surface.

  12. Time to Add a Fifth Pillar to Bedside Physical Examination: Inspection, Palpation, Percussion, Auscultation, and Insonation.

    Science.gov (United States)

    Narula, Jagat; Chandrashekhar, Y; Braunwald, Eugene

    2018-04-01

    Inspection, palpation, percussion, and auscultation have been the 4 pillars of clinical bedside medicine. Although these basic methods of physical examination have served us well, traditional bedside examination, for a number of reasons including diminishing interest and expertise, performs well less than what is required of a modern diagnostic strategy. Improving the performance of physical examination is vital given that it is crucial to guide diagnostic possibilities and further testing. Current efforts at improving physical examination skills during medical training have not been very successful, and incorporating appropriate technology at the bedside might improve its performance. Selective use of bedside ultrasound (or insonation) can be one such strategy that could be incorporated as the fifth component of the physical examination. Seeing pathology through imaging might improve interest in physical examination among trainees, and permit appropriate downstream testing and possibly superior decision making. Current ultrasound technology makes this feasible, and further miniaturization of ultrasound devices and reduced cost will allow for routine use at the bedside. It is time to have a wider debate and a possible consensus about updates required to enhance current paradigms of physical examination.

  13. Influence of intrapulmonary percussive ventilation in upright position on gastro-oesophageal reflux in infants.

    Science.gov (United States)

    Van Ginderdeuren, F; Kerckhofs, E; Deneyer, M; Vanlaethem, S; Buyl, R; Vandenplas, Y

    2016-10-01

    To determine the influence of physiotherapy using intrapulmonary percussive ventilation on gastro-oesophageal reflux (GOR) in infants reflux episodes (RE) over a 20-min period was registered for each infant and a mean per 20 min was calculated in order to obtain a baseline value. The number of RE during IPV R intervention was compared to baseline. Fifty infants with a median age of 133 days were recruited of whom 21 were diagnosed with pathological GOR. During IPV R , the incidence of RE in the entire group was significantly lower compared to baseline; median (inter-quartile range [IQR]) 0 (0-1) versus 0.71 (0-1.33) RE, respectively, P = 0.003. The subgroup with abnormal GOR showed also a significant decrease of RE during IPV R ; median (IQR) 0 (0-1) versus 1.17 (0.55-2.16) RE, respectively, P = 0.03. No difference was detected in the group with normal reflux; median (IQR) 0.6 (0-1) compared to 0 (0-1) RE, respectively, P = 0.34. IPV R does not induce, nor aggravate GOR in infants without and with pathological GOR, respectively, but on the contrary decreases the number of RE in patients with pathological reflux. Pediatr Pulmonol. 2016;51:1065-1071. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. How similar are nut-cracking and stone-flaking? A functional approach to percussive technology.

    Science.gov (United States)

    Bril, Blandine; Parry, Ross; Dietrich, Gilles

    2015-11-19

    Various authors have suggested similarities between tool use in early hominins and chimpanzees. This has been particularly evident in studies of nut-cracking which is considered to be the most complex skill exhibited by wild apes, and has also been interpreted as a precursor of more complex stone-flaking abilities. It has been argued that there is no major qualitative difference between what the chimpanzee does when he cracks a nut and what early hominins did when they detached a flake from a core. In this paper, similarities and differences between skills involved in stone-flaking and nut-cracking are explored through an experimental protocol with human subjects performing both tasks. We suggest that a 'functional' approach to percussive action, based on the distinction between functional parameters that characterize each task and parameters that characterize the agent's actions and movements, is a fruitful method for understanding those constraints which need to be mastered to perform each task successfully, and subsequently, the nature of skill involved in both tasks. © 2015 The Author(s).

  15. Effects of Exercise Following Lateral Fluid Percussion Brain Injury in Rats.

    Science.gov (United States)

    Hicks, Ramona R.; Boggs, Arden; Leider, Denise; Kraemer, Philip; Brown, Russell; Scheff, Stephen W.; Seroogy, Kim B.

    1998-01-01

    Previous studies have suggested that brain-derived neurotrophic factor (BDNF) is involved in memory and learning, and may be neuroprotective following various brain insults. Exercise has been found to increase BDNF mRNA levels in various brain regions, including specific subpopulations of hippocampal neurons. In the present study, we were interested in whether following traumatic brain injury, exercise could increase BDNF mRNA expression, attenuate neuropathology, and improve cognitive and neuromoter performance. We subjected adult male Sprague-Dawley rats to a fluid percussion brain injury, followed by either 18 days of treadmill exercise or handling. Spatial memory was evaluated in a Morris Water Maze (MWM) and motor function was evaluated with a battery of neuromotor tests. Neuropathology was evaluated by measuring the cortical lesion volume and the extent of neuronal loss in the hipocampus. Expression of BDNF mRNA in the hippocampus was assessed with in situ hybridization and densitometry. Hybridization signal for BDNF mRNA was significantly increased bilaterally in the exercise group in hippocampal regions CA1 and CA3 (p<0.05), but not in the granule cell layer of the dentate gyrus. No significant differences were observed between the groups in neuropathology, spatial memory, or motor performance. This study suggests that after traumatic brain injury, exercise elevates BDNF mRNA in specific regions of the hippocampus.

  16. The musical environment and auditory plasticity: Hearing the pitch of percussion

    Directory of Open Access Journals (Sweden)

    Neil M Mclachlan

    2013-10-01

    Full Text Available Although musical skills clearly improve with training, pitch processing has generally been believed to be biologically determined by the behavior of brain stem neural mechanisms. Two main classes of pitch models have emerged over the last 50 years. Harmonic template models have been used to explain cross-channel integration of frequency information, and waveform periodicity models have been used to explain pitch discrimination that is much finer than the resolution of the auditory nerve. It has been proposed that harmonic templates are learnt from repeated exposure to voice, and so it may also be possible to learn inharmonic templates from repeated exposure to inharmonic music instruments. This study investigated whether pitch-matching accuracy for inharmonic percussion instruments was better in people who have trained on these instruments and could reliably recognize their timbre. We found that adults who had trained with Indonesian gamelan instruments were better at recognizing and pitch-matching gamelan instruments than people with similar levels of music training, but no prior exposure to these instruments. These findings suggest that gamelan musicians were able to use inharmonic templates to support accurate pitch processing for these instruments. We suggest that recognition mechanisms based on spectrotemporal patterns of afferent auditory excitation in the early stages of pitch processing allow rapid priming of the lowest frequency partial of inharmonic timbres, explaining how music training can adapt pitch processing to different musical genres and instruments.

  17. Perspectives on object manipulation and action grammar for percussive actions in primates.

    Science.gov (United States)

    Hayashi, Misato

    2015-11-19

    The skill of object manipulation is a common feature of primates including humans, although there are species-typical patterns of manipulation. Object manipulation can be used as a comparative scale of cognitive development, focusing on its complexity. Nut cracking in chimpanzees has the highest hierarchical complexity of tool use reported in non-human primates. An analysis of the patterns of object manipulation in naive chimpanzees after nut-cracking demonstrations revealed the cause of difficulties in learning nut-cracking behaviour. Various types of behaviours exhibited within a nut-cracking context can be examined in terms of the application of problem-solving strategies, focusing on their basis in causal understanding or insightful intentionality. Captive chimpanzees also exhibit complex forms of combinatory manipulation, which is the precursor of tool use. A new notation system of object manipulation was invented to assess grammatical rules in manipulative actions. The notation system of action grammar enabled direct comparisons to be made between primates including humans in a variety of object-manipulation tasks, including percussive-tool use. © 2015 The Author(s).

  18. Reflections on the Body Percussion at the Municipal School Aleixo Pereira Braga II

    Directory of Open Access Journals (Sweden)

    José Donizete Pedrosa Gomes

    2016-03-01

    Full Text Available Why the ideas of discipline, rigidity, detachment between the educator and the educating still are so exalted in our society? Why are they still are directly associated with the learning? Are there no other ways of the learning happen and which may be more effective than this traditional models? These were the main concerns that guide us to elaborate this article. The group PET Conexão de Saberes - Música do Oprimido (Program of Tutorial Education/Connection of knowledge - Music of the Oppressed - UnB performed in the period from 16 May to 11 July 2015 body percussion workshops at the Municipal School Aleixo Pereira Braga II (Cidade Ocidental-GO. We lived with a group of kids during the Saturdays by the morning and realized that this musical activity began a dynamic environment of learning based on the collectivity, playfulness and affectivity. The children assimilate the workshops as plays and felt free to take risks, experiment and learn about music. Thus, this experience with children of Cidade Ocidental made us reflect about the role of the affectivity in the Child Education basing ourselves in articles of Developmental Psychology area and the Social-Emotional Education.

  19. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  20. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  1. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  2. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  3. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  4. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  5. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  6. Analysis and Testing of Load Characteristics for Rotary-Percussive Drilling of Lunar Rock Simulant with a Lunar Regolith Coring Bit

    Directory of Open Access Journals (Sweden)

    Peng Li

    2017-01-01

    Full Text Available Based on an optimized lunar regolith coring bit (LRCB configuration, the load characteristics of rotary-percussive drilling of lunar rock simulant in a laboratory environment are analyzed to determine the effects of the drilling parameters (the rotational velocity, the penetration rate, and the percussion frequency on the drilling load. The process of rotary drilling into lunar rock using an LRCB is modeled as an interaction between an elemental blade and the rock. The rock’s fracture mechanism during different stages of the percussive mechanism is analyzed to create a load forecasting model for the cutting and percussive fracturing of rock using an elemental blade. Finally, a model of the load on the LRCB is obtained from the analytic equation for the bit’s cutting blade distribution; experimental verification of the rotary-impact load characteristics for lunar rock simulant with different parameters is performed. The results show that the penetrations per revolution (PPR are the primary parameter influencing the drilling load. When the PPR are fixed, increasing the percussion frequency reduces the drilling load on the rock. Additionally, the variation pattern of the drilling load of the bit is in agreement with that predicted by the theoretical model. This provides a research basis for subsequent optimization of the drilling procedure and online recognition of the drilling process.

  7. Astrocyte oxidative metabolism and metabolite trafficking after fluid percussion brain injury in adult rats.

    Science.gov (United States)

    Bartnik-Olson, Brenda L; Oyoyo, Udochukwu; Hovda, David A; Sutton, Richard L

    2010-12-01

    Despite various lines of evidence pointing to the compartmentation of metabolism within the brain, few studies have reported the effect of a traumatic brain injury (TBI) on neuronal and astrocyte compartments and/or metabolic trafficking between these cells. In this study we used ex vivo ¹³C NMR spectroscopy following an infusion of [1-¹³C] glucose and [1,2-¹³C₂] acetate to study oxidative metabolism in neurons and astrocytes of sham-operated and fluid percussion brain injured (FPI) rats at 1, 5, and 14 days post-surgery. FPI resulted in a decrease in the ¹³C glucose enrichment of glutamate in neurons in the injured hemisphere at day 1. In contrast, enrichment of glutamine in astrocytes from acetate was not significantly decreased at day 1. At day 5 the ¹³C enrichment of glutamate and glutamine from glucose in the injured hemisphere of FPI rats did not differ from sham levels, but glutamine derived from acetate metabolism in astrocytes was significantly increased. The ¹³C glucose enrichment of the C3 position of glutamate (C3) in neurons was significantly decreased ipsilateral to FPI at day 14, whereas the enrichment of glutamine in astrocytes had returned to sham levels at this time point. These findings indicate that the oxidative metabolism of glucose is reduced to a greater extent in neurons compared to astrocytes following a FPI. The increased utilization of acetate to synthesize glutamine, and the acetate enrichment of glutamate via the glutamate-glutamine cycle, suggests an integral protective role for astrocytes in maintaining metabolic function following TBI-induced impairments in glucose metabolism.

  8. High-frequency percussive ventilation attenuates lung injury in a rabbit model of gastric juice aspiration.

    Science.gov (United States)

    Allardet-Servent, Jérôme; Bregeon, Fabienne; Delpierre, Stéphane; Steinberg, Jean-Guillaume; Payan, Marie-José; Ravailhe, Sylvie; Papazian, Laurent

    2008-01-01

    To test the effects of high-frequency percussive ventilation (HFPV) compared with high-frequency oscillatory ventilation (HFOV) and low-volume conventional mechanical ventilation (LVCMV), on lung injury course in a gastric juice aspiration model. Prospective, randomized, controlled, in-vivo animal study. University animal research laboratory. Forty-three New Zealand rabbits. Lung injury was induced by intratracheal instillation of human gastric juice in order to achieve profound hypoxaemia (PaO2/FIO2ventilated for 4h after randomization in one of the following four groups: HFPV (median pressure 15cmH2O); LVCMV (VT 6mlkg(-1) and PEEP set to reach 15cmH2O plateau pressure); HFOV (mean pressure 15cmH2O); and a high-volume control group HVCMV (VT 12ml kg(-1) and ZEEP). Static respiratory compliance increased after the ventilation period in the HFPV, LVMCV and HFOV groups, in contrast with the HVCMV group. PaO2/FIO2 improved similarly in the HFPV, LVCMV and HFOV groups, and remained lower in the HVCMV group than in the three others. Lung oedema, myeloperoxidase and histological lung injury score were higher in the HVCMV group, but not different among all others. Arterial lactate markedly increased after 4h of ventilation in the HVCMV group, while lower but similar levels were observed in the three other groups. HFPV, like HFOV and protective CMV, improves respiratory mechanics and oxygenation, and attenuates lung damage. The HFPV provides attractive lung protection, but further studies should confirm these results before introducing HFPV into the clinical arena.

  9. Site investigation SFR. Boremap mapping of percussion drilled borehole HFR106

    Energy Technology Data Exchange (ETDEWEB)

    Winell, Sofia (Geosigma AB (Sweden))

    2010-06-15

    This report presents the result from the Boremap mapping of the percussion drilled borehole HFR106, which is drilled from an islet located ca 220 m southeast of the pier above SFR. The purpose of the location and orientation of the borehole is to investigate the possible occurrence of gently dipping, water-bearing structures in the area. HFR106 has a length of 190.4 m and oriented 269.4 deg/-60.9 deg. The mapping is based on the borehole image (BIPS), investigation of drill cuttings and generalized, as well as more detailed geophysical logs. The dominating rock type, which occupies 68% of HFR106, is fine- to medium-grained, pinkish grey metagranite-granodiorite (rock code 101057) mapped as foliated with a medium to strong intensity. Pegmatite to pegmatitic granite (rock code 101061) occupies 29% of the borehole. Subordinate rock types are felsic to intermediate meta volcanic rock (rock code 103076) and fine- to medium-grained granite (rock code 111058). Rock occurrences (rock types < 1 m in length) occupy about 16% of the mapped interval, of which half is veins, dykes and unspecified occurrences of pegmatite and pegmatitic granite. Only 5.5% of HFR106 is inferred to be altered, mainly oxidation in two intervals with an increased fracture frequency. A total number of 845 fractures are registered in HFR106. Of these are 64 interpreted as open with a certain aperture, 230 open with a possible aperture, and 551 sealed. This result in the following fracture frequencies: 1.6 open fractures/m and 3.0 sealed fractures/m. Three fracture sets of open and sealed fractures with the orientations 290 deg/70 deg, 150 deg/85 deg and 200 deg/85 deg can be distinguished in HFR106. The fracture frequency is generally higher in the second half of the borehole, and particularly in the interval 176-187.4 m.

  10. Site investigation SFR. Boremap mapping of percussion drilled borehole HFR106

    International Nuclear Information System (INIS)

    Winell, Sofia

    2010-06-01

    This report presents the result from the Boremap mapping of the percussion drilled borehole HFR106, which is drilled from an islet located ca 220 m southeast of the pier above SFR. The purpose of the location and orientation of the borehole is to investigate the possible occurrence of gently dipping, water-bearing structures in the area. HFR106 has a length of 190.4 m and oriented 269.4 deg/-60.9 deg. The mapping is based on the borehole image (BIPS), investigation of drill cuttings and generalized, as well as more detailed geophysical logs. The dominating rock type, which occupies 68% of HFR106, is fine- to medium-grained, pinkish grey metagranite-granodiorite (rock code 101057) mapped as foliated with a medium to strong intensity. Pegmatite to pegmatitic granite (rock code 101061) occupies 29% of the borehole. Subordinate rock types are felsic to intermediate meta volcanic rock (rock code 103076) and fine- to medium-grained granite (rock code 111058). Rock occurrences (rock types < 1 m in length) occupy about 16% of the mapped interval, of which half is veins, dykes and unspecified occurrences of pegmatite and pegmatitic granite. Only 5.5% of HFR106 is inferred to be altered, mainly oxidation in two intervals with an increased fracture frequency. A total number of 845 fractures are registered in HFR106. Of these are 64 interpreted as open with a certain aperture, 230 open with a possible aperture, and 551 sealed. This result in the following fracture frequencies: 1.6 open fractures/m and 3.0 sealed fractures/m. Three fracture sets of open and sealed fractures with the orientations 290 deg/70 deg, 150 deg/85 deg and 200 deg/85 deg can be distinguished in HFR106. The fracture frequency is generally higher in the second half of the borehole, and particularly in the interval 176-187.4 m

  11. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  12. Supplement to 1978 Catalogue of Wind and Percussion Solos and Ensembles. American School Band Directors' Association. Research Committee Reports for the Annual Convention (27th, Minneapolis, Minnesota, August 1-4, 1979).

    Science.gov (United States)

    Berndt, Arnold, Comp.

    This catalogue lists phonograph records which feature solo and ensemble music by wind and percussion instruments. It supplements the "1978 Catalogue of Wind and Percussion Solos and Ensembles" (ED 171 614). Instruments played on the records include oboe/English horn, flute, clarinet, bassoon, saxophone, trumpet/cornet, French horn, woodwind…

  13. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  14. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  15. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  16. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  17. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  18. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  19. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  20. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  1. Percussion and electrical stunning of Atlantic salmon (Salmo salar) after dewatering and subsequent effect on brain and heart activities nd subsequent

    NARCIS (Netherlands)

    Lambooij, E.; Grimsboe, E.; Vis, van de J.W.; Reimert, H.G.M.; Nortvedt, R.; Roth, B.

    2010-01-01

    The overall objective of the study was to evaluate a percussive and an electrical stunning method under laboratory conditions in Atlantic salmon. Evidence of unconsciousness and insensibility of the salmon was provided on the electroencephalogram (EEG) by the appearance of slow waves and spikes,

  2. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  3. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  4. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  5. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  6. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  7. A comparison of the therapeutic effectiveness of and preference for postural drainage and percussion, intrapulmonary percussive ventilation, and high-frequency chest wall compression in hospitalized cystic fibrosis patients.

    Science.gov (United States)

    Varekojis, Sarah M; Douce, F Herbert; Flucke, Robert L; Filbrun, David A; Tice, Jill S; McCoy, Karen S; Castile, Robert G

    2003-01-01

    Cystic fibrosis (CF) patients have abnormally viscid bronchial secretions that cause airway obstruction, inflammation, and infection that leads to lung damage. To enhance airway clearance and reduce airway obstruction, daily bronchopulmonary hygiene therapy is considered essential. Compare the effectiveness of and patient preferences regarding 3 airway clearance methods: postural drainage and percussion (PD&P), intrapulmonary percussive ventilation (IPV), and high-frequency chest wall compression (HFCWC). The participants were hospitalized CF patients >or= 12 years old. Effectiveness was evaluated by measuring the wet and dry weights of sputum obtained with each method. In random order, each patient received 2 consecutive days of each therapy, delivered 3 times daily for 30 minutes. Sputum was collected during and for 15 minutes after each treatment, weighed wet, then dried and weighed again. Participants rated their preferences using a Likert-type scale. Mean weights and preferences were compared using analysis of variance with repeated measures. Patient preferences were compared using Freidman's test. Twenty-four patients were studied. The mean +/- SD wet sputum weights were 5.53 +/- 5.69 g with PD&P, 6.84 +/- 5.41 g with IPV, and 4.77 +/- 3.29 g with HFCWC. The mean wet sputum weights differed significantly (p = 0.035). Wet sputum weights from IPV were significantly greater than those from HFCWC (p < 0.05). The mean dry sputum weights were not significantly different. With regard to overall preference and to the subcomponents of preference, none of the 3 methods was preferred over the others. HFCWC and IPV are at least as effective as vigorous, professionally administered PD&P for hospitalized CF patients, and the 3 modalities were equally acceptable to them. A hospitalized CF patient should try each therapy and choose his or her preferred modality.

  8. Primer on laser scattering diagnostics

    International Nuclear Information System (INIS)

    Jahoda, F.C.

    1978-07-01

    The theory of laser scattering is presented in abbreviated format, with emphasis on physical interpretation, followed by sections on laser sources, practical considerations in designing experiments, and current developments in extending the techniques to multispace and multitime point measurements

  9. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  10. Reflexões Sobre a Percussão Corporal Na Escola Municipal Aleixo Pereira Braga II

    Directory of Open Access Journals (Sweden)

    José Donizete Pedrosa Gomes

    2016-03-01

    Full Text Available ResumoPor que as ideias de disciplina, rigidez, distanciamento entre educador e educando são ainda tão exaltadas em nossa sociedade? Por que elas ainda são diretamente associadas à aprendizagem? Será que não existem outras formas da aprendizagem acontecer e que possam ser bem mais eficazes que esses modelos tradicionais de ensino? Essas foram as principais inquietações que nos nortearam a elaborar esse artigo. O grupo PET Conexão de Saberes - Música do Oprimido (UnB realizou no período de 16 de maio a 11 de julho de 2015 oficinas de percussão corporal na Escola Municipal Aleixo Pereira Braga II (Cidade Ocidental-GO. Convivemos com um grupo de crianças durante sábados pela manhã e percebemos que essa atividade musical gerou um ambiente de aprendizado dinâmico baseado em coletividade, ludicidade e afetividade. As crianças assimilaram as oficinas como brincadeiras e se sentiram à vontade para arriscar, experimentar e aprender sobre música. Dessa forma, essa experiência com crianças da Cidade Ocidental nos fez refletir sobre o papel da afetividade na Educação Infantil baseando-nos em artigos da área de Psicologia do Desenvolvimento e de Educação Socioemocional. Palavras-chave: Afetividade, educação infantil, ludicidade, percussão corporal, PET - Conexão de Saberes - Música do Oprimido.

  11. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  12. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  13. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  14. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  15. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  16. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  17. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  18. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  19. Java to C: A Primer

    DEFF Research Database (Denmark)

    McDowell, Charlie; Villadsen, Jørgen

    This book is designed to be used as a quick introduction to C for programmers already familiar with Java. It is not a replacement for a reference book on C but is instead a supplement. For the programmer already familiar with Java, the typical book on C requires the reader to wade through many...... details of already-familiar material. In this book, we quickly present the main concepts needed to begin writing serious programs in C, highlighting the differences between C and Java....

  20. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  1. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  2. Design for Disability: Integration of Human Factor for the Design of an Electro-mechanical Drum Stick System

    OpenAIRE

    Coton , Justine; De Gois Pinto , Marcel; Veytizou , Julien; Thomann , Guillaume

    2014-01-01

    International audience; Traditionally, designers imagine, design and manufacture products or interfaces for able-bodied users. In the areas of assistive technology and design for disability, human factors must be taken into account during the design. The final user capabilities but also others specific expertise can constitute these human factors. In the present context, the authors are working with designers who develop products dedicated to play on percussion musical instruments. Musical ch...

  3. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  4. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  5. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  6. Titration of High Frequency Percussive Ventilation by means of real-time monitoring of the viscoelastic respiratory system properties and endotracheal tubes pressure drop.

    OpenAIRE

    Lucangelo, Umberto

    2014-01-01

    2012/2013 The use of High Frequency Percussive Ventilation (HFPV) is still debated although this type of non-conventional ventilation has proven effective and safe in patients with acute respiratory failure. In the clinical practice, HFPV is not an intuitive ventilatory modality and the absence of real-time delivered volume monitoring produces disaffection among the physicians. Avoiding the "volutrauma" is the cornerstone of the "protective ventilation strategy", which assumes a cons...

  7. Estudo do gesto instrumental sob o prisma da Labanotation: o exemplo da Tapping Technique em Percussion Study I para violão solo de Arthur Kampela

    Directory of Open Access Journals (Sweden)

    Ledice Fernandes-Weiss

    2018-04-01

    Full Text Available Este estudo parte dos efeitos de percussão criados por Arthur Kampela em seu Percussion Study I visando compreender o movimento físico e o gesto instrumental do violonista como um fenômeno orgânico, intimamente relacionado com o gesto sonoro. Para tanto, utilizamos como ferramenta de análise a notação de movimentos coreográficos criada por Rudolf von Laban; este sistema é aplicado aos gestos requeridos para se realizarem cinco passagens da obra de Kampela onde os efeitos de percussão estão particularmente presentes. A partir da leitura dos cinetogramas criados, podemos observar uma predominância de movimentos em ricochete e outros efeitos percussivos que, além de promover um melhor relaxamento muscular, corroboram no impacto visual que a peça causa por sua gestualidade corporal. Observamos também que há uma notável exploração espacial do instrumento. Ao abordarmos o fazer musical de um ponto de vista coreográfico, entendemos este como um complexo que inclui o som produzido, os gestos e movimentos do performer, sua energia, seu corpo e o espaço que o circunda.

  8. Haemodynamics and oxygenation improvement induced by high frequency percussive ventilation in a patient with hypoxia following cardiac surgery: a case report

    Directory of Open Access Journals (Sweden)

    Persi Bruno

    2010-10-01

    Full Text Available Abstract Introduction High frequency percussive ventilation is a ventilatory technique that delivers small bursts of high flow respiratory gas into the lungs at high rates. It is classified as a pneumatically powered, pressure-regulated, time-cycled, high-frequency flow interrupter modality of ventilation. High frequency percussive ventilation improves the arterial partial pressure of oxygen with the same positive end expiratory pressure and fractional inspiratory oxygen level as conventional ventilation using a minor mean airway pressure in an open circuit. It reduces the barotraumatic events in a hypoxic patient who has low lung-compliance. To the best of our knowledge, there have been no papers published about this ventilation modality in patients with severe hypoxaemia after cardiac surgery. Case presentation A 75-year-old Caucasian man with an ejection fraction of 27 percent, developed a lung infection with severe hypoxaemia [partial pressure of oxygen/fractional inspiratory oxygen of 90] ten days after cardiac surgery. Conventional ventilation did not improve the gas exchange. He was treated with high frequency percussive ventilation for 12 hours with a low conventional respiratory rate (five per minute. His cardiac output and systemic and pulmonary pressures were monitored. Compared to conventional ventilation, high frequency percussive ventilation gives an improvement of the partial pressure of oxygen from 90 to 190 mmHg with the same fractional inspiratory oxygen and positive end expiratory pressure level. His right ventricular stroke work index was lowered from 19 to seven g-m/m2/beat; his pulmonary vascular resistance index from 267 to 190 dynes•seconds/cm5/m2; left ventricular stroke work index from 28 to 16 gm-m/m2/beat; and his pulmonary arterial wedge pressure was lowered from 32 to 24 mmHg with a lower mean airway pressure compared to conventional ventilation. His cardiac index (2.7 L/min/m2 and ejection fraction (27 percent

  9. Investigation of left and right lateral fluid percussion injury in C57BL6/J mice: In vivo functional consequences.

    Science.gov (United States)

    Schurman, Lesley D; Smith, Terry L; Morales, Anthony J; Lee, Nancy N; Reeves, Thomas M; Phillips, Linda L; Lichtman, Aron H

    2017-07-13

    Although rodent models of traumatic brain injury (TBI) reliably produce cognitive and motor disturbances, behavioral characterization resulting from left and right hemisphere injuries remains unexplored. Here we examined the functional consequences of targeting the left versus right parietal cortex in lateral fluid percussion injury, on Morris water maze (MWM) spatial memory tasks (fixed platform and reversal) and neurological motor deficits (neurological severity score and rotarod). In the MWM fixed platform task, right lateral injury produced a small delay in acquisition rate compared to left. However, injury to either hemisphere resulted in probe trial deficits. In the MWM reversal task, left-right performance deficits were not evident, though left lateral injury produced mild acquisition and probe trial deficits compared to sham controls. Additionally, left and right injury produced similar neurological motor task deficits, impaired righting times, and lesion volumes. Injury to either hemisphere also produced robust ipsilateral, and modest contralateral, morphological changes in reactive microglia and astrocytes. In conclusion, left and right lateral TBI impaired MWM performance, with mild fixed platform acquisition rate differences, despite similar motor deficits, histological damage, and glial cell reactivity. Thus, while both left and right lateral TBI produce cognitive deficits, laterality in mouse MWM learning and memory merits consideration in the investigation of TBI-induced cognitive consequences. Copyright © 2017. Published by Elsevier B.V.

  10. Implantation of Neuronal Stem Cells Enhances Object Recognition without Increasing Neurogenesis after Lateral Fluid Percussion Injury in Mice

    Directory of Open Access Journals (Sweden)

    Laura B. Ngwenya

    2018-01-01

    Full Text Available Cognitive deficits after traumatic brain injury (TBI are debilitating and contribute to the morbidity and loss of productivity of over 10 million people worldwide. Cell transplantation has been linked to enhanced cognitive function after experimental traumatic brain injury, yet the mechanism of recovery is poorly understood. Since the hippocampus is a critical structure for learning and memory, supports adult neurogenesis, and is particularly vulnerable after TBI, we hypothesized that stem cell transplantation after TBI enhances cognitive recovery by modulation of endogenous hippocampal neurogenesis. We performed lateral fluid percussion injury (LFPI in adult mice and transplanted embryonic stem cell-derived neural progenitor cells (NPC. Our data confirm an injury-induced cognitive deficit in novel object recognition, a hippocampal-dependent learning task, which is reversed one week after NPC transplantation. While LFPI alone promotes hippocampal neurogenesis, as revealed by doublecortin immunolabeling of immature neurons, subsequent NPC transplantation prevents increased neurogenesis and is not associated with morphological maturation of endogenous injury-induced immature neurons. Thus, NPC transplantation enhances cognitive recovery early after LFPI without a concomitant increase in neuron numbers or maturation.

  11. Use of a new novel humidification system with high frequency percussive ventilation in a patient with inhalation injury.

    Science.gov (United States)

    Jones, Samuel W; Short, Kathy A; Joseph, Mark; Sommer, Courtney; Cairns, Bruce A

    2010-01-01

    Historically, it has been difficult to provide adequate humidification delivery with the high frequency percussive ventilator (HFPV) used in many burn centers. It is possible burn centers have avoided using HFPV because of the risk of mucus plugging, dried secretions, and cast formation. Experiences with HFPV provided doubt that the HFPV ventilator circuit could supply adequate humidification to patients receiving this mode of ventilation. Independent gas-flow delivery through the ventilator circuit inherent in HFPV provided a challenge in maintaining adequate humidification delivery to the patient. This report describes a dramatic reduction in dried, inspissated secretions by using a novel new humidification device with HFPV. The new device called the Hydrate Omni (Hydrate, Inc., Midlothian, VA) uses a small ceramic disk to provide fine water particles delivered by a pump to the HFPV circuit. This new device may alleviate previous concerns related to the delivery of adequate humidification with the HFPV. This case report was approved by the University of North Carolina School of Medicine Institutional Review Board.

  12. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  13. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  14. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  15. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  16. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  17. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  18. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  19. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  20. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  1. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  2. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  3. Lateral Fluid Percussion Injury Impairs Hippocampal Synaptic Soluble N-Ethylmaleimide Sensitive Factor Attachment Protein Receptor Complex Formation

    Directory of Open Access Journals (Sweden)

    Shaun W. Carlson

    2017-10-01

    Full Text Available Traumatic brain injury (TBI and the activation of secondary injury mechanisms have been linked to impaired cognitive function, which, as observed in TBI patients and animal models, can persist for months and years following the initial injury. Impairments in neurotransmission have been well documented in experimental models of TBI, but the mechanisms underlying this dysfunction are poorly understood. Formation of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE complex facilitates vesicular docking and neurotransmitter release in the synaptic cleft. Published studies highlight a direct link between reduced SNARE complex formation and impairments in neurotransmitter release. While alterations in the SNARE complex have been described following severe focal TBI, it is not known if deficits in SNARE complex formation manifest in a model with reduced severity. We hypothesized that lateral fluid percussion injury (lFPI reduces the abundance of SNARE proteins, impairs SNARE complex formation, and contributes to impaired neurobehavioral function. To this end, rats were subjected to lFPI or sham injury and tested for acute motor performance and cognitive function at 3 weeks post-injury. lFPI resulted in motor impairment between 1 and 5 days post-injury. Spatial acquisition and spatial memory, as assessed by the Morris water maze, were significantly impaired at 3 weeks after lFPI. To examine the effect of lFPI on synaptic SNARE complex formation in the injured hippocampus, a separate cohort of rats was generated and brains processed to evaluate hippocampal synaptosomal-enriched lysates at 1 week post-injury. lFPI resulted in a significant reduction in multiple monomeric SNARE proteins, including VAMP2, and α-synuclein, and SNARE complex abundance. The findings in this study are consistent with our previously published observations suggesting that impairments in hippocampal SNARE complex formation may contribute to

  4. In vivo 1H MR spectroscopic findings in traumatic contusion of ICR mouse brain induced by fluid percussion injury

    International Nuclear Information System (INIS)

    Choi, Chi-Bong; Kim, Hwi-Yool; Han, Duk-Young; Kang, Young-Woon; Han, Young-Min; Jeun, Sin-Soo; Choe, Bo-Young

    2005-01-01

    Purpose: The purpose of this study was to investigate the proton metabolic differences of the right parietal cortex with experimental brain contusions of ICR mouse induced by fluid percussion injury (FPI) compared to normal controls and to test the possibility that 1 H magnetic resonance spectroscopy (MRS) findings could provide neuropathologic criteria in the diagnosis and monitoring of traumatic brain contusions. Materials and methods: A homogeneous group of 20 ICR male mice was used for MRI and in vivo 1 H MRS. Using image-guided, water-suppressed in vivo 1 H MRS with a 4.7 T MRI/MRS system, we evaluated the MRS measurement of the relative proton metabolite ratio between experimental brain contusion of ICR mouse and healthy control subjects. Results: After trauma, NAA/Cr ratio, as a neuronal marker decreased significantly versus controls, indicating neuronal loss. The ratio of NAA/Cr in traumatic brain contusions was 0.90 ± 0.11, while that in normal control subjects was 1.13 ± 0.12 (P = 0.001). The Cho/Cr ratio had a tendency to rise in experimental brain contusions (P = 0.02). The Cho/Cr ratio was 0.91 ± 0.17, while that of the normal control subjects was 0.76 ± 0.15. However, no significant difference of Glx/Cr was established between the experimental traumatic brain injury models and the normal controls. Discussion and conclusions: The present 1 H MRS study shows significant proton metabolic changes of parietal cortex with experimental brain contusions of ICR mouse induced by FPI compared to normal controls. In vivo 1 H MRS may be a useful modality for the clinical evaluation of traumatic contusions and could aid in better understanding the neuropathologic process of traumatic contusions induced by FPI

  5. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  6. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  7. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  8. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  9. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  10. Rectangular section shield driving method applying percussion action. Construction of passage to disabled person elevator in Ichigaya Station; Pakasshon sayo wo riyoshita kukei danmen shirudo seko. Ichigaya Eki shinshoshayo erebeta renraku tsuro secchiko

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, T. [Teito Rapid Transit Authority, Tokyo (Japan); Endo, M. [Obayashi Corp., Osaka (Japan)

    1996-02-25

    Section forms of the shield driving method are mostly circular. This paper reports the work of a rectangular section shield driving method applying percussion action. Percussion type shield machines are outlined first showing figures and a specification table. Then the outline and method of the work now done is described. The work report is stated under the following 5 headings: Driving time by means of percussion, Assembling time of rectangular segments, Effect of movable head slide jacks, Propelling while driving, and Condition of surfaces driven. From the result now worked, the initial intention of driving a free section short passage at a low cost is considered achieved. Lastly, 6 items are discussed for further improvements. The advantages of the method are stated to be a simple mechanism, an availability to various soil conditions, a low production cost, and etc. 14 figs., 2 tabs.

  11. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  12. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  13. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  14. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae

    Directory of Open Access Journals (Sweden)

    Denilce Meneses Lopes

    2010-01-01

    Full Text Available Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  15. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    Science.gov (United States)

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  16. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  17. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  18. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  19. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  20. Intrageneric Primer Design: Bringing Bioinformatics Tools to the Class

    Science.gov (United States)

    Lima, Andre O. S.; Garces, Sergio P. S.

    2006-01-01

    Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private…

  1. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    Science.gov (United States)

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  3. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  4. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  5. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  6. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  7. A group music intervention using percussion instruments with familiar music to reduce anxiety and agitation of institutionalized older adults with dementia.

    Science.gov (United States)

    Sung, Huei-chuan; Lee, Wen-li; Li, Tzai-li; Watson, Roger

    2012-06-01

    This experimental study aimed to evaluate the effects of a group music intervention on anxiety and agitation of institutionalized older adults with dementia. A total of 60 participants were randomly assigned to an experimental or a control group. The experimental group received a 30-min music intervention using percussion instruments with familiar music in a group setting in mid afternoon twice weekly for 6 weeks, whereas the control group received usual care with no music intervention. The Rating of Anxiety in Dementia scale was used to assess anxiety, and Cohen-Mansfield Agitation Inventory was used to assess agitation at baseline, week 4 and week 6. Repeated measures analysis of covariance indicated that older adults who received a group music intervention had a significantly lower anxiety score than those in the control group while controlling for pre-test score and cognitive level (F = 8.98, p = 0.004). However, the reduction of agitation between two groups was not significantly different. Anxiety and agitation are common in older adults with dementia and have been reported by caregivers as challenging care problems. An innovative group music intervention using percussion instruments with familiar music as a cost-effective approach has the potential to reduce anxiety and improve psychological well-being of those with dementia. Copyright © 2011 John Wiley & Sons, Ltd.

  8. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  9. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  10. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  11. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  12. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  13. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  14. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  15. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  16. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  17. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  18. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  19. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  20. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  1. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  2. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  3. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  4. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  5. 454-Pyrosequencing analysis of bacterial communities from autotrophic nitrogen removal bioreactors utilizing universal primers : Effect of annealing temperature

    NARCIS (Netherlands)

    Gonzalez-Martinez, A.; Rodriguez-Sanchez, A.; Rodelas, B.; Abbas, B.A.; Martinez-Toledo, M.V.; Van Loosdrecht, M.C.M.; Osorio, F.; Gonzalez-Lopez, J.

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S

  6. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

  7. Effects of propranolol and clonidine on brain edema, blood-brain barrier permeability, and endothelial glycocalyx disruption after fluid percussion brain injury in the rat

    DEFF Research Database (Denmark)

    Genét, Gustav Folmer; Bentzer, Peter; Hansen, Morten Bagge

    2018-01-01

    clonidine would decrease brain edema, blood-brain barrier permeability, and glycocalyx disruption at 24 hours after trauma. METHODS: We subjected 53 adult male Sprague-Dawley rats to lateral fluid percussion brain injury and randomized infusion with propranolol (n = 16), propranolol + clonidine (n = 16......), vehicle (n = 16), or sham (n = 5) for 24 hours. Primary outcome was brain water content at 24 hours. Secondary outcomes were blood-brain barrier permeability and plasma levels of syndecan-1 (glycocalyx disruption), cell damage (histone-complexed DNA fragments), epinephrine, norepinephrine, and animal.......555). We found no effect of propranolol and propranolol/clonidine on blood-brain barrier permeability and animal motor scores. Unexpectedly, propranolol and propranolol/clonidine caused an increase in epinephrine and syndecan-1 levels. CONCLUSION: This study does not provide any support for unselective...

  8. A degenerate primer MOB typing (DPMT method to classify gamma-proteobacterial plasmids in clinical and environmental settings.

    Directory of Open Access Journals (Sweden)

    Andrés Alvarado

    Full Text Available Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call "Degenerate Primer MOB Typing" or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type.

  9. PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

    Science.gov (United States)

    Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

    2013-01-01

    Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

  10. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  11. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  12. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  13. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  14. Diastolic timed Vibro-Percussion at 50 Hz delivered across a chest wall sized meat barrier enhances clot dissolution and remotely administered Streptokinase effectiveness in an in-vitro model of acute coronary thrombosis

    OpenAIRE

    Hoffmann, Andrew; Gill, Harjit

    2012-01-01

    Abstract Background Low Frequency Vibro-Percussion (LFVP) assists clearance of thrombi in catheter systems and when applied to the heart and timed to diastole is known to enhance coronary flow. However LFVP on a clotted coronary like vessel given engagement over a chest wall sized barrier (to resemble non-invasive heart attack therapy) requires study. Methods One hour old clots (n=16) were dispensed within a flexible segment of Soft-Flo catheter (4 mm lumen), weighted, interfaced with Heparin...

  15. Investment Primer for Green Revolving Funds

    Science.gov (United States)

    Weisbord, Dano

    2012-01-01

    Developing return-oriented green revolving funds (GRFs) is a rapidly growing trend at colleges and universities. A green revolving fund (GRF) is a special account designated for investment in on-campus projects that improve energy efficiency or decrease material use. GRFs invest in a variety of cost-saving initiatives, resulting in significant…

  16. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  17. Evaluation of the shear bond strength of lingual brackets manufactured by three different processes using two different adhesive primers: An in vitro study

    Directory of Open Access Journals (Sweden)

    Shrinivas Ashtekar

    2016-01-01

    Full Text Available Objective: To compare and evaluate the shear bond strength (SBS of lingual brackets, manufactured by three different processes, that is, laser sintering, milling, and casting, bonded with two different adhesive primers. Materials and Methods: One hundred and twenty premolars were selected, and three types of lingual brackets were used, namely, STB (milling, 7th Generation (casting, and lingualmatrix (laser sintering. Forty brackets per system were used half of which were sandblasted while the other half were used as available. Further, these were subdivided and bonded with Transbond XT primer and adhesive and 3M ESPE Primer and Transbond XT adhesive. Customization of STB and 7th Generation was done by Torque Angulation Reference Guide, Lingualmatrix had bases customized by Computer-aided design/computer-aided manufacturing. SBS was tested with universal testing machine and evaluated for adhesive remnant index (ARI. Results: Statistical analysis showed that surface treatment, use of different primers, method of customization influenced the SBS, and ARI suggested that the fracture occurred between composite and bracket interface. Conclusion: Lingualmatrix bracket showed greater SBS as compared to STB and 7th Generation, sandblasting increased SBS. 3M ESPE primer group showed increased SBS as that bonded with Transbond XT primer. The fracture was between the composite bracket interface.

  18. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  19. Oskarshamn site investigation. Hydrogeochemical monitoring programme for core and percussion drilled boreholes 2009. Summary of ground water chemistry results from spring and autumn sampling

    Energy Technology Data Exchange (ETDEWEB)

    Regander, Claes; Bergman, Bo (Sweco Environment AB (Sweden))

    2010-09-15

    This report summarises the results obtained in 2009 from the hydrogeochemical monitoring programme for core and percussion drilled boreholes. During 2009 groundwater sampling has been performed in monitored (permanently installed) boreholes in two sampling periods, spring (May-June), and autumn (October-November). Both in spring and autumn groundwater sampling was carried out in the following 12 sections; HLX28:2, HLX35:2, HLX37:1, HLX39:1, KLX08:4, KLX10:2, KLX10:5, KLX12A:2, KLX15A:3, KLX15A:6, KLX18A:3, KLX19A:3. The programme started in 2005 and since then water sampling has been performed twice every year. The objective of the hydrogeochemical monitoring programme is to determine the groundwater composition in selected sections chosen for this purpose. In 2009 the sampling of core drilled borehole sections has been conducted in time series, where each borehole section has been sampled at seven occasions. Percussion drilled borehole sections has been sampled at three occasions. The final sample in each section was taken when the electric conductivity had reached a stable level. Obtained results from the activities presented here include groundwater chemistry data in accordance with SKB chemistry class 5 including options and SKB chemistry reduced class 5. SKB chemistry reduced class 5 includes analysis of pH, electric conductivity, alkalinity, density, drill water (uranine), major cations (Chapter 5.4), F-, Br-, Cl-, SO{sub 4}2-, Fe(II)/Fe(tot), HS-, DOC, TOC and the isotopes delta2H, delta18O and 3H. Options for SKB chemistry class 5 include even lanthanoids and other trace elements, As, In, I, environmental metals, NH{sub 4}+, nutrient salts and the isotopes delta34S, delta37Cl, 87Sr/86Sr, 10B/11B, delta13C, 226Ra, 222Rn, 238U, 234U, 230Th and 232Th. All data from the activity are stored in the SICADA database

  20. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    products were gel-purified and ligated with pGEM-T easy vector (Promega, USA) and transformed into E. coli cells (Invitrogen, Carlsbad, CA), following the manufacturer’s instructions. Transformants were grown overnight at 37°C on Luria Bertani agar... using culture-independent approach by targeting universal 18S as well as fungal specific and universal ITS (internal transcribed spacers) regions of rRNA genes from three locations in the CIB. It is known that some of the primer pairs designed...

  1. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature.

    Science.gov (United States)

    Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Rodelas, Belén; Abbas, Ben A; Martinez-Toledo, Maria Victoria; van Loosdrecht, Mark C M; Osorio, F; Gonzalez-Lopez, Jesus

    2015-01-01

    Identification of anaerobic ammonium oxidizing (anammox) bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing) of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON) and three full-scale bioreactors (anammox, CANON, and DEMON), was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature). The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C) and hence a range of annealing temperatures of 44-49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  2. 454-Pyrosequencing Analysis of Bacterial Communities from Autotrophic Nitrogen Removal Bioreactors Utilizing Universal Primers: Effect of Annealing Temperature

    Directory of Open Access Journals (Sweden)

    Alejandro Gonzalez-Martinez

    2015-01-01

    Full Text Available Identification of anaerobic ammonium oxidizing (anammox bacteria by molecular tools aimed at the evaluation of bacterial diversity in autotrophic nitrogen removal systems is limited by the difficulty to design universal primers for the Bacteria domain able to amplify the anammox 16S rRNA genes. A metagenomic analysis (pyrosequencing of total bacterial diversity including anammox population in five autotrophic nitrogen removal technologies, two bench-scale models (MBR and Low Temperature CANON and three full-scale bioreactors (anammox, CANON, and DEMON, was successfully carried out by optimization of primer selection and PCR conditions (annealing temperature. The universal primer 530F was identified as the best candidate for total bacteria and anammox bacteria diversity coverage. Salt-adjusted optimum annealing temperature of primer 530F was calculated (47°C and hence a range of annealing temperatures of 44–49°C was tested. Pyrosequencing data showed that annealing temperature of 45°C yielded the best results in terms of species richness and diversity for all bioreactors analyzed.

  3. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  4. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  5. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  6. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  7. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  8. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  9. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  10. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  11. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  12. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  13. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  14. Development of degenerate and species-specific primers for the differential and simultaneous RT-PCR detection of grapevine-infecting nepoviruses of subgroups A, B and C.

    Science.gov (United States)

    Digiaro, Michele; Elbeaino, Toufic; Martelli, Giovanni Paolo

    2007-04-01

    Based on the nucleotide sequence homology of RNA-1 and RNA-2 of nepoviruses isolated from grapevines, three sets of degenerate primers, one for each of the three subgroups of the genus (A, B and C), were designed and proved effective for RT-PCR detection of subgroups in infected grapevines and herbaceous hosts. Primers designed specifically for detecting subgroup A species amplified a fragment of 255 bp from samples infected by Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Tobacco ringspot virus (TRSV) and Grapevine deformation virus (GDefV), but not from samples infected by other nepovirus species. Similarly, primers for detection of subgroup B nepoviruses amplified a 390 bp product from samples infected by Grapevine chrome mosaic virus (GCMV), Tomato black ring virus (TBRV), Grapevine Anatolian ringspot virus (GARSV) and Artichoke Italian latent virus (AILV). The third set of primers amplified a 640 bp fragment, only from samples infected by subgroup C nepoviruses, i.e Tomato ringspot virus (ToRSV) Grapevine Bulgarian latent virus (GBLV), and Grapevine Tunisian ringspot virus (GTRSV). These primers were able to detect simultaneously all viral species belonging to the same subgroup and to discriminate species of different subgroups. Multiplex-PCR detection of subgroup A and B nepoviruses was obtained using a specific primer (sense for subgroup A and antisense for subgroup B) for each of the species of the same subgroup in combination with the degenerate subgroup-specific primers. In this way it was possible to detect four different viral species in single samples containing mixtures of viruses of the same subgroup. In particular, for viruses of subgroup A (TRSV, GFLV, ArMV and GDefV) amplicons of 190, 259, 301 and 371 bp were obtained, whereas amplicons of 190, 278, 425 and 485 bp, respectively, were obtained from samples infected with viruses of subgroup B (GCMV, AILV, GARSV and TBRV).

  15. Novel acsF Gene Primers Revealed a Diverse Phototrophic Bacterial Population, Including Gemmatimonadetes, in Lake Taihu (China)

    DEFF Research Database (Denmark)

    Huang, Yili; Zeng, Yanhua; Lu, Hang

    2016-01-01

    Seq sequencing of the 16S rRNA, pufM, and bchY genes was carried out to assess the diversity of local phototrophic communities. In addition, we designed new degenerate primers of aerobic cyclase gene acsF, which serves as a convenient marker for both phototrophic Gemmatimonadetes and phototrophic Proteobacteria...... a diverse community of phototrophic Gemmatimonadetes forming 30 operational taxonomic units. These species represented 10.5 and 17.3% of the acsF reads in the upper semiaerobic sediment and anoxic sediment, whereas their abundance in the water column was ... fundamental biological processes on Earth. Recently, the presence of photosynthetic reaction centers has been reported from a rarely studied bacterial phylum, Gemmatimonadetes, but almost nothing is known about the diversity and environmental distribution of these organisms. The newly designed acsF primers...

  16. Hormonal emergency contraception: a clinical primer.

    Science.gov (United States)

    Ziebarth, Angela; Hansen, Keith A

    2007-03-01

    Unintended and teenage pregnancies are major public health concerns in the United States. Emergency contraception is used to prevent pregnancy after failure of a contraceptive method or after unprotected intercourse. Expanded use of emergency contraception has the potential to reduce unintended pregnancy and induced abortions, while reducing state and federal healthcare expenditures. The recent approval of Plan B as an over-the-counter medication for individuals over 18 years of age should improve access to this medication. However, there are still widespread misconceptions about the mechanisms and implications of emergency contraception. Expanded access to emergency contraception is associated with increased use, but not associated with decreased efficacy, increased sexual risk-taking behavior, or less consistent use of traditional birth control methods. This review is designed to provide clinicians with information regarding the use of emergency contraception for reproductive age patients. It includes a brief description of methods of use, mechanisms of action, and side effect profiles of the most commonly used methods of emergency contraception, levonorgestrel and the Yuzpe method.

  17. Cardiology office computer use: primer, pointers, pitfalls.

    Science.gov (United States)

    Shepard, R B; Blum, R I

    1986-10-01

    An office computer is a utility, like an automobile, with benefits and costs that are both direct and hidden and potential for disaster. For the cardiologist or cardiovascular surgeon, the increasing power and decreasing costs of computer hardware and the availability of software make use of an office computer system an increasingly attractive possibility. Management of office business functions is common; handling and scientific analysis of practice medical information are less common. The cardiologist can also access national medical information systems for literature searches and for interactive further education. Selection and testing of programs and the entire computer system before purchase of computer hardware will reduce the chances of disappointment or serious problems. Personnel pretraining and planning for office information flow and medical information security are necessary. Some cardiologists design their own office systems, buy hardware and software as needed, write programs for themselves and carry out the implementation themselves. For most cardiologists, the better course will be to take advantage of the professional experience of expert advisors. This article provides a starting point from which the practicing cardiologist can approach considering, specifying or implementing an office computer system for business functions and for scientific analysis of practice results.

  18. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  19. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  20. Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2012-03-01

    Full Text Available The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG4, (TCC5 and (CA7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi.

  1. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  2. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  3. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  4. Design

    DEFF Research Database (Denmark)

    Volf, Mette

    This publication is unique in its demystification and operationalization of the complex and elusive nature of the design process. The publication portrays the designer’s daily work and the creative process, which the designer is a part of. Apart from displaying the designer’s work methods...... and design parameters, the publication shows examples from renowned Danish design firms. Through these examples the reader gets an insight into the designer’s reality....

  5. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  9. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  10. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  11. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  12. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  13. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  14. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  15. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  16. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  17. Neuronal Cell Death Induced by Mechanical Percussion Trauma in Cultured Neurons is not Preceded by Alterations in Glucose, Lactate and Glutamine Metabolism.

    Science.gov (United States)

    Jayakumar, A R; Bak, L K; Rama Rao, K V; Waagepetersen, H S; Schousboe, A; Norenberg, M D

    2016-02-01

    Traumatic brain injury (TBI) is a devastating neurological disorder that usually presents in acute and chronic forms. Brain edema and associated increased intracranial pressure in the early phase following TBI are major consequences of acute trauma. On the other hand, neuronal injury, leading to neurobehavioral and cognitive impairments, that usually develop months to years after single or repetitive episodes of head trauma, are major consequences of chronic TBI. The molecular mechanisms responsible for TBI-induced injury, however, are unclear. Recent studies have suggested that early mitochondrial dysfunction and subsequent energy failure play a role in the pathogenesis of TBI. We therefore examined whether oxidative metabolism of (13)C-labeled glucose, lactate or glutamine is altered early following in vitro mechanical percussion-induced trauma (5 atm) to neurons (4-24 h), and whether such events contribute to the development of neuronal injury. Cell viability was assayed using the release of the cytoplasmic enzyme lactate dehydrogenase (LDH), together with fluorescence-based cell staining (calcein and ethidium homodimer-1 for live and dead cells, respectively). Trauma had no effect on the LDH release in neurons from 1 to 18 h. However, a significant increase in LDH release was detected at 24 h after trauma. Similar findings were identified when traumatized neurons were stained with fluorescent markers. Additionally (13)C-labeling of glutamate showed a small, but statistically significant decrease at 14 h after trauma. However, trauma had no effect on the cycling ratio of the TCA cycle at any time-period examined. These findings indicate that trauma does not cause a disturbance in oxidative metabolism of any of the substrates used for neurons. Accordingly, such metabolic disturbance does not appear to contribute to the neuronal death in the early stages following trauma.

  18. Designing motivation

    DEFF Research Database (Denmark)

    How can products be designed to change our habits for the better? What is some of the leading research that designers can draw on to create new systems that motivate people towards healthier behaviour? Designing Motivation is an edited collection of ‘industrialist cheat sheets’: 22 single......-page summaries of research articles relating to technology design, motivation, and behaviour change. Ranging across the fields of economics, sociology, design research and behavioural science, each summary draws out the design implications of the research. It is intended as a resource for designers who...... are grappling with how to create motivating products, and as a primer for students who want a brief introduction to some of the relevant theories, findings and design interventions in these fields. The editor's introduction raises a number of issues encountered when we try to apply behavioural research...

  19. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  20. An optoelectronic detecting based environment perception experiment for primer students using multiple-layer laser scanner

    Science.gov (United States)

    Wang, Shifeng; Wang, Rui; Zhang, Pengfei; Dai, Xiang; Gong, Dawei

    2017-08-01

    One of the motivations of OptoBot Lab is to train primer students into qualified engineers or researchers. The series training programs have been designed by supervisors and implemented with tutoring for students to test and practice their knowledge from textbooks. An environment perception experiment using a 32 layers laser scanner is described in this paper. The training program design and laboratory operation is introduced. The four parts of the experiments which are preparation, sensor calibration, 3D space reconstruction, and object recognition, are the participating students' main tasks for different teams. This entire program is one of the series training programs that play significant role in establishing solid research skill foundation for opto-electronic students.

  1. A primer on industrial ecosystems : a strategy for sustainable industrial development

    Energy Technology Data Exchange (ETDEWEB)

    Cote, R P [Dalhousie Univ., Halifax, NS (Canada). Eco-Efficiency Centre; [Dalhousie Univ., Halifax, NS (Canada). Faculty of Management, School for Resource and Environmental Studies

    2003-07-01

    Industrial ecology incorporates ecological theories, functions and limits into the design of industrial production systems, processes and products. The main objective is to enhance environmental and economic performance through collaboration in managing environmental resource issues such as energy, water and materials. Industrial ecology recognizes the connectedness and synergies of materials, products and infrastructure. As such, it considers the life cycle of products, the design of buildings, infrastructure and industrial parks. By working together, businesses gain a collective benefit which is greater than the total of the individual benefits each company could achieve on its own. Industrial ecology also considers the reuse, recovery and recycling of resources. The benefits include: efficiency of resource use; cost reduction for industrial infrastructure; sustainable development support; and, new opportunities in economic development, technology development, manufacturing, and business management. This primer also presents guidelines for win-win projects in industrial ecology. refs., figs.

  2. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  3. Identification of E. coli O157:H7 by Using Specific Primers for rfbE and stx2b Genes

    Directory of Open Access Journals (Sweden)

    Mostafa Bakhshi

    2017-07-01

    Sorbitol-MacConkey agar was used to verification of growth ability of selected colonies during PCR. Results: By appearance of the bonds belong to rfbE and stx2B genes on agarose gel, the ability of designed primers in gene detection in samples of E .coli O157:H7 was verified. Colonies which selected during PCR have growth potency on sorbitol-MacConkey agar medium. Conclusion: It was revealed that we can prepare a fast, precise and relative comfortable method for detection of E. coli O157:H7 strain by using PCR technique and specific primers than other available methods.

  4. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  5. Improved primer sequences for the mitochondrial ND1, ND3/4 and ND5/6 segments in salmonid fishes : application to RFLP analysis of Atlantic salmon

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Hansen, Michael Møller; Mensberg, Karen-Lise Dons

    1998-01-01

    New specific primers for the mtDNA segments ND1, ND3/4 and ND5/6 designed from the rainbow trout sequence, improved PCR amplification for salmonid fishes. RFLP analysis revealed restriction site variation for all three segments in Atlantic salmon. Eleven haplotypes were detected in a screening...

  6. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  7. APLIKASI ANIMASI INTERAKTIF PENCAMPURAN TIGA WARNA PRIMER DAN PENGENALAN BENTUK GEOMETRI PADA PAUD AL-MUSLIMUN

    Directory of Open Access Journals (Sweden)

    Mayya Nurbayanti Shobary

    2016-03-01

    Full Text Available Abstract - The development of Interactive animation application mixing three colors and introduction of geometric shapes for early childhood, aims to increase learning tool for parents and teachers to attract the attention of children to learn about colors and shapes using interactive animation application. Application built using the concept of PAUD Al-Muslimun in educating early childhood in knowing the result of mixing three primary colors and geometric shapes. The development of application take an example of how theachers in educating early childhood that began with the introduction of color and shapes, and practice how to mix the primary three colors, by showing interisting picture related to colors and shapes are introduced. Data collection methods used for this study is the direct observation of the teaching and learning activities from the perspective of teachers, children and parents to get an idea of the optimal design of an application built on. The development of Interactive animation application mixing three primary colors and introduction of geometric shapes for early childhood for early childhood through the five steps, analyzing, designing, implemeting, testing, and revision errors or shortfall. In this application there are learning processes knowing the primary color and introduction of geometric shapes with support interactive buttons, interesting picture and audio to enhance the absorption of early childhood to the contents of the material, learning and display concerned and to help parents or teachers role in educating children once more creative . Keywords: Applications, Animation, Interactive, Early Childhood Abstrak - Pembangunan aplikasi animasi interaktif pencampuran tiga warna primer dan pengenalan bentuk geometri untuk anak usia dini, bertujuan untuk menambah sarana pembelajaran untuk orang tua dan guru dalam menarik perhatian anak untuk belajar mengenal warna dan bentuk dengan menggunakan aplikasi animasi interaktif

  8. Construção de iniciadores e otimização de ensaios de PCR e de nested-PCR para a detecção específica de Tritrichomonas foetus Primers design and optimization of PCR and nested-PCR assays for the specific detection of Tritrichomonas foetus

    Directory of Open Access Journals (Sweden)

    Paula Rogério Fernandes

    2008-09-01

    Full Text Available Tritrichomonas foetus é um protozoário patogênico responsável por doença venérea em bovinos conhecida por tricomonose genital bovina. A tricomonose bovina é uma doença venérea causada pelo protozoário cujo habitat natural é o trato genital. Os protocolos já desenvolvidos para o diagnóstico deste parasito por PCR, apesar de serem eficazes na identificação do DNA genômico alvo, promovem algumas amplificações inespecíficas ou são incapazes de distinguir T. foetus das outras espécies do gênero. O presente trabalho foi desenvolvido com o objetivo de estabelecer e otimizar protocolos de ensaio de PCR e nested-PCR para o diagnóstico específico de T. foetus, empregando-se novos iniciadores, selecionados do alinhamento das seqüências dos genes 18S rRNA, 5,8S rRNA, 28S rRNA e dos espaços transcritos do rDNA (ITS1 e ITS2. Um par de iniciadores foi construído para amplificação gênero-específica de um fragmento de 648 pares de base e outros dois para a obtenção de produtos espécie- específicos de 343 e 429 pb. Nenhuma reação cruzada foi observada frente ao DNA genômico de Bos taurus ou de microrganismos responsáveis por infecções genitais. A sensibilidade dos ensaios de PCR e de nested-PCR apresentados neste estudo permitiu um limiar de detecção de até dois parasitos.Tritrichomonas foetus is a pathogenic protozoan that causes a venereal disease in cattle known as bovine genital tricomonosis. In spite of the efficacy to recognize the target genomic DNA, the protocols so far developed for the diagnosis of this organism by PCR promote some inespecific amplifications or they are unable to discriminate T. foetus against other species within the genus. The objective of this study was to assess and optimize PCR and nested-PCR assays for the specific diagnosis of T. foetus, using novel primers selected from the alignment of sequences of the genes 18S rRNA, 5.8S rRNA, 28S rRNA and of the internal transcribed spacers of the

  9. LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification DNA Signatures

    Directory of Open Access Journals (Sweden)

    Gardner Shea N

    2011-06-01

    Full Text Available Abstract Background We developed an extendable open-source Loop-mediated isothermal AMPlification (LAMP signature design program called LAVA (LAMP Assay Versatile Analysis. LAVA was created in response to limitations of existing LAMP signature programs. Results LAVA identifies combinations of six primer regions for basic LAMP signatures, or combinations of eight primer regions for LAMP signatures with loop primers, which can be used as LAMP signatures. The identified primers are conserved among target organism sequences. Primer combinations are optimized based on lengths, melting temperatures, and spacing among primer sites. We compare LAMP signature candidates for Staphylococcus aureus created both by LAVA and by PrimerExplorer. We also include signatures from a sample run targeting all strains of Mycobacterium tuberculosis. Conclusions We have designed and demonstrated new software for identifying signature candidates appropriate for LAMP assays. The software is available for download at http://lava-dna.googlecode.com/.

  10. Investigation on the Effects of Process Parameters on Laser Percussion Drilling Using Finite Element Methodology; Statistical Modelling and Optimization

    Directory of Open Access Journals (Sweden)

    Mahmoud Moradi

    Full Text Available Abstract In the present research, the simulation of the Nickel-base superalloy Inconel 718 fiber-laser drilling process with the thickness of 1mm is investigated through the Finite Element Method. In order to specify the appropriate Gaussian distribution of laser beam, the results of an experimental research on glass laser drilling were simulated using three types of Gaussian distribution. The DFLUX subroutine was used to implement the laser heat sources of the models using the Fortran language. After the appropriate Gaussian distribution was chosen, the model was validated with the experimental results of the Nickel-base superalloy Inconel 718 laser drilling process. The negligible error percentage among the experimental and simulation results demonstrates the high accuracy of this model. The experiments were performed based on the Response Surface Methodology (RSM as a statistical design of experiment (DOE approach to investigate the influence of process parameters on the responses, obtaining the mathematical regressions and predicting the new results. Four parameters i.e. laser pulse frequency (150 to 550 Hz, laser power (200 to 500 watts, laser focal plane position (-0.5 to +0.5 mm and the duty cycle (30 to 70% were considered to be the input variables in 5 levels and four external parameters i.e. the hole's entrance and exit diameters, hole taper angle and the weight of mass removed from the hole, were observed to be the process output responses of this central composite design. By performing the statistical analysis, the input and output parameters were found to have a direct relation with each other. By an increase in each of the input variables, the entrance and exit hole diameters, the hole taper angel, and the weight of mass removed from the hole increase. Finally, the results of the conducted simulations and statistical analyses having been used, the laser drilling process was optimized by means of the desire ability approach. Good

  11. Design

    DEFF Research Database (Denmark)

    Volf, Mette

    Design - proces & metode iBog®  er enestående i sit fokus på afmystificering og operationalisering af designprocessens flygtige og komplekse karakter. Udgivelsen går bag om designerens daglige arbejde og giver et indblik i den kreative skabelsesproces, som designeren er en del af. Udover et bredt...... indblik i designerens arbejdsmetoder og designparametre giver Design - proces & metode en række eksempler fra anerkendte designvirksomheder, der gør det muligt at komme helt tæt på designerens virkelighed....

  12. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  13. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  15. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  16. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  17. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  18. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  19. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  20. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  1. Design

    Science.gov (United States)

    Buchanan, Richard; Cross, Nigel; Durling, David; Nelson, Harold; Owen, Charles; Valtonen, Anna; Boling, Elizabeth; Gibbons, Andrew; Visscher-Voerman, Irene

    2013-01-01

    Scholars representing the field of design were asked to identify what they considered to be the most exciting and imaginative work currently being done in their field, as well as how that work might change our understanding. The scholars included Richard Buchanan, Nigel Cross, David Durling, Harold Nelson, Charles Owen, and Anna Valtonen. Scholars…

  2. Using social media to facilitate knowledge transfer in complex engineering environments: a primer for educators

    Science.gov (United States)

    Murphy, Glen; Salomone, Sonia

    2013-03-01

    While highly cohesive groups are potentially advantageous they are also often correlated with the emergence of knowledge and information silos based around those same functional or occupational clusters. Consequently, an essential challenge for engineering organisations wishing to overcome informational silos is to implement mechanisms that facilitate, encourage and sustain interactions between otherwise disconnected groups. This paper acts as a primer for those seeking to gain an understanding of the design, functionality and utility of a suite of software tools generically termed social media technologies in the context of optimising the management of tacit engineering knowledge. Underpinned by knowledge management theory and using detailed case examples, this paper explores how social media technologies achieve such goals, allowing for the transfer of knowledge by tapping into the tacit and explicit knowledge of disparate groups in complex engineering environments.

  3. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    Science.gov (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  4. Testing of Model Water Chiller System with Hidrokarbon as a Primer Refrigeran

    Directory of Open Access Journals (Sweden)

    Nengah Suarnadwipa

    2012-11-01

    Full Text Available Now days, there are two issues that give a negative impact on the environment due to the uses of synthetic refrigerant on therefrigeration system and air conditioning system. The first issue was the Ozon Layer Depletion and the second issue was theGlobal Warming. Regarding those condition, it will be investigated the design and examination of performance the use of thesplit type AC system as water chiller system and using hydrocarbon as a primer refrigerant. As a result, in the examination ofthe standard split type AC system using refrigerant R-22, it founded that the cooling rate of 1958 Watt and COP of 5.29.While the examination on the modified split type AC system into water chiller system using hydrocarbon (hycool 22, hasgiven cooling rate of 1832 Watt and COP of 4.19. Finally, it could be councluded that the split type AC system could be usedas water chiller system.

  5. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  6. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  7. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  8. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  9. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  10. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  11. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  12. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  13. Design

    DEFF Research Database (Denmark)

    Jensen, Ole B.; Pettiway, Keon

    2017-01-01

    In this chapter, Ole B. Jensen takes a situational approach to mobilities to examine how ordinary life activities are structured by technology and design. Using “staging mobilities” as a theoretical approach, Jensen considers mobilities as overlapping, actions, interactions and decisions by desig...... by providing ideas about future research for investigating mobilities in situ as a kind of “staging,” which he notes is influenced by the “material turn” in social sciences....... with a brief description of how movement is studied within social sciences after the “mobilities turn” versus the idea of physical movement in transport geography and engineering. He then explains how “mobilities design” was derived from connections between traffic and architecture. Jensen concludes...

  14. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  15. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  16. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  17. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  18. EFEKTIVITAS PEMBERIAN TERAPI MUSIK (MOZART DAN BACK EXERCISE TERHADAP PENURUNAN NYERI DYSMENORRHEA PRIMER

    Directory of Open Access Journals (Sweden)

    reni heryani

    2017-12-01

    Full Text Available Dysmenorrhea / nyeri haid adalah nyeri menjelang atau selama haid, yang kadang menyebabkan gangguan aktivitas dan memerlukan istirahat. Nyeri menstruasi atau dysmenorrhea adalah kekakuan atau kejang di bagian bawah perut akibat menstruasi dan produksi zat prostaglandin yang terjadi pada waktu menjelang atau selama menstruasi Dismenorea primer didefinisikan sebagai nyeri haid yang tidak berhubungan dengan kondisi patologis pelvis. Nyeri yang biasanya dirasakan adalah kram yang timbul-hilang atau nyeri yang terus menerus biasanya pada perut bagian bawah yang menjalar sampai ke punggung bagian bawah. Salah satu exercise yang dapat diberikan untuk nyeri dysmenorrhea  ini adalah dengan pemberian terapi musik dan back exercise.Tujuan penelitian ini adalah untuk mengetahui efektivitas pemberian terapi musik dan back exercise terhadap penurunan nyeri dysmenorrhea. Penelitian ini merupakan penelitian Quasi experimental pre and post test with control group design. Populasi pada penelitian ini adalah remaja putri yang sedang mengalami  menstruasi dengan  nyeri dysmenorrhea dengan jumlah responden sebanyak 50 orang yang dibagi menjadi 2 kelompok. Kelompok 1 sebagai kelompok eksperimen, diberikan perlakukan terapi musik (mozart dan back exercise  dan kelompok 2 sebagai kelompok kontrol yang tidak diberikan terapi musik (mozart dan back exercise. Pada penelitian ini menggunakan uji hipotesis Paired Sample T- test untuk mengetahui pengaruh pemberian terapi musik dan back exercice terhadap dysmenorrhea primer. Kemudian untuk uji beda pengaruh antara kelompok kontrol dan kelompok perlakuan digunakan uji Independent Sample T-test.Tingkat nyeri dismenorhoea sebelum diberikan perlakuan adalah nyeri tingkat sedang (rata-rata : 2,08 dan setelah diberikan perlakuan adalah adalah nyeri tingkat ringan (rata rata = 0,88. Uji efektifitas menggunakan Paired Sample T-Test pada kelompok eksperimen menunjukkan hasil p= 0,00 dan pada kelompok kontrol p= 0,00. Dengan

  19. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.

    Science.gov (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José

    2018-04-01

    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.

  20. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  1. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  2. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  3. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  4. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  5. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  6. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  7. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  8. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  9. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  10. The Influence of No-Primer Adhesives and Anchor Pylons Bracket Bases on Shear Bond Strength of Orthodontic Brackets

    Directory of Open Access Journals (Sweden)

    Andrea Scribante

    2013-01-01

    Full Text Available Objective. The aim of this study was to compare the shear bond strength (SBS and adhesive remnant index (ARI scores of no-primer adhesives tested with two different bracket bases. Materials and Methods. 120 bovine permanent mandibular incisors were divided into 6 groups of 20 specimens. Two brackets (ODP with different bracket bases (anchor pylons and 80-gauge mesh were bonded to the teeth using a conventional adhesive (Transbond XT and two different no-primer adhesive (Ortho Cem; Heliosit systems. Groups were tested using an instron universal testing machine. SBS values were recorded. ARI scores were measured. SEM microphotographs were taken to evaluate the pattern of bracket bases. Statistical analysis was performed. ANOVA and Tukey tests were carried out for SBS values, whereas a chi-squared test was applied for ARI scores. Results. Highest bond strength values were reported with Transbond XT (with both pad designs, Ortho Cem bonded on anchor pylons and Heliosit on 80-gauge mesh. A higher frequency of ARI score of “3” was reported for Transbond XT groups. Other groups showed a higher frequency of ARI score “2” and “1.” Conclusion. Transbond XT showed the highest shear bond strength values with both pad designs.

  11. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  12. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  13. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  14. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  15. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  16. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  17. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  18. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  19. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  20. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  1. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  2. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  3. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  4. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  5. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  6. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  7. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  8. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  9. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  10. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  11. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  12. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  13. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  14. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  15. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  16. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  17. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  18. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  19. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  20. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  1. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  2. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  3. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  4. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    Science.gov (United States)

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  5. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  6. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  7. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  8. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Quality assurance and quality control of geochemical data—A primer for the research scientist

    Science.gov (United States)

    Geboy, Nicholas J.; Engle, Mark A.

    2011-01-01

    Geochemistry is a constantly expanding science. More and more, scientists are employing geochemical tools to help answer questions about the Earth and earth system processes. Scientists may assume that the responsibility of examining and assessing the quality of the geochemical data they generate is not theirs but rather that of the analytical laboratories to which their samples have been submitted. This assumption may be partially based on knowledge about internal and external quality assurance and quality control (QA/QC) programs in which analytical laboratories typically participate. Or there may be a perceived lack of time or resources to adequately examine data quality. Regardless of the reason, the lack of QA/QC protocols can lead to the generation and publication of erroneous data. Because the interpretations drawn from the data are primary products to U.S. Geological Survey (USGS) stakeholders, the consequences of publishing erroneous results can be significant. The principal investigator of a scientific study ultimately is responsible for the quality and interpretation of the project's findings, and thus must also play a role in the understanding, implementation, and presentation of QA/QC information about the data. Although occasionally ignored, QA/QC protocols apply not only to procedures in the laboratory but also in the initial planning of a research study and throughout the life of the project. Many of the tenets of developing a sound QA/QC program or protocols also parallel the core concepts of developing a good study: What is the main objective of the study? Will the methods selected provide data of enough resolution to answer the hypothesis? How should samples be collected? Are there known or unknown artifacts or contamination sources in the sampling and analysis methods? Assessing data quality requires communication between the scientists responsible for designing the study and those collecting samples, analyzing samples, treating data, and

  10. Comparison between effectiveness of a low-viscosity glass ionomer and a resin-based glutaraldehyde containing primer in treating dentine hypersensitivity--a 25.2-month evaluation.

    NARCIS (Netherlands)

    Polderman, R.N.; Frencken, J.E.F.M.

    2007-01-01

    OBJECTIVES: The null-hypothesis tested was; there is no difference in effectiveness between a new low-viscosity glass ionomer and a resin-based glutaraldehyde containing primer in treating hypersensitive teeth after 2 years. METHODS: Using a split-mouth design, hypersensitive teeth in 14 adult

  11. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  12. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  13. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. Publicité alimentaire destinée aux enfants : examen de la portée de l’exposition, du pouvoir et des répercussions selon le contexte

    Directory of Open Access Journals (Sweden)

    Rachel Prowse

    2017-01-01

    Full Text Available Introduction : La publicité alimentaire a des répercussions sur les connaissances et les comportements alimentaires des enfants ainsi que sur leur santé. La réglementation actuelle au Canada est axée sur la restriction des aspects promotionnels de la publicité alimentaire, mais elle accorde peu d’attention, voire aucune, à l’endroit où se fait l’expérience alimentaire des enfants. Il est essentiel de comprendre où s’inscrit la publicité alimentaire dans le quotidien des enfants pour pouvoir les protéger. Notre étude fait état de la littérature sur la publicité alimentaire destinée aux enfants au Canada en fonction du contexte. Méthodologie : L’auteure a consulté des bases de données pour trouver des travaux de recherche canadiens portant sur l’exposition des enfants et des jeunes (de 2 à 17 ans à la publicité alimentaire, sur le pouvoir et les répercussions que celle-ci peut avoir sur les enfants dans différents contextes et sur la façon dont la réglementation actuelle peut en atténuer l'effet sur les enfants. Ont été sélectionnées les études en anglais, examinées par des pairs et publiées entre 2000 et 2016. Résultats : Vingt-cinq études se sont intéressées à l’exposition des enfants à la publicité alimentaire et au pouvoir ou aux répercussions qu’elle peut avoir sur ceux-ci à la maison (par la télévision ou Internet (n = 12, dans les écoles publiques (n = 1, dans les épiceries (n = 8, dans les restaurants rapides (n = 2 et en général (n = 2. Les tendances de la recherche révèlent que les aliments malsains ciblent les enfants par différentes techniques promotionnelles, qui se chevauchent selon les contextes. Il existe plusieurs lacunes en matière de recherche dans ce domaine, ce qui donne un portrait incomplet et potentiellement sous-estimé de la publicité alimentaire destinée aux enfants au Canada. Les données probantes disponibles indiquent que les approches canadiennes

  15. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  16. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  17. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  18. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  19. A comparative clinical study of the failure rate of orthodontic brackets bonded with two adhesive systems: conventional and self-etching primer (SEP).

    Science.gov (United States)

    Dominguez, Gladys Cristina; Tortamano, André; Lopes, Luiz Vicente de Moura; Catharino, Priscilla Campanatti Chibebe; Morea, Camillo

    2013-01-01

    This study compared the clinical performance of orthodontic brackets bonded with Transbond adhesive paste after two primer systems: a two-stage conventional system (acid etching + Transbond XT adhesive primer) and a single-stage self-etching primer (SEP) (Transbond Plus). The sample comprised 480 metal brackets bonded to the teeth of 24 consecutive patients treated for 36 to 48 months. A split-mouth design was used for bonding, and both systems were used in each patient. Bracket failure rates for each system were analyzed; and failure causes as reported by the patients and the quadrant of teeth for which brackets failed were recorded. The conventional system group had a failure rate of 5.41%, whereas the rate for SEP was 4.58%. In this group, there were 5 failures (38.4%) in the right maxillary quadrant, 2 (15.4%) in the left maxillary quadrant, 4 (30.8%) in the right mandibular quadrant, and 2 (15.4%) in the left mandibular quadrant. In the SEP group, there were 4 (36.4%) failures in the right maxillary quadrant, 1 (9%) in the left maxillary quadrant, 3 (27.3%) in the right mandibular quadrant, and 3 (27.3%) in the left mandibular quadrant. Results of descriptive statistical analysis and odds ratio did not show any significant differences between rates (p = 0.67). The clinical efficiency of SEP was similar to that of the conventional system.

  20. Novel genus-specific broad range primers for the detection of furoviruses, hordeiviruses and rymoviruses and their application in field surveys in South-East Australia.

    Science.gov (United States)

    Zheng, Linda; Tang, Joe; Clover, Gerard R G; Spackman, Merrin E; Freeman, Angela J; Rodoni, Brendan C

    2015-03-01

    A number of viruses from the genera Furovirus, Hordeivirus and Rymovirus are known to infect and damage the four major temperate cereal crops, wheat, barley, sorghum and oats. Currently, there is no active testing in Australia for any of these viruses, which pose a significant biosecurity threat to the phytosanitary status of Australia's grains industry. To address this, broad spectrum PCR assays were developed to target virus species within the genera Furovirus, Hordeivirus and Rymovirus. Five sets of novel genus-specific primers were designed and tested in reverse-transcription polymerase chain reaction assays against a range of virus isolates in plant virus diagnostic laboratories in both Australia and New Zealand. Three of these assays were then chosen to screen samples in a three-year survey of cereal crops in western Victoria, Australia. Of the 8900 cereal plants screened in the survey, all were tested free of furoviruses, hordeiviruses and rymoviruses. To date, there were no published genus-specific primers available for the detection of furoviruses, hordeiviruses and rymoviruses. This study shows for the first time a broad-spectrum molecular test being used in a survey for exotic grain viruses in Australia. Results from this survey provide important evidence of the use of this method to demonstrate the absence of these viruses in Victoria, Australia. The primer pairs reported here are expected to detect a wide range of virus species within the three genera. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  2. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    International Nuclear Information System (INIS)

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.

    2007-01-01

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased

  3. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  4. Diastolic timed Vibro-Percussion at 50 Hz delivered across a chest wall sized meat barrier enhances clot dissolution and remotely administered Streptokinase effectiveness in an in-vitro model of acute coronary thrombosis

    Directory of Open Access Journals (Sweden)

    Hoffmann Andrew

    2012-11-01

    Full Text Available Abstract Background Low Frequency Vibro-Percussion (LFVP assists clearance of thrombi in catheter systems and when applied to the heart and timed to diastole is known to enhance coronary flow. However LFVP on a clotted coronary like vessel given engagement over a chest wall sized barrier (to resemble non-invasive heart attack therapy requires study. Methods One hour old clots (n=16 were dispensed within a flexible segment of Soft-Flo catheter (4 mm lumen, weighted, interfaced with Heparinized Saline (HS, secured atop a curved dampening base, and photographed. A ~4 cm meat slab was placed over the segment and randomized to receive intermittent LFVP (engaged, - disengaged at 1 second intervals, or no LFVP for 20 minutes. HS was pulsed (~120/80 mmHg, with the diastolic phase coordinated to match LFVP delivery. The segment was then re-photographed and aspirated of fluid to determine post clot weight. The trial was then repeated with 0.5 mls of Streptokinase (15,000 IU/100 microlitre delivered ~ 2 cm upstream from the clot. Results LFVP - HS only samples (vs. controls showed; a development of clot length fluid channels absent in the control group (p Conclusion Diastolic timed LFVP (50 Hz engaged across a chest wall sized barrier enhances clot disruptive effects to an underlying coronary like system.

  5. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  6. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  7. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  8. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  10. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  11. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  12. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    Directory of Open Access Journals (Sweden)

    Assawamakin Anunchai

    2007-08-01

    Full Text Available Abstract Background Allele-specific (AS Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number

  13. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  14. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  15. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  16. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  17. An Introduction to Programming for Bioscientists: A Python-Based Primer.

    Directory of Open Access Journals (Sweden)

    Berk Ekmekci

    2016-06-01

    Full Text Available Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i its straightforward semantics and clean syntax make it a readily accessible first language; (ii it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.. This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.

  18. Measuring reporting verifying. A primer on MRV for nationally appropriate mitigation actions

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (ed.); Luetken, S.; Holm Olsen, K. (Technical Univ. of Denmark. UNEP Risoe Centre, Roskilde (Denmark)); Aalders, E.; Pretlove, B.; Peters, N. (Det Norske Veritas, Hellerup (Denmark))

    2012-03-15

    The requirements for measurement, reporting and verification (MRV) of nationally appropriate mitigation actions (NAMAs) are one of the crucial topics on the agenda of international negotiations to address climate change mitigation. According to agreements so far, the general guidelines for domestic MRV are to be developed by Subsidiary Body for Scientific and Technological Advice (SBSTA)1. Further, the Subsidiary Body for Implementation (SBI) will be conducting international consultations and analysis (ICA) of biennial update reports (BUR) to improve transparency of mitigation actions, which should be measured, reported and verified. 2. What is clear from undergoing discussions both at SBSTA and at SBI is that MRV for NAMAs should not be a burden for controlling greenhouse gas (GHG) emissions connected to economic activities. Instead, the MRV process should facilitate mitigation actions; encourage the redirection of investments and address concerns regarding carbon content of emission intensive operations of private and public companies and enterprises worldwide. While MRV requirements are being shaped within the Convention, there are a number of initiatives supporting developing countries moving forward with NAMA development and demonstration activities. How these actions shall be measured, reported and verified, however, remain unanswered. MRV is not new. It is present in most existing policies and frameworks related to climate change mitigation. With an aim to contribute to international debate and capacity building on this crucial issue, the UNEP Risoe Centre in cooperation with UNDP, are pleased to present this publication that through the direct collaboration with Det Norske Veritas (DNV) builds on existing MRV practices in current carbon markets; provides insights on how MRV for NAMAs can be performed and identifies elements and drivers to be considered when designing adequate MRV systems for NAMAs in developing countries. This primer is the second

  19. Stres Kerja pada Perawat di Rumah Sakit dan Fasilitas Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Herqutanto -

    2017-04-01

    Full Text Available Stres kerja berhubungan dengan kecelakaan, kekerasan di tempat kerja, organizational strain dalam bentuk absensi, penurunan performa kerja, peningkatan angka cedera dan turn-over karyawan. Perawat adalah profesi yang memiliki risiko tinggi terdampak stres kerja. Tujuan penelitian ini adalah mendapatkan angka stres kerja pada perawat di Indonesia dan faktor-faktor yang memengaruhinya menggunakan instrumen expanded nursing stress scale (ENSS versi Bahasa Indonesia. ENSS adalah instrumen penilaian stres yang dikhususkan bagi perawat dan telah diadaptasi sesuai dengan kondisi pekerjaan spesifik dan budaya Indonesia. Sebanyak 124 perawat direkrut, berasal dari rumah sakit dan beberapa fasilitas pelayanan kesehatan primer (FKTP. Semakin tinggi tingkat stres kerja yang dialami perawat, semakin tinggi nilai pengukuran. Tidak ditemukan hubungan antara karakteristik demografi dan tingkat stres di masing-masing subskala pada kedua kelompok responden.   Kata Kunci: Stres kerja, Perawat, ENSS versi Bahasa Indonesia     Job Stress in Nurses in Hospitals and Primary Health Care Facilities   Abstract Work stress is related to accidents, violence in the workplace, organizational strain in the form of absenteeism, decreased work performance, increased injury rates and employee turnover. Nurses are professionals who have high risks of occupational stress. The purpose of this study is to get the prevalens of work stress in nurses in Indonesia and the that influencing factors, using the instrument of ENSS Indonesian version. ENSS is an instrument of stress assessment specifically designed for nurses. ENSS has been adapted to the specific working conditions and culture of Indonesia. A total of 124 nurses were recruited, coming from hospitals and primary healthcare facilities. The higher the level of work stress experienced by nurses, the higher the value of measurement. No relationship was found between demographic characteristics and the level of stress in each

  20. An Introduction to Programming for Bioscientists: A Python-Based Primer.

    Science.gov (United States)

    Ekmekci, Berk; McAnany, Charles E; Mura, Cameron

    2016-06-01

    Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i) its straightforward semantics and clean syntax make it a readily accessible first language; (ii) it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii) the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.). This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.

  1. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  2. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  3. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  4. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  5. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  6. The Economics of Community College Labor Markets: A Primer

    Science.gov (United States)

    Kasper, Hirschel

    2009-01-01

    The community college has many roles and constituents: academic, professional, and vocational. Its curriculum may be distinguished from that of other institutions of higher education by its many courses designed to enhance students' immediate career opportunities, especially with nearby employers. This article focuses on the job markets for…

  7. Integrated STEM: A New Primer for Teaching Technology Education

    Science.gov (United States)

    Asunda, Paul A.; Mativo, John

    2017-01-01

    Part One of this article ("Technology and Engineering Teacher," 75(4), December/January, 2016) presented a process that science, math, engineering, and technology teachers could use to collaborate and design integrated STEM courses. A conceptual framework was discussed that could provide a premise that educators interested in delivery of…

  8. Communications Satellite Receiver Systems for Public Schools: A Technical Primer.

    Science.gov (United States)

    Texas Education Agency, Austin.

    Designed to aid school districts contemplating use of some of the telecommunications services now available by satellite, this document contains information on home satellite receiving dishes (Television Receive-Only--TVROs), which can receive radio signals carrying television, sound, and data. This information includes: some factors involved in…

  9. Yeast tRNAPhe expressed in human cells can be selected by HIV-1 for use as a reverse transcription primer

    International Nuclear Information System (INIS)

    Kelly, Nathan J.; Morrow, Casey D.

    2003-01-01

    All naturally occurring human immune deficiency viruses (HIV-1) select and use tRNA Lys,3 as the primer for reverse transcription. Studies to elucidate the mechanism of tRNA selection from the intracellular milieu have been hampered due to the difficulties in manipulating the endogenous levels of tRNA Lys,3 . We have previously described a mutant HIV-1 with a primer binding site (PBS) complementary to yeast tRNA Phe (psHIV-Phe) that relies on transfection of yeast tRNA Phe for infectivity. To more accurately recapitulate the selection process, a cDNA was designed for the intracellular expression of the yeast tRNA Phe . Increasing amounts of the plasmid encoding tRNA Phe resulted in a corresponding increase in levels of yeast tRNA Phe in the cell. The yeast tRNA Phe isolated from cells transfected with the cDNA for yeast tRNA Phe , or in the cell lines expressing yeast tRNA Phe , were aminoacylated, indicating that the expressed yeast tRNA Phe was incorporated into tRNA biogenesis pathways and translation. Increasing the cytoplasmic levels of tRNA Phe resulted in increased encapsidation of tRNA Phe in viruses with a PBS complementary to tRNA Phe (psHIV-Phe) or tRNA Lys,3 (wild-type HIV-1). Production of infectious psHIV-Phe was dependent on the amount of cotransfected tRNA Phe cDNA. Increasing amounts of plasmids encoding yeast tRNA Phe produced an increase of infectious psHIV-Phe that plateaued at a level lower than that from the transfection of the wild-type genome, which uses tRNA Lys,3 as the primer for reverse transcription. Cell lines were generated that expressed yeast tRNA Phe at levels approximately 0.1% of that for tRNA Lys,3 . Even with this reduced level of yeast tRNA Phe , the cell lines complemented psHIV-Phe over background levels. The results of these studies demonstrate that intracellular levels of primer tRNA can have a direct effect on HIV-1 infectivity and further support the role for PBS-tRNA complementarity in the primer selection process

  10. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  11. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  12. Planning your first wind power project. A primer for utilities: Everything you need to know to bring your first wind power plant on-line

    International Nuclear Information System (INIS)

    Conover, K.; Davis, E.

    1994-12-01

    This primer has been prepared to help utility personnel become familiar with some or the details relative to wind power technology and project development. It is written as a series of relatively independent chapters to address specific topics or phases of wind power evaluation and development as they might occur within a utility. The topics include: wind prospecting and the first pass analysis, resource validation, project feasibility, resource planning and evaluation, resource acquisition, project development, equipment selection, project design and construction, and plant operation and maintenance

  13. Differential equations a primer for scientists and engineers

    CERN Document Server

    Constanda, Christian

    2017-01-01

    This textbook is designed with the needs of today’s student in mind. It is the ideal textbook for a first course in elementary differential equations for future engineers and scientists, including mathematicians. This book is accessible to anyone who has a basic knowledge of precalculus algebra and differential and integral calculus. Its carefully crafted text adopts a concise, simple, no-frills approach to differential equations, which helps students acquire a solid experience in many classical solution techniques. With a lighter accent on the physical interpretation of the results, a more manageable page count than comparable texts, a highly readable style, and over 1000 exercises designed to be solved without a calculating device, this book emphasizes the understanding and practice of essential topics in a succinct yet fully rigorous fashion. Apart from several other enhancements, the second edition contains one new chapter on numerical methods of solution. The book formally splits the "pure" and "applie...

  14. A Statistical Primer: Understanding Descriptive and Inferential Statistics

    OpenAIRE

    Gillian Byrne

    2007-01-01

    As libraries and librarians move more towards evidence‐based decision making, the data being generated in libraries is growing. Understanding the basics of statistical analysis is crucial for evidence‐based practice (EBP), in order to correctly design and analyze researchas well as to evaluate the research of others. This article covers the fundamentals of descriptive and inferential statistics, from hypothesis construction to sampling to common statistical techniques including chi‐square, co...

  15. Nanosyntax: A short primer to a new approach to language

    Directory of Open Access Journals (Sweden)

    Michal Starke

    2010-01-01

    Full Text Available Nanosyntax is a new approach to the architecture of language, designed to make (better sense of the new empirical picture emerging from recent years of syntactic research. It is a large-scale project, addressing a wide array of issues, ranging from big issues such as the modularity of language, to fine details, such as the derivation of allomorphy in irregular patterns of given languages and its interaction with syntactic structures.

  16. Autonomous and Connected Vehicles: A Law Enforcement Primer

    Science.gov (United States)

    2015-12-01

    parallel or back-in parking in Toyota Prius vehicles is one example currently marketed and in operation in the United States.275 Testing is on-going...ownership in a connected environment.276 275 “All-New Third Generation Toyota Prius Raises the Bar for...design-patterns-and- operational-concepts-tasks-28-42-115/. Toyota . “All-New Third Generation Toyota Prius Raises the Bar for Hybrid Vehicles— Again

  17. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  18. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  19. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  20. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.