PCR Based Microbial Monitor for Analysis of Recycled Water Aboard the ISSA: Issues and Prospects
Cassell, Gail H.; Lefkowitz, Elliot J.; Glass, John I.
1995-01-01
The monitoring of spacecraft life support systems for the presence of health threatening microorganisms is paramount for crew well being and successful completion of missions. Development of technology to monitor spacecraft recycled water based on detection and identification of the genetic material of contaminating microorganisms and viruses would be a substantial improvement over current NASA plans to monitor recycled water samples that call for the use of conventional microbiology techniques which are slow, insensitive, and labor intensive. The union of the molecular biology techniques of DNA probe hybridization and polymerase chain reaction (PCR) offers a powerful method for the detection, identification, and quantification of microorganisms and viruses. This technology is theoretically capable of assaying samples in as little as two hours with specificity and sensitivity unmatched by any other method. A major advance in probe-hybridization/PCR has come about in a technology called TaqMan(TM), which was invented by Perkin Elmer. Instrumentation using TaqMan concepts is evolving towards devices that could meet NASA's needs of size, low power use, and simplicity of operation. The chemistry and molecular biology needed to utilize these probe-hybridization/PCR instruments must evolve in parallel with the hardware. The following issues of chemistry and biology must be addressed in developing a monitor: Early in the development of a PCR-based microbial monitor it will be necessary to decide how many and which organisms does the system need the capacity to detect. We propose a set of 17 different tests that would detect groups of bacteria and fungus, as well as specific eukaryotic parasites and viruses; In order to use the great sensitivity of PCR it will be necessary to concentrate water samples using filtration. If a lower limit of detection of 1 microorganism per 100 ml is required then the microbes in a 100 ml sample must be concentrated into a volume that can be
Interlaboratory diagnostic accuracy of a Salmonella specific PCR-based method
DEFF Research Database (Denmark)
Malorny, B.; Hoorfar, Jeffrey; Hugas, M.
2003-01-01
A collaborative study involving four European laboratories was conducted to investigate the diagnostic accuracy of a Salmonella specific PCR-based method, which was evaluated within the European FOOD-PCR project (http://www.pcr.dk). Each laboratory analysed by the PCR a set of independent obtained...... presumably naturally contaminated samples and compared the results with the microbiological culture method. The PCR-based method comprised a preenrichment step in buffered peptone water followed by a thermal cell lysis using a closed tube resin-based method. Artificially contaminated minced beef and whole......-based diagnostic methods and is currently proposed as international standard document....
Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.
2010-01-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602
Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M
2009-09-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.
A standard curve based method for relative real time PCR data processing
Directory of Open Access Journals (Sweden)
Krause Andreas
2005-03-01
Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that
Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J
2017-12-01
qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.
Longitudinal monitoring of bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR
Both veterinarians caring for bottlenose dolphins (Tursiops truncatus) in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin health. Quantitative PCR (qPCR) can be used to assess cytokine expression patterns of peripheral blood m...
Energy Technology Data Exchange (ETDEWEB)
Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com
2009-07-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.
2009-01-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F
2016-08-03
Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification
Blood grouping based on PCR methods and agarose gel electrophoresis.
Sell, Ana Maria; Visentainer, Jeane Eliete Laguila
2015-01-01
The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.
Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M
2005-01-01
We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.
Naddaf, S R; Kishdehi, M; Siavashi, Mr
2011-01-01
The mainstay of diagnosis of relapsing fever (RF) is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL) was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
DNA decontamination methods for internal quality management in clinical PCR laboratories.
Wu, Yingping; Wu, Jianyong; Zhang, Zhihui; Cheng, Chen
2018-03-01
The polymerase chain reaction (PCR) technique, one of the most commonly applied methods in diagnostic and molecular biology, has a frustrating downside: the occurrence of false-positive signals due to contamination. In previous research, various DNA decontamination methods have been developed to overcome this limitation. Unfortunately, the use of random or poorly focused sampling methods for monitoring air and/or object surfaces leads to the incomplete elimination during decontamination procedures. We herein attempted to develop a novel DNA decontamination method (environmental surveillance, including surface and air sampling) and quality management program for clinical molecular diagnostic laboratories (or clinical PCR laboratories). Here, we performed a step-by-step evaluation of current DNA decontamination methods and developed an effective procedure for assessing the presence of decontaminating DNA via PCR analysis. Performing targeted environmental surveillance by sampling, which reached optimal performance over 2 weeks, and the decontamination process had been verified as reliable. Additionally, the process was validated to not affect PCR amplification efficiency based on a comparative study. In this study, effective guidelines for DNA decontamination were developed. The method employed ensured that surface DNA contamination could be effectively identified and eliminated. Furthermore, our study highlighted the importance of overall quality assurance and good clinical laboratory practices for preventing contamination, which are key factors for compliance with regulatory or accreditation requirements. Taken together, we provided the evidence that the presented scheme ranged from troubleshooting to the elimination of surface contamination, could serve as critical foundation for developing regular environmental surveillance guidelines for PCR laboratories. © 2017 Wiley Periodicals, Inc.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.
Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro
2010-01-01
The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.
Directory of Open Access Journals (Sweden)
Kirill V Sergueev
Full Text Available BACKGROUND: Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. METHODOLOGY/PRINCIPAL FINDINGS: The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3 CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. CONCLUSIONS/SIGNIFICANCE: Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.
Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
Gyawali, P; Sidhu, J P S; Ahmed, W; Jagals, P; Toze, S
2017-06-01
Accurate quantitative measurement of viable hookworm ova from environmental samples is the key to controlling hookworm re-infections in the endemic regions. In this study, the accuracy of three quantitative detection methods [culture-based, vital stain and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR)] was evaluated by enumerating 1,000 ± 50 Ancylostoma caninum ova in the laboratory. The culture-based method was able to quantify an average of 397 ± 59 viable hookworm ova. Similarly, vital stain and PMA-qPCR methods quantified 644 ± 87 and 587 ± 91 viable ova, respectively. The numbers of viable ova estimated by the culture-based method were significantly (P methods. Therefore, both PMA-qPCR and vital stain methods appear to be suitable for the quantitative detection of viable hookworm ova. However, PMA-qPCR would be preferable over the vital stain method in scenarios where ova speciation is needed.
Boogert, van den P.H.J.F.; Gent-Pelzer, van M.P.E.; Bonants, P.J.M.; Boer, de S.H.; Wander, J.G.N.; Lévesque, C.A.; Leeuwen, van G.C.M.; Baayen, R.P.
2005-01-01
Abstract PCR-based methods were developed for the detection and quantification of the potato pathogen Synchytrium endobioticum in soil extracts and in planta. PCR primers, based on the internal transcribed spacer region of the multi-copy gene rDNA were tested for specificity, sensitivity and
Directory of Open Access Journals (Sweden)
Eduardo Larriba
2015-04-01
Full Text Available Aim of study: Orchidaceaehas the largest number of species of any family in the plant kingdom. This family is subject to a high risk of extinction in natural environments, such as natural parks and protected areas. Recent studies have shown the prevalence of many species of orchids to be linked to fungal soil diversity, due to their myco-heterotrophic behaviour. Plant communities determine fungal soil diversity, and both generate optimal conditions for orchid development. Area of study: The work was carried out in n the two most important natural parks in Alicante (Font Roja and Sierra Mariola, in South-eastern of Spain. Material and Methods: We designed a molecular tool to monitor the presence of Russula spp. in soil and orchids roots, combined with phytosociological methods. Main results: Using a PCR-based method, we detected the presence in the soil and Limodorum abortivum orchid roots of the mycorrhizal fungi Russula spp. The species with highest coverage was Quercus rotundifolia in areas where the orchid was present. Research highlights: We present a useful tool based on PCR to detect the presence of Russula spp. in a natural environment. These results are consistent with those obtained in different studies that linked the presence of the mycorrhizal fungi Russula spp. in roots of the species Limodorum and the interaction between these fungal species and Quercus ilex trees in Mediterranean forest environments.
Peed, Lindsay A; Nietch, Christopher T; Kelty, Catherine A; Meckes, Mark; Mooney, Thomas; Sivaganesan, Mano; Shanks, Orin C
2011-07-01
Diffuse sources of human fecal pollution allow for the direct discharge of waste into receiving waters with minimal or no treatment. Traditional culture-based methods are commonly used to characterize fecal pollution in ambient waters, however these methods do not discern between human and other animal sources of fecal pollution making it difficult to identify diffuse pollution sources. Human-associated quantitative real-time PCR (qPCR) methods in combination with low-order headwatershed sampling, precipitation information, and high-resolution geographic information system land use data can be useful for identifying diffuse source of human fecal pollution in receiving waters. To test this assertion, this study monitored nine headwatersheds over a two-year period potentially impacted by faulty septic systems and leaky sanitary sewer lines. Human fecal pollution was measured using three different human-associated qPCR methods and a positive significant correlation was seen between abundance of human-associated genetic markers and septic systems following wet weather events. In contrast, a negative correlation was observed with sanitary sewer line densities suggesting septic systems are the predominant diffuse source of human fecal pollution in the study area. These results demonstrate the advantages of combining water sampling, climate information, land-use computer-based modeling, and molecular biology disciplines to better characterize diffuse sources of human fecal pollution in environmental waters.
Vojkovska, H; Kubikova, I; Kralik, P
2015-03-01
Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes
2009-01-01
Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non
PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato
Directory of Open Access Journals (Sweden)
Dash Aditya P
2009-07-01
Full Text Available Abstract Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR, an Amplification Refractory Mutation System (ARMS and Primer Introduced Restriction Analysis-PCR (PIRA-PCR were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method
Lehle, Simon; Hildebrand, Dominic G.; Merz, Britta; Malak, Peter N.; Becker, Michael S.; Schmezer, Peter; Essmann, Frank; Schulze-Osthoff, Klaus; Rothfuss, Oliver
2014-01-01
DNA damage is tightly associated with various biological and pathological processes, such as aging and tumorigenesis. Although detection of DNA damage is attracting increasing attention, only a limited number of methods are available to quantify DNA lesions, and these techniques are tedious or only detect global DNA damage. In this study, we present a high-sensitivity long-run real-time PCR technique for DNA-damage quantification (LORD-Q) in both the mitochondrial and nuclear genome. While most conventional methods are of low-sensitivity or restricted to abundant mitochondrial DNA samples, we established a protocol that enables the accurate sequence-specific quantification of DNA damage in >3-kb probes for any mitochondrial or nuclear DNA sequence. In order to validate the sensitivity of this method, we compared LORD-Q with a previously published qPCR-based method and the standard single-cell gel electrophoresis assay, demonstrating a superior performance of LORD-Q. Exemplarily, we monitored induction of DNA damage and repair processes in human induced pluripotent stem cells and isogenic fibroblasts. Our results suggest that LORD-Q provides a sequence-specific and precise method to quantify DNA damage, thereby allowing the high-throughput assessment of DNA repair, genotoxicity screening and various other processes for a wide range of life science applications. PMID:24371283
de Oliveira, Valéria Maia; Manfio, Gilson Paulo; da Costa Coutinho, Heitor Luiz; Keijzer-Wolters, Anneke Christina; van Elsas, Jan Dirk
2006-03-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was followed by specific amplification of (1) sequences affiliated with Rhizobium leguminosarum "sensu lato" and (2) R. tropici. Using analysis of the amplified sequences in clone libraries obtained on the basis of soil DNA, this two-sided method was shown to be very specific for rhizobial subpopulations in soil. It was then further validated as a direct fingerprinting tool of the target rhizobia based on denaturing gradient gel electrophoresis (DGGE). The PCR-DGGE approach was applied to soils from fields in Brazil cultivated with common bean (Phaseolus vulgaris) under conventional or no-tillage practices. The community fingerprints obtained allowed the direct analysis of the respective rhizobial community structures in soil samples from the two contrasting agricultural practices. Data obtained with both primer sets revealed clustering of the community structures of the target rhizobial types along treatment. Moreover, the DGGE profiles obtained with the R. tropici primer set indicated that the abundance and diversity of these organisms were favoured under NT practices. These results suggest that the R. leguminosarum-as well as R. tropici-targeted IGS-based nested PCR and DGGE are useful tools for monitoring the effect of agricultural practices on these and related rhizobial subpopulations in soils.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy pr...
Specific PCR-based detection of Alternaria helianthi
DEFF Research Database (Denmark)
Udayashankar, A.C.; Nayaka, S. Chandra; Archana, B.
2012-01-01
Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method...... tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification...
Directory of Open Access Journals (Sweden)
S Farnia
2009-05-01
Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR methods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and referred to the Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic fragment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acanthamoeba strains."nResults: Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all prepared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.
Demeke, Tigst; Jenkins, G Ronald
2010-03-01
Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.
Usefulness of in-house PCR methods for hepatitis B virus DNA detection.
Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo
2015-10-01
The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.
Happyana, Nizar; Kayser, Oliver
2016-08-01
Cannabis sativa trichomes are glandular structures predominantly responsible for the biosynthesis of cannabinoids, the biologically active compounds unique to this plant. To the best of our knowledge, most metabolomic works on C. sativa that have been reported previously focused their investigations on the flowers and leaves of this plant. In this study, (1)H NMR-based metabolomics and real-time PCR analysis were applied for monitoring the metabolite profiles of C. sativa trichomes, variety Bediol, during the last 4 weeks of the flowering period. Partial least squares discriminant analysis models successfully classified metabolites of the trichomes based on the harvest time. Δ (9)-Tetrahydrocannabinolic acid (1) and cannabidiolic acid (2) constituted the vital differential components of the organic preparations, while asparagine, glutamine, fructose, and glucose proved to be their water-extracted counterparts. According to RT-PCR analysis, gene expression levels of olivetol synthase and olivetolic acid cyclase influenced the accumulation of cannabinoids in the Cannabis trichomes during the monitoring time. Moreover, quantitative (1)H NMR and RT-PCR analysis of the Cannabis trichomes suggested that the gene regulation of cannabinoid biosynthesis in the C. sativa variety Bediol is unique when compared with other C. sativa varieties. Georg Thieme Verlag KG Stuttgart · New York.
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana
2013-01-01
Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.
PCR IN TRAUMATOLOGY AND ORTHOPAEDICS: METHOD DESCRIPTION AND APPLICABILITY
Directory of Open Access Journals (Sweden)
E. M. Polyakova
2014-01-01
Full Text Available Review brief presents description of polymerase chain reaction method (PCR and its most common variants. Three PCR-based lines of research, carried out in the traumatology and orthopaedics, include identifying a causative agents of the implant-associated infection after orthopaedic surgery; detection of antibiotic resistance genes and biofilm forming genes. It was shown that PCR can be used as additional method for detection of genetic disorders, significant for traumatology and orthopaedics, and for investigation of cartilage and bone regeneration.
Efficacy of a novel PCR- and microarray-based method in diagnosis of a prosthetic joint infection
2014-01-01
Background and purpose Polymerase chain reaction (PCR) methods enable detection and species identification of many pathogens. We assessed the efficacy of a new PCR and microarray-based platform for detection of bacteria in prosthetic joint infections (PJIs). Methods This prospective study involved 61 suspected PJIs in hip and knee prostheses and 20 negative controls. 142 samples were analyzed by Prove-it Bone and Joint assay. The laboratory staff conducting the Prove-it analysis were not aware of the results of microbiological culture and clinical findings. The results of the analysis were compared with diagnosis of PJIs defined according to the Musculoskeletal Infection Society (MSIS) criteria and with the results of microbiological culture. Results 38 of 61 suspected PJIs met the definition of PJI according to the MSIS criteria. Of the 38 patients, the PCR detected bacteria in 31 whereas bacterial culture was positive in 28 patients. 15 of the PJI patients were undergoing antimicrobial treatment as the samples for analysis were obtained. When antimicrobial treatment had lasted 4 days or more, PCR detected bacteria in 6 of the 9 patients, but positive cultures were noted in only 2 of the 9 patients. All PCR results for the controls were negative. Of the 61 suspected PJIs, there were false-positive PCR results in 6 cases. Interpretation The Prove-it assay was helpful in PJI diagnostics during ongoing antimicrobial treatment. Without preceding treatment with antimicrobials, PCR and microarray-based assay did not appear to give any additional information over culture. PMID:24564748
Venema, K.; Maathuis, A.J.H.
2003-01-01
A polymerase chain reaction (PCR)-based method was developed for the identification of isolates of Bifidobacterium at the species level. Using two Bifidobacterium-specific primers directed against the 16S ribosomal gene (Bif164 and Bif662), a PCR product was obtained from the type strains of 12
Comparison of Nested-PCR technique and culture method in ...
African Journals Online (AJOL)
USER
2010-04-05
Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.
Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.
Jamjoom, Manal; Sultan, Amal H
2009-04-01
The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity
A number of PCR-based methods for detecting human fecal material in environmental waters have been developed over the past decade, but these methods have rarely received independent comparative testing. Here, we evaluated ten of these methods (BacH, BacHum-UCD, B. thetaiotaomic...
Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.
Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao
2012-01-21
To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.
Miller, D M; Dudley, E G; Roberts, R F
2012-09-01
Yogurt starter cultures may consist of multiple strains of Lactobacillus delbrueckii ssp. bulgaricus (LB) and Streptococcus thermophilus (ST). Conventional plating methods for monitoring LB and ST levels during yogurt manufacture do not allow for quantification of individual strains. The objective of the present work was to develop a quantitative PCR method for quantification of individual strains in a commercial yogurt starter culture. Strain-specific primers were designed for 2 ST strains (ST DGCC7796 and ST DGCC7710), 1 LB strain (DGCC4078), and 1 Lactobacillus delbrueckii ssp. lactis strain (LL; DGCC4550). Primers for the individual ST and LB strains were designed to target unique DNA sequences in clustered regularly interspersed short palindromic repeats. Primers for LL were designed to target a putative mannitol-specific IIbC component of the phosphotransferase system. Following evaluation of primer specificity, standard curves relating cell number to cycle threshold were prepared for each strain individually and in combination in yogurt mix, and no significant differences in the slopes were observed. Strain balance data was collected for yogurt prepared at 41 and 43°C to demonstrate the potential application of this method. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Development and validation of a Q-PCR based TCID50 method for human herpesvirus 6
Directory of Open Access Journals (Sweden)
Gustafsson Rasmus K L
2012-12-01
Full Text Available Abstract Background For titer assessment of human herpesvirus 6 (HHV-6, IFA targeting viral proteins or a TCID50 method with ocular inspection for CPE can be used. These methods rely on the subjective decision of the assessor, obstructing the ability to obtain unanimous results. Findings We have developed and validated an alternative TCID50 read-out approach where infection in the titration culture plate is assessed by viral DNA load change by quantitative PCR. A ten time increase in viral DNA load was determined as cut point for infection since that yielded a maximum correlation with viral protein expression (93%. The average intra-assay CV was 9% for quantitative PCR read-out of TCID50 compared to 45% for ocular inspection read-out of TCID50, 14% for IFA read-out of TCID50, and 43% for an infectious units approach using IFA. The average inter-assay CV for quantitative PCR read-out of TCID50 was 73%, compared to 66%, 25% and 77% for the ocular inspection read-out for TCID50, IFA read-out of TCID50 and infectious unit approaches respectively. Conclusions The quantitative PCR based read-out of TCID50 proved to be more robust and easier to interpret than traditional TCID50 assessment approaches for HHV-6, and therefore it might be considered as an alternative method.
[A new method of processing quantitative PCR data].
Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun
2003-05-01
Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.
Zhan, Fangfang; Zhou, Xiaoming
2012-12-01
Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.
Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane
2012-02-01
Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.
Wang, Wen-Jun; Zheng, Chao-Feng; Liu, Zhuang; Tan, Yan-Hong; Chen, Xiu-Hua; Zhao, Bin-Liang; Li, Guo-Xia; Xu, Zhi-Fang; Ren, Fang-Gang; Zhang, Yao-Fang; Chang, Jian-Mei; Wang, Hong-Wei
2018-04-25
The present study intended to establish a droplet digital PCR (dd-PCR) for monitoring minimal residual disease (MRD) in patients with BCR/ABL (P210)-positive CML, thereby achieving deep-level monitoring of tumor load and determining the efficacy for guided clinically individualized treatment. Using dd-PCR and RT-qPCR, two cell suspensions were obtained from K562 cells and normal peripheral blood mononuclear cells by gradient dilution and were measured at the cellular level. At peripheral blood(PB) level, 61 cases with CML-chronic phase (CML-CP) were obtained after tyrosine kinase inhibitors (TKIs) treatment and regular follow-ups. By RT-qPCR, BCR/ABL (P210) fusion gene was undetectable in PB after three successive analyses, which were performed once every three months. At the same time, dd-PCR was performed simultaneously with the last equal amount of cDNA. Ten CML patients with MR4.5 were followed up by the two methods. At the cellular level, consistency of results of dd-PCR and RT-qPCR reached R 2 ≥0.99, with conversion equation of Y=33.148X 1.222 (Y: dd-PCR results; X: RT-qPCR results). In the dd-PCR test, 11 of the 61 CML patients (18.03%) tested positive and showed statistically significant difference (PPCR 3 months earlier than by RT-qPCR. In contrast with RT-qPCR, dd-PCR is more sensitive, thus enabling accurate conversion of dd-PCR results into internationally standard RT-qPCR results by conversion equation, to achieve a deeper molecular biology-based stratification of BCR/ABL(P210) MRD. It has some reference value to monitor disease progression in clinic. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
A multiplex PCR method for rapid identification of Brachionus rotifers.
Vasileiadou, Kalliopi; Papakostas, Spiros; Triantafyllidis, Alexander; Kappas, Ilias; Abatzopoulos, Theodore J
2009-01-01
Cryptic species are increasingly being recognized in many organisms. In Brachionus rotifers, many morphologically similar yet genetically distinct species/biotypes have been described. A number of Brachionus cryptic species have been recognized among hatchery strains. In this study, we present a simple, one-step genetic method to detect the presence of those Brachionus sp. rotifers that have been found in hatcheries. With the proposed technique, each of the B. plicatilis sensu stricto, B. ibericus, Brachionus sp. Nevada, Brachionus sp. Austria, Brachionus sp. Manjavacas, and Brachionus sp. Cayman species and/or biotypes can be identified with polymerase chain reaction (PCR) analysis. Based on 233 cytochrome c oxidase subunit I sequences, we reviewed all the available cryptic Brachionus sp. genetic polymorphisms, and we designed six nested primers. With these primers, a specific amplicon of distinct size is produced for every one of the involved species/biotypes. Two highly sensitive protocols were developed for using the primers. Many of the primers can be combined in the same PCR. The proposed method has been found to be an effective and practical tool to investigate the presence of the above six cryptic species/biotypes in both individual and communal (bulk) rotifer deoxyribonucleic acid extractions from hatcheries. With this technique, hatchery managers could easily determine their rotifer composition at the level of cryptic species and monitor their cultures more efficiently.
Directory of Open Access Journals (Sweden)
Mojtaba Tahmoorespur
2016-04-01
Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio
Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S
2018-01-01
The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.
Real-time water quality monitoring at a Great Lakes National Park
Byappanahalli, Muruleedhara; Nevers, Meredith; Shively, Dawn; Spoljaric, Ashley; Otto, Christopher
2018-01-01
Quantitative polymerase chain reaction (qPCR) was used by the USEPA to establish new recreational water quality criteria in 2012 using the indicator bacteria enterococci. The application of this method has been limited, but resource managers are interested in more timely monitoring results. In this study, we evaluated the efficacy of qPCR as a rapid, alternative method to the time-consuming membrane filtration (MF) method for monitoring water at select beaches and rivers of Sleeping Bear Dunes National Lakeshore in Empire, MI. Water samples were collected from four locations (Esch Road Beach, Otter Creek, Platte Point Bay, and Platte River outlet) in 2014 and analyzed for culture-based (MF) and non-culture-based (i.e., qPCR) endpoints using Escherichia coli and enterococci bacteria. The MF and qPCR enterococci results were significantly, positively correlated overall (r = 0.686, p Water quality standard exceedances based on enterococci levels by qPCR were lower than by MF method: 3 and 16, respectively. Based on our findings, we conclude that qPCR may be a viable alternative to the culture-based method for monitoring water quality on public lands. Rapid, same-day results are achievable by the qPCR method, which greatly improves protection of the public from water-related illnesses.
Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR
Eberle, Kirsten C.; Venn-Watson, Stephanie K.; Jensen, Eric D.; Porter, Tracy J.; Waters, Theresa E.; Sacco, Randy E.
2017-01-01
Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus) health. Quantitative PCR (qPCR) can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC). This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL) and concanavalin A (1 μg/mL) for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α). Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies. PMID:29272269
Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR.
Directory of Open Access Journals (Sweden)
Amelia Ruth Hofstetter
Full Text Available Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus health. Quantitative PCR (qPCR can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC. This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL and concanavalin A (1 μg/mL for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α. Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies.
da Fonseca, Allex Jardim; Galvão, Renata Silva; Miranda, Angelica Espinosa; Ferreira, Luiz Carlos de Lima; Chen, Zigui
2016-05-01
To compare the diagnostic performance for HPV infection using three laboratorial techniques. Ninty-five cervicovaginal samples were randomly selected; each was tested for HPV DNA and genotypes using 3 methods in parallel: Multiplex-PCR, the Nested PCR followed by Sanger sequencing, and the Next_Gen Sequencing (NGS) with two assays (NGS-A1, NGS-A2). The study was approved by the Brazilian National IRB (CONEP protocol 16,800). The prevalence of HPV by the NGS assays was higher than that using the Multiplex-PCR (64.2% vs. 45.2%, respectively; P = 0.001) and the Nested-PCR (64.2% vs. 49.5%, respectively; P = 0.003). NGS also showed better performance in detecting high-risk HPV (HR-HPV) and HPV16. There was a weak interobservers agreement between the results of Multiplex-PCR and Nested-PCR in relation to NGS for the diagnosis of HPV infection, and a moderate correlation for HR-HPV detection. Both NGS assays showed a strong correlation for detection of HPVs (k = 0.86), HR-HPVs (k = 0.91), HPV16 (k = 0.92) and HPV18 (k = 0.91). NGS is more sensitive than the traditional Sanger sequencing and the Multiplex PCR to genotype HPVs, with promising ability to detect multiple infections, and may have the potential to establish an alternative method for the diagnosis and genotyping of HPV. © 2015 Wiley Periodicals, Inc.
Wang, Chao; Dong, Dong; Wang, Guangce; Zhang, Baoyu; Peng, Guang; Xu, Pu; Tang, Xiaorong
2009-09-01
An improved method of PCR in which the small segment of conchocelis is amplified directly without DNA extraction was used to amplify a RUBISCO intergenic spacer DNA fragment from nine species of red algal genus Porphyra (Bangiales, Rhodophyta), including Porphyra yezoensis (Jiangsu, China), P. haitanensis (Fujian, China), P. oligospermatangia (Qingdao, China), P. katadai (Qingdao, China), P. tenera (Qingdao, China), P. suborboculata (Fujian, China), P. pseudolinearis (Kogendo, Korea), P. linearis (Devon, England), and P. fallax (Seattle, USA). Standard PCR and the method developed here were both conducted using primers specific for the RUBISCO spacer region, after which the two PCR products were sequenced. The sequencing data of the amplicons obtained using both methods were identical, suggesting that the improved PCR method was functional. These findings indicate that the method developed here may be useful for the rapid identification of species of Porphyra in a germplasm bank. In addition, a phylogenetic tree was constructed using the RUBISCO spacer and partial rbcS sequence, and the results were in concordant with possible alternative phylogenies based on traditional morphological taxonomic characteristics, indicating that the RUBISCO spacer is a useful region for phylogenetic studies.
Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella
2009-01-01
Background One of the major sources of human Salmonella infections is meat. Therefore, efficient and rapid monitoring of Salmonella in the meat production chain is necessary. Validation of alternative methods is needed to prove that the performance is equal to established methods. Very few of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non-commercial real-time PCR method for detection of Salmonella in meat and carcass swabs. Results The comparative trial was performed against a reference method (NMKL-71:5, 1999) using artificially and naturally contaminated samples (60 minced veal and pork meat samples, 60 poultry neck-skins, and 120 pig carcass swabs). The relative accuracy was 99%, relative detection level 100%, relative sensitivity 103% and relative specificity 100%. The collaborative trial included six laboratories testing minced meat, poultry neck-skins, and carcass swabs as un-inoculated samples and samples artificially contaminated with 1–10 CFU/25 g, and 10–100 CFU/25 g. Valid results were obtained from five of the laboratories and used for the statistical analysis. Apart from one of the non-inoculated samples being false positive with PCR for one of the laboratories, no false positive or false negative results were reported. Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion The real-time PCR method for detection of Salmonella in meat
Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni
2017-09-01
Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.
Transgene detection by digital droplet PCR.
Directory of Open Access Journals (Sweden)
Dirk A Moser
Full Text Available Somatic gene therapy is a promising tool for the treatment of severe diseases. Because of its abuse potential for performance enhancement in sports, the World Anti-Doping Agency (WADA included the term 'gene doping' in the official list of banned substances and methods in 2004. Several nested PCR or qPCR-based strategies have been proposed that aim at detecting long-term presence of transgene in blood, but these strategies are hampered by technical limitations. We developed a digital droplet PCR (ddPCR protocol for Insulin-Like Growth Factor 1 (IGF1 detection and demonstrated its applicability monitoring 6 mice injected into skeletal muscle with AAV9-IGF1 elements and 2 controls over a 33-day period. A duplex ddPCR protocol for simultaneous detection of Insulin-Like Growth Factor 1 (IGF1 and Erythropoietin (EPO transgenic elements was created. A new DNA extraction procedure with target-orientated usage of restriction enzymes including on-column DNA-digestion was established. In vivo data revealed that IGF1 transgenic elements could be reliably detected for a 33-day period in DNA extracted from whole blood. In vitro data indicated feasibility of IGF1 and EPO detection by duplex ddPCR with high reliability and sensitivity. On-column DNA-digestion allowed for significantly improved target detection in downstream PCR-based approaches. As ddPCR provides absolute quantification, it ensures excellent day-to-day reproducibility. Therefore, we expect this technique to be used in diagnosing and monitoring of viral and bacterial infection, in detecting mutated DNA sequences as well as profiling for the presence of foreign genetic material in elite athletes in the future.
Noguchi, Akio; Nakamura, Kosuke; Sakata, Kozue; Sato-Fukuda, Nozomi; Ishigaki, Takumi; Mano, Junichi; Takabatake, Reona; Kitta, Kazumi; Teshima, Reiko; Kondo, Kazunari; Nishimaki-Mogami, Tomoko
2016-04-19
A number of genetically modified (GM) maize events have been developed and approved worldwide for commercial cultivation. A screening method is needed to monitor GM maize approved for commercialization in countries that mandate the labeling of foods containing a specified threshold level of GM crops. In Japan, a screening method has been implemented to monitor approved GM maize since 2001. However, the screening method currently used in Japan is time-consuming and requires generation of a calibration curve and experimental conversion factor (C(f)) value. We developed a simple screening method that avoids the need for a calibration curve and C(f) value. In this method, ΔC(q) values between the target sequences and the endogenous gene are calculated using multiplex real-time PCR, and the ΔΔC(q) value between the analytical and control samples is used as the criterion for determining analytical samples in which the GM organism content is below the threshold level for labeling of GM crops. An interlaboratory study indicated that the method is applicable independently with at least two models of PCR instruments used in this study.
A novel PCR-based method to enumerate Salmonella in animal feed
DEFF Research Database (Denmark)
Löfström, Charlotta; Andersson, Gunnar; Häggblom, Per
2010-01-01
and pellets) only three gave results that differed between the PCR and MSRV methods. Ct values for naturally contaminated samples were higher compared to samples artificially contaminated with low numbers (approx. 2 CFU/25 g feed) of stressed Salmonella. To allow quantification of low numbers of Salmonella...
Park, Eunyoung; Lee, Cheonghoon; Bisesi, Michael; Lee, Jiyoung
2014-03-01
The disinfection efficiency of peracetic acid (PAA) was investigated on three microbial types using three different methods (filtration-based ATP (adenosine-triphosphate) bioluminescence, quantitative polymerase chain reaction (qPCR), culture-based method). Fecal indicator bacteria (Enterococcus faecium), virus indicator (male-specific (F(+)) coliphages (coliphages)), and protozoa disinfection surrogate (Bacillus subtilis spores (spores)) were tested. The mode of action for spore disinfection was visualized using scanning electron microscopy. The results indicated that PAA concentrations of 5 ppm (contact time: 5 min), 50 ppm (10 min), and 3,000 ppm (5 min) were needed to achieve 3-log reduction of E. faecium, coliphages, and spores, respectively. Scanning electron microscopy observation showed that PAA targets the external layers of spores. The lower reduction rates of tested microbes measured with qPCR suggest that qPCR may overestimate the surviving microbes. Collectively, PAA showed broad disinfection efficiency (susceptibility: E. faecium > coliphages > spores). For E. faecium and spores, ATP bioluminescence was substantially faster (∼5 min) than culture-based method (>24 h) and qPCR (2-3 h). This study suggests PAA as an effective alternative to inactivate broad types of microbial contaminants in water. Together with the use of rapid detection methods, this approach can be useful for urgent situations when timely response is needed for ensuring water quality.
Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro
2016-09-01
Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.
Touron-Bodilis, A; Pougnard, C; Frenkiel-Lebossé, H; Hallier-Soulier, S
2011-08-01
This study was designed to evaluate the usefulness of quantification by real-time PCR as a management tool to monitor concentrations of Legionella spp. and Legionella pneumophila in industrial cooling systems and its ability to anticipate culture trends by the French standard method (AFNOR T90-431). Quantifications of Legionella bacteria were achieved by both methods on samples from nine cooling systems with different water qualities. Proportion of positive samples for L. pneumophila quantified by PCR was clearly lower in deionized or river waters submitted to a biocide treatment than in raw river waters, while positive samples for Legionella spp. were quantified for almost all the samples. For some samples containing PCR inhibitors, high quantification limits (up to 4·80 × 10(5) GU l(-1) ) did not allow us to quantify L. pneumophila, when they were quantified by culture. Finally, the monitoring of concentrations of L. pneumophila by both methods showed similar trends for 57-100% of the samples. These results suggest that, if some methodological steps designed to reduce inhibitory problems and thus decrease the quantification limits, could be developed to quantify Legionella in complex waters, the real-time PCR could be a valuable complementary tool to monitor the evolution of L. pneumophila concentrations. This study shows the possibility of using real-time PCR to monitor L. pneumophila proliferations in cooling systems and the importance to adapt nucleic acid extraction and purification protocols to raw waters. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology. No claim to French Government works.
DEFF Research Database (Denmark)
Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina
2013-01-01
in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
A rapid method for screening arrayed plasmid cDNA library by PCR
International Nuclear Information System (INIS)
Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong
1999-01-01
Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency
Opota, Onya; Brouillet, René; Greub, Gilbert; Jaton, Katia
2017-01-01
The advances in molecular biology of the last decades have dramatically improved the field of diagnostic bacteriology. In particular, PCR-based technologies have impacted the diagnosis of infections caused by obligate intracellular bacteria such as pathogens from the Chlamydiacae family. Here, we describe a real-time PCR-based method using the Taqman technology for the diagnosis of Chlamydia pneumoniae, Chlamydia psittaci, and Chlamydia abortus infection. The method presented here can be applied to various clinical samples and can be adapted on opened molecular diagnostic platforms.
Internal quality control of PCR-based genotyping methods
DEFF Research Database (Denmark)
Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen
2002-01-01
Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Directory of Open Access Journals (Sweden)
Burgos Lorenzo
2010-07-01
Full Text Available Abstract Background The routine generation of transgenic plants involves analysis of transgene integration into the host genome by means of Southern blotting. However, this technique cannot distinguish between uniformly transformed tissues and the presence of a mixture of transgenic and non-transgenic cells in the same tissue. On the other hand, the use of reporter genes often fails to accurately detect chimerical tissues because their expression can be affected by several factors, including gene silencing and plant development. So, new approaches based on the quantification of the amount of the transgene are needed urgently. Results We show here that chimeras are a very frequent phenomenon observed after regenerating transgenic plants. Spatial and temporal analyses of transformed tobacco and apricot plants with a quantitative, real-time PCR amplification of the neomycin phosphotransferase (nptII transgene as well as of an internal control (β-actin, used to normalise the amount of target DNA at each reaction, allowed detection of chimeras at unexpected rates. The amount of the nptII transgene differed greatly along with the sub-cultivation period of these plants and was dependent on the localisation of the analysed leaves; being higher in roots and basal leaves, while in the apical leaves it remained at lower levels. These data demonstrate that, unlike the use of the gus marker gene, real-time PCR is a powerful tool for detection of chimeras. Although some authors have proposed a consistent, positive Southern analysis as an alternative methodology for monitoring the dissociation of chimeras, our data show that it does not provide enough proof of uniform transformation. In this work, however, real-time PCR was applied successfully to monitor the dissociation of chimeras in tobacco plants and apricot callus. Conclusions We have developed a rapid and reliable method to detect and estimate the level of chimeras in transgenic tobacco and apricot
Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag
2018-03-05
The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.
Qin, T; Zhou, H; Ren, H; Shi, W; Jin, H; Jiang, X; Xu, Y; Zhou, M; Li, J; Wang, J; Shao, Z; Xu, X
2016-07-01
Legionnaires' disease (LD) is a globally distributed systemic infectious disease. The burden of LD in many regions is still unclear, especially in Asian countries including China. A survey of Legionella infection using real-time PCR and nested sequence-based typing (SBT) was performed in two hospitals in Shanghai, China. A total of 265 bronchoalveolar lavage fluid (BALF) specimens were collected from hospital A between January 2012 and December 2013, and 359 sputum specimens were collected from hospital B throughout 2012. A total of 71 specimens were positive for Legionella according to real-time PCR focusing on the 5S rRNA gene. Seventy of these specimens were identified as Legionella pneumophila as a result of real-time PCR amplification of the dotA gene. Results of nested SBT revealed high genetic polymorphism in these L. pneumophila and ST1 was the predominant sequence type. These data revealed that the burden of LD in China is much greater than that recognized previously, and real-time PCR may be a suitable monitoring technology for LD in large sample surveys in regions lacking the economic and technical resources to perform other methods, such as urinary antigen tests and culture methods.
Tuomi, Jari Michael; Voorbraak, Frans; Jones, Douglas L.; Ruijter, Jan M.
2010-01-01
For real-time monitoring of PCR amplification of DNA, quantitative PCR (qPCR) assays use various fluorescent reporters. DNA binding molecules and hybridization reporters (primers and probes) only fluoresce when bound to DNA and result in the non-cumulative increase in observed fluorescence.
DEFF Research Database (Denmark)
Josefsen, Mathilde Hartmann; Cook, N.; D'Agostino, M.
2004-01-01
A PCR-based method for rapid detection of food-borne thermotolerant campylobacters was evaluated through a collaborative trial with 12 laboratories testing spiked carcass rinse samples. The method showed an interlaboratory diagnostic sensitivity of 96.7% and a diagnostic specificity of 100% for c......% for chicken samples, while these values were 94.2 and 83.3%, respectively, for pig samples....
COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS
Directory of Open Access Journals (Sweden)
Tülin GÜVEN GÖKMEN
Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.
A rapid and direct real time PCR-based method for identification of Salmonella spp
DEFF Research Database (Denmark)
Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.
2003-01-01
The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...
DEFF Research Database (Denmark)
Ornskov, D; Kolmos, B; Bendix Horn, P
2008-01-01
2005, all patients and healthcare personnel have been screened for MRSA colonisation, involving analysis of 300-400 samples daily. To deal with this number of samples, a PCR-based method customised for high-throughput analysis and a system for fast reporting of MRSA carrier status were developed. Swab...... samples were incubated overnight in a selective tryptone soya broth and were analysed by PCR the following day. Using this strategy, non-colonised individuals were identified within 24 h, while MRSA-positive samples were analysed further by traditional microbiological methods to determine the resistance...... pattern. This is a cost-effective approach, as the greatest expense in hospitals involves the isolation of patients of unknown MRSA status. The method was evaluated by testing 2194 clinical samples, with a sensitivity and specificity of 100% and 94%, respectively. The analytical sensitivity was 97...
Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R
2008-05-15
A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products.
PCR-based techniques for leprosy diagnosis: from the laboratory to the clinic.
Directory of Open Access Journals (Sweden)
Alejandra Nóbrega Martinez
2014-04-01
Full Text Available In leprosy, classic diagnostic tools based on bacillary counts and histopathology have been facing hurdles, especially in distinguishing latent infection from active disease and diagnosing paucibacillary clinical forms. Serological tests and IFN-gamma releasing assays (IGRA that employ humoral and cellular immune parameters, respectively, are also being used, but recent results indicate that quantitative PCR (qPCR is a key technique due to its higher sensitivity and specificity. In fact, advances concerning the structure and function of the Mycobacterium leprae genome led to the development of specific PCR-based gene amplification assays for leprosy diagnosis and monitoring of household contacts. Also, based on the validation of point-of-care technologies for M. tuberculosis DNA detection, it is clear that the same advantages of rapid DNA detection could be observed in respect to leprosy. So far, PCR has proven useful in the determination of transmission routes, M. leprae viability, and drug resistance in leprosy. However, PCR has been ascertained to be especially valuable in diagnosing difficult cases like pure neural leprosy (PNL, paucibacillary (PB, and patients with atypical clinical presentation and histopathological features compatible with leprosy. Also, the detection of M. leprae DNA in different samples of the household contacts of leprosy patients is very promising. Although a positive PCR result is not sufficient to establish a causal relationship with disease outcome, quantitation provided by qPCR is clearly capable of indicating increased risk of developing the disease and could alert clinicians to follow these contacts more closely or even define rules for chemoprophylaxis.
Immunomagnetic nanoparticle based quantitative PCR for rapid detection of Salmonella
International Nuclear Information System (INIS)
Bakthavathsalam, Padmavathy; Rajendran, Vinoth Kumar; Saran, Uttara; Chatterjee, Suvro; Ali, Baquir Mohammed Jaffar
2013-01-01
We have developed a rapid and sensitive method for immunomagnetic separation (IMS) of Salmonella along with their real time detection via PCR. Silica-coated magnetic nanoparticles were functionalized with carboxy groups to which anti-Salmonella antibody raised against heat-inactivated whole cells of Salmonella were covalently attached. The immuno-captured target cells were detected in beverages like milk and lemon juice by multiplex PCR and real time PCR with a detection limit of 10 4 cfu.mL −1 and 10 3 cfu.mL −1 , respectively. We demonstrate that IMS can be used for selective concentration of target bacteria from beverages for subsequent use in PCR detection. PCR also enables differentiation of Salmonella typhi and Salmonella paratyphi A using a set of four specific primers. In addition, IMS—PCR can be used as a screening tool in the food and beverage industry for the detection of Salmonella within 3–4 h which compares favorably to the time of several days that is needed in case of conventional detection based on culture and biochemical methods. (author)
DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.
Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P
2015-07-01
Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.
Hussain, Musaddeq
2015-11-10
Chinese hamster ovary (CHO) cells are the host cell of choice for manufacturing of monoclonal antibody (mAb) drugs in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and must be controlled and monitored in order to ensure drug purity and safety. A conventional method for quantification of host residual DNA in drug requires extraction of DNA from the mAb drug substance with subsequent quantification of the extracted DNA using real-time PCR (qPCR). Here we report a method where the DNA extraction step is eliminated prior to qPCR. In this method, which we have named 'direct resDNA qPCR', the mAb drug substance is digested with a protease called KAPA in a 96-well PCR plate, the protease in the digest is then denatured at high temperature, qPCR reagents are added to the resultant reaction wells in the plate along with standards and controls in other wells of the same plate, and the plate subjected to qPCR for analysis of residual host DNA in the samples. This direct resDNA qPCR method for CHO is sensitive to 5.0fg of DNA with high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with four mAbs drug, two IgG1 and two IgG4. Both the purified drug substance as well as a number of process intermediate samples, e.g., bioreactor harvest, Protein A column eluate and ion-exchange column eluates were tested. This method simplifies the residual DNA quantification protocol, reduces time of analysis and leads to increased assay sensitivity and development of automated high-throughput methods. Copyright © 2015 Elsevier B.V. All rights reserved.
Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.
Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong
2017-10-15
Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.
Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong
2014-09-01
PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.
Mengtong Jin; Haiquan Liu; Wenshuo Sun; Qin Li; Zhaohuan Zhang; Jibing Li; Yingjie Pan; Yong Zhao
2015-01-01
Vibrio parahemolyticus is an important pathogen that leads to food illness associated seafood. Therefore, rapid and reliable methods to detect and quantify the total viable V. parahaemolyticus in seafood are needed. In this assay, a RNA-based real-time reverse-transcriptase PCR (RT-qPCR) without an enrichment step has been developed for detection and quantification of the total viable V. parahaemolyticus in shrimp. RNA standards with the target segments were synthesized in vitro with T7 RNA p...
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods
DEFF Research Database (Denmark)
Cowland, J B; Madsen, H O; Morling, N
1995-01-01
(ASA) method, which together recognise eight alleles. In 146 unrelated Danish individuals, the HLA-DQA1 alleles were in Hardy-Weinberg equilibrium. For identity testing, the power of discrimination (PD) of HLA-DQA1 was 0.932 with the RDB method and 0.942 with the PCR-RFLP/ASA method. For paternity...
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.
Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto
2018-08-01
Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kwang-Pyo Kim
2015-09-01
Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.
Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.
2018-01-01
Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909
Efficient color correction method for smartphone camera-based health monitoring application.
Duc Dang; Chae Ho Cho; Daeik Kim; Oh Seok Kwon; Jo Woon Chong
2017-07-01
Smartphone health monitoring applications are recently highlighted due to the rapid development of hardware and software performance of smartphones. However, color characteristics of images captured by different smartphone models are dissimilar each other and this difference may give non-identical health monitoring results when the smartphone health monitoring applications monitor physiological information using their embedded smartphone cameras. In this paper, we investigate the differences in color properties of the captured images from different smartphone models and apply a color correction method to adjust dissimilar color values obtained from different smartphone cameras. Experimental results show that the color corrected images using the correction method provide much smaller color intensity errors compared to the images without correction. These results can be applied to enhance the consistency of smartphone camera-based health monitoring applications by reducing color intensity errors among the images obtained from different smartphones.
Low-cost monitoring of campylobacter in poultry houses by air sampling and quantitative PCR
DEFF Research Database (Denmark)
Søndergaard, Mette Sofie Rousing; Josefsen, Mathilde Hasseldam; Löfström, Charlotta
2014-01-01
approximately 10(4) and 10(5) CCE per sample for boot swabs and air, respectively. In conclusion, using air samples combined with quantitative real-time PCR, Campylobacter contamination could be detected earlier than by boot swabs and was found to be a more convenient technique for monitoring and/or to obtain......The present study describes the evaluation of a method for the quantification of Campylobacter by air sampling in poultry houses. Sampling was carried out in conventional chicken houses in Poland, in addition to a preliminary sampling in Denmark. Each measurement consisted of three air samples, two...... standard boot swab fecal samples, and one airborne particle count. Sampling was conducted over an 8-week period in three flocks, assessing the presence and levels of Campylobacter in boot swabs and air samples using quantitative real-time PCR. The detection limit for air sampling was approximately 100...
DNA extraction method for PCR in mycorrhizal fungi.
Manian, S; Sreenivasaprasad, S; Mills, P R
2001-10-01
To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.
Advanced image based methods for structural integrity monitoring: Review and prospects
Farahani, Behzad V.; Sousa, Pedro José; Barros, Francisco; Tavares, Paulo J.; Moreira, Pedro M. G. P.
2018-02-01
There is a growing trend in engineering to develop methods for structural integrity monitoring and characterization of in-service mechanical behaviour of components. The fast growth in recent years of image processing techniques and image-based sensing for experimental mechanics, brought about a paradigm change in phenomena sensing. Hence, several widely applicable optical approaches are playing a significant role in support of experiment. The current review manuscript describes advanced image based methods for structural integrity monitoring, and focuses on methods such as Digital Image Correlation (DIC), Thermoelastic Stress Analysis (TSA), Electronic Speckle Pattern Interferometry (ESPI) and Speckle Pattern Shearing Interferometry (Shearography). These non-contact full-field techniques rely on intensive image processing methods to measure mechanical behaviour, and evolve even as reviews such as this are being written, which justifies a special effort to keep abreast of this progress.
Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke
2016-10-30
A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.
Pandey, Gunjan; Pandey, Janmejay; Jain, Rakesh K
2006-05-01
Monitoring of micro-organisms released deliberately into the environment is essential to assess their movement during the bio-remediation process. During the last few years, DNA-based genetic methods have emerged as the preferred method for such monitoring; however, their use is restricted in cases where organisms used for bio-remediation are not well characterized or where the public domain databases do not provide sufficient information regarding their sequence. For monitoring of such micro-organisms, alternate approaches have to be undertaken. In this study, we have specifically monitored a p-nitrophenol (PNP)-degrading organism, Arthrobacter protophormiae RKJ100, using molecular methods during PNP degradation in soil microcosm. Cells were tagged with a transposon-based foreign DNA sequence prior to their introduction into PNP-contaminated microcosms. Later, this artificially introduced DNA sequence was PCR-amplified to distinguish the bio-augmented organism from the indigenous microflora during PNP bio-remediation.
Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.
Smith, Cindy J; Osborn, A Mark
2009-01-01
Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.
A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.
2000-01-01
Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130
European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.
Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario
2014-08-01
The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Krstić Aleksandra D.
2007-01-01
Full Text Available Hematopoietic stem cell transplantation (HSCT is a very successful method of treatment for children with different aquired or inborn diseases. The main goal of post-transplantation chimerism monitoring in HSCT is to predict negative events (such as disease relapse and graft rejection, in order to intervene with appropriate therapy and improve the probability of long-term DFS (disease free survival. In this context, by quantifying the relative amounts of donor and recipient cells present in the peripheral blood sample, it can be determined if engraftment has taken place at all, or if full or mixed chimerism exists. In a group of patients who underwent hematopoietic stem cell transplantation at the Mother and Child Health Care Institute, we decided to use standard human identfication tests based on multiplex PCR analyses of short tandem repeats (STRs, as they are highly informative, sensitive, and fast and therefore represent an optimal methodological approach to engraftment analysis.
Directory of Open Access Journals (Sweden)
Mirae Harford
2017-10-01
Full Text Available Abstract Background For many vital signs, monitoring methods require contact with the patient and/or are invasive in nature. There is increasing interest in developing still and video image-guided monitoring methods that are non-contact and non-invasive. We will undertake a systematic review of still and video image-based monitoring methods. Methods We will perform searches in multiple databases which include MEDLINE, Embase, CINAHL, Cochrane library, IEEE Xplore and ACM Digital Library. We will use OpenGrey and Google searches to access unpublished or commercial data. We will not use language or publication date restrictions. The primary goal is to summarise current image-based vital signs monitoring methods, limited to heart rate, respiratory rate, oxygen saturations and blood pressure. Of particular interest will be the effectiveness of image-based methods compared to reference devices. Other outcomes of interest include the quality of the method comparison studies with respect to published reporting guidelines, any limitations of non-contact non-invasive technology and application in different populations. Discussion To the best of our knowledge, this is the first systematic review of image-based non-contact methods of vital signs monitoring. Synthesis of currently available technology will facilitate future research in this highly topical area. Systematic review registration PROSPERO CRD42016029167
Shape based kinetic outlier detection in real-time PCR
Directory of Open Access Journals (Sweden)
D'Atri Mario
2010-04-01
Full Text Available Abstract Background Real-time PCR has recently become the technique of choice for absolute and relative nucleic acid quantification. The gold standard quantification method in real-time PCR assumes that the compared samples have similar PCR efficiency. However, many factors present in biological samples affect PCR kinetic, confounding quantification analysis. In this work we propose a new strategy to detect outlier samples, called SOD. Results Richards function was fitted on fluorescence readings to parameterize the amplification curves. There was not a significant correlation between calculated amplification parameters (plateau, slope and y-coordinate of the inflection point and the Log of input DNA demonstrating that this approach can be used to achieve a "fingerprint" for each amplification curve. To identify the outlier runs, the calculated parameters of each unknown sample were compared to those of the standard samples. When a significant underestimation of starting DNA molecules was found, due to the presence of biological inhibitors such as tannic acid, IgG or quercitin, SOD efficiently marked these amplification profiles as outliers. SOD was subsequently compared with KOD, the current approach based on PCR efficiency estimation. The data obtained showed that SOD was more sensitive than KOD, whereas SOD and KOD were equally specific. Conclusion Our results demonstrated, for the first time, that outlier detection can be based on amplification shape instead of PCR efficiency. SOD represents an improvement in real-time PCR analysis because it decreases the variance of data thus increasing the reliability of quantification.
Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella
DEFF Research Database (Denmark)
Löfström, Charlotta; Krause, Michael; Josefsen, Mathilde Hartmann
2009-01-01
of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non....... Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially...... contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion: The real-time PCR method for detection of Salmonella in meat and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method...
von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi
2018-05-01
Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.
An enhanced method for sequence walking and paralog mining: TOPO® Vector-Ligation PCR
Directory of Open Access Journals (Sweden)
Davis Thomas M
2010-03-01
Full Text Available Abstract Background Although technological advances allow for the economical acquisition of whole genome sequences, many organisms' genomes remain unsequenced, and fully sequenced genomes may contain gaps. Researchers reliant upon partial genomic or heterologous sequence information require methods for obtaining unknown sequences from loci of interest. Various PCR based techniques are available for sequence walking - i.e., the acquisition of unknown DNA sequence adjacent to known sequence. Many such methods require rigid, elaborate protocols and/or impose narrowly confined options in the choice of restriction enzymes for necessary genomic digests. We describe a new method, TOPO® Vector-Ligation PCR (or TVL-PCR that innovatively integrates available tools and familiar concepts to offer advantages as a means of both targeted sequence walking and paralog mining. Findings TVL-PCR exploits the ligation efficiency of the pCR®4-TOPO® (Invitrogen, Carlsbad, California vector system to capture fragments of unknown sequence by creating chimeric molecules containing defined priming sites at both ends. Initially, restriction enzyme-digested genomic DNA is end-repaired to create 3' adenosine overhangs and is then ligated to pCR4-TOPO vectors. The ligation product pool is used directly as a template for nested PCR, using specific primers to target orthologous sequences, or degenerate primers to enable capture of paralogous gene family members. We demonstrated the efficacy of this method by capturing entire coding and partial promoter sequences of several strawberry Superman-like genes. Conclusions TVL-PCR is a convenient and efficient method for DNA sequence walking and paralog mining that is applicable to any organism for which relevant DNA sequence is available as a basis for primer design.
Energy Technology Data Exchange (ETDEWEB)
Brill, J.A.; Wiegel, J. [Univ. of Georgia, Athens, GA (United States)
1997-12-31
A set of molecular probes was devised to develop a method for screening for the presence of sequences homologous to three representative genes exclusively involved in endosporulation. Based on known gene sequences, degenerate PCR primers were designed against spo0A and ssp. Experimental conditions were devised under which homologs of both genes were consistently detected in endospore-forming bacteria, but not in asporogenic bacteria. The PCR amplification products and dpaA/B from Bacillus subtilis were used as hybridization probes for Southern blots. Identical conditions were used with the genomic DNA from endospore-forming and asporogenic bacteria. We therefore concluded that the probes specifically detect the targeted sporulation genes and we obtained no indication that genes homologous to ssp, spo0A and dpaA/B are present in asporogenic bacteria. Thus, this assay can potentially be used to detect spore-forming bacteria in various kinds of samples and to distinguish between bacteria containing sporulation genes and those who do not regardless of whether sporulation is observed or not. 43 refs., 3 figs., 1 tab.
Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi
2013-01-01
In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.
Directory of Open Access Journals (Sweden)
Bahman Navidshad
2012-02-01
Full Text Available The applications of conventional culture-dependent assays to quantify bacteria populations are limited by their dependence on the inconsistent success of the different culture-steps involved. In addition, some bacteria can be pathogenic or a source of endotoxins and pose a health risk to the researchers. Bacterial quantification based on the real-time PCR method can overcome the above-mentioned problems. However, the quantification of bacteria using this approach is commonly expressed as absolute quantities even though the composition of samples (like those of digesta can vary widely; thus, the final results may be affected if the samples are not properly homogenized, especially when multiple samples are to be pooled together before DNA extraction. The objective of this study was to determine the correlation coefficients between four different methods of expressing the output data of real-time PCR-based bacterial quantification. The four methods were: (i the common absolute method expressed as the cell number of specific bacteria per gram of digesta; (ii the Livak and Schmittgen, ΔΔCt method; (iii the Pfaffl equation; and (iv a simple relative method based on the ratio of cell number of specific bacteria to the total bacterial cells. Because of the effect on total bacteria population in the results obtained using ΔCt-based methods (ΔΔCt and Pfaffl, these methods lack the acceptable consistency to be used as valid and reliable methods in real-time PCR-based bacterial quantification studies. On the other hand, because of the variable compositions of digesta samples, a simple ratio of cell number of specific bacteria to the corresponding total bacterial cells of the same sample can be a more accurate method to quantify the population.
Harford, Mirae; Catherall, Jacqueline; Gerry, Stephen; Young, Duncan; Watkinson, Peter
2017-10-25
For many vital signs, monitoring methods require contact with the patient and/or are invasive in nature. There is increasing interest in developing still and video image-guided monitoring methods that are non-contact and non-invasive. We will undertake a systematic review of still and video image-based monitoring methods. We will perform searches in multiple databases which include MEDLINE, Embase, CINAHL, Cochrane library, IEEE Xplore and ACM Digital Library. We will use OpenGrey and Google searches to access unpublished or commercial data. We will not use language or publication date restrictions. The primary goal is to summarise current image-based vital signs monitoring methods, limited to heart rate, respiratory rate, oxygen saturations and blood pressure. Of particular interest will be the effectiveness of image-based methods compared to reference devices. Other outcomes of interest include the quality of the method comparison studies with respect to published reporting guidelines, any limitations of non-contact non-invasive technology and application in different populations. To the best of our knowledge, this is the first systematic review of image-based non-contact methods of vital signs monitoring. Synthesis of currently available technology will facilitate future research in this highly topical area. PROSPERO CRD42016029167.
PCR-based detection of a rare linear DNA in cell culture
Directory of Open Access Journals (Sweden)
Saveliev Sergei V.
2002-01-01
Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-RFLP Method to Identify Salmonid Species of Economic Importance
Directory of Open Access Journals (Sweden)
Andreea Dudu
2011-05-01
Full Text Available The identification of different fish species by molecular methods has become necessary to avoid both the incorrect labelling of individuals involved in repopulation programmes and the commercial frauds on the fish market. Different fish species of great economical importance, like the salmonids, which are very much requested for their meat, can be identified using molecular techniques such as PCR-RFLP. The method is based on the amplification of a target region from the genome by PCR reaction followed by endonucleases digestion to detect the polymorphism of restriction fragments. In our study we analysed the following salmonid species from Romania: Salmo trutta fario, Salmo labrax, Salvelinus fontinalis, Onchorhynchus mykiss, Thymallus thymallus and Hucho hucho. In order to discriminate between the analysed species we amplified a fragment of mitochondrial genome comprising tRNAGlu/ cytochrome b/ tRNAThr/ tRNAPro/ D-loop/ tRNAPhe, followed by digestion with a specific restriction enzyme. The direct digestion of unpurified PCR products generated species-specific restriction patterns and proved to be a simple, reliable, inexpensive and fast method. Thus, it may be successfully utilized in specialized laboratories for the correct identification of the fish species for multiple purposes, including the traceability of fish food products.
Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan
2015-02-01
AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.
Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R
2011-09-01
In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.
Greenspoon, S A; Sykes, K L V; Ban, J D; Pollard, A; Baisden, M; Farr, M; Graham, N; Collins, B L; Green, M M; Christenson, C C
2006-12-20
Human genome, pharmaceutical and research laboratories have long enjoyed the application of robotics to performing repetitive laboratory tasks. However, the utilization of robotics in forensic laboratories for processing casework samples is relatively new and poses particular challenges. Since the quantity and quality (a mixture versus a single source sample, the level of degradation, the presence of PCR inhibitors) of the DNA contained within a casework sample is unknown, particular attention must be paid to procedural susceptibility to contamination, as well as DNA yield, especially as it pertains to samples with little biological material. The Virginia Department of Forensic Science (VDFS) has successfully automated forensic casework DNA extraction utilizing the DNA IQ(trade mark) System in conjunction with the Biomek 2000 Automation Workstation. Human DNA quantitation is also performed in a near complete automated fashion utilizing the AluQuant Human DNA Quantitation System and the Biomek 2000 Automation Workstation. Recently, the PCR setup for casework samples has been automated, employing the Biomek 2000 Automation Workstation and Normalization Wizard, Genetic Identity version, which utilizes the quantitation data, imported into the software, to create a customized automated method for DNA dilution, unique to that plate of DNA samples. The PCR Setup software method, used in conjunction with the Normalization Wizard method and written for the Biomek 2000, functions to mix the diluted DNA samples, transfer the PCR master mix, and transfer the diluted DNA samples to PCR amplification tubes. Once the process is complete, the DNA extracts, still on the deck of the robot in PCR amplification strip tubes, are transferred to pre-labeled 1.5 mL tubes for long-term storage using an automated method. The automation of these steps in the process of forensic DNA casework analysis has been accomplished by performing extensive optimization, validation and testing of the
International Nuclear Information System (INIS)
Fu Cuiming; Xi Pingping; Ma Yinghao; Tan Linglong; Shen Fu
2011-01-01
This article introduces a radioactive aerosol continuous monitor based on accumulation sampling and measuring and three methods for processing the operation data. The monitoring results are processed by the 3 methods which are applied both under the conditions of natural background and at workplaces of a nuclear facility. How the monitoring results are assessed and how to calculate the detection limit when using the 3 different methods are explained. Moreover, the advantages and disadvantages of the 3 methods are discussed. (authors)
Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro
2015-01-01
Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.
1999-01-01
The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...
Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee
2017-08-15
The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.
Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S
2010-01-01
Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers
A Study on the Estimation Method of Risk Based Area for Jetty Safety Monitoring
Directory of Open Access Journals (Sweden)
Byeong-Wook Nam
2015-09-01
Full Text Available Recently, the importance of safety-monitoring systems was highlighted by the unprecedented collision between a ship and a jetty in Yeosu. Accordingly, in this study, we introduce the concept of risk based area and develop a methodology for a jetty safety-monitoring system. By calculating the risk based areas for a ship and a jetty, the risk of collision was evaluated. To calculate the risk based areas, we employed an automatic identification system for the ship, stopping-distance equations, and the regulation velocity near the jetty. In this paper, we suggest a risk calculation method for jetty safety monitoring that can determine the collision probability in real time and predict collisions using the amount of overlap between the two calculated risk based areas. A test was conducted at a jetty control center at GS Caltex, and the effectiveness of the proposed risk calculation method was verified. The method is currently applied to the jetty-monitoring system at GS Caltex in Yeosu for the prevention of collisions.
Multicenter validation of PCR-based method for detection of Salmonella in chicken and pig samples
DEFF Research Database (Denmark)
Malorny, B.; Cook, N.; D'Agostino, M.
2004-01-01
As part of a standardization project, an interlaboratory trial including 15 laboratories from 13 European countries was conducted to evaluate the performance of a noproprietary polymerase chain reaction (PCR)-based method for the detection of Salmonella on artificially contaminated chicken rinse...... or positive. Outlier results caused, for example, by gross departures from the experimental protocol, were omitted from the analysis. For both the chicken rinse and the pig swab samples, the diagnostic sensitivity was 100%, with 100% accordance (repeatability) and concordance (reproducibility). The diagnostic...... specificity was 80.1% (with 85.7% accordance and 67.5% concordance) for chicken rinse, and 91.7% (with 100% accordance and 83.3% concordance) for pig swab. Thus, the interlaboratory variation due to personnel, reagents, thermal cyclers, etc., did not affect the performance of the method, which...
Guglielmo, F; Bergemann, S E; Gonthier, P; Nicolotti, G; Garbelotto, M
2007-11-01
The goal of this research was the development of a PCR-based assay to identify important decay fungi from wood of hardwood tree species in northern temperate regions. Eleven taxon-specific primers were designed for PCR amplification of either nuclear or mitochondrial ribosomal DNA regions of Armillaria spp., Ganoderma spp., Hericium spp., Hypoxylon thouarsianum var. thouarsianum, Inonotus/Phellinus-group, Laetiporus spp., Perenniporia fraxinea, Pleurotus spp., Schizophyllum spp., Stereum spp. and Trametes spp. Multiplex PCR reactions were developed and optimized to detect fungal DNA and identify each taxon with a sensitivity of at least 1 pg of target DNA in the template. This assay correctly identified the agents of decay in 82% of tested wood samples. The development and optimization of multiplex PCRs allowed for reliable identification of wood rotting fungi directly from wood. Early detection of wood decay fungi is crucial for assessment of tree stability in urban landscapes. Furthermore, this method may prove useful for prediction of the severity and the evolution of decay in standing trees.
Probe-based real-time PCR method for multilocus melt typing of Xylella fastidiosa strains.
Brady, Jeff A; Faske, Jennifer B; Ator, Rebecca A; Castañeda-Gill, Jessica M; Mitchell, Forrest L
2012-04-01
Epidemiological studies of Pierce's disease (PD) can be confounded by a lack of taxonomic detail on the bacterial causative agent, Xylella fastidiosa (Xf). PD in grape is caused by strains of Xylella fastidiosa subsp. fastidiosa, but is not caused by other subspecies of Xf that typically colonize plants other than grape. Detection assays using ELISA and qPCR are effective at detecting and quantifying Xf presence or absence, but offer no information on Xf subspecies or strain identity. Surveying insects or host plants for Xf by current ELISA or qPCR methods provides only presence/absence and quantity information for any and all Xf subspecies, potentially leading to false assessments of disease threat. This study uses a series of adjacent-hybridizing DNA melt analysis probes that are capable of efficiently discriminating Xf subspecies and strain relationships in rapid real-time PCR reactions. Copyright © 2012 Elsevier B.V. All rights reserved.
Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan
2016-01-01
Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.
Zhu, Pengyu; Tian, Wenying; Cheng, Nan; Huang, Kunlun; Luo, Yunbo; Xu, Wentao
2016-08-01
Sensor-based detection methods have inspired the idea that chemical or physical signals could be converted to nucleic acid signals to be quantitatively detected using a combination of appropriate detection tools. To achieve ultra-sensitive and absolute quantitative detection of mercury ion (Hg(2+)), we have combined a mispairing biosensor for Hg(2+) and emulsion PCR. The parameters that might influence the biosensor step, such as the duration of isothermal amplification and the concentration of the sensor oligonucleotide, have been firstly optimized in our study to achieve the most efficient biosensor detection. The evaluation results of secondary structures between the biosensors with different number of T-Hg-T structures achieved by Circular Dichroism have indicated that the secondary hairpin structure would be varied according to the change of number of T-Hg-T structures, which could influence the quantitative detection results. Further optimization of number of T-Hg-T within the biosensor sequences showed that 5 T-Hg-T structures could generate the most efficient amplification. After the above optimizations, the emulsion PCR has been employed to achieve the absolute quantitation of nucleic acid signals. The final results have shown that the limit of quantitation (LOQ) in our study was as low as 40fmol, and the limit of detection (LOD) was 10fmol. The practical detection tests showed that the quantitative results were stable and accurate for all substrates. In conclusion, by combining a mispairing biosensor with emulsion PCR, we developed a flexible and stable quantitative "turn-on" detection method with ultra-sensitivity that can detect trace amounts Hg(2+) within different substrates. Copyright © 2016 Elsevier B.V. All rights reserved.
Wang, Li-Ping; Lei, Kun
2016-12-01
Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.
Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.
Kitta, Kazumi; Takabatake, Reona; Mano, Junichi
2016-01-01
This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.
Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2015-07-01
Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).
Directory of Open Access Journals (Sweden)
Lu Jia
2011-10-01
Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.
Automated micro fluidic system for PCR applications in the monitoring of drinking water quality
International Nuclear Information System (INIS)
Soria Soria, E.; Yanez Amoros, A.; Murtula Corbi, R.; Catalan Cuenca, V.; Martin-Cisneros, C. S.; Ymbern, O.; Alonso-Chamorro, J.
2009-01-01
Microbiological laboratories present a growing interest in automated, simple and user-friendly methodologies able to perform simultaneous analysis of a high amount of samples. Analytical tools based on micro-fluidic could play an important role in this field. In this work, the development of an automated micro fluidic system for PCR applications and aimed to monitoring of drinking water quality is presented. The device will be able to determine, simultaneously, fecal pollution indicators and water-transmitted pathogens. Further-more, complemented with DNA pre-concentration and extraction modules, the device would present a highly integrated solution for microbiological diagnostic laboratories. (Author) 13 refs.
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Roberto Viau
2017-02-01
Full Text Available Molecular typing using repetitive sequenced-based PCR (rep-PCR and hsp60 sequencing were applied to a collection of diverse Enterobacter cloacae complex isolates. To determine the most practical method for reference laboratories, we analyzed 71 E. cloacae complex isolates from sporadic and outbreak occurrences originating from 4 geographic areas. While rep-PCR was more discriminating, hsp60 sequencing provided a broader and a more objective geographical tracking method similar to multilocus sequence typing (MLST. In addition, we suggest that MLST may have higher discriminative power compared to hsp60 sequencing, although rep-PCR remains the most discriminative method for local outbreak investigations. In addition, rep-PCR can be an effective and inexpensive method for local outbreak investigation.
Inverse PCR-based method for isolating novel SINEs from genome.
Han, Yawei; Chen, Liping; Guan, Lihong; He, Shunping
2014-04-01
Short interspersed elements (SINEs) are moderately repetitive DNA sequences in eukaryotic genomes. Although eukaryotic genomes contain numerous SINEs copy, it is very difficult and laborious to isolate and identify them by the reported methods. In this study, the inverse PCR was successfully applied to isolate SINEs from Opsariichthys bidens genome in Eastern Asian Cyprinid. A group of SINEs derived from tRNA(Ala) molecular had been identified, which were named Opsar according to Opsariichthys. SINEs characteristics were exhibited in Opsar, which contained a tRNA(Ala)-derived region at the 5' end, a tRNA-unrelated region, and AT-rich region at the 3' end. The tRNA-derived region of Opsar shared 76 % sequence similarity with tRNA(Ala) gene. This result indicated that Opsar could derive from the inactive or pseudogene of tRNA(Ala). The reliability of method was tested by obtaining C-SINE, Ct-SINE, and M-SINEs from Ctenopharyngodon idellus, Megalobrama amblycephala, and Cyprinus carpio genomes. This method is simpler than the previously reported, which successfully omitted many steps, such as preparation of probes, construction of genomic libraries, and hybridization.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific
International Nuclear Information System (INIS)
Yilmaz, R.; Cabi, E.; Dogan, M.
2014-01-01
RAPD-PCR (Random Amplified Polymorphic DNA Polymerase Chain Reaction) and Post PCR (Polymerase Chain Reaction) Melting Curve Analysis (MCA) have been used to investigate the pattern of genetic variation among some species in the genera Eremopyrum (Ledeb.) Jaub. and Spach and Agropyron Gaertner (Poaceae). Thirteen primers have been used in the study based on the RAPD-PCR and MCA analyses. Each species produced a distinct pattern of DNA fragments which have been used as a measure of the degree of relationship between species by means of using the RAPD-PCR results with three primers selected for identifying the genetic similarities. Polymorphic melting profiles have been obtained with Post PCR MCA method using three primers. Genetic similarities are calculated for all the species studied with RAPD-PCR and MCA methods, the dendrograms are obtained with the MVSP (Multi Variate Statistical Package) software using UPGMA (Unweighted Pair Group Method with Arithmetic Averages) and Jaccard's Coefficient. Polymorphism between 18 populations of Eremopyrum and 6 Agropyron populations and within the species are determined by using RAPD-PCR and Post PCR melting curve analysis (MCA) respectively. (author)
Directory of Open Access Journals (Sweden)
Raquel M. Fernández
2013-01-01
Full Text Available Preimplantation genetic diagnosis (PGD of single gene disorders, combined with HLA matching (PGD-HLA, has emerged as a tool for couples at risk of transmitting a genetic disease to select unaffected embryos of an HLA tissue type compatible with that of an existing affected child. Here, we present a novel one-step multiplex PCR to genotype a spectrum of STRs to simultaneously perform HLA typing and PGD for -thalassemia. This method is being routinely used for PGD-HLA cycles in our department, with a genotyping success rate of 100%. As an example, we present the first successful PGD-HLA typing in Spain, which resulted in the birth of a boy and subsequent successful HSC transplantation to his affected brother, who is doing well 4 years following transplantation. The advantage of our method is that it involves only a round of single PCR for multiple markers amplification (up to 10 markers within the HLA and 6 markers at the -globin loci. This strategy has allowed us to considerably reduce the optimization of the PCR method for each specific PGD-HLA family as well as the time to obtain molecular results in each cycle.
Directory of Open Access Journals (Sweden)
Mateusz G Adamski
Full Text Available Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1 the achievement of absolute quantification and (2 a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.
Woo, Nain; Kim, Su-Kang; Sun, Yucheng; Kang, Seong Ho
2018-01-01
Human apolipoprotein E (ApoE) is associated with high cholesterol levels, coronary artery disease, and especially Alzheimer's disease. In this study, we developed an ApoE genotyping and one-step multiplex polymerase chain reaction (PCR) based-capillary electrophoresis (CE) method for the enhanced diagnosis of Alzheimer's. The primer mixture of ApoE genes enabled the performance of direct one-step multiplex PCR from whole blood without DNA purification. The combination of direct ApoE genotyping and one-step multiplex PCR minimized the risk of DNA loss or contamination due to the process of DNA purification. All amplified PCR products with different DNA lengths (112-, 253-, 308-, 444-, and 514-bp DNA) of the ApoE genes were analyzed within 2min by an extended voltage programming (VP)-based CE under the optimal conditions. The extended VP-based CE method was at least 120-180 times faster than conventional slab gel electrophoresis methods In particular, all amplified DNA fragments were detected in less than 10 PCR cycles using a laser-induced fluorescence detector. The detection limits of the ApoE genes were 6.4-62.0pM, which were approximately 100-100,000 times more sensitive than previous Alzheimer's diagnosis methods In addition, the combined one-step multiplex PCR and extended VP-based CE method was also successfully applied to the analysis of ApoE genotypes in Alzheimer's patients and normal samples and confirmed the distribution probability of allele frequencies. This combination of direct one-step multiplex PCR and an extended VP-based CE method should increase the diagnostic reliability of Alzheimer's with high sensitivity and short analysis time even with direct use of whole blood. Copyright © 2017 Elsevier B.V. All rights reserved.
de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.
2006-01-01
A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was
International Nuclear Information System (INIS)
Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H
2008-01-01
Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples
Directory of Open Access Journals (Sweden)
Charlotte Nejad
2018-01-01
Full Text Available MicroRNA (miRNA detection by reverse transcription (RT quantitative real-time PCR (RT-qPCR is the most popular method currently used to measure miRNA expression. Although the majority of miRNA families are constituted of several 3′-end length variants (“isomiRs”, little attention has been paid to their differential detection by RT-qPCR. However, recent evidence indicates that 3′-end miRNA isoforms can exhibit 3′-length specific regulatory functions, underlining the need to develop strategies to differentiate 3′-isomiRs by RT-qPCR approaches. We demonstrate here that polyadenylation-based RT-qPCR strategies targeted to 20–21 nt isoforms amplify entire miRNA families, but that primers targeted to >22 nt isoforms were specific to >21 nt isoforms. Based on this observation, we developed a simple method to increase selectivity of polyadenylation-based RT-qPCR assays toward shorter isoforms, and demonstrate its capacity to help distinguish short RNAs from longer ones, using synthetic RNAs and biological samples with altered isomiR stoichiometry. Our approach can be adapted to many polyadenylation-based RT-qPCR technologies already exiting, providing a convenient way to distinguish long and short 3′-isomiRs.
Miguez, Carlos B.; Shen, Chun F.; Bourque, Denis; Guiot, Serge R.; Groleau, Denis
1999-01-01
We attempted to mimic in small upflow anaerobic sludge bed (UASB) bioreactors the metabolic association found in nature between methanogens and methanotrophs. UASB bioreactors were inoculated with pure cultures of methanotrophs, and the bioreactors were operated by using continuous low-level oxygenation in order to favor growth and/or survival of methanotrophs. Unlike the reactors in other similar studies, the hybrid anaerobic-aerobic bioreactors which we used were operated synchronously, not sequentially. Here, emphasis was placed on monitoring various methanotrophic populations by using classical methods and also a PCR amplification assay based on the mmoX gene fragment of the soluble methane monooxygenase (sMMO). The following results were obtained: (i) under the conditions used, Methylosinus sporium appeared to survive better than Methylosinus trichosporium; (ii) the PCR method which we used could detect as few as about 2,000 sMMO gene-containing methanotrophs per g (wet weight) of granular sludge; (iii) inoculation of the bioreactors with pure cultures of methanotrophs contributed greatly to increases in the sMMO-containing population (although the sMMO-containing population decreased gradually with time, at the end of an experiment it was always at least 2 logs larger than the initial population before inoculation); (iv) in general, there was a good correlation between populations with the sMMO gene and populations that exhibited sMMO activity; and (v) inoculation with sMMO-positive cultures helped increase significantly the proportion of sMMO-positive methanotrophs in reactors, even after several weeks of operation under various regimes. At some point, anaerobic-aerobic bioreactors like those described here might be used for biodegradation of various chlorinated pollutants. PMID:9925557
Directory of Open Access Journals (Sweden)
Tian-Min Qiao
2016-10-01
Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-01-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-10-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Iida, Takao; Mizuno, Yukie; Kaizaki, Yasuharu
2017-10-27
Mutations in RAS and BRAF are predictors of the efficacy of anti-epidermal growth factor receptor (EGFR) therapy in patients with metastatic colorectal cancer (mCRC). Therefore, simple, rapid, cost-effective methods to detect these mutations in the clinical setting are greatly needed. In the present study, we evaluated BNA Real-time PCR Mutation Detection Kit Extended RAS (BNA Real-time PCR), a real-time PCR method that uses bridged nucleic acid clamping technology to rapidly detect mutations in RAS exons 2-4 and BRAF exon 15. Genomic DNA was extracted from 54 formalin-fixed paraffin-embedded (FFPE) tissue samples obtained from mCRC patients. Among the 54 FFPE samples, BNA Real-time PCR detected 21 RAS mutations (38.9%) and 5 BRAF mutations (9.3%), and the reference assay (KRAS Mutation Detection Kit and MEBGEN™ RASKET KIT) detected 22 RAS mutations (40.7%). The concordance rate of detected RAS mutations between the BNA Real-time PCR assay and the reference assays was 98.2% (53/54). The BNA Real-time PCR assay proved to be a more simple, rapid, and cost-effective method for detecting KRAS and RAS mutations compared with existing assays. These findings suggest that BNA Real-time PCR is a valuable tool for predicting the efficacy of early anti-EGFR therapy in mCRC patients. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Ruijter, Jan M.; Hoff, Maurice J. B. van den; Lorenz, Peter; Tuomi, Jari M.; Hecker, Michael
2014-01-01
The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of −1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. (author)
Detection of foodborne pathogens by qPCR: A practical approach for food industry applications
Directory of Open Access Journals (Sweden)
María-José Chapela
2015-12-01
Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.
Diagnosis of Giardia infections by PCR-based methods in children of an endemic area
Directory of Open Access Journals (Sweden)
EB David
2011-01-01
Full Text Available The present study was designed to estimate the prevalence of Giardia infection in preschool- and school-aged children living in an endemic area. Fecal samples from 573 children were processed by zinc sulfate centrifugal flotation, centrifugal sedimentation (using a commercial device for fecal concentration - TF-Test kit® and polymerase chain reaction (PCR-based methods. Of the stool samples assessed, 277 (48.3% were positive for intestinal parasites and/or commensal protozoa. Centrifugal flotation presented the highest diagnostic sensitivity for Giardia infections. The kappa index revealed that both coproparasitological techniques closely agreed on the Giardia diagnosis (86% versus satisfactory (72% and poor (35% concordances for commensal protozoan and helminth infections, respectively. Concerning Giardia molecular diagnosis, from the 71 microscopy-positive samples, specific amplification of gdh and tpi fragments was noted in 68 (95.7% and 64 (90% samples, respectively. Amplification of gdh and tpi genes was observed, respectively, in 95.7% and 90% of microscopy-positive Giardia samples. For 144 microscopy-negative samples, gdh and tpi gene amplification products were obtained from 8.3% and 35.9% samples, respectively. The agreement between these genes was about 40%. The centrifuge-flotation based method was the most suitable means of Giardia diagnosis assessed in the present study by combining accuracy and low cost.
2014-01-01
Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886
Multi-phase flow monitoring with electrical impedance tomography using level set based method
International Nuclear Information System (INIS)
Liu, Dong; Khambampati, Anil Kumar; Kim, Sin; Kim, Kyung Youn
2015-01-01
Highlights: • LSM has been used for shape reconstruction to monitor multi-phase flow using EIT. • Multi-phase level set model for conductivity is represented by two level set functions. • LSM handles topological merging and breaking naturally during evolution process. • To reduce the computational time, a narrowband technique was applied. • Use of narrowband and optimization approach results in efficient and fast method. - Abstract: In this paper, a level set-based reconstruction scheme is applied to multi-phase flow monitoring using electrical impedance tomography (EIT). The proposed scheme involves applying a narrowband level set method to solve the inverse problem of finding the interface between the regions having different conductivity values. The multi-phase level set model for the conductivity distribution inside the domain is represented by two level set functions. The key principle of the level set-based method is to implicitly represent the shape of interface as the zero level set of higher dimensional function and then solve a set of partial differential equations. The level set-based scheme handles topological merging and breaking naturally during the evolution process. It also offers several advantages compared to traditional pixel-based approach. Level set-based method for multi-phase flow is tested with numerical and experimental data. It is found that level set-based method has better reconstruction performance when compared to pixel-based method
Deflection monitoring for a box girder based on a modified conjugate beam method
Chen, Shi-Zhi; Wu, Gang; Xing, Tuo
2017-08-01
After several years of operation, a box girder bridge would commonly experience excessive deflection, which endangers the bridge’s life span as well as the safety of vehicles travelling on it. In order to avoid potential risks, it is essential to constantly monitor the defection of box girders. However, currently, the direct deflection monitoring methods are limited by the complicated environments beneath the bridges, such as rivers or other traffic lanes, which severely impede the layouts of the sensors. The other indirect deflection monitoring methods mostly do not thoroughly consider the inherent shear lag effect and shear deformation in the box girder, resulting in a rather large error. Under these circumstances, a deflection monitoring method suiting box girders is proposed in this article, based on the conjugate beam method and distributed long-gauge fibre Bragg grating (FBG) sensor. A lab experiment was conducted to verify the reliability and feasibility of this method under practical application. Further, the serviceability under different span-depth ratios and web thicknesses was examined through a finite element model.
Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat
DEFF Research Database (Denmark)
Josefsen, Mathilde Hartmann; Krause, Michael; Hansen, F.
2007-01-01
no positive effects and resulted in decreased reproducibility. Increasing the amount of PCR template DNA from 5 to 20 mu l improved the threshold cycle value by approximately 2. The improved 12-h PCR method was successfully compared to a reference culture method with 100 minced meat and poultry samples...... the highest number of salmonellae. When analyzing minced meat samples, positive effects of increasing the initial sampling volume from 1 to 5 ml and increasing the amount of paramagnetic particles to 90 mu l were observed. However, washing the pellet and eluting the DNA in reduced volumes (25 and 50 mu l) had...
Ramírez, Juan Carlos; Cura, Carolina Inés; da Cruz Moreira, Otacilio; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Marcos da Matta Guedes, Paulo; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Maria da Cunha Galvão, Lúcia; Jácome da Câmara, Antonia Cláudia; Espinoza, Bertha; Alarcón de Noya, Belkisyole; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G
2015-09-01
An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
PCR-based detection of gene transfer vectors: application to gene doping surveillance.
Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O
2013-12-01
Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.
Directory of Open Access Journals (Sweden)
Elhamnia, F.
2010-07-01
Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.
Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.
Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua
2016-10-11
The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.
The PCR-Based Diagnosis of Central Nervous System Tuberculosis: Up to Date
Directory of Open Access Journals (Sweden)
Teruyuki Takahashi
2012-01-01
Full Text Available Central nervous system (CNS tuberculosis, particularly tuberculous meningitis (TBM, is the severest form of Mycobacterium tuberculosis (M.Tb infection, causing death or severe neurological defects in more than half of those affected, in spite of recent advancements in available anti-tuberculosis treatment. The definitive diagnosis of CNS tuberculosis depends upon the detection of M.Tb bacilli in the cerebrospinal fluid (CSF. At present, the diagnosis of CNS tuberculosis remains a complex issue because the most widely used conventional “gold standard” based on bacteriological detection methods, such as direct smear and culture identification, cannot rapidly detect M.Tb in CSF specimens with sufficient sensitivity in the acute phase of TBM. Recently, instead of the conventional “gold standard”, the various molecular-based methods including nucleic acid amplification (NAA assay technique, particularly polymerase chain reaction (PCR assay, has emerged as a promising new method for the diagnosis of CNS tuberculosis because of its rapidity, sensitivity and specificity. In addition, the innovation of nested PCR assay technique is worthy of note given its contribution to improve the diagnosis of CNS tuberculosis. In this review, an overview of recent progress of the NAA methods, mainly highlighting the PCR assay technique, was presented.
Directory of Open Access Journals (Sweden)
Maryam AlTamimi
2017-01-01
Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.
Agrimonti, Caterina; Bottari, Benedetta; Sardaro, Maria Luisa Savo; Marmiroli, Nelson
2017-09-08
Dairy foods represent an important sector of the food market for their nutritional qualities and their organoleptic characteristics, which are often linked to tradition and to region. These products are typically protected by labels such as PDO (Protected Designation of Origin) and PGI (Protected Geographical Indication). Real-time PCR (qPCR) is a fundamental tool in "Food Genomics;" a discipline concerned with the residual DNA in food, which, alongside traditional physical and chemical methods, is frequently used to determine product safety, quality and authenticity. Compared to conventional or "end-point" PCR, qPCR incorporates continuous monitoring of reaction progress, thereby enabling quantification of target DNA. This review describes qPCR applications to the analysis of microbiota, and to the identification of the animal species source of milk from which dairy products have been made. These are important aspects for ensuring safety and authenticity. The various applications of qPCR are discussed, as well as advantages and disadvantages in comparison with other analytical methods.
Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays
Energy Technology Data Exchange (ETDEWEB)
Frank F. Roberto
2008-08-01
Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.
Isaksson, Mats; Hagström, Åsa; Armua-Fernandez, Maria Teresa; Wahlström, Helene; Ågren, Erik Olof; Miller, Andrea; Holmberg, Anders; Lukacs, Morten; Casulli, Adriano; Deplazes, Peter; Juremalm, Mikael
2014-12-19
Following the first finding of Echinococcus multilocularis in Sweden in 2011, 2985 red foxes (Vulpes vulpes) were analysed by the segmental sedimentation and counting technique. This is a labour intensive method and requires handling of the whole carcass of the fox, resulting in a costly analysis. In an effort to reduce the cost of labour and sample handling, an alternative method has been developed. The method is sensitive and partially automated for detection of E. multilocularis in faecal samples. The method has been used in the Swedish E. multilocularis monitoring program for 2012-2013 on more than 2000 faecal samples. We describe a new semi-automated magnetic capture probe DNA extraction method and real time hydrolysis probe polymerase chain reaction assay (MC-PCR) for the detection of E. multilocularis DNA in faecal samples from red fox. The diagnostic sensitivity was determined by validating the new method against the sedimentation and counting technique in fox samples collected in Switzerland where E. multilocularis is highly endemic. Of 177 foxes analysed by the sedimentation and counting technique, E. multilocularis was detected in 93 animals. Eighty-two (88%, 95% C.I 79.8-93.9) of these were positive in the MC-PCR. In foxes with more than 100 worms, the MC-PCR was positive in 44 out of 46 (95.7%) cases. The two MC-PCR negative samples originated from foxes with only immature E. multilocularis worms. In foxes with 100 worms or less, (n = 47), 38 (80.9%) were positive in the MC-PCR. The diagnostic specificity of the MC-PCR was evaluated using fox scats collected within the Swedish screening. Of 2158 samples analysed, two were positive. This implies that the specificity is at least 99.9% (C.I. = 99.7-100). The MC-PCR proved to have a high sensitivity and a very high specificity. The test is partially automated but also possible to perform manually if desired. The test is well suited for nationwide E. multilocularis surveillance programs where sampling
Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.
Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping
2017-07-25
Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an
Herrero, Beatriz; Lago, Fátima C; Vieites, Juan M; Espiñeira, Montserrat
2012-01-01
Judged by quality and taste, the European sole (Solea solea) is considered one of the finest flatfish and is, thus, of considerable commercial value. In the present work, a specific fast real-time PCR was developed for the authentication of S. solea, i.e. to distinguish it from other related species and avoid substitution of this species, either deliberately or unintentionally. The method is based on a species-specific set of primers and MGB Taqman probe which amplifies a 116-bp fragment of the internal transcribed spacer 1 (ITS 1) ribosomal DNA region. This assay combines the high specificity and sensitivity of real-time PCR with the rapidity of the fast mode, allowing the detection of S. solea in a short period of time. The present methodology was validated for application to all types of manufactured products for the presence of S. solea, with successful results. Subsequently, the method was applied to 40 commercial samples to determine whether correct labeling had been employed in the market. It was demonstrated that the assay is a useful tool in monitoring and verifying food labeling regulations.
Directory of Open Access Journals (Sweden)
Alam A
2002-01-01
Full Text Available Gonococcal infection remains still a major cause of morbidity among sexually active individuals. Diagnosis of the infection in a female case is more difficult than that in a male. This was a prospective study among 269 female commercial sex workers (CSWs to screen them for gonococcal infection, comparing the rapid method of identification of gonococci by polymerase chain reaction (PCR with the selective culture method. A total of 92 (34.2% CSWs were identified positive for Neisseria gonorrhoeae by combination of the two methods. The PCR method identified 87 of the specimens to harbour cppB gene of N. gonorrhoeae, whereas culture method identified 83 specimens showing colonies of gonococci. Taking into consideration of the total positive cases (92, the PCR method showed a sensitivity of 94.57%, whereas sensitivity of culture method was 90.22%. The selective culture method appears to be the most applicable in the identification of gonococci from clinical specimens, particularly in the less resourceful countries like Bangladesh.
Directory of Open Access Journals (Sweden)
Iveta Svobodová
Full Text Available Detection and characterization of circulating cell-free fetal DNA (cffDNA from maternal circulation requires an extremely sensitive and precise method due to very low cffDNA concentration. In our study, droplet digital PCR (ddPCR was implemented for fetal RHD genotyping from maternal plasma to compare this new quantification alternative with real-time PCR (qPCR as a golden standard for quantitative analysis of cffDNA. In the first stage of study, a DNA quantification standard was used. Clinical samples, including 10 non-pregnant and 35 pregnant women, were analyzed as a next step. Both methods' performance parameters-standard curve linearity, detection limit and measurement precision-were evaluated. ddPCR in comparison with qPCR has demonstrated sufficient sensitivity for analysing of cffDNA and determination of fetal RhD status from maternal circulation, results of both methods strongly correlated. Despite the more demanding workflow, ddPCR was found to be slightly more precise technology, as evaluated using quantitative standard. Regarding the clinical samples, the precision of both methods equalized with decreasing concentrations of tested DNA samples. In case of cffDNA with very low concentrations, variance parameters of both techniques were comparable. Detected levels of fetal cfDNA in maternal plasma were slightly higher than expected and correlated significantly with gestational age as measured by both methods (ddPCR r = 0.459; qPCR r = 0.438.
Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay
Directory of Open Access Journals (Sweden)
Gaya Prasad
2013-06-01
Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557
An easy 'one tube' method to estimate viability of Cryptosporidium oocysts using real-time qPCR
Paziewska-Harris, A.; Schoone, G.; Schallig, H. D. F. H.
2016-01-01
Viability estimation of the highly resistant oocysts of Cryptosporidium remains a key issue for the monitoring and control of this pathogen. We present here a simple 'one tube' quantitative PCR (qPCR) protocol for viability estimation using a DNA extraction protocol which preferentially solubilizes
International Nuclear Information System (INIS)
Maria Lina R; Andi Yasmon
2011-01-01
There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)
Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.
Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S
2015-11-01
The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Study the Three Extraction Methods for HBV DNA to Use in PCR
Directory of Open Access Journals (Sweden)
N. Sheikh
2004-07-01
Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.
Directory of Open Access Journals (Sweden)
Gadani F
2014-12-01
Full Text Available Analytical methods based on the polymerase chain reaction (PCR technology are increasingly used for the detection of deoxyribonucleic acid (DNA sequences associated with genetically modified organisms (GMOs. In the European Union and Switzerland, mandatory labeling of novel foods and food ingredients consisting of, or containing GMOs is required according to food regulations and is triggered by the presence of newly introduced foreign DNA sequences, or newly expressed proteins. In order to meet regulatory and consumer demand, numerous PCR-based methods have been developed which can detect, identify and quantify GMOs in agricultural crops, food and feed. Moreover, the determination of genetic identity allows for segregation and traceability (identity preservation throughout the supply chain of GM crops that have been enhanced with value-added quality traits. Prerequisites for GMO detection include a minimum amount of the target gene and prior knowledge of the type of genetic modification, such as virus or insect resistance traits, including controlling elements (promoters and terminators. Moreover, DNA extraction and purification is a critical step for the preparation of PCR-quality samples, particularly for processed agricultural crops such as tobacco. This paper reviews the state-of-the-art of PCR-based method development for the qualitative and quantitative determination and identification of GMOs, and includes a short summary of official and validated GMO detection methods.
Directory of Open Access Journals (Sweden)
Huiling Qiu
Full Text Available DNA vector-encoded Tough Decoy (TuD miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer, which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD vector in which only two sets of shorter oligonucleotides (< 60 mer were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324 were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo.
Nested PCR and RFLP analysis based on the 16S rRNA gene
Current phytoplasma detection and identification method is primarily based on nested PCR followed by restriction fragment length polymorphism analysis and gel electrophoresis. This method can potentially detect and differentiate all phytoplasmas including those previously not described. The present ...
Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi
2016-01-01
A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.
Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David
2014-08-01
The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.
Molecular typing of uropathogenic E. coli strains by the ERIC-PCR method.
Ardakani, Maryam Afkhami; Ranjbar, Reza
2016-04-01
Escherichia coli (E. coli) is the most common cause of urinary infections in hospitals. The aim of this study was to evaluate the ERIC-PCR method for molecular typing of uropathogenic E. coli strains isolated from hospitalized patients. In a cross sectional study, 98 E. coli samples were collected from urine samples taken from patients admitted to Baqiyatallah Hospital from June 2014 to January 2015. The disk agar diffusion method was used to determine antibiotic sensitivity. DNA proliferation based on repetitive intergenic consensus was used to classify the E. coli strains. The products of proliferation were electrophoresed on 1.5% agarose gel, and their dendrograms were drawn. The data were analyzed by online Insillico software. The method used in this research proliferated numerous bands (4-17 bands), ranging from 100 to 3000 base pairs. The detected strains were classified into six clusters (E1-E6) with 70% similarity between them. In this study, uropathogenic E. coli strains belonged to different genotypic clusters. It was found that ERIC-PCR had good differentiation power for molecular typing of uropathogenic E. coli strains isolated from the patients in the study.
PCR-Based Seamless Genome Editing with High Efficiency and Fidelity in Escherichia coli
DEFF Research Database (Denmark)
Liu, Yilan; Yang, Maohua; Yan, Daojiang
2016-01-01
Efficiency and fidelity are the key obstacles for genome editing toolboxes. In the present study, a PCR-based tandem repeat assisted genome editing (TRAGE) method with high efficiency and fidelity was developed. The design of TRAGE is based on the mechanism of repair of spontaneous double...... for seamlessly deleting, substituting and inserting targeted genes using PCR products. The effects of different manipulations including sucrose addition time, subculture times in LB with sucrose and stages of inoculation on the efficiency were investigated. With our recommended procedure, seamless excision...... of cat-sacB cassette can be realized in 48 h efficiently. We believe that the developed method has great potential for seamless genome editing in E. coli....
De Spiegelaere, Ward; Malatinkova, Eva; Lynch, Lindsay; Van Nieuwerburgh, Filip; Messiaen, Peter; O'Doherty, Una; Vandekerckhove, Linos
2014-06-01
Quantification of integrated proviral HIV DNA by repetitive-sampling Alu-HIV PCR is a candidate virological tool to monitor the HIV reservoir in patients. However, the experimental procedures and data analysis of the assay are complex and hinder its widespread use. Here, we provide an improved and simplified data analysis method by adopting binomial and Poisson statistics. A modified analysis method on the basis of Poisson statistics was used to analyze the binomial data of positive and negative reactions from a 42-replicate Alu-HIV PCR by use of dilutions of an integration standard and on samples of 57 HIV-infected patients. Results were compared with the quantitative output of the previously described Alu-HIV PCR method. Poisson-based quantification of the Alu-HIV PCR was linearly correlated with the standard dilution series, indicating that absolute quantification with the Poisson method is a valid alternative for data analysis of repetitive-sampling Alu-HIV PCR data. Quantitative outputs of patient samples assessed by the Poisson method correlated with the previously described Alu-HIV PCR analysis, indicating that this method is a valid alternative for quantifying integrated HIV DNA. Poisson-based analysis of the Alu-HIV PCR data enables absolute quantification without the need of a standard dilution curve. Implementation of the CI estimation permits improved qualitative analysis of the data and provides a statistical basis for the required minimal number of technical replicates. © 2014 The American Association for Clinical Chemistry.
Identification of circulating miRNA biomarkers based on global quantitative real-time PCR profiling
Directory of Open Access Journals (Sweden)
Kang Kang
2012-02-01
Full Text Available Abstract MicroRNAs (miRNAs are small noncoding RNAs (18-25 nucleotides that regulate gene expression at the post-transcriptional level. Recent studies have demonstrated the presence of miRNAs in the blood circulation. Deregulation of miRNAs in serum or plasma has been associated with many diseases including cancers and cardiovascular diseases, suggesting the possible use of miRNAs as diagnostic biomarkers. However, the detection of the small amount of miRNAs found in serum or plasma requires a method with high sensitivity and accuracy. Therefore, the current study describes polymerase chain reaction (PCR-based methods for measuring circulating miRNAs. Briefly, the procedure involves four major steps: (1 sample collection and preparation; (2 global miRNAs profiling using quantitative real-time PCR (qRT-PCR; (3 data normalization and analysis; and (4 selection and validation of miRNA biomarkers. In conclusion, qRT-PCR is a promising method for profiling of circulating miRNAs as biomarkers.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Karolina Stojowska
Full Text Available We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s, while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR, whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR. The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.
Stojowska, Karolina; Krawczyk, Beata
2014-01-01
We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.
Energy Technology Data Exchange (ETDEWEB)
Woodrick, Jordan; Gupta, Suhani; Khatkar, Pooja; Dave, Kalpana; Levashova, Darya; Choudhury, Sujata; Elias, Hadi; Saha, Tapas; Mueller, Susette; Roy, Rabindra, E-mail: rr228@georgetown.edu
2015-05-15
Highlights: • A method of monitoring lesion-specific recruitment of proteins in vivo is described. • Recruitment of repair enzymes to abasic sites is monitored by co-localization. • Repair protein recruitment is consistent with known protein–protein relationships. • Cells demonstrated complete repair of abasic sites by 90 min. - Abstract: DNA–protein relationships have been studied by numerous methods, but a particular gap in methodology lies in the study of DNA adduct-specific interactions with proteins in vivo, which particularly affects the field of DNA repair. Using the repair of a well-characterized and ubiquitous adduct, the abasic (AP) site, as a model, we have developed a comprehensive method of monitoring DNA lesion-specific recruitment of proteins in vivo over time. We utilized a surrogate system in which a Cy3-labeled plasmid containing a single AP-site was transfected into cells, and the interaction of the labeled DNA with BER enzymes, including APE1, Polβ, LIG1, and FEN1, was monitored by immunofluorescent staining of the enzymes by Alexafluor-488-conjugated secondary antibody. The recruitment of enzymes was characterized by quantification of Cy3-Alexafluor-488 co-localization. To validate the microscopy-based method, repair of the transfected AP-site DNA was also quantified at various time points post-transfection using a real time PCR-based method. Notably, the recruitment time kinetics for each enzyme were consistent with AP-site repair time kinetics. This microscopy-based methodology is reliable in detecting the recruitment of proteins to specific DNA substrates and can be extended to study other in vivo DNA–protein relationships in any DNA sequence and in the context of any DNA structure in transfectable proliferating or quiescent cells. The method may be applied to a variety of disciplines of nucleic acid transaction pathways, including repair, replication, transcription, and recombination.
International Nuclear Information System (INIS)
Woodrick, Jordan; Gupta, Suhani; Khatkar, Pooja; Dave, Kalpana; Levashova, Darya; Choudhury, Sujata; Elias, Hadi; Saha, Tapas; Mueller, Susette; Roy, Rabindra
2015-01-01
Highlights: • A method of monitoring lesion-specific recruitment of proteins in vivo is described. • Recruitment of repair enzymes to abasic sites is monitored by co-localization. • Repair protein recruitment is consistent with known protein–protein relationships. • Cells demonstrated complete repair of abasic sites by 90 min. - Abstract: DNA–protein relationships have been studied by numerous methods, but a particular gap in methodology lies in the study of DNA adduct-specific interactions with proteins in vivo, which particularly affects the field of DNA repair. Using the repair of a well-characterized and ubiquitous adduct, the abasic (AP) site, as a model, we have developed a comprehensive method of monitoring DNA lesion-specific recruitment of proteins in vivo over time. We utilized a surrogate system in which a Cy3-labeled plasmid containing a single AP-site was transfected into cells, and the interaction of the labeled DNA with BER enzymes, including APE1, Polβ, LIG1, and FEN1, was monitored by immunofluorescent staining of the enzymes by Alexafluor-488-conjugated secondary antibody. The recruitment of enzymes was characterized by quantification of Cy3-Alexafluor-488 co-localization. To validate the microscopy-based method, repair of the transfected AP-site DNA was also quantified at various time points post-transfection using a real time PCR-based method. Notably, the recruitment time kinetics for each enzyme were consistent with AP-site repair time kinetics. This microscopy-based methodology is reliable in detecting the recruitment of proteins to specific DNA substrates and can be extended to study other in vivo DNA–protein relationships in any DNA sequence and in the context of any DNA structure in transfectable proliferating or quiescent cells. The method may be applied to a variety of disciplines of nucleic acid transaction pathways, including repair, replication, transcription, and recombination
Nigro, Mónica G; Figueroa, Carlos; Ledesma, Bibiana A
2014-01-01
Toxoplasmosis is an opportunistic infection caused by the parasite Toxoplasma gondii. The infection is severe and difficult to diagnose in patients receiving allogeneic hematopoietic stem cell transplantation (HSCT). Twelve patients receiving HSCT were monitored post-transplant, by qualitative PCR at the Children's Hospital S.A.M.I.C. "Prof. Dr. Juan P. Garrahan". The monitoring of these patients was defined by a history of positive serology for toxoplasmosis in the donor or recipient and because their hematologic condition did not allow the use of trimethoprim-sulfamethoxazole for prophylaxis. During the patients' monitoring, two of them with positive PCR results showed signs of illness by T. gondii and were treated with pyrimethamine-clindamycin. In two other patients, toxoplasmosis was the cause of death and an autopsy finding, showing negative PCR results. Four patients without clinical manifestations received treatment for toxoplasmosis because of positive PCR detection. In four patients there were no signs of toxoplasmosis disease and negative PCR results during follow-up. The qualitative PCR technique proved useful for the detection of toxoplasmosis reactivation in HSCT recipients, but has limitations in monitoring and making clinical decisions due to the persistence of positive PCR over time and manifestations of toxicity caused by the treatment. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.
Srůtková, Dagmar; Spanova, Alena; Spano, Miroslav; Dráb, Vladimír; Schwarzer, Martin; Kozaková, Hana; Rittich, Bohuslav
2011-10-01
Bifidobacterium longum is considered to play an important role in health maintenance of the human gastrointestinal tract. Probiotic properties of bifidobacterial isolates are strictly strain-dependent and reliable methods for the identification and discrimination of this species at both subspecies and strain levels are thus required. Differentiation between B. longum ssp. longum and B. longum ssp. infantis is difficult due to high genomic similarities. In this study, four molecular-biological methods (species- and subspecies-specific PCRs, random amplified polymorphic DNA (RAPD) method using 5 primers, repetitive sequence-based (rep)-PCR with BOXA1R and (GTG)(5) primers and amplified ribosomal DNA restriction analysis (ARDRA)) and biochemical analysis, were compared for the classification of 30 B. longum strains (28 isolates and 2 collection strains) on subspecies level. Strains originally isolated from the faeces of breast-fed healthy infants (25) and healthy adults (3) showed a high degree of genetic homogeneity by PCR with subspecies-specific primers and rep-PCR. When analysed by RAPD, the strains formed many separate clusters without any potential for subspecies discrimination. These methods together with arabionose/melezitose fermentation analysis clearly differentiated only the collection strains into B. longum ssp. longum and B. longum ssp. infantis at the subspecies level. On the other hand, ARDRA analysis differentiated the strains into the B. longum/infantis subspecies using the cleavage analysis of genus-specific amplicon with just one enzyme, Sau3AI. According to our results the majority of the strains belong to the B. longum ssp. infantis (75%). Therefore we suggest ARDRA using Sau3AI restriction enzyme as the first method of choice for distinguishing between B. longum ssp. longum and B. longum ssp. infantis. Copyright © 2011 Elsevier B.V. All rights reserved.
Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.
Qin, Li-Xuan; Beyer, Richard P; Hudson, Francesca N; Linford, Nancy J; Morris, Daryl E; Kerr, Kathleen F
2006-01-17
There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch) and a sequence-based method of background adjustment (as in gcRMA) as the most important factors in methods' performances. However, we found poor reliability for methods using mismatch probes for low-intensity genes
Evaluation of methods for oligonucleotide array data via quantitative real-time PCR
Directory of Open Access Journals (Sweden)
Morris Daryl E
2006-01-01
Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods
Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.
Lee, Seong-Hun
2014-11-01
There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
Lock, Martin; Alvira, Mauricio R; Chen, Shu-Jen; Wilson, James M
2014-04-01
Accurate titration of adeno-associated viral (AAV) vector genome copies is critical for ensuring correct and reproducible dosing in both preclinical and clinical settings. Quantitative PCR (qPCR) is the current method of choice for titrating AAV genomes because of the simplicity, accuracy, and robustness of the assay. However, issues with qPCR-based determination of self-complementary AAV vector genome titers, due to primer-probe exclusion through genome self-annealing or through packaging of prematurely terminated defective interfering (DI) genomes, have been reported. Alternative qPCR, gel-based, or Southern blotting titering methods have been designed to overcome these issues but may represent a backward step from standard qPCR methods in terms of simplicity, robustness, and precision. Droplet digital PCR (ddPCR) is a new PCR technique that directly quantifies DNA copies with an unparalleled degree of precision and without the need for a standard curve or for a high degree of amplification efficiency; all properties that lend themselves to the accurate quantification of both single-stranded and self-complementary AAV genomes. Here we compare a ddPCR-based AAV genome titer assay with a standard and an optimized qPCR assay for the titration of both single-stranded and self-complementary AAV genomes. We demonstrate absolute quantification of single-stranded AAV vector genomes by ddPCR with up to 4-fold increases in titer over a standard qPCR titration but with equivalent readout to an optimized qPCR assay. In the case of self-complementary vectors, ddPCR titers were on average 5-, 1.9-, and 2.3-fold higher than those determined by standard qPCR, optimized qPCR, and agarose gel assays, respectively. Droplet digital PCR-based genome titering was superior to qPCR in terms of both intra- and interassay precision and is more resistant to PCR inhibitors, a desirable feature for in-process monitoring of early-stage vector production and for vector genome biodistribution
Jacobs, D E; Zhu, X; Gasser, R B; Chilton, N B
1997-11-01
Genomic DNA was extracted from ascaridoid nematodes collected from dogs, foxes and cats. A region spanning the second internal transcribed spacer (ITS-2) of the ribosomal DNA of each sample was amplified by PCR. Representative ITS-2 products for each nematode species (Toxocara canis, Toxocara cati and Toxascaris leonina) were sequenced. Restriction sites were identified for use as genetic markers in a PCR-linked RFLP assay. The three species could be differentiated from each other and from other ascaridoids that may be found in human tissues by use of two endonucleases, HinfI and RsaI. Primers were designed to unique regions of the ITS-2 sequences of the three species for use in diagnostic PCR procedures and primer sets evaluated against panels of homologous and heterologous DNA samples. Results suggest that both methods are good candidates for further development for the detection and/or identification of ascaridoid larvae in human tissues.
Using Real-Time PCR as a tool for monitoring the authenticity of commercial coffees.
Ferreira, Thiago; Farah, Adriana; Oliveira, Tatiane C; Lima, Ivanilda S; Vitório, Felipe; Oliveira, Edna M M
2016-05-15
Coffee is one of the main food products commercialized in the world. Its considerable market value among food products makes it susceptible to adulteration, especially with cereals. Therefore, the objective of this study was to develop a method based on Real-Time Polymerase Chain Reaction (PCR) for detection of cereals in commercial ground roast and soluble coffees. After comparison with standard curves obtained by serial dilution of DNA extracted from barley, corn and rice, the method was sensitive and specific to quantify down to 0.6 pg, 14 pg and 16 pg of barley, corn and rice DNA, respectively. To verify the applicability of the method, 30 commercial samples obtained in different countries were evaluated and those classified as gourmets or superior did not present the tested cereals DNA. However, barley was detected in various traditional (cheaper) samples from South America. In addition, corn and rice were also detected in different samples. Real-Time PCR showed to be suitable for detection of food adulterants in commercial ground roast and soluble coffees. Copyright © 2015 Elsevier Ltd. All rights reserved.
Arbitrarily primed PCR- A rapid and simple method for typing of leptospiral serovars
Directory of Open Access Journals (Sweden)
Ramadass P
2002-01-01
Full Text Available PURPOSE: To investigate the use of arbitrarily primed polymerase chain reaction (AP-PCR for typing of leptospiral serovars. METHODS: AP-PCR was adopted for identification of laboratory strains of leptospires and leptospiral cultures at serovar level. A primer of 12 bp was used for amplifying DNA of 13 laboratory strains of leptospires as well as culture pellets of leptospires. RESULTS: Each serovar produced distinct DNA fingerprint which was characteristic for each serovar. These patterns were used for typing of 81 serum culture samples obtained from human leptospiral cases. Of these samples, 39 could be typed based on AP-PCR fingerprints belonging to serovars autumnalis, pomona, canicola, javanica, icterohaemorrhagiae, patoc and pyrogenes. These results were confirmed by RAPD fingerprinting of the DNA samples of the respective leptospiral serovars after culturing -FNx01them in EMJH media. One of the important findings of this work was that straight culture sample could be used for AP-PCR assay, without purification of DNA. By having more number of AP-PCR reference fingerprints, more serovars could be typed. CONCLUSIONS: AP-PCR technique provides great potential for simple and rapid identification of leptospires at serovar level, which could be useful in molecular epidemiological studies of leptospirosis.
Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi
2017-10-01
Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.
Saingam, Prakit; Li, Bo; Yan, Tao
2018-06-01
DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.
PCR-RFLP diagnostic method for identifying Globodera species in Slovenia
Directory of Open Access Journals (Sweden)
Sasa ŠIRCA
2011-01-01
Full Text Available Species identification within the genus Globodera is based on the morphological and morphometrical characters of the cysts and second stage juveniles, and these are included in the majority of identification keys. Morphometrical methods are fast and can be applied to most of samples but they demand a trained and experienced specialist. Furthermore, some morphometrical characters may overlap between populations and beetwen species, leading to inaccurate identification. To confirm and complement the morphometrical identification of Globodera species molecular methods have been developed. Sequences of the internal transcribed spacer regions ITS1 and ITS2 of the rDNA gene cluster proved to be useful for identifying nematode species identification. A PCR-RFLP molecular method was used to identify Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae. Globodera rostochiensis, G. pallida, G. tabacum and G. achilleae can be distinguished with PCR-RFLP analysis of the rDNA ITS fragment using five restriction enzymes. The RFLP patterns of G. rostochiensis, G. tabacum and G. achilleae were species-specific, while those of G. pallida varied. South American populations of G. pallida differed from other populations as their RFLP patterns were demonstrated to be distinct by in silico restriction of the ITS sequences deposited at NCBI.
A Security Monitoring Method Based on Autonomic Computing for the Cloud Platform
Directory of Open Access Journals (Sweden)
Jingjie Zhang
2018-01-01
Full Text Available With the continuous development of cloud computing, cloud security has become one of the most important issues in cloud computing. For example, data stored in the cloud platform may be attacked, and its security is difficult to be guaranteed. Therefore, we must attach weight to the issue of how to protect the data stored in the cloud. To protect data, data monitoring is a necessary process. Based on autonomic computing, we develop a cloud data monitoring system on the cloud platform, monitoring whether the data is abnormal in the cycle and analyzing the security of the data according to the monitored results. In this paper, the feasibility of the scheme can be verified through simulation. The results show that the proposed method can adapt to the dynamic change of cloud platform load, and it can also accurately evaluate the degree of abnormal data. Meanwhile, by adjusting monitoring frequency automatically, it improves the accuracy and timeliness of monitoring. Furthermore, it can reduce the monitoring cost of the system in normal operation process.
A novel mean-centering method for normalizing microRNA expression from high-throughput RT-qPCR data
Directory of Open Access Journals (Sweden)
Wylie Dennis
2011-12-01
Full Text Available Abstract Background Normalization is critical for accurate gene expression analysis. A significant challenge in the quantitation of gene expression from biofluids samples is the inability to quantify RNA concentration prior to analysis, underscoring the need for robust normalization tools for this sample type. In this investigation, we evaluated various methods of normalization to determine the optimal approach for quantifying microRNA (miRNA expression from biofluids and tissue samples when using the TaqMan® Megaplex™ high-throughput RT-qPCR platform with low RNA inputs. Findings We compared seven normalization methods in the analysis of variation of miRNA expression from biofluid and tissue samples. We developed a novel variant of the common mean-centering normalization strategy, herein referred to as mean-centering restricted (MCR normalization, which is adapted to the TaqMan Megaplex RT-qPCR platform, but is likely applicable to other high-throughput RT-qPCR-based platforms. Our results indicate that MCR normalization performs comparable to or better than both standard mean-centering and other normalization methods. We also propose an extension of this method to be used when migrating biomarker signatures from Megaplex to singleplex RT-qPCR platforms, based on the identification of a small number of normalizer miRNAs that closely track the mean of expressed miRNAs. Conclusions We developed the MCR method for normalizing miRNA expression from biofluids samples when using the TaqMan Megaplex RT-qPCR platform. Our results suggest that normalization based on the mean of all fully observed (fully detected miRNAs minimizes technical variance in normalized expression values, and that a small number of normalizer miRNAs can be selected when migrating from Megaplex to singleplex assays. In our study, we find that normalization methods that focus on a restricted set of miRNAs tend to perform better than methods that focus on all miRNAs, including
Nucleic acid extraction, oligonucleotide probes and PCR methods
International Nuclear Information System (INIS)
Zhongtang Yu; Forster, R.J.
2005-01-01
Complex microbiomes of rumen and gastrointestinal tracts. Bacteria, fungi and protozoa, present in rumen and gastrointestinal (GI) tracts, interact with feed, with each other, and with their host animals, resulting in a complex symbiotic microbiota of distinctive composition and structure. Such microbiota is dynamic and highly responsive to a variety of biotic and abiotic factors, such as diet, feed additives, age, health and physiological status of the host animal, geographical locations, season and feeding regimen (reviewed in Ref. [39]). This symbiotic microbiota has been the focus of microbial research for over half a century in search for improved ruminant nutrition. Before the advent of molecular biology techniques, microorganisms in rumen and GI tracts, as in other habitats, were studied with cultivation-based techniques, which only allows for the isolation and characterization of a limited number of readily culturable species. As estimated, there are more than 400 species of bacteria and up to 100 species of protozoa and fungi inhabiting rumen and GI tracts. In human GI tracts, as much as 60% of these members cannot be isolated on agar plates and, thus, remain unknown. In ruminants, although it is not known, the culturable species of the microbiota are probably in the same range. Even among the culturable species, probably only some of them have been isolated and described. The application of cultivation-independent, more sensitive and accurate molecular techniques to the study of ruminal and GI microorganisms provided an alternative to directly examining the diversity and the community structure of ruminal and GI microbiota on the basis of genotypes, instead of phenotypes. Both polymerase chain reaction (PCR)-based methods, such as denaturing gradient gel electrophoresis (DGGE), ribosomal intergenic spacer analysis, terminal restriction fragment length polymorphism, cloning and sequencing of PCR amplicons and amplified 16S ribosomal DNA restriction
Seo, K H; Valentin-Bon, I E; Brackett, R E
2006-03-01
Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.
DNA microarray-based PCR ribotyping of Clostridium difficile.
Schneeberg, Alexander; Ehricht, Ralf; Slickers, Peter; Baier, Vico; Neubauer, Heinrich; Zimmermann, Stefan; Rabold, Denise; Lübke-Becker, Antina; Seyboldt, Christian
2015-02-01
This study presents a DNA microarray-based assay for fast and simple PCR ribotyping of Clostridium difficile strains. Hybridization probes were designed to query the modularly structured intergenic spacer region (ISR), which is also the template for conventional and PCR ribotyping with subsequent capillary gel electrophoresis (seq-PCR) ribotyping. The probes were derived from sequences available in GenBank as well as from theoretical ISR module combinations. A database of reference hybridization patterns was set up from a collection of 142 well-characterized C. difficile isolates representing 48 seq-PCR ribotypes. The reference hybridization patterns calculated by the arithmetic mean were compared using a similarity matrix analysis. The 48 investigated seq-PCR ribotypes revealed 27 array profiles that were clearly distinguishable. The most frequent human-pathogenic ribotypes 001, 014/020, 027, and 078/126 were discriminated by the microarray. C. difficile strains related to 078/126 (033, 045/FLI01, 078, 126, 126/FLI01, 413, 413/FLI01, 598, 620, 652, and 660) and 014/020 (014, 020, and 449) showed similar hybridization patterns, confirming their genetic relatedness, which was previously reported. A panel of 50 C. difficile field isolates was tested by seq-PCR ribotyping and the DNA microarray-based assay in parallel. Taking into account that the current version of the microarray does not discriminate some closely related seq-PCR ribotypes, all isolates were typed correctly. Moreover, seq-PCR ribotypes without reference profiles available in the database (ribotype 009 and 5 new types) were correctly recognized as new ribotypes, confirming the performance and expansion potential of the microarray. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
DEFF Research Database (Denmark)
Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen
2011-01-01
Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...
An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period
Directory of Open Access Journals (Sweden)
Antonio Olmos
2008-01-01
Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.
Directory of Open Access Journals (Sweden)
Fatemeh Dehghan
2014-11-01
Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.
Ciofi, Claudio; Tzika, Athanasia C; Natali, Chiara; Watts, Phillip C; Sulandari, Sri; Zein, Moch S A; Milinkovitch, Michel C
2011-05-01
Multiplex PCR assays for the coamplification of microsatellite loci allow rapid and cost-effective genetic analyses and the production of efficient screening protocols for international breeding programs. We constructed a partial genomic library enriched for di-nucleotide repeats and characterized 14 new microsatellite loci for the Komodo monitor (or Komodo dragon, Varanus komodoensis). Using these novel microsatellites and four previously described loci, we developed multiplex PCR assays that may be loaded on a genetic analyser in three separate panels. We tested the novel set of microsatellites for polymorphism using 69 individuals from three island populations and evaluated the resolving power of the entire panel of 18 loci by conducting (i) a preliminary assignment test to determine population(s) of origin and (ii) a parentage analysis for 43 captive Komodo monitors. This panel of polymorphic loci proved useful for both purposes and thus can be exploited for fine-scale population genetic analyses and as part of international captive breeding programs directed at maintaining genetically viable ex situ populations and reintroductions. © 2011 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Yoshikawa, S.; Saiki, A.; Ugolini, D.; Ozawa, K.
1996-01-01
The main objective of this paper is to develop an advanced diagnosis system based on the artificial intelligence technique to monitor the operation and to improve the operational safety of nuclear power plants. Three different methods have been elaborated in this study: an artificial neural network local diagnosis (NN ds ) scheme that acting at the component level discriminates between normal and abnormal transients, a model-based diagnostic reasoning mechanism that combines a physical causal network model-based knowledge compiler (KC) that generates applicable diagnostic rules from widely accepted physical knowledge compiler (KC) that generates applicable diagnostic rules from widely accepted physical knowledge. Although the three methods have been developed and verified independently, they are highly correlated and, when connected together, form a effective and robust diagnosis and monitoring tool. (authors)
PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains
Directory of Open Access Journals (Sweden)
Nowak Magdalena
2009-11-01
Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
Is qPCR a Reliable Indicator of Cyanotoxin Risk in Freshwater?
Pacheco, Ana Beatriz F.; Guedes, Iame A.; Azevedo, Sandra M.F.O.
2016-01-01
The wide distribution of cyanobacteria in aquatic environments leads to the risk of water contamination by cyanotoxins, which generate environmental and public health issues. Measurements of cell densities or pigment contents allow both the early detection of cellular growth and bloom monitoring, but these methods are not sufficiently accurate to predict actual cyanobacterial risk. To quantify cyanotoxins, analytical methods are considered the gold standards, but they are laborious, expensive, time-consuming and available in a limited number of laboratories. In cyanobacterial species with toxic potential, cyanotoxin production is restricted to some strains, and blooms can contain varying proportions of both toxic and non-toxic cells, which are morphologically indistinguishable. The sequencing of cyanobacterial genomes led to the description of gene clusters responsible for cyanotoxin production, which paved the way for the use of these genes as targets for PCR and then quantitative PCR (qPCR). Thus, the quantification of cyanotoxin genes appeared as a new method for estimating the potential toxicity of blooms. This raises a question concerning whether qPCR-based methods would be a reliable indicator of toxin concentration in the environment. Here, we review studies that report the parallel detection of microcystin genes and microcystin concentrations in natural populations and also a smaller number of studies dedicated to cylindrospermopsin and saxitoxin. We discuss the possible issues associated with the contradictory findings reported to date, present methodological limitations and consider the use of qPCR as an indicator of cyanotoxin risk. PMID:27338471
Is qPCR a Reliable Indicator of Cyanotoxin Risk in Freshwater?
Directory of Open Access Journals (Sweden)
Ana Beatriz F. Pacheco
2016-06-01
Full Text Available The wide distribution of cyanobacteria in aquatic environments leads to the risk of water contamination by cyanotoxins, which generate environmental and public health issues. Measurements of cell densities or pigment contents allow both the early detection of cellular growth and bloom monitoring, but these methods are not sufficiently accurate to predict actual cyanobacterial risk. To quantify cyanotoxins, analytical methods are considered the gold standards, but they are laborious, expensive, time-consuming and available in a limited number of laboratories. In cyanobacterial species with toxic potential, cyanotoxin production is restricted to some strains, and blooms can contain varying proportions of both toxic and non-toxic cells, which are morphologically indistinguishable. The sequencing of cyanobacterial genomes led to the description of gene clusters responsible for cyanotoxin production, which paved the way for the use of these genes as targets for PCR and then quantitative PCR (qPCR. Thus, the quantification of cyanotoxin genes appeared as a new method for estimating the potential toxicity of blooms. This raises a question concerning whether qPCR-based methods would be a reliable indicator of toxin concentration in the environment. Here, we review studies that report the parallel detection of microcystin genes and microcystin concentrations in natural populations and also a smaller number of studies dedicated to cylindrospermopsin and saxitoxin. We discuss the possible issues associated with the contradictory findings reported to date, present methodological limitations and consider the use of qPCR as an indicator of cyanotoxin risk.
Directory of Open Access Journals (Sweden)
Duborjal Hervé
2008-02-01
Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized
Y Tao, S.; Zhang, X. Z.; Cai, H. W.; Li, P.; Feng, Y.; Zhang, T. C.; Li, J.; Wang, W. S.; Zhang, X. K.
2017-12-01
The pulse current method for partial discharge detection is generally applied in type testing and other off-line tests of electrical equipment at delivery. After intensive analysis of the present situation and existing problems of partial discharge detection in switch cabinets, this paper designed the circuit principle and signal extraction method for partial discharge on-line detection based on a high-voltage presence indicating systems (VPIS), established a high voltage switch cabinet partial discharge on-line detection circuit based on the pulse current method, developed background software integrated with real-time monitoring, judging and analyzing functions, carried out a real discharge simulation test on a real-type partial discharge defect simulation platform of a 10KV switch cabinet, and verified the sensitivity and validity of the high-voltage switch cabinet partial discharge on-line monitoring device based on the pulse current method. The study presented in this paper is of great significance for switch cabinet maintenance and theoretical study on pulse current method on-line detection, and has provided a good implementation method for partial discharge on-line monitoring devices for 10KV distribution network equipment.
Nucleic acids-based tools for ballast water surveillance, monitoring, and research
Darling, John A.; Frederick, Raymond M.
2018-03-01
Understanding the risks of biological invasion posed by ballast water-whether in the context of compliance testing, routine monitoring, or basic research-is fundamentally an exercise in biodiversity assessment, and as such should take advantage of the best tools available for tackling that problem. The past several decades have seen growing application of genetic methods for the study of biodiversity, driven in large part by dramatic technological advances in nucleic acids analysis. Monitoring approaches based on such methods have the potential to increase dramatically sampling throughput for biodiversity assessments, and to improve on the sensitivity, specificity, and taxonomic accuracy of traditional approaches. The application of targeted detection tools (largely focused on PCR but increasingly incorporating novel probe-based methodologies) has led to a paradigm shift in rare species monitoring, and such tools have already been applied for early detection in the context of ballast water surveillance. Rapid improvements in community profiling approaches based on high throughput sequencing (HTS) could similarly impact broader efforts to catalogue biodiversity present in ballast tanks, and could provide novel opportunities to better understand the risks of biotic exchange posed by ballast water transport-and the effectiveness of attempts to mitigate those risks. These various approaches still face considerable challenges to effective implementation, depending on particular management or research needs. Compliance testing, for instance, remains dependent on accurate quantification of viable target organisms; while tools based on RNA detection show promise in this context, the demands of such testing require considerable additional investment in methods development. In general surveillance and research contexts, both targeted and community-based approaches are still limited by various factors: quantification remains a challenge (especially for taxa in larger size
Muraosa, Yasunori; Toyotome, Takahito; Yahiro, Maki; Watanabe, Akira; Shikanai-Yasuda, Maria Aparecida; Kamei, Katsuhiko
2016-05-01
We developed new cycling probe-based real-time PCR and nested real-time PCR assays for the detection of Histoplasma capsulatum that were designed to detect the gene encoding N-acetylated α-linked acidic dipeptidase (NAALADase), which we previously identified as an H. capsulatum antigen reacting with sera from patients with histoplasmosis. Both assays specifically detected the DNAs of all H. capsulatum strains but not those of other fungi or human DNA. The limited of detection (LOD) of the real-time PCR assay was 10 DNA copies when using 10-fold serial dilutions of the standard plasmid DNA and 50 DNA copies when using human serum spiked with standard plasmid DNA. The nested real-time PCR improved the LOD to 5 DNA copies when using human serum spiked with standard plasmid DNA, which represents a 10-fold higher than that observed with the real-time PCR assay. To assess the ability of the two assays to diagnose histoplasmosis, we analyzed a small number of clinical specimens collected from five patients with histoplasmosis, such as sera (n = 4), formalin-fixed paraffin-embedded (FFPE) tissue (n = 4), and bronchoalveolar lavage fluid (BALF) (n = 1). Although clinical sensitivity of the real-time PCR assay was insufficiently sensitive (33%), the nested real-time PCR assay increased the clinical sensitivity (77%), suggesting it has a potential to be a useful method for detecting H. capsulatum DNA in clinical specimens. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Daranas, Núria; Bonaterra, Anna; Francés, Jesús; Cabrefiga, Jordi; Montesinos, Emilio; Badosa, Esther
2018-03-09
A viability qPCR (v-qPCR) assay was developed for the unambiguous detection and quantification of Lactobacillus plantarum PM411 viable cells in aerial plant surfaces. A 972 bp region of a PM411 predicted prophage with mosaic architecture enabled the identification of a PM411 strain-specific molecular marker. Three primer sets, with different amplicon lengths (92, 188, and 317 bp), and one TaqMan probe were designed. All the qPCR assays showed good linearity over a 4-log range and good efficiencies, but differed in sensitivity. The nucleic acid-binding dye PEMAX was used for selectively detecting and enumerating viable bacteria by v-qPCR. The primer set amplifying a 188 bp DNA fragment was selected as the most suitable for v-qPCR. The performance of the method was assessed on apple blossoms, pear, strawberry and kiwifruit leaves in potted plants under controlled environmental conditions, and pear and apple blossoms under field conditions, by comparing v-qPCR population estimation to those obtained by qPCR and specific plate counting on MRS-rifampicin. The population estimation did not differ significantly between methods when conditions were conducive to bacterial survival. However, under stressful conditions, differences between methods were observed due to cell death or viable but non-culturable state induction. While qPCR overestimated the population level, plate counting underestimated this value in comparison to v-qPCR. PM411 attained stable population levels of viable cells on flower environment under high relative humidity. However, the unfavourable conditions onto the leaf surface and the relatively dryness in the field caused an important decrease of viable population. IMPORTANCE The v-qPCR method in combination with plate counting and qPCR is a powerful tool for studies of colonization and survival in field conditions, to improve formulations and delivery strategies of PM411, or to optimize the dose and timing of spray schedules. It is expected that PEMAX
Basic requirements to the methods of personnel monitoring
International Nuclear Information System (INIS)
Keirim-Markus, I.B.
1981-01-01
Requirements to methods of personnel monitoring (PMM) depending on irradiation conditions are given. The irradiation conditions determine subjected to monitoring types of irradiation, measurement ranges, periodicity of monitoring, operativeness of obtaining results and required accuracy. The PMM based on the photographic effect of ionizing radiation is the main method of the mass monitoring [ru
Dolci, Paola; Cocolin, Luca
2017-08-01
This study describes the optimization and application of repetitive element-PCR (rep-PCR) technique directly on microbial DNA extracted from type I sourdoughs for fast monitoring of a Lb. plantarum starter strain (P1FMC) throughout daily back-slopping. The challenge was to follow and study the performance of a starter culture directly in sourdoughs without cultivation on selective media. The extraction of good quality microbial DNA suitable for amplification from a complex matrix such as dough was the first target. In addition, the objective to obtain a clear rep-PCR profile referable to a specific starter strain among a microbial community was pursued. Co-inoculum trials, in flour matrix, with Lb. plantarum P1FMC and L. lactis LC71 strains and, subsequently, type I sourdough back-slopping trials were performed. The rep-PCR amplification profiles obtained were clearly referable to that of Lb. plantarum P1FMC starter in both co-inoculum trials (also when it was present with one order of magnitude less with respect to L. lactis LC71) and back-slopping trials where it dominated the fermentation process with loads of 10 8 cfu g -1 and prevailed on the autochthonous microbiota. Thus, the approach proposed in this paper could be considered a methodological advancement, based on a culture-independent one-step rep-PCR, suitable for fast monitoring of starter performance. © 2017 Institute of Food Technologists®.
Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay
Directory of Open Access Journals (Sweden)
Farzaneh Lotfipour
2015-06-01
Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.
Directory of Open Access Journals (Sweden)
Tatiana Rochat
2017-09-01
Full Text Available Flavobacterium psychrophilum is a devastating bacterial pathogen of salmonids reared in freshwater worldwide. So far, serological diversity between isolates has been described but the underlying molecular factors remain unknown. By combining complete genome sequence analysis and the serotyping method proposed by Lorenzen and Olesen (1997 for a set of 34 strains, we identified key molecular determinants of the serotypes. This knowledge allowed us to develop a robust multiplex PCR-based serotyping scheme, which was applied to 244 bacterial isolates. The results revealed a striking association between PCR-serotype and fish host species and illustrate the use of this approach as a simple and cost-effective method for the determination of F. psychrophilum serogroups. PCR-based serotyping could be a useful tool in a range of applications such as disease surveillance, selection of salmonids for bacterial coldwater disease resistance and future vaccine formulation.
Optimal layout of radiological environment monitoring based on TOPSIS method
International Nuclear Information System (INIS)
Li Sufen; Zhou Chunlin
2006-01-01
TOPSIS is a method for multi-objective-decision-making, which can be applied to comprehensive assessment of environmental quality. This paper adopts it to get the optimal layout of radiological environment monitoring, it is proved that this method is a correct, simple and convenient, practical one, and beneficial to supervision departments to scientifically and reasonably layout Radiological Environment monitoring sites. (authors)
Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina
2015-01-01
Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.
Evaluation of quantitative PCR measurement of bacterial colonization of epithelial cells.
Schmidt, Marcin T; Olejnik-Schmidt, Agnieszka K; Myszka, Kamila; Borkowska, Monika; Grajek, Włodzimierz
2010-01-01
Microbial colonization is an important step in establishing pathogenic or probiotic relations to host cells and in biofilm formation on industrial or medical devices. The aim of this work was to verify the applicability of quantitative PCR (Real-Time PCR) to measure bacterial colonization of epithelial cells. Salmonella enterica and Caco-2 intestinal epithelial cell line was used as a model. To verify sensitivity of the assay a competition of the pathogen cells to probiotic microorganism was tested. The qPCR method was compared to plate count and radiolabel approach, which are well established techniques in this area of research. The three methods returned similar results. The best quantification accuracy had radiolabel method, followed by qPCR. The plate count results showed coefficient of variation two-times higher than this of qPCR. The quantitative PCR proved to be a reliable method for enumeration of microbes in colonization assay. It has several advantages that make it very useful in case of analyzing mixed populations, where several different species or even strains can be monitored at the same time.
Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.
Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D
1996-11-01
A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.
Capillary-based integrated digital PCR in picoliter droplets.
Chen, Jinyu; Luo, Zhaofeng; Li, Lin; He, Jinlong; Li, Luoquan; Zhu, Jianwei; Wu, Ping; He, Liqun
2018-01-30
The droplet digital polymerase chain reaction (ddPCR) is becoming more and more popular in diagnostic applications in academia and industry. In commercially available ddPCR systems, after they have been made by a generator, the droplets have to be transferred manually to modules for amplification and detection. In practice, some of the droplets (∼10%) are lost during manual transfer, leading to underestimation of the targets. In addition, the droplets are also at risk of cross-contamination during transfer. By contrast, in labs, some chip-based ddPCRs have been demonstrated where droplets always run in channels. However, the droplets easily coalesce to large ones in chips due to wall wetting as well as thermal oscillation. The loss of droplets becomes serious when such ddPCRs are applied to absolutely quantify rare mutations, such as in early diagnostics in clinical research or when measuring biological diversity at the cell level. Here, we propose a capillary-based integrated ddPCR system that is used for the first time to realize absolute quantification in this way. In this system, a HPLC T-junction is used to generate droplets and a long HPLC capillary connects the generator with both a capillary-based thermocycler and a capillary-based cytometer. The performance of the system is validated by absolute quantification of a gene specific to lung cancer (LunX). The results show that this system has very good linearity (0.9988) at concentrations ranging from NTC to 2.4 × 10 -4 copies per μL. As compared to qPCR, the all-in-one scheme is superior both in terms of the detection limit and the smaller fold changes measurement. The system of ddPCR might provide a powerful approach for clinical or academic applications where rare events are mostly considered.
Dreesen, Jos; Destouni, Aspasia; Kourlaba, Georgia; Degn, Birte; Mette, Wulf Christensen; Carvalho, Filipa; Moutou, Celine; Sengupta, Sioban; Dhanjal, Seema; Renwick, Pamela; Davies, Steven; Kanavakis, Emmanouel; Harton, Gary; Traeger-Synodinos, Joanne
2014-01-01
Preimplantation genetic diagnosis (PGD) for monogenic disorders currently involves polymerase chain reaction (PCR)-based methods, which must be robust, sensitive and highly accurate, precluding misdiagnosis. Twelve adverse misdiagnoses reported to the ESHRE PGD-Consortium are likely an underestimate. This retrospective study, involving six PGD centres, assessed the validity of PCR-based PGD through reanalysis of untransferred embryos from monogenic-PGD cycles. Data were collected on the genotype concordance at PGD and follow-up from 940 untransferred embryos, including details on the parameters of PGD cycles: category of monogenic disease, embryo morphology, embryo biopsy and genotype assay strategy. To determine the validity of PCR-based PGD, the sensitivity (Se), specificity (Sp) and diagnostic accuracy were calculated. Stratified analyses were also conducted to assess the influence of the parameters above on the validity of PCR-based PGD. The analysis of overall data showed that 93.7% of embryos had been correctly classified at the time of PGD, with Se of 99.2% and Sp of 80.9%. The stratified analyses found that diagnostic accuracy is statistically significantly higher when PGD is performed on two cells versus one cell (P=0.001). Se was significantly higher when multiplex protocols versus singleplex protocols were applied (P=0.005), as well as for PGD applied on cells from good compared with poor morphology embryos (P=0.032). Morphology, however, did not affect diagnostic accuracy. Multiplex PCR-based methods on one cell, are as robust as those on two cells regarding false negative rate, which is the most important criteria for clinical PGD applications. Overall, this study demonstrates the validity, robustness and high diagnostic value of PCR-based PGD. PMID:24301057
A survey of tools for the analysis of quantitative PCR (qPCR) data.
Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas
2014-09-01
Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.
Typing of Y chromosome SNPs with multiplex PCR methods
DEFF Research Database (Denmark)
Sanchez Sanchez, Juan Jose; Børsting, Claus; Morling, Niels
2005-01-01
We describe a method for the simultaneous typing of Y-chromosome single nucleotide polymorphism (SNP) markers by means of multiplex polymerase chain reaction (PCR) strategies that allow the detection of 35 Y chromosome SNPs on 25 amplicons from 100 to 200 pg of chromosomal deoxyribonucleic acid...... factors for the creation of larger SNP typing PCR multiplexes include careful selection of primers for the primary amplification and the SBE reaction, use of DNA primers with homogenous composition, and balancing the primer concentrations for both the amplification and the SBE reactions....
Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang
2018-05-01
Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Murphy, Helen R; Lee, Seulgi; da Silva, Alexandre J
2017-07-01
Cyclospora cayetanensis is a protozoan parasite that causes human diarrheal disease associated with the consumption of fresh produce or water contaminated with C. cayetanensis oocysts. In the United States, foodborne outbreaks of cyclosporiasis have been linked to various types of imported fresh produce, including cilantro and raspberries. An improved method was developed for identification of C. cayetanensis in produce at the U.S. Food and Drug Administration. The method relies on a 0.1% Alconox produce wash solution for efficient recovery of oocysts, a commercial kit for DNA template preparation, and an optimized TaqMan real-time PCR assay with an internal amplification control for molecular detection of the parasite. A single laboratory validation study was performed to assess the method's performance and compare the optimized TaqMan real-time PCR assay and a reference nested PCR assay by examining 128 samples. The samples consisted of 25 g of cilantro or 50 g of raspberries seeded with 0, 5, 10, or 200 C. cayetanensis oocysts. Detection rates for cilantro seeded with 5 and 10 oocysts were 50.0 and 87.5%, respectively, with the real-time PCR assay and 43.7 and 94.8%, respectively, with the nested PCR assay. Detection rates for raspberries seeded with 5 and 10 oocysts were 25.0 and 75.0%, respectively, with the real-time PCR assay and 18.8 and 68.8%, respectively, with the nested PCR assay. All unseeded samples were negative, and all samples seeded with 200 oocysts were positive. Detection rates using the two PCR methods were statistically similar, but the real-time PCR assay is less laborious and less prone to amplicon contamination and allows monitoring of amplification and analysis of results, making it more attractive to diagnostic testing laboratories. The improved sample preparation steps and the TaqMan real-time PCR assay provide a robust, streamlined, and rapid analytical procedure for surveillance, outbreak response, and regulatory testing of foods for
Cai, Xi; Han, Guang; Song, Xin; Wang, Jinkuan
2017-11-01
single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring. To build unconstrained monitoring environments, we propose a method to measure step length symmetry ratio (a useful gait parameter representing gait symmetry without significant relationship with age) from unconstrained straight walking using a single camera, without strict restrictions on walking directions or routes. according to projective geometry theory, we first develop a calculation formula of step length ratio for the case of unconstrained straight-line walking. Then, to adapt to general cases, we propose to modify noncollinear footprints, and accordingly provide general procedure for step length ratio extraction from unconstrained straight walking. Our method achieves a mean absolute percentage error (MAPE) of 1.9547% for 15 subjects' normal and abnormal side-view gaits, and also obtains satisfactory MAPEs for non-side-view gaits (2.4026% for 45°-view gaits and 3.9721% for 30°-view gaits). The performance is much better than a well-established monocular gait measurement system suitable only for side-view gaits with a MAPE of 3.5538%. Independently of walking directions, our method can accurately estimate step length ratios from unconstrained straight walking. This demonstrates our method is applicable for elders' daily gait monitoring to provide valuable information for elderly health care, such as abnormal gait recognition, fall risk assessment, etc. single-camera-based gait monitoring is unobtrusive, inexpensive, and easy-to-use to monitor daily gait of seniors in their homes. However, most studies require subjects to walk perpendicularly to camera's optical axis or along some specified routes, which limits its application in elderly home monitoring
Why the need for qPCR publication guidelines?--The case for MIQE.
Bustin, Stephen A
2010-04-01
The polymerase chain reaction (PCR) has matured from a labour- and time-intensive, low throughput qualitative gel-based technique to an easily automated, rapid, high throughput quantitative technology. Real-time quantitative PCR (qPCR) has become the benchmark technology for the detection and quantification of nucleic acids in a research, diagnostic, forensic and biotechnology setting. However, ill-assorted pre-assay conditions, poor assay design and inappropriate data analysis methodologies have resulted in the recurrent publication of data that are at best inconsistent and at worst irrelevant and even misleading. Furthermore, there is a lamentable lack of transparency of reporting, with the "Materials and Methods" sections of many publications, especially those with high impact factors, not fit for the purpose of evaluating the quality of any reported qPCR data. This poses a challenge to the integrity of the scientific literature, with serious consequences not just for basic research, but potentially calamitous implications for drug development and disease monitoring. These issues are being addressed by a set of guidelines that propose a minimum standard for the provision of information for qPCR experiments ("MIQE"). MIQE aims to restructure to-day's free-for-all qPCR methods into a more consistent format that will encourage detailed auditing of experimental detail, data analysis and reporting principles. General implementation of these guidelines is an important requisite for the maturing of qPCR into a robust, accurate and reliable nucleic acid quantification technology. Copyright 2009 Elsevier Inc. All rights reserved.
Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina
2006-08-14
Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Stachelska, M A
2017-09-26
The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.
Virology: The Next Generation from Digital PCR to Single Virion Genomics
Energy Technology Data Exchange (ETDEWEB)
White, Richard A.; Brazelton De Cardenas, Jessica N.; Hayden, Randall T.
2015-10-01
In the past 25 years, virology has had major technology breakthroughs stemming first from the introduction of nucleic acid amplification testing, but more recently from the use of next-generation sequencing, digital PCR, and the possibility of single virion genomics. These technologies have and will improve diagnosis and disease state monitoring in clinical settings, aid in environmental monitoring, and reveal the vast genetic potential of viruses. Using the principle of limiting dilution, digital PCR amplifies single molecules of DNA in highly partitioned endpoint reactions and reads each of those reactions as either positive or negative based on the presence or absence of target fluorophore. In this review, digital PCR will be highlighted along with current studies, advantages/disadvantages, and future perspectives with regard to digital PCR, viral load testing, and the possibility of single virion genomics.
DEFF Research Database (Denmark)
Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo
2015-01-01
The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...
Gangwar, Maulshree
2012-09-23
A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.
Gangwar, Maulshree; Waters, Alicia M.; Bej, Gautam A.; Bej, Asim K.; Mojib, Nazia
2012-01-01
A SYBR Green™ I-based real-time multiplexed PCR assay was developed targeting invA and spvB for the detection of Salmonella strains in shellfish after both hns and invA genes were identified in all Salmonella strains. Simultaneously, the 16S rRNA gene was used as a PCR internal amplification control (IAC). All 89 Salmonella strains tested in this study exhibited amplification of invA, whereas only 21 (23. 6 %) were PCR positive for spvB. The sensitivity of detection of all three targeted genes was 1 ng, which is equivalent to approximately 105 colony-forming unit (CFU) of Salmonella enterica. The analysis showed specific PCR products that were identified by reproducible melt temperature profiles (invA, 84. 27 ± 1. 7 °C; spvB, 88. 76 ± 1. 0 °C; and 16S rRNA gene, 87. 16 ± 0. 8 °C). The sensitivity of detection was 10 pg purified DNA (invA) or 105 CFU in 1 mL pure culture of S. enterica ATCC 14028. The above molecular detection method for Salmonella strains was successfully applied to the oyster homogenates (food matrix). An initial inoculum of 106 and 102 CFU Salmonella in 1 ml seeded oyster tissue homogenate was detected by multiplexed PCR for all three genes after 5 and 24 h of enrichment, respectively. Natural oysters isolated from Gulf of Mexico during the winter months exhibited negative PCR amplification results suggesting the absence of Salmonella. In contrast to conventional PCR, real-time multiplex PCR assay developed in this study is rapid and sensitive and will help Interstate Shellfish Sanitation Conference undertake appropriate measures to monitor Salmonella in oysters, thereby preventing disease outbreaks and consequently protecting consumer health. © 2012 Springer Science+Business Media, LLC.
Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H
2010-09-01
The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to
Restoring method for missing data of spatial structural stress monitoring based on correlation
Zhang, Zeyu; Luo, Yaozhi
2017-07-01
Long-term monitoring of spatial structures is of great importance for the full understanding of their performance and safety. The missing part of the monitoring data link will affect the data analysis and safety assessment of the structure. Based on the long-term monitoring data of the steel structure of the Hangzhou Olympic Center Stadium, the correlation between the stress change of the measuring points is studied, and an interpolation method of the missing stress data is proposed. Stress data of correlated measuring points are selected in the 3 months of the season when missing data is required for fitting correlation. Data of daytime and nighttime are fitted separately for interpolation. For a simple linear regression when single point's correlation coefficient is 0.9 or more, the average error of interpolation is about 5%. For multiple linear regression, the interpolation accuracy is not significantly increased after the number of correlated points is more than 6. Stress baseline value of construction step should be calculated before interpolating missing data in the construction stage, and the average error is within 10%. The interpolation error of continuous missing data is slightly larger than that of the discrete missing data. The data missing rate of this method should better not exceed 30%. Finally, a measuring point's missing monitoring data is restored to verify the validity of the method.
Directory of Open Access Journals (Sweden)
Gilad Oren
2005-03-01
Full Text Available Abstract Background Outbreaks with mass mortality among common carp Cyprinus carpio carpio and koi Cyprinus carpio koi have occurred worldwide since 1998. The herpes-like virus isolated from diseased fish is different from Herpesvirus cyprini and channel catfish virus and was accordingly designated koi herpesvirus (KHV. Diagnosis of KHV infection based on viral isolation and current PCR assays has a limited sensitivity and therefore new tools for the diagnosis of KHV infections are necessary. Results A robust and sensitive PCR assay based on a defined gene sequence of KHV was developed to improve the diagnosis of KHV infection. From a KHV genomic library, a hypothetical thymidine kinase gene (TK was identified, subcloned and expressed as a recombinant protein. Preliminary characterization of the recombinant TK showed that it has a kinase activity using dTTP but not dCTP as a substrate. A PCR assay based on primers selected from the defined DNA sequence of the TK gene was developed and resulted in a 409 bp amplified fragment. The TK based PCR assay did not amplify the DNAs of other fish herpesviruses such as Herpesvirus cyprini (CHV and the channel catfish virus (CCV. The TK based PCR assay was specific for the detection of KHV and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions. The TK based PCR was compared to previously described PCR assays and to viral culture in diseased fish and was shown to be the most sensitive method of diagnosis of KHV infection. Conclusion The TK based PCR assay developed in this work was shown to be specific for the detection of KHV. The TK based PCR assay was more sensitive for the detection of KHV than previously described PCR assays; it was as sensitive as virus isolation which is the golden standard method for KHV diagnosis and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions.
Online Condition Monitoring of Gripper Cylinder in TBM Based on EMD Method
Li, Lin; Tao, Jian-Feng; Yu, Hai-Dong; Huang, Yi-Xiang; Liu, Cheng-Liang
2017-11-01
The gripper cylinder that provides braced force for Tunnel Boring Machine (TBM) might fail due to severe vibration when the TBM excavates in the tunnel. Early fault diagnosis of the gripper cylinder is important for the safety and efficiency of the whole tunneling project. In this paper, an online condition monitoring system based on the Empirical Mode Decomposition (EMD) method is established for fault diagnosis of the gripper cylinder while TBM is working. Firstly, the lumped mass parameter model of the gripper cylinder is established considering the influence of the variable stiffness at the rock interface, the equivalent stiffness of the oil, the seals, and the copper guide sleeve. The dynamic performance of the gripper cylinder is investigated to provide basis for its health condition evaluation. Then, the EMD method is applied to identify the characteristic frequencies of the gripper cylinder for fault diagnosis and a field test is used to verify the accuracy of the EMD method for detection of the characteristic frequencies. Furthermore, the contact stiffness at the interface between the barrel and the rod is calculated with Hertz theory and the relationship between the natural frequency and the stiffness varying with the health condition of the cylinder is simulated based on the dynamic model. The simulation shows that the characteristic frequencies decrease with the increasing clearance between the barrel and the rod, thus the defects could be indicated by monitoring the natural frequency. Finally, a health condition management system of the gripper cylinder based on the vibration signal and the EMD method is established, which could ensure the safety of TBM.
RT-PCR Protocols - Methods in Molecular Biology
Directory of Open Access Journals (Sweden)
Manuela Monti
2011-03-01
Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........
A Method for Monitoring Iron and Steel Factory Economic Activity Based on Satellites
Directory of Open Access Journals (Sweden)
Yi Zhou
2018-06-01
Full Text Available The Chinese government has promulgated a de-capacity policy for economic growth and environmental sustainability, especially for the iron and steel industry. With these policies, this study aimed to monitor the economic activities and evaluate the production conditions of an iron and steel factory based on satellites via Landsat-8 Thermal Infrared Sensor (TIRS data and high-resolution images from January 2013 to October 2017, and propel next economic adjustment and environmental protection. Our methods included the construction of a heat island intensity index for an iron and steel factory (ISHII, a heat island radio index for an iron and steel factory (ISHRI and a dense classifying approach to monitor the spatiotemporal changes of the internal heat field of an iron and steel factory. Additionally, we used GF-2 and Google Earth images to identify the main production area, detect facility changes to a factory that alters its heat field and verify the accuracy of thermal analysis in a specific time span. Finally, these methods were used together to evaluate economic activity. Based on five iron and steel factories in the Beijing-Tianjin-Hebei region, when the ISHII curve is higher than the seasonal changes in a time series, production is normal; otherwise, there is a shut-down or cut-back. In the spatial pattern analyses, the ISHRI is large in normal production and decreases when cut-back or shut-down occurs. The density classifying images and high-resolution images give powerful evidence to the above-mentioned results. Finally, three types of economic activities of normal production, shut-down or cut-back were monitored for these samples. The study provides a new perspective and method for monitoring the economic activity of an iron and steel factory and provides supports for sustainable development in China.
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297
Directory of Open Access Journals (Sweden)
Kanako Komaki-Yasuda
Full Text Available A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and
Internal quality control of PCR-based genotyping methods in research studies and patient diagnostics
DEFF Research Database (Denmark)
Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen
2002-01-01
Genetic analyses are increasingly integrated in the clinical laboratory, and internal quality control programmes are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) by ammonium acetate....... Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences we propose an internal quality control programme for widely used PCR-based haemostasis polymorphism analyses.......-isolation (pre-analytical factors), DNA-amplification, digestion with restriction enzymes, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 microg/ml blood...
International Nuclear Information System (INIS)
Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander
2013-01-01
The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a
Presently there is no established cell line or small animal model that allows for the detection of infectious human norovirus. Current methods based on RT-PCR and RT-qPCR detect both infectious and non-infectious virus and thus the conclusions that may be drawn regarding the publ...
Development of a high-speed real-time PCR system for rapid and precise nucleotide recognition
Terazono, Hideyuki; Takei, Hiroyuki; Hattori, Akihiro; Yasuda, Kenji
2010-04-01
Polymerase chain reaction (PCR) is a common method used to create copies of a specific target region of a DNA sequence and to produce large quantities of DNA. A few DNA molecules, which act as templates, are rapidly amplified by PCR into many billions of copies. PCR is a key technology in genome-based biological analysis, revolutionizing many life science fields such as medical diagnostics, food safety monitoring, and countermeasures against bioterrorism. Thus, many applications have been developed with the thermal cycling. For these PCR applications, one of the most important key factors is reduction in the data acquisition time. To reduce the acquisition time, it is necessary to decrease the temperature transition time between the high and low ends as much as possible. We have developed a novel rapid real-time PCR system based on rapid exchange of media maintained at different temperatures. This system consists of two thermal reservoirs and a reaction chamber for PCR observation. The temperature transition was achieved within 0.3 sec, and good thermal stability was achieved during thermal cycling with rapid exchange of circulating media. This system allows rigorous optimization of the temperatures required for each stage of the PCR processes. Resulting amplicons were confirmed by electrophoresis. Using the system, rapid DNA amplification was accomplished within 3.5 min, including initial heating and complete 50 PCR cycles. It clearly shows that the device could allow us faster temperature switching than the conventional conduction-based heating systems based on Peltier heating/cooling.
Directory of Open Access Journals (Sweden)
Alejandro G Schijman
-95%, accuracy of 86.8-89.5% and kappa index of 0.7-0.8 compared to consensus PCR reports of the 16 good performing tests and 63-69%, 100%, 71.4-76.2% and 0.4-0.5, respectively compared to serodiagnosis. Method LbD2 used solvent extraction followed by Sybr-Green based Real time PCR targeted to Sat-DNA; method LbD3 used solvent DNA extraction followed by conventional PCR targeted to Sat-DNA. The third method (LbF1 used glass fiber column based DNA extraction followed by TaqMan Real Time PCR targeted to Sat-DNA (cruzi 1/cruzi 2 and cruzi 3 TaqMan probe and the fourth method (LbQ used solvent DNA extraction followed by conventional hot-start PCR targeted to kDNA (primer pairs 121/122. These four methods were further evaluated at the coordinating laboratory in a subset of human blood samples, confirming the performance obtained by the participating laboratories. CONCLUSION/SIGNIFICANCE: This study represents a first crucial step towards international validation of PCR procedures for detection of T. cruzi in human blood samples.
Single tube genotyping of sickle cell anaemia using PCR-based SNP analysis.
Waterfall, C M; Cobb, B D
2001-12-01
Allele-specific amplification (ASA) is a generally applicable technique for the detection of known single nucleotide polymorphisms (SNPs), deletions, insertions and other sequence variations. Conventionally, two reactions are required to determine the zygosity of DNA in a two-allele system, along with significant upstream optimisation to define the specific test conditions. Here, we combine single tube bi-directional ASA with a 'matrix-based' optimisation strategy, speeding up the whole process in a reduced reaction set. We use sickle cell anaemia as our model SNP system, a genetic disease that is currently screened using ASA methods. Discriminatory conditions were rapidly optimised enabling the unambiguous identification of DNA from homozygous sickle cell patients (HbS/S), heterozygous carriers (HbA/S) or normal DNA in a single tube. Simple downstream mathematical analyses based on product yield across the optimisation set allow an insight into the important aspects of priming competition and component interactions in this competitive PCR. This strategy can be applied to any polymorphism, defining specific conditions using a multifactorial approach. The inherent simplicity and low cost of this PCR-based method validates bi-directional ASA as an effective tool in future clinical screening and pharmacogenomic research where more expensive fluorescence-based approaches may not be desirable.
DEFF Research Database (Denmark)
Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo
2015-01-01
The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same...
Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes
Directory of Open Access Journals (Sweden)
Georg Walch
2016-04-01
Full Text Available Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success.
Carvalho, G M L; Rêgo, F D; Tanure, A; Silva, A C P; Dias, T A; Paz, G F; Andrade Filho, J D
2017-07-01
PCR-based identification of vertebrate host bloodmeals has been performed on several vectors species with success. In the present study, we used a previously published PCR protocol followed by DNA sequencing based on primers designed from multiple alignments of the mitochondrial cytochrome b gene used to identify avian and mammalian hosts of various hematophagous vectors. The amplification of a fragment encoding a 359 bp sequence of the Cyt b gene yielded recognized amplification products in 192 female sand flies (53%), from a total of 362 females analyzed. In the study area of Casa Branca, Brazil, blood-engorged female sand flies such as Lutzomyia longipalpis (Lutz & Neiva, 1912), Migonemyia migonei (França, 1924), and Nyssomyia whitmani (Antunes & Coutinho, 1939) were analyzed for bloodmeal sources. The PCR-based method identified human, dog, chicken, and domestic rat blood sources. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Jeni Vuong
Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.
[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].
Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan
2015-04-01
To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.
Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi
2011-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.
A novel method for detection of dioxins. Exonuclease protection mediated PCR assay
Energy Technology Data Exchange (ETDEWEB)
Xu, S.Q.; Sun, X.; Li, F.; Li, B.S. [Huazhong Univ. of Science and Technology, Wuhan, HB (China). Tongji Medical College
2004-09-15
The aromatic hydrocarbon receptor (AhR) is a ligand-actived transcription factor that mediates many of the biologic and toxicologic effects of dioxin-like chemicals (DLCs), such as 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD). Numerous AhR-based bioassays for identification and detection of DLCs have been developed in vitro. Such as the chemical-activated luciferase gene expression (CALUX), ethoxyresolufin-O-deethylase (EROD) activity are sometimes represented as the next best system when compared with whole body or in vivo systems. However, cell systems can be affected by the toxic chemical itself during the assay, thus confusing problems couldn't be avoided in the assay. Incorporation of metabolism in cell systems with uncertain consequences prolongs assay complexity and time. Thus these drawbacks limit the utility of cell systems for screening purposes. Most cell-free bioassays require radioactivity, such as the gel retardation of AhR binding (GRAB) assay, or antibody of AhR or ligand, which are unfeasible for some laboratories. Here a cell-free bioanalysis method, Exonuclease Protection Mediated PCR (EPM-PCR) bioassay, was established for detection of AhR ligands based on the binding of the dioxin:AhR complex to the specific DNA. EPM-PCR can provide indirect detection of ligands by quantification of the specific AhR-binding DNA, no necessary of any DNA labeling and sophisticated equipments. This new bioassay not only has the higher sensitivity and specificity, but it is rapid and easy to perform.
Energy Technology Data Exchange (ETDEWEB)
Romanak, Katherine [Gulf Coast Carbon Center, Bureau of Economic Geology, The University of Texas at Austin, TX 78713 (United States); Dobeck, Laura; Spangler, Lee [Department of Chemistry and Biochemistry, Montana State University, Bozeman, MT 59717 (United States); Dixon, Tim [IEA Greenhouse Gas R and D Programme, Cheltenham GL52 7RZ (United Kingdom)
2013-07-01
The process-based method is a new technique for monitoring CO{sub 2} storage permanence in the vadose zone above geologic carbon storage (GCS) sites. This method uses ratios of coexisting gas species to understand geochemical processes rather than comparing CO{sub 2} concentrations with large baseline data sets, thereby making monitoring more efficient. In the vadose zone, ratios among coexisting gases (CO{sub 2}, O{sub 2}, N{sub 2} and CH{sub 4}) have been used to distinguish biologic respiration, water-rock-CO{sub 2} interaction, and methane oxidation from a leakage signal. We report the preliminary results of a feasibility test conducted in July 2012 at the Zero Emission Research and Technology Center (ZERT) controlled release site in Montana, USA to discern whether the method could be applied to dissolved gases in groundwater, thereby enhancing groundwater monitoring. Preliminary results are favorable, making the process-based approach potentially useful for monitoring shallow freshwater aquifers above GCS sites. (authors)
Caldwell Eldridge, Sara L.; Driscoll, Conner; Dreher, Theo W.
2017-06-05
per liter) from mid-June to mid-August, 2014. After August 18, the Aphanizomenon bloom was overtaken by Microcystis late in the season as microcystin concentrations peaked. Overall, results of this study showed how DNA-based, genetic methods may provide rapid and sensitive diagnoses for the presence of toxigenic cyanobacteria and that they are useful for general monitoring or ecological studies and identification of cyanobacterial community members in complex aquatic habitats. These same methods can also be used to simultaneously address spatial (horizontal and vertical) and temporal variation and under different conditions. Additionally, with some modifications, the same techniques can be applied to different sample types, including water, sediment, and tissue.
Power System Real-Time Monitoring by Using PMU-Based Robust State Estimation Method
DEFF Research Database (Denmark)
Zhao, Junbo; Zhang, Gexiang; Das, Kaushik
2016-01-01
Accurate real-time states provided by the state estimator are critical for power system reliable operation and control. This paper proposes a novel phasor measurement unit (PMU)-based robust state estimation method (PRSEM) to real-time monitor a power system under different operation conditions...... the system real-time states with good robustness and can address several kinds of BD.......-based bad data (BD) detection method, which can handle the smearing effect and critical measurement errors, is presented. We evaluate PRSEM by using IEEE benchmark test systems and a realistic utility system. The numerical results indicate that, in short computation time, PRSEM can effectively track...
Bisset, S A; Knight, J S; Bouchet, C L G
2014-02-24
A multiplex PCR-based method was developed to overcome the limitations of microscopic examination as a means of identifying individual infective larvae from the wide range of strongylid parasite species commonly encountered in sheep in mixed sheep-cattle grazing situations in New Zealand. The strategy employed targets unique species-specific sequence markers in the second internal transcribed spacer (ITS-2) region of ribosomal DNA of the nematodes and utilises individual larval lysates as reaction templates. The basic assay involves two sets of reactions designed to target the ten strongylid species most often encountered in ovine faecal cultures under New Zealand conditions (viz. Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus axei, Trichostrongylus colubriformis, Trichostrongylus vitrinus, Cooperia curticei, Cooperia oncophora, Nematodirus spathiger, Chabertia ovina, and Oesophagostomum venulosum). Five species-specific primers, together with a pair of "generic" (conserved) primers, are used in each of the reactions. Two products are generally amplified, one by the generic primer pair regardless of species (providing a positive PCR control) and the other (whose size is indicative of the species present) by the appropriate species-specific primer in combination with one or other of the generic primers. If necessary, any larvae not identified by these reactions can subsequently be tested using primers designed specifically to detect those species less frequently encountered in ovine faecal cultures (viz. Ostertagia ostertagi, Ostertagia leptospicularis, Cooperia punctata, Nematodirus filicollis, and Bunostomum trigonocephalum). Results of assays undertaken on >5500 nematode larvae cultured from lambs on 16 different farms distributed throughout New Zealand indicated that positive identifications were initially obtained for 92.8% of them, while a further 4.4% of reactions gave a generic but no visible specific product and 2.8% gave no discernible
Directory of Open Access Journals (Sweden)
Bárbara Angulo
Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.
Suñén, Ester; Casas, Nerea; Moreno, Belén; Zigorraga, Carmen
2004-03-01
The detection of hepatitis A virus in shellfish by reverse transcription-nested polymerase chain reaction (RT-nested PCR) is hampered mainly by low levels of virus contamination and PCR inhibitors in shellfish. In this study, we focused on getting a rapid and sensitive processing procedure for the detection of HAV by RT-nested PCR in clam samples (Tapes spp.). Two previously developed processing methods for virus concentration in shellfish have been improved upon and compared. The first method involves acid adsorption, elution, polyethylene glycol (PEG) precipitation, chloroform extraction and PEG precipitation. The second method is based on elution with a glycine buffer at pH 10, chloroform extraction and concentration by ultracentrifugation. Final clam concentrates were processed by RNA extraction or immunomagnetic capture of viruses (IMC) before the RT-nested PCR reaction. Both methods of sample processing combined with the RNA extraction from the concentrates were very efficient when they were assayed in seeded and naturally contaminated samples. The results show that the first method was more effective in removal inhibitors and the second was simpler and faster. The IMC of HAV from clam concentrates processed by method 1 was revealed to be a very effective method of simultaneously removing residual PCR inhibitors and of concentrating the virus.
Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E
2013-10-01
Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling
A rapid PCR-based approach for molecular identification of filamentous fungi.
Chen, Yuanyuan; Prior, Bernard A; Shi, Guiyang; Wang, Zhengxiang
2011-08-01
In this study, a novel rapid and efficient DNA extraction method based on alkaline lysis, which can deal with a large number of filamentous fungal isolates in the same batch, was established. The filamentous fungal genomic DNA required only 20 min to prepare and can be directly used as a template for PCR amplification. The amplified internal transcribed spacer regions were easy to identify by analysis. The extracted DNA also can be used to amplify other protein-coding genes for fungal identification. This method can be used for rapid systematic identification of filamentous fungal isolates.
Application of PCR-DGGE method for identification of nematode communities in pepper growing soil
Nguyen, Thi Phuong; Ha, Duy Ngo; Nguyen, Huu Hung; Duong, Duc Hieu
2017-01-01
Soil nematodes play an important role in indication for assessing soil environments and ecosystems. Previous studies of nematode community analyses based on molecular identification have shown to be useful for assessing soil environments. Here we applied PCR-DGGE method for molecular analysis of five soil nematode communities (designed as S1 to S5) collected from four provinces in Southeastern Vietnam (Binh Duong, Ba Ria Vung Tau, Binh Phuoc and Dong Nai) based on SSU gene. By sequencing DNA ...
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha
2006-01-01
A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the
Mathematics of quantitative kinetic PCR and the application of standard curves.
Rutledge, R G; Côté, C
2003-08-15
Fluorescent monitoring of DNA amplification is the basis of real-time PCR, from which target DNA concentration can be determined from the fractional cycle at which a threshold amount of amplicon DNA is produced. Absolute quantification can be achieved using a standard curve constructed by amplifying known amounts of target DNA. In this study, the mathematics of quantitative PCR are examined in detail, from which several fundamental aspects of the threshold method and the application of standard curves are illustrated. The construction of five replicate standard curves for two pairs of nested primers was used to examine the reproducibility and degree of quantitative variation using SYBER Green I fluorescence. Based upon this analysis the application of a single, well- constructed standard curve could provide an estimated precision of +/-6-21%, depending on the number of cycles required to reach threshold. A simplified method for absolute quantification is also proposed, in which quantitative scale is determined by DNA mass at threshold.
Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M
2004-10-01
The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.
Bergmann, I; Mundt, K; Sontag, M; Baumstark, I; Nettmann, E; Klocke, M
2010-03-01
Quantitative real-time PCR (Q-PCR) is commonly applied for the detection of certain microorganisms in environmental samples. However, some environments, like biomass-degrading biogas fermenters, are enriched with PCR-interfering substances. To study the impact of the DNA extraction protocol on the results of Q-PCR-based analysis of the methane-producing archaeal community in biogas fermenters, nine different protocols with varying cell disruption and DNA purification approaches were tested. Differences in the quantities of the isolated DNA and the purity parameters were found, with the best cell lysis efficiencies being obtained by a combined lysozyme/SDS-based lysis. When DNA was purified by sephacryl columns, the amount of DNA decreased by one log cycle but PCR inhibitors were eliminated sufficiently. In the case of detection of methanogenic Archaea, the chosen DNA isolation protocol strongly influenced the Q-PCR-based determination of 16S rDNA copy numbers. For example, with protocols including mechanical cell disruption, the 16S rDNA of Methanobacteriales were predominantly amplified (81-90% of the total 16S rDNA copy numbers), followed by the 16S rDNA of Methanomicrobiales (9-18%). In contrast, when a lysozyme/SDS-based cell lysis was applied, the 16S rDNA copy numbers determined for these two orders were the opposite (Methanomicrobiales 82-95%, Methanobacteriales 4-18%). In extreme cases, the DNA isolation method led to discrimination of some groups of methanogens (e.g. members of the Methanosaetaceae). In conclusion, for extraction of high amounts of microbial DNA with high purity from samples of biogas plants, a combined lysozyme/SDS-based cell lysis followed by a purification step with sephacryl columns is recommended. Copyright 2010 Elsevier GmbH. All rights reserved.
Ozone Measurements Monitoring Using Data-Based Approach
Harrou, Fouzi; Kadri, Farid; Khadraoui, Sofiane; Sun, Ying
2016-01-01
The complexity of ozone (O3) formation mechanisms in the troposphere make the fast and accurate modeling of ozone very challenging. In the absence of a process model, principal component analysis (PCA) has been extensively used as a data-based monitoring technique for highly correlated process variables; however conventional PCA-based detection indices often fail to detect small or moderate anomalies. In this work, we propose an innovative method for detecting small anomalies in highly correlated multivariate data. The developed method combine the multivariate exponentially weighted moving average (MEWMA) monitoring scheme with PCA modelling in order to enhance anomaly detection performance. Such a choice is mainly motivated by the greater ability of the MEWMA monitoring scheme to detect small changes in the process mean. The proposed PCA-based MEWMA monitoring scheme is successfully applied to ozone measurements data collected from Upper Normandy region, France, via the network of air quality monitoring stations. The detection results of the proposed method are compared to that declared by Air Normand air monitoring association.
Ozone Measurements Monitoring Using Data-Based Approach
Harrou, Fouzi
2016-02-01
The complexity of ozone (O3) formation mechanisms in the troposphere make the fast and accurate modeling of ozone very challenging. In the absence of a process model, principal component analysis (PCA) has been extensively used as a data-based monitoring technique for highly correlated process variables; however conventional PCA-based detection indices often fail to detect small or moderate anomalies. In this work, we propose an innovative method for detecting small anomalies in highly correlated multivariate data. The developed method combine the multivariate exponentially weighted moving average (MEWMA) monitoring scheme with PCA modelling in order to enhance anomaly detection performance. Such a choice is mainly motivated by the greater ability of the MEWMA monitoring scheme to detect small changes in the process mean. The proposed PCA-based MEWMA monitoring scheme is successfully applied to ozone measurements data collected from Upper Normandy region, France, via the network of air quality monitoring stations. The detection results of the proposed method are compared to that declared by Air Normand air monitoring association.
High-Density Real-Time PCR-Based in Vivo Toxicogenomic Screen to Predict Organ-Specific Toxicity
Directory of Open Access Journals (Sweden)
Laszlo G. Puskas
2011-09-01
Full Text Available Toxicogenomics, based on the temporal effects of drugs on gene expression, is able to predict toxic effects earlier than traditional technologies by analyzing changes in genomic biomarkers that could precede subsequent protein translation and initiation of histological organ damage. In the present study our objective was to extend in vivo toxicogenomic screening from analyzing one or a few tissues to multiple organs, including heart, kidney, brain, liver and spleen. Nanocapillary quantitative real-time PCR (QRT-PCR was used in the study, due to its higher throughput, sensitivity and reproducibility, and larger dynamic range compared to DNA microarray technologies. Based on previous data, 56 gene markers were selected coding for proteins with different functions, such as proteins for acute phase response, inflammation, oxidative stress, metabolic processes, heat-shock response, cell cycle/apoptosis regulation and enzymes which are involved in detoxification. Some of the marker genes are specific to certain organs, and some of them are general indicators of toxicity in multiple organs. Utility of the nanocapillary QRT-PCR platform was demonstrated by screening different references, as well as discovery of drug-like compounds for their gene expression profiles in different organs of treated mice in an acute experiment. For each compound, 896 QRT-PCR were done: four organs were used from each of the treated four animals to monitor the relative expression of 56 genes. Based on expression data of the discovery gene set of toxicology biomarkers the cardio- and nephrotoxicity of doxorubicin and sulfasalazin, the hepato- and nephrotoxicity of rotenone, dihydrocoumarin and aniline, and the liver toxicity of 2,4-diaminotoluene could be confirmed. The acute heart and kidney toxicity of the active metabolite SN-38 from its less toxic prodrug, irinotecan could be differentiated, and two novel gene markers for hormone replacement therapy were identified
Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A
2015-06-01
The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
Directory of Open Access Journals (Sweden)
Peng Xia
2009-01-01
Full Text Available Quantification of circulating nucleic acids in plasma and serum could be used as a non-invasive diagnostic tool for monitoring a wide variety of diseases and conditions. We describe here a rapid, simple and accurate multiplex real-time PCR method for direct synchronized analysis of circulating cell-free (ccf mitochondrial (mtDNA and nuclear (nDNA DNA in plasma and serum samples. The method is based on one-step multiplex real-time PCR using a FAM-labeled MGB probe and primers to amplify the mtDNA sequence of the ATP 8 gene, and a VIC-labeled MGB probe and primers to amplify the nDNA sequence of the glycerinaldehyde-3-phosphate-dehydrogenase (GAPDH gene, in plasma and serum samples simultaneously. The efficiencies of the multiplex assays were measured in serial dilutions. Based on the simulation of the PCR reaction kinetics, the relative quantities of ccf mtDNA were calculated using a very simple equation. Using our optimised real-time PCR conditions, close to 100% efficiency was obtained from the two assays. The two assays performed in the dilution series showed very good and reproducible correlation to each other. This optimised multiplex real-time PCR protocol can be widely used for synchronized quantification of mtDNA and nDNA in different samples, with a very high rate of efficiency.
Rapid Methods to Distinguish Heterodera schachtii from Heterodera glycines Using PCR Technique
Directory of Open Access Journals (Sweden)
Hyoung Rai Ko
2017-09-01
Full Text Available The purpose of this study was to develop rapid methods for distinguishing between Heterodera schachtii and H. glycines detected from chinese cabbage fields of highland in Gangwon, Korea. To do this, we performed PCR-RFLP and PCR with the primers set developed in this study for GC147, GC408 and PM001 population, H. schachtii, and YS224, DA142 and BC115 population, H. glycines. Eight restriction enzymes generated RFLP profiles of mtDNA COI region for populations of H. schachtii and H. glycines, repectively. As a result, treatment of two restriction enzymes, RsaI and HinfI, were allowed to distinguish H. schachtii from H. glycines based on the differences of DNA band patterns. The primer set, #JBS1, #JBG1 and #JB3R, amplified specific fragments with 277 and 339 bp of H. schachtii, 339 bp of H. glycines, respectively, while it did not amplify fragments from three root-knot nematodes and two root-lesion nematodes. Thus, the primer set developed in this study could be a good method, which is used to distinguish between H. schachtii and H. glycines.
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage
An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period
Directory of Open Access Journals (Sweden)
Antonio Olmos
2008-01-01
Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.
DEFF Research Database (Denmark)
Löfström, Charlotta; Hoorfar, Jeffrey
2012-01-01
A comparative study of a 20-hr, non-commercial, open-formula PCR method and the standard culture-based method NMKL 187, for detection of Salmonella, was performed according to the validation protocol from the Nordic organization for validation of alternative microbiological methods (NordVal) on 81...
A web-based adaptive tutor to teach PCR primer design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
A Web-based Adaptive Tutor to Teach PCR Primer Design
Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Salam, Khaled W.; El-Fadel, Mutasem E.; Barbour, Elie K.; Saikaly, Pascal
2014-01-01
The development of rapid detection assays of cell viability is essential for monitoring the microbiological quality of water systems. Coupling propidium monoazide with quantitative PCR (PMA-qPCR) has been successfully applied in different studies for the detection and quantification of viable cells in small-volume samples (0.25-1.00 mL), but it has not been evaluated sufficiently in marine environments or in large-volume samples. In this study, we successfully integrated blue light-emitting diodes for photoactivating PMA and membrane filtration into the PMA-qPCR assay for the rapid detection and quantification of viable Enterococcus faecalis cells in 10-mL samples of marine waters. The assay was optimized in phosphate-buffered saline and seawater, reducing the qPCR signal of heat-killed E. faecalis cells by 4 log10 and 3 log10 units, respectively. Results suggest that high total dissolved solid concentration (32 g/L) in seawater can reduce PMA activity. Optimal PMA-qPCR standard curves with a 6-log dynamic range and detection limit of 102 cells/mL were generated for quantifying viable E. faecalis cells in marine waters. The developed assay was compared with the standard membrane filter (MF) method by quantifying viable E. faecalis cells in seawater samples exposed to solar radiation. The results of the developed PMA-qPCR assay did not match that of the standard MF method. This difference in the results reflects the different physiological states of E. faecalis cells in seawater. In conclusion, the developed assay is a rapid (∼5 h) method for the quantification of viable E. faecalis cells in marine recreational waters, which should be further improved and tested in different seawater settings. © 2014 Springer-Verlag Berlin Heidelberg.
Salam, Khaled W.
2014-08-23
The development of rapid detection assays of cell viability is essential for monitoring the microbiological quality of water systems. Coupling propidium monoazide with quantitative PCR (PMA-qPCR) has been successfully applied in different studies for the detection and quantification of viable cells in small-volume samples (0.25-1.00 mL), but it has not been evaluated sufficiently in marine environments or in large-volume samples. In this study, we successfully integrated blue light-emitting diodes for photoactivating PMA and membrane filtration into the PMA-qPCR assay for the rapid detection and quantification of viable Enterococcus faecalis cells in 10-mL samples of marine waters. The assay was optimized in phosphate-buffered saline and seawater, reducing the qPCR signal of heat-killed E. faecalis cells by 4 log10 and 3 log10 units, respectively. Results suggest that high total dissolved solid concentration (32 g/L) in seawater can reduce PMA activity. Optimal PMA-qPCR standard curves with a 6-log dynamic range and detection limit of 102 cells/mL were generated for quantifying viable E. faecalis cells in marine waters. The developed assay was compared with the standard membrane filter (MF) method by quantifying viable E. faecalis cells in seawater samples exposed to solar radiation. The results of the developed PMA-qPCR assay did not match that of the standard MF method. This difference in the results reflects the different physiological states of E. faecalis cells in seawater. In conclusion, the developed assay is a rapid (∼5 h) method for the quantification of viable E. faecalis cells in marine recreational waters, which should be further improved and tested in different seawater settings. © 2014 Springer-Verlag Berlin Heidelberg.
Tissue-specific methylation of human insulin gene and PCR assay for monitoring beta cell death.
Directory of Open Access Journals (Sweden)
Mohamed I Husseiny
Full Text Available The onset of metabolic dysregulation in type 1 diabetes (T1D occurs after autoimmune destruction of the majority of pancreatic insulin-producing beta cells. We previously demonstrated that the DNA encoding the insulin gene is uniquely unmethylated in these cells and then developed a methylation-specific PCR (MSP assay to identify circulating beta cell DNA in streptozotocin-treated mice prior to the rise in blood glucose. The current study extends to autoimmune non-obese diabetic (NOD mice and humans, showing in NOD mice that beta cell death occurs six weeks before the rise in blood sugar and coincides with the onset of islet infiltration by immune cells, demonstrating the utility of MSP for monitoring T1D. We previously reported unique patterns of methylation of the human insulin gene, and now extend this to other human tissues. The methylation patterns of the human insulin promoter, intron 1, exon 2, and intron 2 were determined in several normal human tissues. Similar to our previous report, the human insulin promoter was unmethylated in beta cells, but methylated in all other tissues tested. In contrast, intron 1, exon 2 and intron 2 did not exhibit any tissue-specific DNA methylation pattern. Subsequently, a human MSP assay was developed based on the methylation pattern of the insulin promoter and human islet DNA was successfully detected in circulation of T1D patients after islet transplantation therapy. Signal levels of normal controls and pre-transplant samples were shown to be similar, but increased dramatically after islet transplantation. In plasma the signal declines with time but in whole blood remains elevated for at least two weeks, indicating that association of beta cell DNA with blood cells prolongs the signal. This assay provides an effective method to monitor beta cell destruction in early T1D and in islet transplantation therapy.
Quantitative CrAssphage PCR Assays for Human Fecal ...
Environmental waters are monitored for fecal pollution to protect public health and water resources. Traditionally, general fecal indicator bacteria are used; however, they cannot distinguish human fecal waste from pollution from other animals. Recently, a novel bacteriophage, crAssphage, was discovered by metagenomic data mining and reported to be abundant in and closely associated with human fecal waste. To confirm bioinformatic predictions, 384 primer sets were designed along the length of the crAssphage genome. Based upon initial screening, two novel crAssphage qPCR assays (CPQ_056 and CPQ_064) were designed and evaluated in reference fecal samples and water matrices. The assays exhibited high specificities (98.6%) when tested against a large animal fecal reference library and were highly abundant in raw sewage and sewage impacted water samples. In addition, CPQ_056 and CPQ_064 assay performance was compared to HF183/BacR287 and HumM2 methods in paired experiments. Findings confirm viral crAssphage qPCR assays perform at a similar level to well established bacterial human-associated fecal source identification technologies. These new viral based assays could become important water quality management and research tools. To inform the public.
Microbial community analysis of shallow subsurface samples with PCR-DGGE
Energy Technology Data Exchange (ETDEWEB)
Itaevaara, M.; Suihko, M. -L.; Kapanen, A.; Piskonen, R.; Juvonen, R. [VTT Biotechnology, Espoo (Finland)
2005-11-15
This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing
Microbial community analysis of shallow subsurface samples with PCR-DGGE
International Nuclear Information System (INIS)
Itaevaara, M.; Suihko, M.-L.; Kapanen, A.; Piskonen, R.; Juvonen, R.
2005-11-01
This work is part of the site investigations for the disposal of spent nuclear fuel in Olkiluoto bedrock. The purpose of the research was to study the suitability of PCR-DGGE (polymerase chain reaction - denaturing gradient gel electrophoresis) method for monitoring of hydrogeomicrobiology of Olkiluoto repository site. PCR-DGGE method has been applied for monitoring microbial processes in several applications. The benefit of the method is that microorganisms are not cultivated but the presence of microbial communities can be monitored by direct DNA extractions from the environmental samples. Partial 16SrDNA gene sequence is specifically amplified by PCR (polymerase chain reaction) which detect bacteria as a group. The gene sequences are separated in DGGE, and the nucleotide bands are then cut out, extracted, sequenced and identified by the genelibraries by e.g. Blast program. PCR-DGGE method can be used to detect microorganisms which are present abundantly in the microbial communities because small quantities of genes cannot be separated reliably. However, generally the microorganisms involved in several environmental processes are naturally enriched and present as major population. This makes it possible to utilize PCRDGGE as a monitoring method. In this study, we studied the structure of microbial communities in ten ground water samples originating from Olkiluoto. Two universal bacterial primer sets were compared which amplified two different regions of the 16SrDNA gene. The longer sequence amplified resulted in fewer bands in DGGE, in addition there were problems with purification of the sequences after DGGE. The shorter sequence gave more bands in DGGE and more clear results without any amplification problems. Comparison of the sequences from the gene-libraries resulted in the detection of the same species by both primer sets, in addition some different species were detected. Several species were anaerobic bacteria, such as acetogenic and sulphate reducing
Comparison of power curve monitoring methods
Directory of Open Access Journals (Sweden)
Cambron Philippe
2017-01-01
Full Text Available Performance monitoring is an important aspect of operating wind farms. This can be done through the power curve monitoring (PCM of wind turbines (WT. In the past years, important work has been conducted on PCM. Various methodologies have been proposed, each one with interesting results. However, it is difficult to compare these methods because they have been developed using their respective data sets. The objective of this actual work is to compare some of the proposed PCM methods using common data sets. The metric used to compare the PCM methods is the time needed to detect a change in the power curve. Two power curve models will be covered to establish the effect the model type has on the monitoring outcomes. Each model was tested with two control charts. Other methodologies and metrics proposed in the literature for power curve monitoring such as areas under the power curve and the use of statistical copulas have also been covered. Results demonstrate that model-based PCM methods are more reliable at the detecting a performance change than other methodologies and that the effectiveness of the control chart depends on the types of shift observed.
Result Variation and Efficiency Kinetics in Real-Time PCR
Directory of Open Access Journals (Sweden)
Reza Shahsiah
2010-10-01
Full Text Available Fluorescent monitoring of DNA amplification is the basis of real-time PCR. Absolute quantification can be achieved using a standard curve method. The standard curve is constructed by amplifying known amounts of standards under identical conditions to that of the samples.The objective of the current study is to propose a mathematical model to assess the acceptability of PCR resulys.Four commercial standards for HCV-RNA (hepatitis C virus RNA along with 6 patient samples were measured by real-time PCR, using two different RT-PCR reagents. The standard deviation of regression (Sy,x was calculated for each group of standard and compared by F-Test. The efficiency kinetics was computed by logistic regression, c2 goodness of fit test was preformed to assess the appropriateness of the efficiency curves.Calculated efficiencies were not significantly different from the value predicted by logistic regression model. Reactions with more variation showed less stable efficiency curves, with wider range of amplification efficiencies.Amplification efficiency kinetics can be computed by fitting a logistic regression curve to the gathered fluorescent data of each reaction. This model can be employed to assess the acceptability of PCR results calculated by standard curve method.
Directory of Open Access Journals (Sweden)
Markus Spiliotis
Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.
Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.
Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin
2017-12-01
Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.
An external standard method for quantification of human cytomegalovirus by PCR
International Nuclear Information System (INIS)
Rongsen, Shen; Liren, Ma; Fengqi, Zhou; Qingliang, Luo
1997-01-01
An external standard method for PCR quantification of HCMV was reported. [α- 32 P]dATP was used as a tracer. 32 P-labelled specific amplification product was separated by agarose gel electrophoresis. A gel piece containing the specific product band was excised and counted in a plastic scintillation counter. Distribution of [α- 32 P]dATP in the electrophoretic gel plate and effect of separation between the 32 P-labelled specific product and free [α- 32 P]dATP were observed. A standard curve for quantification of HCMV by PCR was established and detective results of quality control templets were presented. The external standard method and the electrophoresis separation effect were appraised. The results showed that the method could be used for relative quantification of HCMV. (author)
Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi
2014-01-01
A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.
Directory of Open Access Journals (Sweden)
Žel Jana
2006-08-01
Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was
Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina
2006-01-01
Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)
2011-07-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.
2011-01-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
Directory of Open Access Journals (Sweden)
Amanda eMartino
2012-01-01
Full Text Available A degenerate PCR-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. The method, which we have called Random Amplification Metagenomic PCR (RAMP, involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3’ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10X. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin, and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa show that community analysis can be sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low biomass samples.
Rapid detection of food-borne Salmonella contamination using IMBs-qPCR method based on pagC gene
Directory of Open Access Journals (Sweden)
Jiashun Wang
Full Text Available Abstract Detection of Salmonella is very important to minimize the food safety risk. In this study, the recombinant PagC protein and PagC antibody were prepared and coupled with immunomagnetic beads (IMBs to capture Salmonella cells from pork and milk samples. And then the SYBR Green qualitative PCR was developed to detect the pathogenic Salmonella. The results showed that the PagC polyclonal antiserum is of good specificity and the capture rate of 0.1 mg IMBs for Salmonella tended to be stable at the range of 70-74% corresponding to the concentrations between 101 and 104 CFU/mL. The method developed demonstrated high specificity for the positive Salmonella samples when compared to non-specific DNA samples, such as Escherichia coli, Staphylococcus aureus, Yersinia enterocolitica, and Yersinia pseudotuberculosis. The limit of detection of this assay was 18 CFU/mL. Detection and quantitative enumeration of Salmonella in samples of pork or milk shows good recoveries of 54.34% and 52.07%. In conclusion, the polyclonal antibody of recombinant PagC protein is effective to capture Salmonella from detected samples. The developed pagC antibody IMBs-qPCR method showed efficiency, sensitivity and specificity for 30 Salmonella detection, enabling detection within 10 h, which is a promising rapid method to detect Salmonella in emergency.
Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R
2003-08-01
Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.
Multiple Hotspot Mutations Scanning by Single Droplet Digital PCR.
Decraene, Charles; Silveira, Amanda B; Bidard, François-Clément; Vallée, Audrey; Michel, Marc; Melaabi, Samia; Vincent-Salomon, Anne; Saliou, Adrien; Houy, Alexandre; Milder, Maud; Lantz, Olivier; Ychou, Marc; Denis, Marc G; Pierga, Jean-Yves; Stern, Marc-Henri; Proudhon, Charlotte
2018-02-01
Progress in the liquid biopsy field, combined with the development of droplet digital PCR (ddPCR), has enabled noninvasive monitoring of mutations with high detection accuracy. However, current assays detect a restricted number of mutations per reaction. ddPCR is a recognized method for detecting alterations previously characterized in tumor tissues, but its use as a discovery tool when the mutation is unknown a priori remains limited. We established 2 ddPCR assays detecting all genomic alterations within KRAS exon 2 and EGFR exon 19 mutation hotspots, which are of clinical importance in colorectal and lung cancer, with use of a unique pair of TaqMan ® oligoprobes. The KRAS assay scanned for the 7 most common mutations in codons 12/13 but also all other mutations found in that region. The EGFR assay screened for all in-frame deletions of exon 19, which are frequent EGFR-activating events. The KRAS and EGFR assays were highly specific and both reached a limit of detection of <0.1% in mutant allele frequency. We further validated their performance on multiple plasma and formalin-fixed and paraffin-embedded tumor samples harboring a panel of different KRAS or EGFR mutations. This method presents the advantage of detecting a higher number of mutations with single-reaction ddPCRs while consuming a minimum of patient sample. This is particularly useful in the context of liquid biopsy because the amount of circulating tumor DNA is often low. This method should be useful as a discovery tool when the tumor tissue is unavailable or to monitor disease during therapy. © 2017 American Association for Clinical Chemistry.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods.
Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris
2015-01-01
We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
New multiplex PCR methods for rapid screening of genetically modified organisms in foods
Directory of Open Access Journals (Sweden)
Nelly eDatukishvili
2015-07-01
Full Text Available We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs. New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.
Methods of Complex Data Processing from Technical Means of Monitoring
Directory of Open Access Journals (Sweden)
Serhii Tymchuk
2017-03-01
Full Text Available The problem of processing the information from different types of monitoring equipment was examined. The use of generalized methods of information processing, based on the techniques of clustering combined territorial information sources for monitoring and the use of framing model of knowledge base for identification of monitoring objects was proposed as a possible solution of the problem. Clustering methods were formed on the basis of Lance-Williams hierarchical agglomerative procedure using the Ward metrics. Frame model of knowledge base was built using the tools of object-oriented modeling.
Directory of Open Access Journals (Sweden)
Roohollah Dorostkar
2015-06-01
Full Text Available Abstract Background: In 1970, human papillomavirus (HPV was introduced as the main etiologic factor of cervical carcinoma. Since there is no possibility of detecting the virus and its subtypes using serological methods and cell culture, the molecular methods such as PCR have particular importance in accurate, early and definite diagnosis of the virus. So, in this research, our goal is to use a proprietary PCR assay based on L1 gene of human papillomavirus for molecular recognition of HPV and to evaluate its prevalence in patient samples. Materials and Methods: In this experimental study, after collecting of samples from malignant cervical lesions, the viral DNA was extracted from paraffin blocks of 50 clinical samples and PCR was done by specific primers for L1 gene of human papillomavirus in all samples. After the analysis of PCR products by 2% agarose gel electrophoresis, sensitivity and specificity of the test were also evaluated. Results: Among 50 patient samples, 33 cases were confirmed to be positive for HPV infection and 17 cases were negative, showing high frequency of HPV in this patient population (about 66%. The results of specificity assay were positive for papilloma samples and sensitivity of the assay was 20 copies of recombinant construct containing L1 per reaction. Conclusion: This study showed that PCR by specific primers for L1 gene of human papilloma virus is a proper and accurate method for detection of this virus and the results confirm the previous reports of correlation between HPV and cervical carcinoma.
Directory of Open Access Journals (Sweden)
Tharangamala Samarakoon
2013-01-01
Full Text Available Premise of the study: PCR amplification of DNA extracted from plants is sometimes difficult due to the presence of inhibitory compounds. An effective method to overcome the inhibitory effect of compounds that contaminate DNA from difficult plant specimens is needed. Methods and Results: The effectiveness of a PCR additive reagent containing trehalose, bovine serum albumin (BSA, and polysorbate-20 (Tween-20 (TBT-PAR was tested. PCR of DNA extracted from fresh, silica-dried, and herbarium leaf material of species of Achariaceae, Asteraceae, Lacistemataceae, and Samydaceae that failed using standard techniques were successful with the addition of TBT-PAR. Conclusions: The addition of TBT-PAR during routine PCR is an effective method to improve amplification of DNA extracted from herbarium specimens or plants that are known to contain PCR inhibitors.
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.
2013-01-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia
2013-07-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83
Viability qPCR, a new tool for Legionella risk management.
Lizana, X; López, A; Benito, S; Agustí, G; Ríos, M; Piqué, N; Marqués, A M; Codony, F
2017-11-01
Viability quantitative Polymerase Chain Reaction (v-qPCR) is a recent analytical approach for only detecting live microorganisms by DNA amplification-based methods This approach is based on the use of a reagent that irreversibly fixes dead cells DNA. In this study, we evaluate the utility of v-qPCR versus culture method for Legionellosis risk management. The present study was performed using 116 real samples. Water samples were simultaneously analysed by culture, v-qPCR and qPCR methods. Results were compared by means of a non-parametric test. In 11.6% of samples using both methods (culture method and v-qPCR) results were positive, in 50.0% of samples both methods gave rise to negative results. As expected, equivalence between methods was not observed in all cases, as in 32.1% of samples positive results were obtained by v-qPCR and all of them gave rise to negative results by culture. Only in 6.3% of samples, with very low Legionella levels, was culture positive and v-qPCR negative. In 3.5% of samples, overgrowth of other bacteria did not allow performing the culture. When comparing both methods, significant differences between culture and v-qPCR were in the samples belonging to the cooling towers-evaporative condensers group. The v-qPCR method detected greater presence and obtained higher concentrations of Legionella spp. (p<0.001). Otherwise, no significant differences between methods were found in the rest of the groups. The v-qPCR method can be used as a quick tool to evaluate Legionellosis risk, especially in cooling towers-evaporative condensers, where this technique can detect higher levels than culture. The combined interpretation of PCR results along with the ratio of live cells is proposed as a tool for understanding the sample context and estimating the Legionellosis risk potential according to 4 levels of hierarchy. Copyright © 2017 Elsevier GmbH. All rights reserved.
Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina
2009-12-01
Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Directory of Open Access Journals (Sweden)
Helena Lage Ferreira
2009-08-01
Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do
Frequency of Chlamydia trachomatis in genital specimens: kerman city, PCR method
Directory of Open Access Journals (Sweden)
Khalili M
2008-06-01
Full Text Available Background: Chlamydia trachomatis (CT is an obligate intracellular bacterium that causes genital disease and the most common sexually transmitted infection in the world. The most frequent risk factors associated with chlamydial infection are related to sexual behavior, multiple partners, and inconsistent condom use. Presenting primarily as urtheritis in men and cervicitis in women, CT a major cause of chronic pelvic inflammatory disease and subsequent infertility in women, eye and lung infection in newborns and other manifestations. Identification of CT-infected patients may prevent its spread and thereby reduce the high morbidity associated with CT infections. Polymerase chain reaction (PCR is a sensitive and specific method for the detection of small quantity of bacterial DNA in clinical samples. The aim of this study was to determine the frequency of C. trachomatis by PCR in genital samples from patients in the city of Kerman.Methods: A total of 130 genital samples including 64 endocervical and 66 urethral swab samples were collected by physicians. Nucleic acid was extracted from each sample using a commercial DNA extraction kit. PCR primers specific for a conserved region of the C. trachomatis omp2 gene, encoding an outer membrane protein, were used for amplification. Results: A total of 9.2% (6.25% of cervicitis and 12.1% of urethritis of the samples were found positive for CT using this PCR method. Conclusions: The present study shows a high prevalence of CT infection, especially in men with urethritis. Such patients should be referred to genitourinary clinics for treatment and partner notification. Given its worldwide prevalence, further CT studies on more populations are needed to assess potential public health implications of these infections.
McMahon, Tanis C.; Blais, Burton W.; Wong, Alex; Carrillo, Catherine D.
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin (stx) and intimin (eae)]. However, false positives arise when complex food matrices, such as beef, contain mixtu...
Increased efficacy for in-house validation of real-time PCR GMO detection methods.
Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H
2010-03-01
To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.
Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay
Directory of Open Access Journals (Sweden)
Khandaker Shadia
2012-01-01
Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11
Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method
Directory of Open Access Journals (Sweden)
H Ansari
2010-02-01
Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.
Directory of Open Access Journals (Sweden)
M Fallah
2012-09-01
Full Text Available Background: Metronidazole is drug of choice recommended by WHO for treatment of trichomoniasis, however, some reports claims drug resistance in Trichomonas vaginalis isolates recently. The objective of this study was to determine the minimum lethal concentration (MLC of metronidazole in resistant and sensitive strains, as well as genetic patterns of these stains by PCR method. Methods: From February 2006 to March 2007, in a cross sectional study, clinical and wet mount examination of vaginal smear along with culture were performed on 683 women attending to public and private outpatient clinics in Hamadan. Trichomoniasis marked based on major clinical symptoms. Diagnosis confirmed using wet mount microscopically and culture in Diamond medium. A serial concentration of metronidazole was provided and all isolated Trichomonas strains (resistant and sensitive tested by standard method. Finally, all sensitive and resistant strains examined by PCR technique. Results: Only 15/683, (2.2% of patients clinically diagnosed trichomonal vaginitis were positive for T. vaginalis by wet smear and culture. The minimum lethal concentration (MLC for clinically sensitive isolates was 25 µg/ml; however, this concentration for resistant isolates was 200 µg/ml after 24 h and 100 µg/ml after 50 h. The results of PCR examination of DNA from sensitive and resistant isolates had same pattern. The lanes appeared by two primers were 98 bp and 261 bp for both clinically sensitive and resistant strains. Conclusion: Resistance to metronidazole in T. vaginalis has not relation to genetic variations and might be related to some physiologic pathways of organism.
Directory of Open Access Journals (Sweden)
Yogita Maheshwari
Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.
Directory of Open Access Journals (Sweden)
Henry Perdigon
2004-06-01
Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.
A proline racemase based PCR for identification of Trypanosoma vivax in cattle blood.
Directory of Open Access Journals (Sweden)
Regassa Fikru
Full Text Available A study was conducted to develop a Trypanosoma vivax (T. vivax specific PCR based on the T. vivax proline racemase (TvPRAC gene. Forward and reverse primers were designed that bind at 764-783 bp and 983-1002 bp of the gene. To assess its specificity, TvPRAC PCR was conducted on DNA extracted from different haemotropic pathogens: T. vivax from Nigeria, Ethiopia and Venezuela, T. congolense Savannah type, T. brucei brucei, T. evansi, T. equiperdum, T. theileri, Theileria parva, Anaplasma marginale, Babesia bovis and Babesia bigemina and from bovine, goat, mouse, camel and human blood. The analytical sensitivity of the TvPRAC PCR was compared with that of the ITS-1 PCR and the 18S PCR-RFLP on a dilution series of T. vivax DNA in water. The diagnostic performance of the three PCRs was compared on 411 Ethiopian bovine blood specimens collected in a former study. TvPRAC PCR proved to be fully specific for T. vivax, irrespective of its geographical origin. Its analytical sensitivity was lower than that of ITS-1 PCR. On these bovine specimens, TvPRAC PCR detected 8.3% T. vivax infections while ITS-1 PCR and 18S PCR-RFLP detected respectively 22.6 and 6.1% T. vivax infections. The study demonstrates that a proline racemase based PCR could be used, preferably in combination with ITS-1 PCR, as a species-specific diagnostic test for T. vivax infections worldwide.
System and Method for Monitoring Distributed Asset Data
Gorinevsky, Dimitry (Inventor)
2015-01-01
A computer-based monitoring system and monitoring method implemented in computer software for detecting, estimating, and reporting the condition states, their changes, and anomalies for many assets. The assets are of same type, are operated over a period of time, and outfitted with data collection systems. The proposed monitoring method accounts for variability of working conditions for each asset by using regression model that characterizes asset performance. The assets are of the same type but not identical. The proposed monitoring method accounts for asset-to-asset variability; it also accounts for drifts and trends in the asset condition and data. The proposed monitoring system can perform distributed processing of massive amounts of historical data without discarding any useful information where moving all the asset data into one central computing system might be infeasible. The overall processing is includes distributed preprocessing data records from each asset to produce compressed data.
Collins, S; Jorgensen, F; Willis, C; Walker, J
2015-10-01
Culture remains the gold-standard for the enumeration of environmental Legionella. However, it has several drawbacks including long incubation and poor sensitivity, causing delays in response times to outbreaks of Legionnaires' disease. This study aimed to validate real-time PCR assays to quantify Legionella species (ssrA gene), Legionella pneumophila (mip gene) and Leg. pneumophila serogroup-1 (wzm gene) to support culture-based detection in a frontline public health laboratory. Each qPCR assay had 100% specificity, excellent sensitivity (5 GU/reaction) and reproducibility. Comparison of the assays to culture-based enumeration of Legionella from 200 environmental samples showed that they had a negative predictive value of 100%. Thirty eight samples were positive for Legionella species by culture and qPCR. One hundred samples were negative by both methods, whereas 62 samples were negative by culture but positive by qPCR. The average log10 increase between culture and qPCR for Legionella spp. and Leg. pneumophila was 0·72 (P = 0·0002) and 0·51 (P = 0·006), respectively. The qPCR assays can be conducted on the same 1 l water sample as culture thus can be used as a supplementary technique to screen out negative samples and allow more rapid indication of positive samples. The assay could prove informative in public health investigations to identify or rule out sources of Legionella as well as to specifically identify Leg. pneumophila serogroup 1 in a timely manner not possible with culture. © 2015 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Junan Ren
Full Text Available Meat adulteration is a worldwide concern. In this paper, a new droplet digital PCR (ddPCR method was developed for the quantitative determination of the presence of chicken in sheep and goat meat products. Meanwhile, a constant (multiplication factor was introduced to transform the ratio of copy numbers to the proportion of meats. The presented ddPCR method was also proved to be more accurate (showing bias of less than 9% in the range from 5% to 80% than real-time PCR, which has been widely used in this determination. The method exhibited good repeatability and stability in different thermal treatments and at ultra-high pressure. The relative standard deviation (RSD values of 5% chicken content was less than 5.4% for ultra-high pressure or heat treatment. Moreover, we confirmed that different parts of meat had no effect on quantification accuracy of the ddPCR method. In contrast to real-time PCR, we examined the performance of ddPCR as a more precise, sensitive and stable analytical strategy to overcome potential problems of discrepancies in amplification efficiency discrepancy and to obtain the copy numbers directly without standard curves. The method and strategy developed in this study can be applied to quantify the presence and to confirm the absence of adulterants not only to sheep but also to other kinds of meat and meat products.
Directory of Open Access Journals (Sweden)
Koppel Juraj
2007-12-01
Full Text Available Abstract Background Fluorescent data obtained from real-time PCR must be processed by some method of data analysis to obtain the relative quantity of target mRNA. The method chosen for data analysis can strongly influence results of the quantification. Results To compare the performance of six techniques which are currently used for analysing fluorescent data in real-time PCR relative quantification, we quantified four cytokine transcripts (IL-1β, IL-6 TNF-α, and GM-CSF in an in vivo model of colonic inflammation. Accuracy of the methods was tested by quantification on samples with known relative amounts of target mRNAs. Reproducibility of the methods was estimated by the determination of the intra-assay and inter-assay variability. Cytokine expression normalized to the expression of three reference genes (ACTB, HPRT, SDHA was then determined using the six methods for data analysis. The best results were obtained with the relative standard curve method, comparative Ct method and with DART-PCR, LinRegPCR and Liu & Saint exponential methods when average amplification efficiency was used. The use of individual amplification efficiencies in DART-PCR, LinRegPCR and Liu & Saint exponential methods significantly impaired the results. The sigmoid curve-fitting (SCF method produced medium performance; the results indicate that the use of appropriate type of fluorescence data and in some instances manual selection of the number of amplification cycles included in the analysis is necessary when the SCF method is applied. We also compared amplification efficiencies (E and found that although the E values determined by different methods of analysis were not identical, all the methods were capable to identify two genes whose E values significantly differed from other genes. Conclusion Our results show that all the tested methods can provide quantitative values reflecting the amounts of measured mRNA in samples, but they differ in their accuracy and
A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic
Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.
2007-01-01
Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.
Bovine Papillomavirus in Brazil: Detection of Coinfection of Unusual Types by a PCR-RFLP Method
Directory of Open Access Journals (Sweden)
R. F. Carvalho
2013-01-01
Full Text Available Bovine papillomavirus (BPV is recognized as a causal agent of benign and malignant tumors in cattle. Thirteen types of BPV are currently characterized and classified into three distinct genera, associated with different pathological outcomes. The described BPV types as well as other putative ones have been demonstrated by molecular biology methods, mainly by the employment of degenerated PCR primers. Specifically, divergences in the nucleotide sequence of the L1 gene are useful for the identification and classification of new papillomavirus types. On the present work, a method based on the PCR-RFLP technique and DNA sequencing was evaluated as a screening tool, allowing for the detection of two relatively rare types of BPV in lesions samples from a six-year-old Holstein dairy cow, chronically affected with cutaneous papillomatosis. These findings point to the dissemination of BPVs with unclear pathogenic potential, since two relatively rare, new described BPV types, which were first characterized in Japan, were also detected in Brazil.
[Application of rapid PCR to authenticate medicinal snakes].
Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man
2014-10-01
To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.
A method for accurate detection of genomic microdeletions using real-time quantitative PCR
Directory of Open Access Journals (Sweden)
Bassett Anne S
2005-12-01
Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive
Thongdee, Pimwan; Chaijaroenkul, Wanna; Kuesap, Jiraporn; Na-Bangchang, Kesara
2014-08-01
Microscopy is considered as the gold standard for malaria diagnosis although its wide application is limited by the requirement of highly experienced microscopists. PCR and serological tests provide efficient diagnostic performance and have been applied for malaria diagnosis and research. The aim of this study was to investigate the diagnostic performance of nested PCR and a recently developed an ELISA-based new rapid diagnosis test (RDT), NovaLisa test kit, for diagnosis of malaria infection, using microscopic method as the gold standard. The performance of nested-PCR as a malaria diagnostic tool is excellent with respect to its high accuracy, sensitivity, specificity, and ability to discriminate Plasmodium species. The sensitivity and specificity of nested-PCR compared with the microscopic method for detection of Plasmodium falciparum, Plasmodium vivax, and P. falciparum/P. vivax mixed infection were 71.4 vs 100%, 100 vs 98.7%, and 100 vs 95.0%, respectively. The sensitivity and specificity of the ELISA-based NovaLisa test kit compared with the microscopic method for detection of Plasmodium genus were 89.0 vs 91.6%, respectively. NovaLisa test kit provided comparable diagnostic performance. Its relatively low cost, simplicity, and rapidity enables large scale field application.
Guidelines for molecular monitoring of BCR-ABL1 in chronic myeloid leukemia patients by RT-qPCR
Directory of Open Access Journals (Sweden)
Irene Larripa
2017-02-01
Full Text Available Current clinical guidelines for managing chronic myeloid leukemia include molecular monitoring of BCR-ABL1 transcript quantitative reverse-transcription PCR. Despite the proven prognostic significance of molecular response, it is not widely appreciated that quantitative reverse-transcription PCR potentially produces highly variable data, which may affect the validity of results, making comparability between different laboratories difficult. Therefore, standardized reporting of BCR-ABL1 measurements is needed for optimal clinical management. An approach to achieve comparable BCR-ABL1 values is the use of an international reporting scale. Conversion to the international scale is achieved by the application of laboratory specific conversion factor that is obtained by using validated secondary reference calibrators. Moreover, with the aim to mitigate the interlaboratory imprecision of quantitative BCR-ABL1 measurements and to facilitate local laboratory results interpretation and reporting, we decide to prepare laboratory guidelines that will further facilitate interlaboratory comparative studies and independent quality-assessment programs, which are of paramount importance for worldwide standardization of BCR-ABL1 monitoring results, in particular for those most isolated laboratories, with not easy access to commercial kits or sample interchange programs
International Nuclear Information System (INIS)
Du Yanjun; Liu Qingcheng; Liu Hongzhang; Qin Guoxiu
2009-01-01
In order to find the feasibility of calculating mine radiation dose based on γ field theory, this paper calculates the γ radiation dose of a mine by means of γ field theory based calculation method. The results show that the calculated radiation dose is of small error and can be used to monitor mine environment of nuclear radiation. (authors)
Detection and Identification of Free-living Amoeba from Environmental Water in Taiwan by PCR Method
Tsai, H. F.; Hsu, B. M.; Huang, K. H.; She, C. Y.; Kao, P. M.; Shen, S. M.; Tseng, S. F.; Chen, J. S.
2012-04-01
Acanthamoeba, Naegleria, Balamuthia and Hartmannella all belong to free-living amoebae that are present ubiquitously in the environment including water, soil, and air. Free-living amoebae are parasites which can infect humans and can lead to serious illness and even death. The aim of this study is to investigate the presence of free-living amoebae in aquatic environment in Taiwan, and to compare the differences between Acanthamoeba and Naegleria in diverse cultivation methods and conditions. In this study, we used molecular method by PCR amplification with specific primers to analyze the occurrence of free-living amoebae. We collected 176 samples from environmental water including drinking water treatment plants, stream water, and hot spring recreational areas in Taiwan. Based on the results of PCR, 43 water samples (24.4%) were detected positive for free-living amoebae. The most common Acanthamoeba genotype isolated from samples including T2, T4, T5, T12, and T15. N. australiensis and N. lovaniensis were also identified by molecular biology techniques. Furthermore, we found that both Acanthamoeba and Naegleria can be cultured by PYG in 30° C, but not all free-living amoebae can be isolated and enriched by using storage-cultivation method. Because of the widespread presence of Acanthamoeba and Naegleria in aquatic environments, the water quality and safety of aquatic environments should be more conscious in Taiwan and worldwide. Keywords: free-living amoebae; Acanthamoeba; Naegleria; Balamuthia; Hartmannella; PCR
Directory of Open Access Journals (Sweden)
Tomasz Kulik
2012-12-01
Full Text Available We identified a species level of the fungal cultures isolated from selected crop seeds using traditional method and BIO-PCR. The use of BIO-PCR did not correspond completely to the morphological analyses. Both methods showed increased infection with F. poae in winter wheat seed sample originated from north Poland. Fungal culture No 40 (isolated from faba bean and identified with traditional method as mixed culture with F. culmorum and F. graminearum did not produce expected product after PCR reaction with species specific primers OPT18F470, OPT18R470. However, the use of additional primers Fc01F, Fc01R allowed for reliable identification of F. culmorum in the culture.
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
EPA Method 1615 measures enteroviruses and noroviruses present in environmental and drinking waters. The viral ribonucleic acid (RNA) from water sample concentrates is extracted and tested for enterovirus and norovirus RNA using reverse transcription-quantitative PCR (RT-qPCR). V...
Bliem, Rupert; Reischer, Georg; Linke, Rita; Farnleitner, Andreas; Kirschner, Alexander
2018-06-01
In recent years, global warming has led to a growing number of Vibrio cholerae infections in bathing water users in regions formerly unaffected by this pathogen. It is therefore of high importance to monitor V. cholerae in aquatic environments and to elucidate the main factors governing its prevalence and abundance. For this purpose, rapid and standardizable methods that can be performed by routine water laboratories are prerequisite. In this study, we applied a recently developed multiplex quantitative PCR (qPCR) strategy (i) to monitor the spatiotemporal variability of V. cholerae abundance in two small soda pools and a large lake that is intensively used for recreation and (ii) to elucidate the main factors driving V. cholerae dynamics in these environments. V. cholerae was detected with qPCR at high concentrations of up to 970,000 genomic units 100 ml -1 during the warm season, up to 2 orders of magnitude higher than values obtained by cultivation. An independent cytometric approach led to results comparable to qPCR data but with significantly more positive samples due to problems with DNA recovery for qPCR. Not a single sample was positive for toxigenic V. cholerae , indicating that only nontoxigenic V. cholerae (NTVC) was present. Temperature was the main predictor of NTVC abundance, but the quality and quantity of dissolved organic matter were also important environmental correlates. Based on this study, we recommend using the developed qPCR strategy for quantification of toxigenic and nontoxigenic V. cholerae in bathing waters with the need for improvements in DNA recovery. IMPORTANCE There is a definitive need for rapid and standardizable methods to quantify waterborne bacterial pathogens. Such methods have to be thoroughly tested for their applicability to environmental samples. In this study, we critically tested a recently developed multiplex qPCR strategy for its applicability to determine the spatiotemporal variability of V. cholerae abundance in
Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N
2016-05-01
To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang
2015-08-04
Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.
Development of PCR method for diagnosing of honey bee American Foulbrood disease
Directory of Open Access Journals (Sweden)
Modirrousta, H.
2012-06-01
Full Text Available American foulbrood (AFB disease is caused by the sporeforming bacterium Paenibacillus larvae larvae. Traditional diagnosis is based on culture technique is time and laboratory work consuming. In this study with standard strain, PCR was developed by specific primers and PCR products were electrophoresed on 0.8 % agarose gel. The PCR primers were selected on the basis of the 16S rRNA gene and amplify a 700-bp amplicon. Detection limits were determined for suspensions of bacteria and spores and also honey and larvae experimentally contaminated. The lowest number of bacteria and spores that were able to detect were respectively 28, 33, 330 and 243 cfu /ml. This PCR technique can be used to identification of the presence of Paenibacillus larvae larvae spores in honey samples, brood samples or on the colonies that grow on medium.
High performance of a new PCR-based urine assay for HPV-DNA detection and genotyping.
Tanzi, Elisabetta; Bianchi, Silvia; Fasolo, Maria Michela; Frati, Elena R; Mazza, Francesca; Martinelli, Marianna; Colzani, Daniela; Beretta, Rosangela; Zappa, Alessandra; Orlando, Giovanna
2013-01-01
Human papillomavirus (HPV) testing has been proposed as a means of replacing or supporting conventional cervical screening (Pap test). However, both methods require the collection of cervical samples. Urine sample is easier and more acceptable to collect and could be helpful in facilitating cervical cancer screening. The aim of this study was to evaluate the sensitivity and specificity of urine testing compared to conventional cervical smear testing using a PCR-based method with a new, designed specifically primer set. Paired cervical and first voided urine samples collected from 107 women infected with HIV were subjected to HPV-DNA detection and genotyping using a PCR-based assay and a restriction fragment length polymorphism method. Sensitivity, specificity, Positive Predictive Value (PPV), and Negative Predictive Value (NPV) were calculated using the McNemar's test for differences. Concordance between tests was assessed using the Cohen's unweighted Kappa (k). HPV DNA was detected in 64.5% (95% CI: 55.1-73.1%) of both cytobrush and urine samples. High concordance rates of HPV-DNA detection (k = 0.96; 95% CI: 0.90-1.0) and of high risk-clade and low-risk genotyping in paired samples (k = 0.80; 95% CI: 0.67-0.92 and k = 0.74; 95% CI: 0.60-0.88, respectively) were observed. HPV-DNA detection in urine versus cervix testing revealed a sensitivity of 98.6% (95% CI: 93.1-99.9%) and a specificity of 97.4% (95% CI: 87.7-99.9%), with a very high NPV (97.4%; 95% CI: 87.7-99.9%). The PCR-based assay utilized in this study proved highly sensitive and specific for HPV-DNA detection and genotyping in urine samples. These data suggest that a urine-based assay would be a suitable and effective tool for epidemiological surveillance and, most of all, screening programs. Copyright © 2012 Wiley Periodicals, Inc.
Development of a PZT-based wireless digital monitor for composite impact monitoring
International Nuclear Information System (INIS)
Liu, Peipei; Yuan, Shenfang; Qiu, Lei
2012-01-01
One of the major concerns in the whole lifetime of composite materials in aircraft is their susceptibility to impact damage. And there has existed a need in recent years to develop an online structural health monitoring (SHM) system for impact monitoring. This paper proposes a new PZT-based wireless digital impact monitoring system development method aimed at giving a localized area for further inspection. Based on this method, a PZT-based wireless digital impact monitor (WDIM) with advantages of compactness, light weight, low power consumption and high efficiency is developed. Differently from conventional SHM systems, the complex analog circuits are removed and the whole process is achieved in a digital way by turning the output of the PZT sensor directly into a digital queue through a comparator. A simple but efficient sub-region location method is implemented in a field programmable gate array (FPGA) as the processing core of the WDIM to detect and record the impact events. In addition, wireless communication technology is used in the WDIM to transmit data and form a monitoring network. To illustrate the capability of the WDIM, a complete process dealing with an impact event is investigated and the stability of the WDIM is also evaluated in this paper. The WDIM shows its potential for real online applications in aircraft. (paper)
Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio
2015-01-01
We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.
Mehle, Nataša; Dobnik, David; Ravnikar, Maja; Pompe Novak, Maruša
2018-05-03
RNA viruses have a great potential for high genetic variability and rapid evolution that is generated by mutation and recombination under selection pressure. This is also the case of Potato virus Y (PVY), which comprises a high diversity of different recombinant and non-recombinant strains. Consequently, it is hard to develop reverse transcription real-time quantitative PCR (RT-qPCR) with the same amplification efficiencies for all PVY strains which would enable their equilibrate quantification; this is specially needed in mixed infections and other studies of pathogenesis. To achieve this, we initially transferred the PVY universal RT-qPCR assay to a reverse transcription droplet digital PCR (RT-ddPCR) format. RT-ddPCR is an absolute quantification method, where a calibration curve is not needed, and it is less prone to inhibitors. The RT-ddPCR developed and validated in this study achieved a dynamic range of quantification over five orders of magnitude, and in terms of its sensitivity, it was comparable to, or even better than, RT-qPCR. RT-ddPCR showed lower measurement variability. We have shown that RT-ddPCR can be used as a reference tool for the evaluation of different RT-qPCR assays. In addition, it can be used for quantification of RNA based on in-house reference materials that can then be used as calibrators in diagnostic laboratories.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Martino, Amanda J.; Rhodes, Matthew E.; Biddle, Jennifer F.; Brandt, Leah D.; Tomsho, Lynn P.; House, Christopher H.
2011-01-01
A degenerate polymerase chain reaction (PCR)-based method of whole-genome amplification, designed to work fluidly with 454 sequencing technology, was developed and tested for use on deep marine subsurface DNA samples. While optimized here for use with Roche 454 technology, the general framework presented may be applicable to other next generation sequencing systems as well (e.g., Illumina, Ion Torrent). The method, which we have called random amplification metagenomic PCR (RAMP), involves the use of specific primers from Roche 454 amplicon sequencing, modified by the addition of a degenerate region at the 3′ end. It utilizes a PCR reaction, which resulted in no amplification from blanks, even after 50 cycles of PCR. After efforts to optimize experimental conditions, the method was tested with DNA extracted from cultured E. coli cells, and genome coverage was estimated after sequencing on three different occasions. Coverage did not vary greatly with the different experimental conditions tested, and was around 62% with a sequencing effort equivalent to a theoretical genome coverage of 14.10×. The GC content of the sequenced amplification product was within 2% of the predicted values for this strain of E. coli. The method was also applied to DNA extracted from marine subsurface samples from ODP Leg 201 site 1229 (Peru Margin), and results of a taxonomic analysis revealed microbial communities dominated by Proteobacteria, Chloroflexi, Firmicutes, Euryarchaeota, and Crenarchaeota, among others. These results were similar to those obtained previously for those samples; however, variations in the proportions of taxa identified illustrates well the generally accepted view that community analysis is sensitive to both the amplification technique used and the method of assigning sequences to taxonomic groups. Overall, we find that RAMP represents a valid methodology for amplifying metagenomes from low-biomass samples. PMID:22319519
GLRT Based Anomaly Detection for Sensor Network Monitoring
Harrou, Fouzi
2015-12-07
Proper operation of antenna arrays requires continuously monitoring their performances. When a fault occurs in an antenna array, the radiation pattern changes and can significantly deviate from the desired design performance specifications. In this paper, the problem of fault detection in linear antenna arrays is addressed within a statistical framework. Specifically, a statistical fault detection method based on the generalized likelihood ratio (GLR) principle is utilized for detecting potential faults in linear antenna arrays. The proposed method relies on detecting deviations in the radiation pattern of the monitored array with respect to a reference (fault-free) one. To assess the abilities of the GLR based fault detection method, three case studies involving different types of faults have been performed. The simulation results clearly illustrate the effectiveness of the GLR-based fault detection method in monitoring the performance of linear antenna arrays.
GLRT Based Anomaly Detection for Sensor Network Monitoring
Harrou, Fouzi; Sun, Ying
2015-01-01
Proper operation of antenna arrays requires continuously monitoring their performances. When a fault occurs in an antenna array, the radiation pattern changes and can significantly deviate from the desired design performance specifications. In this paper, the problem of fault detection in linear antenna arrays is addressed within a statistical framework. Specifically, a statistical fault detection method based on the generalized likelihood ratio (GLR) principle is utilized for detecting potential faults in linear antenna arrays. The proposed method relies on detecting deviations in the radiation pattern of the monitored array with respect to a reference (fault-free) one. To assess the abilities of the GLR based fault detection method, three case studies involving different types of faults have been performed. The simulation results clearly illustrate the effectiveness of the GLR-based fault detection method in monitoring the performance of linear antenna arrays.
A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.
Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping
2018-01-24
Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of
International Nuclear Information System (INIS)
Yoshida, Makoto; Ohi, Yoshihiro; Chida, Tohru; Wu, Youyang.
1993-01-01
A calibration method for radioactive gas monitoring instruments was studied. In the method, gaseous radioactivity standards were provided on the basis of the direct radioactivity measurement by the diffusion-in long proportional counter method (DLPC method). The radioactivity concentration of the gas mixture through a monitoring instrument was determined by sampling the known volume of the gas mixture into the proportional counter used for the DLPC method. Since oxygen in the gas mixture decreased the counting efficiency in a proportional counter, the influence on calibration was experimentally estimated. It was not serious and able to be easily corrected. By the present method, the relation between radioactivity concentration and ionization current was determined for a gas-flow ionization chamber with 1.5 l effective volume. It showed good agreement with the results in other works. (author)
Robinson, S; Follo, M; Haenel, D; Mauler, M; Stallmann, D; Tewari, M; Duerschmied, D; Peter, K; Bode, C; Ahrens, I; Hortmann, M
2018-04-15
micro-RNAs have shown promise as potential biomarkers for acute myocardial infarction and ischemia-reperfusion injury (I/R). Most recently droplet digital polymerase chain reaction (ddPCR) has been introduced as a more reliable and reproducible method for detecting micro-RNAs. We aimed to demonstrate the improved technical performance and diagnostic potential of ddPCR by measuring micro-RNAs in ST-elevation myocardial infarction (STEMI). A dilution series was performed in duplicate on synthetic Caenorrhabditis elegans-miR-39, comparing quantitative real-time PCR (qRT-PCR) and ddPCR. We used ddPCR and qRT-PCR to quantify the serum levels of miR-21, miR-208a and miR-499 between STEMI patients (n=24) and stable coronary artery disease (CAD) patients (n=20). In STEMI, I/R injury was assessed via measurement of ST-segment resolution. In the dilution series, ddPCR demonstrated superior coefficient of variation (12.1%vs.32.9%) and limit of detection (0.9325 vs.2.425copies/μl). In the patient cohort, ddPCR demonstrated greater differences in miR-21 levels (2190.5 vs. 484.7copies/μl; p=0.0004 for ddPCR and 136.4 vs. 122.8copies/μl; p=0.2273 for qRT-PCR) and in miR-208a (0 vs. 24.1copies/μl, p=0.0013 for ddPCR and 0 vs. 0copies/μl, p=0.0032 for qRT-PCR), with similar differences observed in miR-499 levels (9.4 vs. 81.5copies/μl, pPCR). ddPCR also more accurately defined STEMI for all miRNAs (area under the curve (AUC) of 0.8021/0.7740/0.9063 for miR-21/208a/499 with ddPCR vs. AUC of 0.6083/0.6917/0.8417 with qRT-PCR). However, there was no association between miR-21/208a/499 levels and ischemia-reperfusion injury. ddPCR demonstrates superiority in both technical performance and diagnostic potential compared to qRT-PCR. Ultimately, this supports its use as a diagnostic method for quantifying micro-RNAs, particularly in large multi-center trials. Copyright © 2017 Elsevier B.V. All rights reserved.
A real-time PCR antibiogram for drug-resistant sepsis.
Directory of Open Access Journals (Sweden)
John R Waldeisen
Full Text Available Current molecular diagnostic techniques for susceptibility testing of septicemia rely on genotyping for the presence of known resistance cassettes. This technique is intrinsically vulnerable due to the inability to detect newly emergent resistance genes. Traditional phenotypic susceptibility testing has always been a superior method to assay for resistance; however, relying on the multi-day growth period to determine which antimicrobial to administer jeopardizes patient survival. These factors have resulted in the widespread and deleterious use of broad-spectrum antimicrobials. The real-time PCR antibiogram, described herein, combines universal phenotypic susceptibility testing with the rapid diagnostic capabilities of PCR. We have developed a procedure that determines susceptibility by monitoring pathogenic load with the highly conserved 16S rRNA gene in blood samples exposed to different antimicrobial drugs. The optimized protocol removes heme and human background DNA from blood, which allows standard real-time PCR detection systems to be employed with high sensitivity (<100 CFU/mL. Three strains of E. coli, two of which were antimicrobial resistant, were spiked into whole blood and exposed to three different antibiotics. After real-time PCR-based determination of pathogenic load, a ΔC(t<3.0 between untreated and treated samples was found to indicate antimicrobial resistance (P<0.01. Minimum inhibitory concentration was determined for susceptible bacteria and pan-bacterial detection was demonstrated with 3 gram-negative and 2 gram-positive bacteria. Species identification was performed via analysis of the hypervariable amplicons. In summary, we have developed a universal diagnostic phenotyping technique that assays for the susceptibility of drug-resistant septicemia with the speed of PCR. The real-time PCR antibiogram achieves detection, susceptibility testing, minimum inhibitory concentration determination, and identification in less than 24
PCR specific for Actinobacillus pleuropneumoniae serotype 3
DEFF Research Database (Denmark)
Zhou, L.; Jones, S.C.P.; Angen, Øystein
2008-01-01
, but the method has liminations, for example, cross-reactions between serotypes 3, 6, and 8. This study describes the development of a serotype 3-specific PCR, based on the capsule locus, which can be used in a multiplex format with the organism's specific gene apxIV. The PCR test was evaluated on 266 strains...
Directory of Open Access Journals (Sweden)
Touseef Hussain
2018-05-01
Full Text Available Phytophthora infestans (mont de Bary is a pathogen of great concern across the globe, and accurate detection is an important component in responding to the outbreaks of potential disease. Although the molecular diagnostic protocol used in regulatory programs has been evaluated but till date methods implying direct comparison has rarely used. In this study, a known area soil samples from potato fields where light blight appear every year (both A1 and A2 mating type was assayed by soil bait method, PCR assay detection and quantification of the inoculums. Suspected disease symptoms appeared on bait tubers were further confirmed by rapid PCR, inoculums were quantified through Real Time PCR, which confirms presence of P. infestans. These diagnostic methods can be highly correlated with one another. Potato tuber baiting increased the sensitivity of the assay compared with direct extraction of DNA from tuber and soil samples. Our study determines diagnostic sensitivity and specificity of the assays to determine the performance of each method. Overall, molecular techniques based on different types of PCR amplification and Real-time PCR can lead to high throughput, faster and more accurate detection method which can be used in quarantine programmes in potato industry and diagnostic laboratory.
Use of real-time PCR to evaluate two DNA extraction methods from food
Directory of Open Access Journals (Sweden)
Maria Regina Branquinho
2012-03-01
Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.
Methods for microbial DNA extraction from soil for PCR amplification
Directory of Open Access Journals (Sweden)
Yeates C
1998-01-01
Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.
DEFF Research Database (Denmark)
Krause, Michael; Josefsen, Mathilde Hartmann; Lund, Marianne
2006-01-01
, a faster, real-time PCR approach was validated in comparative and collaborative trials, based on recommendations from the Nordic system for validation of alternative microbiological methods (NordVal). The comparative real-time PCR trial was performed in comparison to two reference culture protocols...... fulfilled the NordVal validation criteria and has since been implemented at a major abattoir....
Cao, Yiping; Sivaganesan, Mano; Kelty, Catherine A; Wang, Dan; Boehm, Alexandria B; Griffith, John F; Weisberg, Stephen B; Shanks, Orin C
2018-01-01
Human fecal pollution of recreational waters remains a public health concern worldwide. As a result, there is a growing interest in the application of human-associated fecal source identification quantitative real-time PCR (qPCR) technologies for water quality research and management. However, there are currently no standardized approaches for field implementation and interpretation of qPCR data. In this study, a standardized HF183/BacR287 qPCR method was combined with a water sampling strategy and a novel Bayesian weighted average approach to establish a human fecal contamination score (HFS) that can be used to prioritize sampling sites for remediation based on measured human waste levels. The HFS was then used to investigate 975 study design scenarios utilizing different combinations of sites with varying sampling intensities (daily to once per week) and number of qPCR replicates per sample (2-14 replicates). Findings demonstrate that site prioritization with HFS is feasible and that both sampling intensity and number of qPCR replicates influence reliability of HFS estimates. The novel data analysis strategy presented here provides a prescribed approach for the implementation and interpretation of human-associated HF183/BacR287 qPCR data with the goal of site prioritization based on human fecal pollution levels. In addition, information is provided for future users to customize study designs for optimal HFS performance. Published by Elsevier Ltd.
Industrial chimney monitoring - contemporary methods
Kaszowska, Olga; Gruchlik, Piotr; Mika, Wiesław
2018-04-01
The paper presents knowledge acquired during the monitoring of a flue-gas stack, performed as part of technical and scientific surveillance of mining activity and its impact on industrial objects. The chimney is located in an area impacted by mining activity since the 1970s, from a coal mine which is no longer in existence. In the period of 2013-16, this area was subject to mining carried out by a mining entrepreneur who currently holds a license to excavate hard coal. Periodic measurements of the deflection of the 113-meter chimney are performed using conventional geodetic methods. The GIG used 3 methods to observe the stack: landbased 3D laser scanning, continuous deflection monitoring with a laser sensor, and drone-based visual inspections. The drone offered the possibility to closely inspect the upper sections of the flue-gas stack, which are difficult to see from the ground level.
PLS-based memory control scheme for enhanced process monitoring
Harrou, Fouzi
2017-01-20
Fault detection is important for safe operation of various modern engineering systems. Partial least square (PLS) has been widely used in monitoring highly correlated process variables. Conventional PLS-based methods, nevertheless, often fail to detect incipient faults. In this paper, we develop new PLS-based monitoring chart, combining PLS with multivariate memory control chart, the multivariate exponentially weighted moving average (MEWMA) monitoring chart. The MEWMA are sensitive to incipient faults in the process mean, which significantly improves the performance of PLS methods and widen their applicability in practice. Using simulated distillation column data, we demonstrate that the proposed PLS-based MEWMA control chart is more effective in detecting incipient fault in the mean of the multivariate process variables, and outperform the conventional PLS-based monitoring charts.
DEFF Research Database (Denmark)
Yi, Sun; Dhumpa, Raghuram; Bang, Dang Duong
2011-01-01
of RNA extract in the liquid phase with sequence-specific nested PCR on the solid phase. A simple ultraviolet cross-linking method was used to immobilize the DNA probes over an unmodified glass surface, which makes solid-phase PCR a convenient possibility for AIV screening. The testing of 33 avian fecal....... In this article, a DNA microarray-based solid-phase polymerase chain reaction (PCR) approach has been developed for rapid detection of influenza virus type A and for simultaneous identification of pathogenic virus subtypes H5 and H7. This solid-phase RT-PCR method combined reverse-transcription amplification...
Directory of Open Access Journals (Sweden)
Wang Zhen
2011-11-01
Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.
Accurate quantification of supercoiled DNA by digital PCR
Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul
2016-01-01
Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649
A Smart Washer for Bolt Looseness Monitoring Based on Piezoelectric Active Sensing Method
Directory of Open Access Journals (Sweden)
Heyue Yin
2016-10-01
Full Text Available Piezoceramic based active sensing methods have been researched to monitor preload on bolt connections. However, there is a saturation problem involved with this type of method. The transmitted energy is sometimes saturated before the maximum preload which is due to it coming into contact with flat surfaces. When it comes to flat contact surfaces, the true contact area will easily saturate with the preload. The design of a new type of bolt looseness monitoring sensor, a smart washer, is to mitigate the saturation problem. The smart washer is composed of two annular disks with contact surfaces that are machined into convex and concave respectively, to eliminate the complete flat contact surfaces and to reduce the saturation effect. One piezoelectric patch is bonded on the non-contact surface of each annular disk. These two mating annular disks form a smart washer. One of the two piezoelectric patches serves as an actuator to generate an ultrasonic wave that propagates through the contact surface; the other one serves as a sensor to detect the propagated waves. The wave energy propagated through the contact surface is proportional to the true contact area which is determined by the bolt preload. The time reversal method is used to extract the peak of the focused signal as the index of the transmission wave energy; then, the relationship between the signal peak and bolt preload is obtained. Experimental results show that the focused signal peak value changes with the bolt preload and presents an approximate linear relationship when the saturation problem is experienced. The proposed smart washer can monitor the full range of the rated preload.
Canine distemper virus detection by different methods of One-Step RT-qPCR
Directory of Open Access Journals (Sweden)
Claudia de Camargo Tozato
2016-01-01
Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.
Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing
Espy, M. J.; Uhl, J. R.; Sloan, L. M.; Buckwalter, S. P.; Jones, M. F.; Vetter, E. A.; Yao, J. D. C.; Wengenack, N. L.; Rosenblatt, J. E.; Cockerill, F. R.; Smith, T. F.
2006-01-01
Real-time PCR has revolutionized the way clinical microbiology laboratories diagnose many human microbial infections. This testing method combines PCR chemistry with fluorescent probe detection of amplified product in the same reaction vessel. In general, both PCR and amplified product detection are completed in an hour or less, which is considerably faster than conventional PCR detection methods. Real-time PCR assays provide sensitivity and specificity equivalent to that of conventional PCR combined with Southern blot analysis, and since amplification and detection steps are performed in the same closed vessel, the risk of releasing amplified nucleic acids into the environment is negligible. The combination of excellent sensitivity and specificity, low contamination risk, and speed has made real-time PCR technology an appealing alternative to culture- or immunoassay-based testing methods for diagnosing many infectious diseases. This review focuses on the application of real-time PCR in the clinical microbiology laboratory. PMID:16418529
Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan
2017-11-15
A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Delogu Mauro
2006-05-01
Full Text Available Abstract Background Avian influenza viruses (AIVs are endemic in wild birds and their introduction and conversion to highly pathogenic avian influenza virus in domestic poultry is a cause of serious economic losses as well as a risk for potential transmission to humans. The ability to rapidly recognise AIVs in biological specimens is critical for limiting further spread of the disease in poultry. The advent of molecular methods such as real time polymerase chain reaction has allowed improvement of detection methods currently used in laboratories, although not all of these methods include an Internal Positive Control (IPC to monitor for false negative results. Therefore we developed a one-step reverse transcription real time PCR (RRT-PCR with a Minor Groove Binder (MGB probe for the detection of different subtypes of AIVs. This technique also includes an IPC. Methods RRT-PCR was developed using an improved TaqMan technology with a MGB probe to detect AI from reference viruses. Primers and probe were designed based on the matrix gene sequences from most animal and human A influenza virus subtypes. The specificity of RRT-PCR was assessed by detecting influenza A virus isolates belonging to subtypes from H1–H13 isolated in avian, human, swine and equine hosts. The analytical sensitivity of the RRT-PCR assay was determined using serial dilutions of in vitro transcribed matrix gene RNA. The use of a rodent RNA as an IPC in order not to reduce the efficiency of the assay was adopted. Results The RRT-PCR assay is capable to detect all tested influenza A viruses. The detection limit of the assay was shown to be between 5 and 50 RNA copies per reaction and the standard curve demonstrated a linear range from 5 to 5 × 108 copies as well as excellent reproducibility. The analytical sensitivity of the assay is 10–100 times higher than conventional RT-PCR. Conclusion The high sensitivity, rapidity, reproducibility and specificity of the AIV RRT-PCR with
Day, J B; Basavanna, U
2015-01-01
To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.
Sampling method of environmental radioactivity monitoring
International Nuclear Information System (INIS)
1984-01-01
This manual provides sampling methods of environmental samples of airborne dust, precipitated dust, precipitated water (rain or snow), fresh water, soil, river sediment or lake sediment, discharged water from a nuclear facility, grains, tea, milk, pasture grass, limnetic organisms, daily diet, index organisms, sea water, marine sediment, marine organisms, and that for tritium and radioiodine determination for radiation monitoring from radioactive fallout or radioactivity release by nuclear facilities. This manual aims at the presentation of standard sampling procedures for environmental radioactivity monitoring regardless of monitoring objectives, and shows preservation method of environmental samples acquired at the samplingpoint for radiation counting for those except human body. Sampling techniques adopted in this manual is decided by the criteria that they are suitable for routine monitoring and any special skillfulness is not necessary. Based on the above-mentioned principle, this manual presents outline and aims of sampling, sampling position or object, sampling quantity, apparatus, equipment or vessel for sampling, sampling location, sampling procedures, pretreatment and preparation procedures of a sample for radiation counting, necessary recording items for sampling and sample transportation procedures. Special attention is described in the chapter of tritium and radioiodine because these radionuclides might be lost by the above-mentioned sample preservation method for radiation counting of less volatile radionuclides than tritium or radioiodine. (Takagi, S.)
A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation
Directory of Open Access Journals (Sweden)
Tierling Sascha
2010-06-01
Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
Mathematical analysis of the real time array PCR (RTA PCR) process
Dijksman, Johan Frederik; Pierik, A.
2012-01-01
Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the
Tessitore, Marion Vaglio; Sottini, Alessandra; Roccaro, Aldo M; Ghidini, Claudia; Bernardi, Simona; Martellosio, Giovanni; Serana, Federico; Imberti, Luisa
2017-04-05
A normal number of T-cell receptor excision circles (TRECs) and K-deleting recombination excision circles (KRECs) is considered a biomarker for adequate new T- and B-cell production. In newborns, detection of TRECs and KRECs by real time PCR from dried blood spotted on filter paper is used for the screening of severe immunodeficiency. In adults, elderly and during diseases, where the number of TRECs is lower than in newborns and children, a large amount of DNA and a sensitive method of amplification are necessary to identify newly produced lymphocytes. DNA was prepared from blood of 203 healthy adults (range: 18-91 years old) absorbed for 10 s on flocked swabs and let to dry, or from peripheral blood mononuclear cells. DNA was subjected to digital PCR and to well established conventional real time PCR-based method using TREC- and KREC-specific primers and probes. The number of TRECs and KRECs was expressed per mL of blood. Statistical analysis was performed by nested ANOVA, Pearson coefficient of determination, and by linear regression tests. The novel method for the storage of dried blood on nylon flocked swabs and the use of digital PCR allow quantification of TRECs and KRECs with high degree of sensitivity, specificity, accuracy, and precision. TRECs and KRECs were amplified by digital PCR in all tested blood samples, including those obtained from elderly individuals (>70 years old) and that were negative by real time PCR. Furthermore, values of TRECs and KRECs obtained by digital PCR were in the range of those acquired by real time PCR. Our findings demonstrate that DNA isolation from dried blood on flocked swabs followed by digital PCR-based analysis represents a useful tool for studying new lymphocyte production in adults and elderly individuals. This suggests the potential use of the methodology when monitoring of clinical variables is limited by the number of molecules that can be amplified and detected, such as in patients with immunodeficiency or under
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
SMA Diagnosis: Detection of SMN1 Deletion with Real-Time mCOP-PCR System Using Fresh Blood DNA.
Niba, Emma Tabe Eko; Ar Rochmah, Mawaddah; Harahap, Nur Imma Fatimah; Awano, Hiroyuki; Morioka, Ichiro; Iijima, Kazumoto; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Lai, Poh San; Bouike, Yoshihiro; Nishio, Hisahide; Shinohara, Masakazu
2017-12-18
Spinal muscular atrophy (SMA) is one of the most common autosomal recessive disorders. The symptoms are caused by defects of lower motor neurons in the spinal cord. More than 95% of SMA patients are homozygous for survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique using dried blood spot (DBS) on filter paper. This system is convenient for mass screening in the large population and/or first-tier diagnostic method of the patients in the remote areas. However, this system was still time-consuming and effort-taking, because it required pre-amplification procedure to avoid non-specific amplification and gel-electrophoresis to detect the presence or absence of SMN1 deletion. When the fresh blood samples are used instead of DBS, or when the gel-electrophoresis is replaced by real-time PCR, we may have a simpler and more rapid diagnostic method for SMA. To establish a simpler and more rapid diagnostic method of SMN1 deletion using fresh blood DNA. DNA samples extracted from fresh blood and stored at 4 ℃ for 1 month. The samples were assayed using a real-time mCOP-PCR system without pre-amplification procedures. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The DNA samples were directly subjected to the mCOP-PCR step. The amplification of mCOP-PCR was monitored in a real-time PCR apparatus. The genotyping results of the real-time mCOP-PCR system using fresh blood DNA were completely matched with those of PCR-RFLP. In this real-time mCOP-PCR system using fresh blood-DNA, it took only four hours from extraction of DNA to detection of the presence or absence of SMN1 deletion, while it took more than 12 hours in PCR-RFLP. Our real-time mCOP-PCR system using fresh blood DNA was rapid and accurate, suggesting it may be useful for the first
Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao
2014-02-01
The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.
Directory of Open Access Journals (Sweden)
Hanan R Shehata
Full Text Available Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2 of 0.997-0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05-3.0% (wt/wt for the bovine and turkey targets, and 0.01-1.0% (wt/wt for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for
Industrial chimney monitoring - contemporary methods
Directory of Open Access Journals (Sweden)
Kaszowska Olga
2018-01-01
Full Text Available The paper presents knowledge acquired during the monitoring of a flue-gas stack, performed as part of technical and scientific surveillance of mining activity and its impact on industrial objects. The chimney is located in an area impacted by mining activity since the 1970s, from a coal mine which is no longer in existence. In the period of 2013-16, this area was subject to mining carried out by a mining entrepreneur who currently holds a license to excavate hard coal. Periodic measurements of the deflection of the 113-meter chimney are performed using conventional geodetic methods. The GIG used 3 methods to observe the stack: landbased 3D laser scanning, continuous deflection monitoring with a laser sensor, and drone-based visual inspections. The drone offered the possibility to closely inspect the upper sections of the flue-gas stack, which are difficult to see from the ground level.
Fluorescence quantitative PCR in detection of HBV DNA
International Nuclear Information System (INIS)
Shen Zheng; Li Ming; Shen Xia
2003-01-01
Objective: To study the relationship between the serum content of HBV-DNA and expression of serological markers with HBV infection patients. Methods: Serum samples from 375 hepatitis B patients with different clinical status and 70 normal persons were quantitated for HBV-DNA by FQ-PCR. Results: The average of HBV-DNA contents in the patient in the groups of HBsAg (+) and of HBeAg(+) were significantly higher than those in the group of HBsAg(-) and of HBeAg(-). Even in the group of HBeAg negative, high HBV-DNA contents might still be present in both the HBeAg(+) and HBeAg(-) groups. Conclusion: FQ-PCR can be used to monitor the real state of HBV infection, replication and the course of disease
DEFF Research Database (Denmark)
D'Agostino, M.; Wagner, M.; Vazquez-Boland, J.A.
2004-01-01
the accordance (repeatability) and the concordance (reproducibility) were 99.4%. The assay was incorporated within a method for the detection of L. monocytogenes in raw milk, which involves 24 It of enrichment in half-Fraser broth followed by 16 h of enrichment in a medium that can be added directly into the PCR...
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
International Nuclear Information System (INIS)
Jackson, Christopher B.; Gallati, Sabina; Schaller, André
2012-01-01
Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
Energy Technology Data Exchange (ETDEWEB)
Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)
2012-07-06
Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in
Komparasi Metode Isolasi DNA Patogen Antraknosa dan Bulai untuk Deteksi PCR
Directory of Open Access Journals (Sweden)
Ade Syahputra
2016-11-01
Full Text Available Polymerase chain reaction (PCR is an important tool for detection, identification and monitoring of quarantine pests in Indonesia. DNA isolation method from target organism is an important step to provide adequate DNA template for performing PCR. Objective of the research was to compare conventional, commercial kit, FTA-card and its modification methods of DNA isolation to be used in PCR detection for Colletotrichum acutatum and Peronosclerospora sorghi from chili and maize, respectively. DNA obtained from various isolation methods were measured using UV-vis nanodrop-spectrophotometry. DNA amplification was performed using DNA concentration of 15 ng µL-1 from each isolation method with gradual primer concentrations of 0.4; 0.6; 0.8; and 1.0 mM. The highest concentration of DNA was achieved with conventional methods for C. acutatum from pure culture and P. sorghi from maize leaf. Best DNA purity was obtained from isolation method using commercial kit for C. acutatum from infected fruit (1.94 and from conventional method for C. acutatum from pure culture (1.91. The highest total yield of isolated DNA was achieved by modified FTA-card for C. acutatum from pure culture. In general DNA amplification using various primer concentration gave positive results although DNA bands intensity was varied from faint to very bright. Furthermore PCR optimization using the best primer concentration from previous reaction showed that all DNA templates resulted in thick and bright DNA bands.
Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H
2012-04-27
To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.
Jarvi, Susan I.; Schultz, Jeffrey J.; Atkinson, Carter T.
2002-01-01
Several polymerase chain reaction (PCR)-based methods have recently been developed for diagnosing malarial infections in both birds and reptiles, but a critical evaluation of their sensitivity in experimentally-infected hosts has not been done. This study compares the sensitivity of several PCR-based methods for diagnosing avian malaria (Plasmodium relictum) in captive Hawaiian honeycreepers using microscopy and a recently developed immunoblotting technique. Sequential blood samples were collected over periods of up to 4.4 yr after experimental infection and rechallenge to determine both the duration and detectability of chronic infections. Two new nested PCR approaches for detecting circulating parasites based on P. relictum 18S rRNA genes and the thrombospondin-related anonymous protein (TRAP) gene are described. The blood smear and the PCR tests were less sensitive than serological methods for detecting chronic malarial infections. Individually, none of the diagnostic methods was 100% accurate in detecting subpatent infections, although serological methods were significantly more sensitive (97%) than either nested PCR (61–84%) or microscopy (27%). Circulating parasites in chronically infected birds either disappear completely from circulation or to drop to intensities below detectability by nested PCR. Thus, the use of PCR as a sole means of detection of circulating parasites may significantly underestimate true prevalence.
Directory of Open Access Journals (Sweden)
Zahra Gharibi
2017-10-01
Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.
Directory of Open Access Journals (Sweden)
Yong Huang
Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.
Koc, A Nedret; Atalay, Mustafa A; Inci, Melek; Sariguzel, Fatma M; Sav, Hafize
2017-05-01
Dermatophyte species, isolation and identification in clinical samples are still difficult and take a long time. The identification and molecular epidemiology of dermatophytes commonly isolated in a clinical laboratory in Turkey by repetitive sequence-based PCR (rep-PCR) were assessed by comparing the results with those of reference identification. A total of 44 dermatophytes isolated from various clinical specimens of 20 patients with superficial mycoses in Kayseri and 24 patients in Hatay were studied. The identification of dermatophyte isolates was based on the reference identification and rep-PCR using the DiversiLab System (BioMerieux). The genotyping of dermatophyte isolates from different patients was determined by rep-PCR. In the identification of dermatophyte isolates, agreement between rep-PCR and conventional methods was 87.8 % ( 36 of 41). The dermatophyte strains belonged to four clones (A -D) which were determined by the use of rep-PCR. The dermatophyte strains in Clone B, D showed identical patterns with respect to the region. In conclusion, rep-PCR appears to be useful for evaluation of the identification and clonal relationships between Trichophyton rubrum species complex and Trichophyton mentagrophytes species complex isolates. The similarity and diversity of these isolates may be assessed according to different regions by rep-PCR. © 2017 Blackwell Verlag GmbH.
Quantitative monitoring of microbial species during bioleaching of a copper concentrate
Directory of Open Access Journals (Sweden)
Sabrina Hedrich
2016-12-01
Full Text Available Monitoring of the microbial community in bioleaching processes is essential in order to control process parameters and enhance the leaching efficiency. Suitable methods are, however, limited as they are usually not adapted to bioleaching samples and often no taxon-specific assays are available in the literature for these types of consortia. Therefore, our study focused on the development of novel quantitative real-time PCR (qPCR assays for the quantification of Acidithiobacillus caldus, Leptospirillum ferriphilum, Sulfobacillus thermosulfidooxidans and Sulfobacillus benefaciens and comparison of the results with data from other common molecular monitoring methods in order to evaluate their accuracy and specificity. Stirred tank bioreactors for the leaching of copper concentrate, housing a consortium of acidophilic, moderately-thermophilic bacteria, relevant in several bioleaching operations, served as a model system. The microbial community analysis via qPCR allowed a precise monitoring of the evolution of total biomass as well as abundance of specific species. Data achieved by the standard fingerprinting methods, terminal restriction fragment length polymorphism (T-RFLP and capillary electrophoresis single strand conformation polymorphism (CE-SSCP on the same samples followed the same trend as qPCR data. The main added value of qPCR was, however, to provide quantitative data for each species whereas only relative abundance could be deduced from T-RFLP and CE-SSCP profiles. Additional value was obtained by applying two further quantitative methods which do not require nucleic acid extraction, total cell counting after SYBR Green staining and metal sulfide oxidation activity measurements via microcalorimetry. Overall, these complementary methods allow for an efficient quantitative microbial community monitoring in various bioleaching operations.
Quantitative Monitoring of Microbial Species during Bioleaching of a Copper Concentrate.
Hedrich, Sabrina; Guézennec, Anne-Gwenaëlle; Charron, Mickaël; Schippers, Axel; Joulian, Catherine
2016-01-01
Monitoring of the microbial community in bioleaching processes is essential in order to control process parameters and enhance the leaching efficiency. Suitable methods are, however, limited as they are usually not adapted to bioleaching samples and often no taxon-specific assays are available in the literature for these types of consortia. Therefore, our study focused on the development of novel quantitative real-time PCR (qPCR) assays for the quantification of Acidithiobacillus caldus, Leptospirillum ferriphilum, Sulfobacillus thermosulfidooxidans , and Sulfobacillus benefaciens and comparison of the results with data from other common molecular monitoring methods in order to evaluate their accuracy and specificity. Stirred tank bioreactors for the leaching of copper concentrate, housing a consortium of acidophilic, moderately thermophilic bacteria, relevant in several bioleaching operations, served as a model system. The microbial community analysis via qPCR allowed a precise monitoring of the evolution of total biomass as well as abundance of specific species. Data achieved by the standard fingerprinting methods, terminal restriction fragment length polymorphism (T-RFLP) and capillary electrophoresis single strand conformation polymorphism (CE-SSCP) on the same samples followed the same trend as qPCR data. The main added value of qPCR was, however, to provide quantitative data for each species whereas only relative abundance could be deduced from T-RFLP and CE-SSCP profiles. Additional value was obtained by applying two further quantitative methods which do not require nucleic acid extraction, total cell counting after SYBR Green staining and metal sulfide oxidation activity measurements via microcalorimetry. Overall, these complementary methods allow for an efficient quantitative microbial community monitoring in various bioleaching operations.
Moreno, Lilliana I; Mills, DeEtta; Fetscher, Jill; John-Williams, Krista; Meadows-Jantz, Lee; McCord, Bruce
2011-03-01
The placement of cadavers in shallow, clandestine graves may alter the microbial and geochemical composition of the underlying and adjacent soils. Using amplicon length heterogeneity-PCR (LH-PCR) the microbial community changes in these soils can be assessed. In this investigation, nine different grave sites were examined over a period of 16weeks. The results indicated that measurable changes occurred in the soil bacterial community during the decomposition process. In this study, amplicons corresponding to anaerobic bacteria, not indigenous to the soil, were shown to produce differences between grave sites and control soils. Among the bacteria linked to these amplicons are those that are most often part of the commensal flora of the intestines, mouth and skin. In addition, over the 16week sampling interval, the level of indicator organisms (i.e., nitrogen fixing bacteria) dropped as the body decomposed and after four weeks of environmental exposure they began to increase again; thus differences in the abundance of nitrogen fixing bacteria were also found to contribute to the variation between controls and grave soils. These results were verified using primers that specifically targeted the nifH gene coding for nitrogenase reductase. LH-PCR provides a fast, robust and reproducible method to measure microbial changes in soil and could be used to determine potential cadaveric contact in a given area. The results obtained with this method could ultimately provide leads to investigators in criminal or missing person scenarios and allow for further analysis using human specific DNA assays to establish the identity of the buried body. Copyright © 2010 Elsevier B.V. All rights reserved.
KEYBOARD MONITORING BASED UPON THE IMMUNOLOGIC CLONING
Directory of Open Access Journals (Sweden)
Yu. A. Bryukhomitsky
2016-12-01
Full Text Available The Biometric Keyboard Monitoring System is represented. It’s intended for permanent textindependent control and analysis of automated information data systems users’ keyboard script. It’s suggested a keyboard monitoring method, which is combined the idea and advantages of threaded method of keyboard parameters representation and immunological approach to its realization, based upon the detectors cloning model. Suggested method potentially possesses a pinpoint accuracy, higher convergence rate of classification problems solving, ability to learn on only “own” class exemplars.
Clinical Assessment of a Nocardia PCR-Based Assay for Diagnosis of Nocardiosis.
Rouzaud, Claire; Rodriguez-Nava, Véronica; Catherinot, Emilie; Méchaï, Frédéric; Bergeron, Emmanuelle; Farfour, Eric; Scemla, Anne; Poirée, Sylvain; Delavaud, Christophe; Mathieu, Daniel; Durupt, Stéphane; Larosa, Fabrice; Lengelé, Jean-Philippe; Christophe, Jean-Louis; Suarez, Felipe; Lortholary, Olivier; Lebeaux, David
2018-06-01
The diagnosis of nocardiosis, a severe opportunistic infection, is challenging. We assessed the specificity and sensitivity of a 16S rRNA Nocardia PCR-based assay performed on clinical samples. In this multicenter study (January 2014 to April 2015), patients who were admitted to three hospitals and had an underlying condition favoring nocardiosis, clinical and radiological signs consistent with nocardiosis, and a Nocardia PCR assay result for a clinical sample were included. Patients were classified as negative control (NC) (negative Nocardia culture results and proven alternative diagnosis or improvement at 6 months without anti- Nocardia treatment), positive control (PC) (positive Nocardia culture results), or probable nocardiosis (positive Nocardia PCR results, negative Nocardia culture results, and no alternative diagnosis). Sixty-eight patients were included; 47 were classified as NC, 8 as PC, and 13 as probable nocardiosis. PCR results were negative for 35/47 NC patients (74%). For the 12 NC patients with positive PCR results, the PCR assay had been performed with respiratory samples. These NC patients had chronic bronchopulmonary disease more frequently than did the NC patients with negative PCR results (8/12 patients [67%] versus 11/35 patients [31%]; P = 0.044). PCR results were positive for 7/8 PC patients (88%). There were 13 cases of probable nocardiosis, diagnosed solely using the PCR results; 9 of those patients (69%) had lung involvement (consolidation or nodule). Nocardia PCR testing had a specificity of 74% and a sensitivity of 88% for the diagnosis of nocardiosis. Nocardia PCR testing may be helpful for the diagnosis of nocardiosis in immunocompromised patients but interpretation of PCR results from respiratory samples is difficult, because the PCR assay may also detect colonization. Copyright © 2018 American Society for Microbiology.
Partial and Full PCR-Based Reverse Genetics Strategy for Influenza Viruses
Chen, Hongjun; Ye, Jianqiang; Xu, Kemin; Angel, Matthew; Shao, Hongxia; Ferrero, Andrea; Sutton, Troy; Perez, Daniel R.
2012-01-01
Since 1999, plasmid-based reverse genetics (RG) systems have revolutionized the way influenza viruses are studied. However, it is not unusual to encounter cloning difficulties for one or more influenza genes while attempting to recover virus de novo. To overcome some of these shortcomings we sought to develop partial or full plasmid-free RG systems. The influenza gene of choice is assembled into a RG competent unit by virtue of overlapping PCR reactions containing a cDNA copy of the viral gene segment under the control of RNA polymerase I promoter (pol1) and termination (t1) signals – herein referred to as Flu PCR amplicons. Transfection of tissue culture cells with either HA or NA Flu PCR amplicons and 7 plasmids encoding the remaining influenza RG units, resulted in efficient virus rescue. Likewise, transfections including both HA and NA Flu PCR amplicons and 6 RG plasmids also resulted in efficient virus rescue. In addition, influenza viruses were recovered from a full set of Flu PCR amplicons without the use of plasmids. PMID:23029501
Vibration-Based Adaptive Novelty Detection Method for Monitoring Faults in a Kinematic Chain
Directory of Open Access Journals (Sweden)
Jesus Adolfo Cariño-Corrales
2016-01-01
Full Text Available This paper presents an adaptive novelty detection methodology applied to a kinematic chain for the monitoring of faults. The proposed approach has the premise that only information of the healthy operation of the machine is initially available and fault scenarios will eventually develop. This approach aims to cover some of the challenges presented when condition monitoring is applied under a continuous learning framework. The structure of the method is divided into two recursive stages: first, an offline stage for initialization and retraining of the feature reduction and novelty detection modules and, second, an online monitoring stage to continuously assess the condition of the machine. Contrary to classical static feature reduction approaches, the proposed method reformulates the features by employing first a Laplacian Score ranking and then the Fisher Score ranking for retraining. The proposed methodology is validated experimentally by monitoring the vibration measurements of a kinematic chain driven by an induction motor. Two faults are induced in the motor to validate the method performance to detect anomalies and adapt the feature reduction and novelty detection modules to the new information. The obtained results show the advantages of employing an adaptive approach for novelty detection and feature reduction making the proposed method suitable for industrial machinery diagnosis applications.
Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method
Directory of Open Access Journals (Sweden)
Javad Mohammadi
2017-06-01
Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary
Xu, Min; Zhang, Lei; Yue, Hong-Shui; Pang, Hong-Wei; Ye, Zheng-Liang; Ding, Li
2017-10-01
To establish an on-line monitoring method for extraction process of Schisandrae Chinensis Fructus, the formula medicinal material of Yiqi Fumai lyophilized injection by combining near infrared spectroscopy with multi-variable data analysis technology. The multivariate statistical process control (MSPC) model was established based on 5 normal batches in production and 2 test batches were monitored by PC scores, DModX and Hotelling T2 control charts. The results showed that MSPC model had a good monitoring ability for the extraction process. The application of the MSPC model to actual production process could effectively achieve on-line monitoring for extraction process of Schisandrae Chinensis Fructus, and can reflect the change of material properties in the production process in real time. This established process monitoring method could provide reference for the application of process analysis technology in the process quality control of traditional Chinese medicine injections. Copyright© by the Chinese Pharmaceutical Association.
International Nuclear Information System (INIS)
Grecco, Claudio H.S.; Santos, Isaac J.A.L.; Carvalho, Paulo V.R.; Vidal, Mario C.R.; Cosenza, Carlos A.N.
2013-01-01
Resilience is the intrinsic ability of a system to adjust its functioning prior to, during, or following changes and disturbances, so that it can sustain required operations under expected and unexpected conditions. This definition focuses on the ability to function, rather than on being impervious to failure, and thereby overcomes the traditional conflict between productivity and safety. Resilience engineering (RE) has fast become recognized as a valuable complement to the established approaches to safety of complex socio-technical systems and methods to monitor organizational resilience are needed. However, few, if any, comprehensive and systematic research studies focus on developing an objective, reliable and practical assessment model for monitoring organizational resilience. Most methods cannot fully solve the subjectivity of resilience evaluation. In order to remedy this deficiency, the aim of this research is to adopt a Fuzzy Set Theory (FST) approach to establish a method for resilience assessment in organizations based on leading safety performance indicators, defined according to the resilience engineering principles. The method uses FST concepts and properties to model the indicators and to assess the results of their application. To exemplify the method we performed an exploratory case study at the process of radiopharmaceuticals dispatch package of a Brazilian radioactive facility. (author)
Energy Technology Data Exchange (ETDEWEB)
Grecco, Claudio H.S.; Santos, Isaac J.A.L.; Carvalho, Paulo V.R., E-mail: grecco@ien.gov.br, E-mail: luquetti@ien.gov.br, E-mail: paulov@ien.gov.br [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Divisao de Instrumentacao e Confiabilidade Humana; Vidal, Mario C.R.; Cosenza, Carlos A.N., E-mail: mvidal@ergonomia.ufrj.br, E-mail: cosenza@pep.ufrj.br [Coordenacao dos Programas de Pos-Graduacao em Engenharia (PEP/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Programa de Engenharia de Producao
2013-07-01
Resilience is the intrinsic ability of a system to adjust its functioning prior to, during, or following changes and disturbances, so that it can sustain required operations under expected and unexpected conditions. This definition focuses on the ability to function, rather than on being impervious to failure, and thereby overcomes the traditional conflict between productivity and safety. Resilience engineering (RE) has fast become recognized as a valuable complement to the established approaches to safety of complex socio-technical systems and methods to monitor organizational resilience are needed. However, few, if any, comprehensive and systematic research studies focus on developing an objective, reliable and practical assessment model for monitoring organizational resilience. Most methods cannot fully solve the subjectivity of resilience evaluation. In order to remedy this deficiency, the aim of this research is to adopt a Fuzzy Set Theory (FST) approach to establish a method for resilience assessment in organizations based on leading safety performance indicators, defined according to the resilience engineering principles. The method uses FST concepts and properties to model the indicators and to assess the results of their application. To exemplify the method we performed an exploratory case study at the process of radiopharmaceuticals dispatch package of a Brazilian radioactive facility. (author)
Galactomannan and Real-Time PCR in the diagnosis of invasive Aspergillosis: preliminary data
Directory of Open Access Journals (Sweden)
Cristina Pedrotti
2014-03-01
Full Text Available The diagnosis of invasive aspergillosis is notoriously difficult. The standard culture-based methods have shown considerable limitations in performance. For this reason, non-culture methods have been increasingly employed for the diagnosis of invasive aspergillosis, and, among them, the methods based on Real-Time polymerase chain reaction (RT-PCR. In this study we assess the contribution in lowering diagnosis errors provided by the RT-PCR method when run alongside other methods. We analyzed 23 biological samples, 14 serum samples, and 9 bronchoalveolar lavage samples (BAL from 10 immunocompromised patients who were selected according to EORTC/MSG criteria (European Organization for Research and Treatment of Cancer/Mycoses Study Group. On the serum sample we searched the galactomannan (GM (Platelia Aspergillus® and the fungal genome (MycAssayTMAspergillus; the BAL samples were subjected also to the culture tests. In 11 serum samples the results showed concordance between GM and RT–PCR tests, while in 3 samples we report discordance: 2 results were GM positive and RT-PCR negative, and 1 results GM negative and RT-PCR indeterminate. In 5 BAL samples the results showed concordance between the two methods, while 4 were GM positive and RT-PCR negative. The data, although still preliminary, suggest an increased accuracy in the diagnosis of suspected invasive aspergillosis when employing both RT-PCR and GM tests given that the RT-PCR test eliminates the false positive results of the GM test. The PCR methods require, however, further applications of this type of diagnostic because of the severe limit given by the lack of standardization.
International Nuclear Information System (INIS)
Trendafilova, I
2011-01-01
Vibration-based structural interrogation and health monitoring is a field which is concerned with the estimation of the current state of a structure or a component from its vibration response with regards to its ability to perform its intended function appropriately. One way to approach this problem is through damage features extracted from the measured structural vibration response. This paper suggests to use a new concept for the purposes of vibration-based health monitoring. The correlation between two signals, an input and an output, measured on the structure is used to develop a damage indicator. The paper investigates the applicability of the signal cross-correlation and a nonlinear alternative, the average mutual information between the two signals, for the purposes of structural health monitoring and damage assessment. The suggested methodology is applied and demonstrated for delamination detection in a composite beam.
Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar
2016-12-15
Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.
ABO Blood Group Genotyping by Real-time PCR in Kazakh Population
Directory of Open Access Journals (Sweden)
Pavel Tarlykov
2014-12-01
Full Text Available Introduction. ABO blood group genotyping is a new technology in hematology that helps prevent adverse transfusion reactions in patients. Identification of antigens on the surface of red blood cells is based on serology; however, genotyping employs a different strategy and is aimed directly at genes that determine the surface proteins. ABO blood group genotyping by real-time PCR has several crucial advantages over other PCR-based techniques, such as high rapidity and reliability of analysis. The purpose of this study was to examine nucleotide substitutions differences by blood types using a PCR-based method on Kazakh blood donors.Methods. The study was approved by the Ethics Committee of the National Center for Biotechnology. Venous blood samples from 369 healthy Kazakh blood donors, whose blood types had been determined by serological methods, were collected after obtaining informed consent. The phenotypes of the samples included blood group A (n = 99, B (n = 93, O (n = 132, and AB (n = 45. Genomic DNA was extracted using a salting-out method. PCR products of ABO gene were sequenced on an ABI 3730xl DNA analyzer (Applied Biosystems. The resulting nucleotide sequences were compared and aligned against reference sequence NM_020469.2. Real-time PCR analysis was performed on CFX96 Touch™ Real-Time PCR Detection System (BioRad.Results. Direct sequencing of ABO gene in 369 samples revealed that the vast majority of nucleotide substitutions that change the ABO phenotype were limited to exons 6 and 7 of the ABO gene at positions 261, 467, 657, 796, 803, 930 and 1,060. However, genotyping of only three of them (261, 796 and 803 resulted in identification of major ABO genotypes in the Kazakh population. As a result, TaqMan probe based real-time PCR assay for the specific detection of genotypes 261, 796 and 803 was developed. The assay did not take into account several other mutations that may affect the determination of blood group, because they have a
Advanced aircraft service life monitoring method via flight-by-flight load spectra
Lee, Hongchul
This research is an effort to understand current method and to propose an advanced method for Damage Tolerance Analysis (DTA) for the purpose of monitoring the aircraft service life. As one of tasks in the DTA, the current indirect Individual Aircraft Tracking (IAT) method for the F-16C/D Block 32 does not properly represent changes in flight usage severity affecting structural fatigue life. Therefore, an advanced aircraft service life monitoring method based on flight-by-flight load spectra is proposed and recommended for IAT program to track consumed fatigue life as an alternative to the current method which is based on the crack severity index (CSI) value. Damage Tolerance is one of aircraft design philosophies to ensure that aging aircrafts satisfy structural reliability in terms of fatigue failures throughout their service periods. IAT program, one of the most important tasks of DTA, is able to track potential structural crack growth at critical areas in the major airframe structural components of individual aircraft. The F-16C/D aircraft is equipped with a flight data recorder to monitor flight usage and provide the data to support structural load analysis. However, limited memory of flight data recorder allows user to monitor individual aircraft fatigue usage in terms of only the vertical inertia (NzW) data for calculating Crack Severity Index (CSI) value which defines the relative maneuver severity. Current IAT method for the F-16C/D Block 32 based on CSI value calculated from NzW is shown to be not accurate enough to monitor individual aircraft fatigue usage due to several problems. The proposed advanced aircraft service life monitoring method based on flight-by-flight load spectra is recommended as an improved method for the F-16C/D Block 32 aircraft. Flight-by-flight load spectra was generated from downloaded Crash Survival Flight Data Recorder (CSFDR) data by calculating loads for each time hack in selected flight data utilizing loads equations. From
Fredlund, Elisabeth; Gidlund, Ann; Olsen, Monica; Börjesson, Thomas; Spliid, Niels Henrik Hytte; Simonsson, Magnus
2008-04-01
Identification of Fusarium species by traditional methods requires specific skill and experience and there is an increased interest for new molecular methods for identification and quantification of Fusarium from food and feed samples. Real-time PCR with probe technology (Taqman) can be used for the identification and quantification of several species of Fusarium from cereal grain samples. There are several critical steps that need to be considered when establishing a real-time PCR-based method for DNA quantification, including extraction of DNA from the samples. In this study, several DNA extraction methods were evaluated, including the DNeasy Plant Mini Spin Columns (Qiagen), the Bio robot EZ1 (Qiagen) with the DNeasy Blood and Tissue Kit (Qiagen), and the Fast-DNA Spin Kit for Soil (Qbiogene). Parameters such as DNA quality and stability, PCR inhibitors, and PCR efficiency were investigated. Our results showed that all methods gave good PCR efficiency (above 90%) and DNA stability whereas the DNeasy Plant Mini Spin Columns in combination with sonication gave the best results with respect to Fusarium DNA yield. The modified DNeasy Plant Mini Spin protocol was used to analyse 31 wheat samples for the presence of F. graminearum and F. culmorum. The DNA level of F. graminearum could be correlated to the level of DON (r(2) = 0.9) and ZEN (r(2) = 0.6) whereas no correlation was found between F. culmorum and DON/ZEA. This shows that F. graminearum and not F. culmorum, was the main producer of DON in Swedish wheat during 2006.
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Vital, Pierangeli G; Van Ha, Nguyen Thi; Tuyet, Le Thi Hong; Widmer, Kenneth W
2017-02-01
Surface water samples in Vietnam were collected from the Saigon River, rural and suburban canals, and urban runoff canals in Ho Chi Minh City, Vietnam, and were processed to enumerate Escherichia coli. Quantification was done through membrane filtration and quantitative real-time polymerase chain reaction (PCR). Mean log colony-forming unit (CFU)/100 ml E. coli counts in the dry season for river/suburban canals and urban canals were log 2.8 and 3.7, respectively, using a membrane filtration method, while using Taqman quantitative real-time PCR they were log 2.4 and 2.8 for river/suburban canals and urban canals, respectively. For the wet season, data determined by the membrane filtration method in river/suburban canals and urban canals samples had mean counts of log 3.7 and 4.1, respectively. While mean log CFU/100 ml counts in the wet season using quantitative PCR were log 3 and 2, respectively. Additionally, the urban canal samples were significantly lower than those determined by conventional culture methods for the wet season. These results show that while quantitative real-time PCR can be used to determine levels of fecal indicator bacteria in surface waters, there are some limitations to its application and it may be impacted by sources of runoff based on surveyed samples.
Implementing and Innovating Marine Monitoring Approaches for Assessing Marine Environmental Status
Danovaro, Roberto; Carugati, Laura; Berzano, Marco; Cahill, Abigail E.; Carvalho, Susana; Chenuil, Anne; Corinaldesi, Cinzia; Cristina, Sonia; David, Romain; Dell'Anno, Antonio; Dzhembekova, Nina; Garcé s, Esther; Gasol, Joseph M.; Goela, Priscila; Fé ral, Jean-Pierre; Ferrera, Isabel; Forster, Rodney M.; Kurekin, Andrey A.; Rastelli, Eugenio; Marinova, Veselka; Miller, Peter I.; Moncheva, Snejana; Newton, Alice; Pearman, John K.; Pitois, Sophie G.; Reñ é , Albert; Rodrí guez-Ezpeleta, Naiara; Saggiomo, Vincenzo; Simis, Stefan G. H.; Stefanova, Kremena; Wilson, Christian; Lo Martire, Marco; Greco, Silvestro; Cochrane, Sabine K. J.; Mangoni, Olga; Borja, Angel
2016-01-01
Marine environmental monitoring has tended to focus on site-specific methods of investigation. These traditional methods have low spatial and temporal resolution and are relatively labor intensive per unit area/time that they cover. To implement the Marine Strategy Framework Directive (MSFD), European Member States are required to improve marine monitoring and design monitoring networks. This can be achieved by developing and testing innovative and cost-effective monitoring systems, as well as indicators of environmental status. Here, we present several recently developed methodologies and technologies to improve marine biodiversity indicators and monitoring methods. The innovative tools are discussed concerning the technologies presently utilized as well as the advantages and disadvantages of their use in routine monitoring. In particular, the present analysis focuses on: (i) molecular approaches, including microarray, Real Time quantitative PCR (qPCR), and metagenetic (metabarcoding) tools; (ii) optical (remote) sensing and acoustic methods; and (iii) in situ monitoring instruments. We also discuss their applications in marine monitoring within the MSFD through the analysis of case studies in order to evaluate their potential utilization in future routine marine monitoring. We show that these recently-developed technologies can present clear advantages in accuracy, efficiency and cost.
Implementing and Innovating Marine Monitoring Approaches for Assessing Marine Environmental Status
Danovaro, Roberto
2016-11-23
Marine environmental monitoring has tended to focus on site-specific methods of investigation. These traditional methods have low spatial and temporal resolution and are relatively labor intensive per unit area/time that they cover. To implement the Marine Strategy Framework Directive (MSFD), European Member States are required to improve marine monitoring and design monitoring networks. This can be achieved by developing and testing innovative and cost-effective monitoring systems, as well as indicators of environmental status. Here, we present several recently developed methodologies and technologies to improve marine biodiversity indicators and monitoring methods. The innovative tools are discussed concerning the technologies presently utilized as well as the advantages and disadvantages of their use in routine monitoring. In particular, the present analysis focuses on: (i) molecular approaches, including microarray, Real Time quantitative PCR (qPCR), and metagenetic (metabarcoding) tools; (ii) optical (remote) sensing and acoustic methods; and (iii) in situ monitoring instruments. We also discuss their applications in marine monitoring within the MSFD through the analysis of case studies in order to evaluate their potential utilization in future routine marine monitoring. We show that these recently-developed technologies can present clear advantages in accuracy, efficiency and cost.
Monitoring of Yersinia enterocolitica strains from free-living animals using different methods.
Syczyło, K; Platt-Samoraj, A; Bancerz-Kisiel, A; Szczerba-Turek, A; Lipczyńska, K; Jabłoński, A; Procajło, Z; Szweda, W
2016-01-01
The aim of the study was to monitor Y. enterocolitica strains from free-living animals captured during 2011-2014 hunting seasons in Poland using warm (ITC) and cold (PSB) enrichment and molecular examination. Over 1600 samples have been cultured. After ITC/PSB enrichment 237 strains presenting features characteristic for Y. enterocolitica were isolated. Molecular examination using multiplex PCR revealed 140 isolates from PSB and 78 from ITC. The concentration of pathogenic Yersinia in asymptomatic carriers is low and the PCR detection should be preceded by bacteriological examination.
Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW
2009-01-01
Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...
A Bridge Deflection Monitoring System Based on CCD
Directory of Open Access Journals (Sweden)
Baohua Shan
2016-01-01
Full Text Available For long-term monitoring of the midspan deflection of Songjiazhuang cloverleaf junction on 309 national roads in Zibo city, this paper proposes Zhang’s calibration-based DIC deflection monitoring method. CCD cameras are used to track the change of targets’ position, Zhang’s calibration algorithm is introduced to acquire the intrinsic and extrinsic parameters of CCD cameras, and the DIC method is combined with Zhang’s calibration algorithm to measure bridge deflection. The comparative test between Zhang’s calibration and scale calibration is conducted in lab, and experimental results indicate that the proposed method has higher precision. According to the deflection monitoring scheme, the deflection monitoring software for Songjiazhuang cloverleaf junction is developed by MATLAB, and a 4-channel CCD deflection monitoring system for Songjiazhuang cloverleaf junction is integrated in this paper. This deflection monitoring system includes functions such as image preview, simultaneous collection, camera calibration, deflection display, and data storage. In situ deflection curves show a consistent trend; this suggests that the proposed method is reliable and is suitable for the long-term monitoring of bridge deflection.
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario
2017-05-04
Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
A Eslami
2012-12-01
Full Text Available Background: Due to the lack of a suitable and economic test for the analysis of the polymorphism at codon 167, we developed a new PCR-RFLP technique, based on a modified forward primer (UT-HC167 MF-primer, to identify simultaneously the SNPs at codons 167 and 200 of isotype 1 β-tubulin gene of Haemonchus contortus.Methods: There already are several safe and easy methods for identification of point mutations at codons 198 and 200. Due to the lack of a reliable and easy method for the detection of the single nucleotide polymorphism (SNP at codon 167, we developed an innovative PCR-RFLP technique based on a modified forward primer (UT-HC167 MF-primer, in which the nucleotide T at the position 443 was substituted through a nucleotide A creating a restriction site for restriction endonuclease SnaB I in the nucleotide sequences including codon 167. A total of 138 adult male H. contortus were collected from three different geo-climatic areas of Iran. The isolated genomic DNA of each single worm was amplified by PCR using primers flanking codon 167. The PCR product (527 bp was then amplified by semi-nested PCR using the UT-HC167 MF-primer and the reverse primer achieving a PCR product of 451 bp in length. This PCR product was subsequently digested with the restriction endonucleases SnaB I and TaaI for analysis of the mutations at codons 167 and 200, respectively.Results: All worms had two alleles encoding for phenylalanine (BZss homozygote for both codons.Conclusion: Using the UT-HC167 MF-primer and a suitable reverse primer designed upstream from codon 200, it is possible to amplify a PCR product which can be used for analysis of the SNPs at all three mentioned codons using RFLP.
Zhou, Liqing; Pollard, Andrew J
2012-07-27
Enteric fever is a major public health problem, causing an estimated 21million new cases and 216,000 or more deaths every year. Current diagnosis of the disease is inadequate. Blood culture only identifies 45 to 70% of the cases and is time-consuming. Serological tests have very low sensitivity and specificity. Clinical samples obtained for diagnosis of enteric fever in the field generally have blood, so that even PCR-based methods, widely used for detection of other infectious diseases, are not a straightforward option in typhoid diagnosis. We developed a novel method to enrich target bacterial DNA by selective removal of human DNA from blood samples, enhancing the sensitivity of PCR tests. This method offers the possibility of improving PCR assays directly using clinical specimens for diagnosis of this globally important infectious disease. Blood samples were mixed with ox bile for selective lysis of human blood cells and the released human DNA was then digested with addition of bile resistant micrococcal nuclease. The intact Salmonella Typhi bacteria were collected from the specimen by centrifugation and the DNA extracted with QIAamp DNA mini kit. The presence of Salmonella Typhi bacteria in blood samples was detected by PCR with the fliC-d gene of Salmonella Typhi as the target. Micrococcal nuclease retained activity against human blood DNA in the presence of up to 9% ox bile. Background human DNA was dramatically removed from blood samples through the use of ox bile lysis and micrococcal nuclease for removal of mammalian DNA. Consequently target Salmonella Typhi DNA was enriched in DNA preparations and the PCR sensitivity for detection of Salmonella Typhi in spiked blood samples was enhanced by 1,000 fold. Use of a combination of selective ox-bile blood cell lysis and removal of human DNA with micrococcal nuclease significantly improves PCR sensitivity and offers a better option for improved typhoid PCR assays directly using clinical specimens in diagnosis of
Directory of Open Access Journals (Sweden)
Johnson Sandra
2010-10-01
Full Text Available Abstract Background Detection of bacterial nucleic acids in synovial fluid following total joint arthroplasty with suspected infection can be difficult; among other technical challenges, inhibitors in the specimens require extensive sample preparation and can diminish assay sensitivity even using polymerase chain reaction (PCR-based methods. To address this problem a simple protocol for prior use of multiple displacement amplification (MDA as an adjunct to PCR was established and tested on both purified S. aureus DNA as well as on clinical samples known to contain S. aureus nucleic acids. Findings A single round of MDA on purified nucleic acids resulted in a > 300 thousand-fold increase in template DNA on subsequent quantitative PCR (qPCR analysis. MDA use on clinical samples resulted in at least a 100-fold increase in sensitivity on subsequent qPCR and required no sample preparation other than a simple alkali/heat lysis step. Mixed samples of S. aureus DNA with a 103 - 104-fold excess of human genomic DNA still allowed for MDA amplification of the minor bacterial component to the threshold of detectability. Conclusion MDA is a promising technique that may serve to significantly enhance the sensitivity of molecular assays in cases of suspected joint infection while simultaneously reducing the specimen handling required.
Sampling methods for rumen microbial counts by Real-Time PCR techniques
Directory of Open Access Journals (Sweden)
S. Puppo
2010-02-01
Full Text Available Fresh rumen samples were withdrawn from 4 cannulated buffalo females fed a fibrous diets in order to quantify bacteria concentration in the rumen by Real-Time PCR techniques. To obtain DNA of a good quality from whole rumen fluid, eight (M1-M8 different pre-filtration methods (cheese cloths, glass-fibre and nylon filter in combination with various centrifugation speeds (1000, 5000 and 14,000 rpm were tested. Genomic DNA extraction was performed either on fresh or frozen samples (-20°C. The quantitative bacteria analysis was realized according to Real-Time PCR procedure for Butyrivibrio fibrisolvens reported in literature. M5 resulted the best sampling procedure allowing to obtain a suitable genomic DNA. No differences were revealed between fresh and frozen samples.
Erdősi, Orsolya; Szakmár, Katalin; Reichart, Olivér; Szili, Zsuzsanna; László, Noémi; Székely Körmöczy, Péter; Laczay, Péter
2014-09-01
The incidence of outbreaks of foodborne listeriosis has indicated the need for a reliable and rapid detection of the microbe in different foodstuffs. A method combining redox potential measurement and real-time polymerase chain reaction (PCR) was developed to detect Listeria monocytogenes in artificially contaminated raw milk and soft cheese. Food samples of 25 g or 25 ml were homogenised in 225 ml of Listeria Enrichment Broth (LEB) with Oxford supplement, and the redox potential measurement technique was applied. For Listeria species the measuring time was maximum 34 h. The absence of L. monocytogenes could reliably be proven by the redox potential measurement method, but Listeria innocua and Bacillus subtilis could not be differentiated from L. monocytogenes on the basis of the redox curves. The presence of L. monocytogenes had to be confirmed by real-time PCR. The combination of these two methods proved to detect < 10 cfu/g of L. monocytogenes in a cost- and time-effective manner. This method can potentially be used as an alternative to the standard nutrient method for the rapid detection of L. monocytogenes in food.
Nuriya, Hideko; Inoue, Kazuaki; Tanaka, Takeshi; Hayashi, Yukiko; Hishima, Tsunekazu; Funata, Nobuaki; Kaji, Kyosuke; Hayashi, Seishu; Kaneko, Shuichi; Kohara, Michinori
2010-01-01
Although PCR-based in situ hybridization (PCR-ISH) can be used to determine the distribution and localization of pathogens in tissues, this approach is hampered by its low specificity. Therefore, we used a highly specific and sensitive PCR-ISH method to reveal the lobular distribution and intracellular localization of hepatitis B virus (HBV) and HCV in chronic liver disease and to clarify the state of persistent HBV and HCV infection in the liver. HBV genomic DNA was detected in almost all hepatocytes, whereas HBV RNA or protein was differentially distributed only in a subset of the HBV DNA-positive region. Further, HCV genomic RNA was detected in almost all hepatocytes and was localized to the cytoplasm. HCV RNA was also detected in the epithelium of the large bile duct but not in endothelial cells, portal tracts, or sinusoidal lymphocytes. In patients with HBV and HCV coinfection, HCV RNA was localized to the noncancerous tissue, whereas HBV DNA was found only in the cancerous tissue. Using this novel PCR-ISH method, we could visualize the staining pattern of HBV and HCV in liver sections, and we obtained results consistent with those of real-time detection (RTD)-PCR analysis. In conclusion, almost all hepatocytes are infected with HBV or HCV in chronic liver disease; this finding implies that the viruses spreads throughout the liver in the chronic stage. PMID:20739486
Park, S.; Kim, H.; Kim, M.; Lee, Y.; Han, J.
2011-12-01
The 2010 outbreak of foot and mouth disease (FMD) in South Korea caused about 4,054 carcass burial sites to dispose the carcasses. Potential environmental impacts by leachate of carcass on groundwater have been issued and it still needs to be studied. Therefore, we tried to develop robust and sensitive tool to immediately determine a groundwater contamination by the leachate from carcass burial. For tracking both an agricultural fecal contamination source and the leachate in groundwater, competitive real-time PCR and PCR method were developed using various PCR primer sets designed to detect E. Coli uidA gene and mtDNA(cytochrome B, cytB) of the animal species such as ovine, porcine, caprine, and bovine. The designed methods were applied to tract the animal species in livestock wastewater and leachate of carcass under appropriate PCR or real-time PCR condition. In the result, mtDNA primer sets for individual (Cow or Pig) and multiple (Cow and Pig) amplification, and E. Coli uidA primers for fecal source amplification were specific and sensitive to target genes. To determine contamination source, concentration of amplified mtDNA and uidA was competitively quantified in Livestock wastewater, leachate of carcass, and groundwater. The highest concentration of mtDNA and uidA showed in leachate of carcass and livestock wastewater, respectively. Groundwater samples possibly contaminated by leachate of carcass were analyzed by this assay and it was able to prove contamination source.
A simple negative selection method to identify adenovirus recombinants using colony PCR
Directory of Open Access Journals (Sweden)
Yongliang Zhao
2014-01-01
Conclusions: The negative selection method to identify AdEasy adenovirus recombinants by colony PCR can identify the recombined colony within a short time-period, and maximally avoid damage to the recombinant plasmid by limiting recombination time, resulting in improved adenovirus packaging.
A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.
Govan, V A; Brözel, V; Allsopp, M H; Davison, S
1998-05-01
Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.
Beaulieu, Robert; López-Mondéjar, Rubén; Tittarelli, Fabio; Ros, Margarita; Pascual, José Antonio
2011-02-01
To ensure proper use of Trichoderma harzianum in agriculture, accurate data must be obtained in population monitoring. The effectiveness of qRT-PCR to quantify T. harzianum in different growing media was compared to the commonly used techniques of colony counting and qPCR. Results showed that plate counting and qPCR offered similar T. harzianum quantification patterns of an initial rapid increase in fungal population that decreased over time. However, data from qRT-PCR showed a population curve of active T. harzianum with a delayed onset of initial growth which then increased throughout the experiment. Results demonstrated that T. harzianum can successfully grow in these media and that qRT-PCR can offer a more distinct representation of active T. harzianum populations. Additionally, compost amended with T. harzianum exhibited a lower Fusarium oxysporum infection rate (67%) and lower percentage of fresh weight loss (11%) in comparison to amended peat (90% infection rate, 23% fresh weight loss). Copyright © 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Daniela Camargos Costa
2014-02-01
Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.
DEFF Research Database (Denmark)
Wang, Chong; Robles, Francisco; Ramirez, Saul
2016-01-01
Gallibacterium is a genus within the family Pasteurellaceae characterized by a high level of phenotypic and genetic diversity. No diagnostic method has yet been described, which allows species-specific identification of Gallibacterium anatis. The aim of this study was to develop a real...... published conventional PCR method and culture-based identification, respectively. The detection rates were 97%, 78% and 34% for the current qPCR, the conventional PCR and the culture-based identification method, respectively. The qPCR assay was able to detect the gene gyrB in serial dilutions of 10......-time quantitative PCR (qPCR) method allowing species-specific identification and quantification of G. anatis. A G. anatis specific DNA sequence was identified in the gyrase subunit B gene (gyrB) and used to design a TaqMan probe and corresponding primers. The specificity of the assay was tested on 52 bacterial...
A new smart traffic monitoring method using embedded cement-based piezoelectric sensors
International Nuclear Information System (INIS)
Zhang, Jinrui; Lu, Youyuan; Lu, Zeyu; Liu, Chao; Sun, Guoxing; Li, Zongjin
2015-01-01
Cement-based piezoelectric composites are employed as the sensing elements of a new smart traffic monitoring system. The piezoelectricity of the cement-based piezoelectric sensors enables powerful and accurate real-time detection of the pressure induced by the traffic flow. To describe the mechanical-electrical conversion mechanism between traffic flow and the electrical output of the embedded piezoelectric sensors, a mathematical model is established based on Duhamel’s integral, the constitutive law and the charge-leakage characteristics of the piezoelectric composite. Laboratory tests show that the voltage magnitude of the sensor is linearly proportional to the applied pressure, which ensures the reliability of the cement-based piezoelectric sensors for traffic monitoring. A series of on-site road tests by a 10 tonne truck and a 6.8 tonne van show that vehicle weight-in-motion can be predicted based on the mechanical-electrical model by taking into account the vehicle speed and the charge-leakage property of the piezoelectric sensor. In the speed range from 20 km h −1 to 70 km h −1 , the error of the repeated weigh-in-motion measurements of the 6.8 tonne van is less than 1 tonne. The results indicate that the embedded cement-based piezoelectric sensors and associated measurement setup have good capability of smart traffic monitoring, such as traffic flow detection, vehicle speed detection and weigh-in-motion measurement. (paper)
Monitoring Campylobacter in the poultry production chain - From culture to genes and beyond
DEFF Research Database (Denmark)
Josefsen, Mathilde Hasseldam; Bhunia, Arun; Engvall, Eva Olsson
2015-01-01
Improved monitoring tools are important for the control of Campylobacter bacteria in poultry production. Standardized reference culture methods issued by national and international standardization organizations are time-consuming, cumbersome and not amenable to automation for screening of large...... numbers of samples. The ultimate goal for rapid monitoring of Campylobacter is to prevent contaminated meat from entering the food market. Currently, real-time PCR is fulfilling abovementioned criteria to a certain extent. Further development of real-time PCR, microarray PCR, miniaturized biosensors...
Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.
Gryson, Nicolas
2010-03-01
The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.
Christ, Theodore J.; Desjardins, Christopher David
2018-01-01
Curriculum-Based Measurement of Oral Reading (CBM-R) is often used to monitor student progress and guide educational decisions. Ordinary least squares regression (OLSR) is the most widely used method to estimate the slope, or rate of improvement (ROI), even though published research demonstrates OLSR's lack of validity and reliability, and…
Directory of Open Access Journals (Sweden)
Christian Diamant Mossoro-Kpinde
2016-01-01
Full Text Available Objectives. We evaluated the performances of Amplix real-time PCR platform developed by Biosynex (Strasbourg, France, combining automated station extraction (Amplix station 16 Dx and real-time PCR (Amplix NG, for quantifying plasma HIV-1 RNA by lyophilized HIV-1 RNA-based Amplix reagents targeting gag and LTR, using samples from HIV-1-infected adults from Central African Republic. Results. Amplix real-time PCR assay showed low limit of detection (28 copies/mL, across wide dynamic range (1.4–10 log copies/mL, 100% sensitivity and 99% specificity, high reproducibility, and accuracy with mean bias < 5%. The assay showed excellent correlations and concordance of 95.3% with the reference HIV-1 RNA load assay (Roche, with mean absolute bias of +0.097 log copies/mL by Bland-Altman analysis. The assay was able to detect and quantify the most prevalent HIV-1 subtype strains and the majority of non-B subtypes, CRFs of HIV-1 group M, and HIV-1 groups N and O circulating in Central Africa. The Amplix assay showed 100% sensitivity and 99.6% specificity to diagnose virological failure in clinical samples from antiretroviral drug-experienced patients. Conclusions. The HIV-1 RNA-based Amplix real-time PCR platform constitutes sensitive and reliable system for clinical monitoring of HIV-1 RNA load in HIV-1-infected children and adults, particularly adapted to intermediate laboratory facilities in sub-Saharan Africa.
Species Authentication of Common Meat Based on PCR Analysis of the Mitochondrial COI Gene.
Dai, Zhenyu; Qiao, Jiao; Yang, Siran; Hu, Shen; Zuo, Jingjing; Zhu, Weifeng; Huang, Chunhong
2015-07-01
Adulteration of meat products and costly animal-derived commodities with their inferior/cheaper counterparts is a grievous global problem. Species authentication is still technical challenging, especially to those deep processed products. The present study described the design of seven sets of species-specific primer based on a high heterozygous region of mitochondrial cytochrome c oxidase subunit I (COI) gene. These primers were proven to have high species specificity and no cross-reactions and unexpected products to different DNA source. Multiplex PCR assay was achieved for rapid and economical identification of four commonly consumed meats (pork, beef, chicken, and mutton). The conventional PCR assay was sensitive down to 0.001 ng of DNA template in the reactant. The developed method was also powerful in detecting as low as 0.1-mg adulterated pork (0.05 % in wt/wt) in an artificial counterfeited mutton. Validation test showed that the assay is specific, reproducible, and robust in commercial deep processed meats, leatherware, and feather commodities. This proposed method will be greatly beneficial to the consumers, food industry, leather, and feather commodity manufacture.
Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S
2010-07-01
To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.
Sonkar, Subash C; Sachdev, Divya; Mishra, Prashant K; Kumar, Anita; Mittal, Pratima; Saluja, Daman
2016-12-15
The currently available nucleic acid amplification tests (NAATs) for trichomoniasis are accurate, quick and confirmative with superior sensitivity than traditional culture-based microbiology assays. However, these assays are associated with problems of carry over contamination, false positive results, requirement of technical expertise for performance and detection of end product. Hence, a diagnostic assay with easy visualization of the amplified product will be profitable. An in-house, rapid, sensitive, specific molecular-beacon-based PCR assay, using primers against pfoB gene of Trichomonas vaginalis, was developed and evaluated using dry ectocervical swabs (n=392) from symptomatic females with vaginal discharge. Total DNA was isolated and used as template for the PCR assays. The performance and reproducibility of PCR assay was evaluated by composite reference standard (CRS). For easy visualization of the amplified product, molecular-beacon was designed and amplicons were visualized directly using fluorescent handheld dark reader or by Micro-Plate Reader. Molecular-beacons are single-stranded hairpin shaped nucleic acid probes composed of a stem, with fluorophore/quencher pair and a loop region complementary to the desired DNA. The beacon-based PCR assay designed in the present study is highly specific as confirmed by competition experiments and extremely sensitive with detection limit of 20fg of genomic DNA (3-4 pathogens). The minimum infrastructure requirement and ease to perform the assay makes this method highly useful for resource poor countries for better disease management. Copyright © 2016 Elsevier B.V. All rights reserved.
Engineered XcmI cassette-containing vector for PCR-based ...
Indian Academy of Sciences (India)
Unknown
A simple and general method is described to construct a new vector bearing a synthetic XcmI cassette for direct cloning of PCR-amplified genes of interest. Cleavage of the vector with XcmI generates a linearized molecule with a single thymidine (T) overhang at the 3′ ends (T-vector) that facilitates TA cloning of PCR ...
David Helman; Itamar M. Lensky; Naama Tessler; Yagil Osem
2015-01-01
We present an efficient method for monitoring woody (i.e., evergreen) and herbaceous (i.e., ephemeral) vegetation in Mediterranean forests at a sub pixel scale from Normalized Difference Vegetation Index (NDVI) time series derived from the Moderate Resolution Imaging Spectroradiometer (MODIS). The method is based on the distinct development periods of those vegetation components. In the dry season, herbaceous vegetation is absent or completely dry in Mediterranean forests. Thus the mean NDVI ...
Energy Technology Data Exchange (ETDEWEB)
Hutchison, Janine R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Piepel, Gregory F. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Amidan, Brett G. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sydor, Michael A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Deatherage Kaiser, Brooke L [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2015-05-01
Surface sampling for Bacillus anthracis spores has traditionally relied on detection via bacterial cultivation methods. Although effective, this approach does not provide the level of organism specificity that can be gained through molecular techniques. False negative rates (FNR) and limits of detection (LOD) were determined for two B. anthracis surrogates with modified rapid viability-polymerase chain reaction (mRV-PCR) following macrofoam-swab sampling. This study was conducted in parallel with a previously reported study that analyzed spores using a plate-culture method. B. anthracis Sterne (BAS) or B. atrophaeus Nakamura (BG) spores were deposited onto four surface materials (glass, stainless steel, vinyl tile, and plastic) at nine target concentrations (2 to 500 spores/coupon; 0.078 to 19.375 colony-forming units [CFU] per cm²). Mean FNR values for mRV-PCR analysis ranged from 0 to 0.917 for BAS and 0 to 0.875 for BG and increased as spore concentration decreased (over the concentrations investigated) for each surface material. FNRs based on mRV-PCR data were not statistically different for BAS and BG, but were significantly lower for glass than for vinyl tile. FNRs also tended to be lower for the mRV-PCR method compared to the culture method. The mRV-PCR LOD₉₅ was lowest for glass (0.429 CFU/cm² with BAS and 0.341 CFU/cm² with BG) and highest for vinyl tile (0.919 CFU/cm² with BAS and 0.917 CFU/cm² with BG). These mRV-PCR LOD₉₅ values were lower than the culture values (BAS: 0.678 to 1.023 CFU/cm² and BG: 0.820 to 1.489 CFU/cm²). The FNR and LOD₉₅ values reported in this work provide guidance for environmental sampling of Bacillus spores at low concentrations.
Energy Technology Data Exchange (ETDEWEB)
Hutchison, Janine R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Piepel, Gregory F. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Amidan, Brett G. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sydor, Michael A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Kaiser, Brooke L.D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)
2016-06-01
Surface sampling for Bacillus anthracis spores has traditionally relied on detection via bacterial cultivation methods. Although effective, this approach does not provide the level of organism specificity that can be gained through molecular techniques. False negative rates (FNR) and limits of detection (LOD) were determined for two B. anthracis surrogates with modified rapid viability-polymerase chain reaction (mRV-PCR) following macrofoam-swab sampling. This study was conducted in parallel with a previously reported study that analyzed spores using a plate-culture method. B. anthracis Sterne (BAS) or B. atrophaeus Nakamura (BG) spores were deposited onto four surface materials (glass, stainless steel, vinyl tile, and plastic) at nine target concentrations (2 to 500 spores/coupon; 0.078 to 19.375 colony-forming units [CFU] per cm2). Mean FNR values for mRV-PCR analysis ranged from 0 to 0.917 for BAS and 0 to 0.875 for BG and increased as spore concentration decreased (over the concentrations investigated) for each surface material. FNRs based on mRV-PCR data were not statistically different for BAS and BG, but were significantly lower for glass than for vinyl tile. FNRs also tended to be lower for the mRV-PCR method compared to the culture method. The mRV-PCR LOD95 was lowest for glass (0.429 CFU/cm2 with BAS and 0.341 CFU/cm2 with BG) and highest for vinyl tile (0.919 CFU/cm2 with BAS and 0.917 CFU/cm2 with BG). These mRV-PCR LOD95 values were lower than the culture values (BAS: 0.678 to 1.023 CFU/cm2 and BG: 0.820 to 1.489 CFU/cm2). The FNR and LOD95 values reported in this work provide guidance for environmental sampling of Bacillus spores at low concentrations.
Detection of Streptococcus pneumoniae in whole blood by PCR.
Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D
1995-03-01
Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple
Whitman, Richard L.; Ge, Zhongfu; Nevers, Meredith B.; Boehm, Alexandria B.; Chern, Eunice C.; Haugland, Richard A.; Lukasik, Ashley M.; Molina, Marirosa; Przybyla-Kelly, Kasia; Shively, Dawn A.; White, Emily M.; Zepp, Richard G.; Byappanahalli, Muruleedhara N.
2010-01-01
The quantitative polymerase chain reaction (qPCR) method provides rapid estimates of fecal indicator bacteria densities that have been indicated to be useful in the assessment of water quality. Primarily because this method provides faster results than standard culture-based methods, the U.S. Environmental Protection Agency is currently considering its use as a basis for revised ambient water quality criteria. In anticipation of this possibility, we sought to examine the relationship between qPCR-based and culture-based estimates of enterococci in surface waters. Using data from several research groups, we compared enterococci estimates by the two methods in water samples collected from 37 sites across the United States. A consistent linear pattern in the relationship between cell equivalents (CCE), based on the qPCR method, and colony-forming units (CFU), based on the traditional culturable method, was significant (P 10CFU > 2.0/100 mL) while uncertainty increases at lower CFU values. It was further noted that the relative error in replicated qPCR estimates was generally higher than that in replicated culture counts even at relatively high target levels, suggesting a greater need for replicated analyses in the qPCR method to reduce relative error. Further studies evaluating the relationship between culture and qPCR should take into account analytical uncertainty as well as potential differences in results of these methods that may arise from sample variability, different sources of pollution, and environmental factors.
Directory of Open Access Journals (Sweden)
Hou Bo
2015-06-01
Full Text Available Advanced crack monitoring technique is the cornerstone of aircraft structural health monitoring. To achieve real-time crack monitoring of aircraft metal structures in the course of service, a new crack monitoring method is proposed based on Cu coating sensor and electrical potential difference principle. Firstly, insulation treatment process was used to prepare a dielectric layer on structural substrate, such as an anodizing layer on 2A12-T4 aluminum alloy substrate, and then a Cu coating crack monitoring sensor was deposited on the structure fatigue critical parts by pulsed bias arc ion plating technology. Secondly, the damage consistency of the Cu coating sensor and 2A12-T4 aluminum alloy substrate was investigated by static tensile experiment and fatigue test. The results show that strain values of the coating sensor and the 2A12-T4 aluminum alloy substrate measured by strain gauges are highly coincident in static tensile experiment and the sensor has excellent fatigue damage consistency with the substrate. Thirdly, the fatigue performance discrepancy between samples with the coating sensor and original samples was investigated. The result shows that there is no obvious negative influence on the fatigue performance of the 2A12-T4 aluminum alloy after preparing the Cu coating sensor on its surface. Finally, crack monitoring experiment was carried out with the Cu coating sensor. The experimental results indicate that the sensor is sensitive to crack, and crack origination and propagation can be monitored effectively through analyzing the change of electrical potential values of the coating sensor.
Sakalar, Ergün; Ergün, Seyma Özçirak; Akar, Emine
2015-01-01
A duplex real-time polymerase chain reaction (PCR) based assay for the detection of porcine and horse meat in sausages was designed by using EvaGreen fluorescent dye. Primers were selected from mitochondrial 12S rRNA and 16S rRNA genes which are powerful regions for identification of horse and porcine meat. DNA from reference samples and industrial products was successfully extracted using the GIDAGEN® Multi-Fast DNA Isolation Kit. Genomes were identified based on their specific melting peaks (Mp) which are 82.5℃ and 78℃ for horse and porcine, respectively. The assay used in this study allowed the detection of as little as 0.0001% level of horse meat and 0.001% level of porcine meat in the experimental admixtures. These findings indicate that EvaGreen based duplex real-time PCR is a potentially sensitive, reliable, rapid and accurate assay for the detection of meat species adulterated with porcine and horse meats.
Alchalby, H; Badbaran, A; Bock, O; Fehse, B; Bacher, U; Zander, A R; Kröger, N
2010-09-01
Monitoring of minimal residual disease (MRD) after allogeneic (allo)-SCT for myelofibrosis (MF) allows recognizing the depth of remission and thus guides application of appropriate therapeutic interventions. MPL W515L/K mutations, which are detected in 5-10% of JAK2V617F-negative patients, may be useful for this purpose. Using a highly sensitive quantitative PCR method, we tested 90 patients with MF who underwent allo-SCT for the presence of MPL W515L/K mutations. Two patients with primary MF were found to harbor MPLW515L while no patient was positive for MPLW515K mutation. Both patients were JAK2V617F negative and cleared the mutation rapidly after allo-SCT and remained negative for a median follow-up of 19 months. The results of molecular monitoring correlated well with other remission parameters such as normalization of peripheral blood counts and morphology and complete donor chimerism. We conclude that MPLW515L can be cleared after allo-SCT and hence may be used as an MRD marker in a proportion of JAK2V617F-negative MF patients.
Sun, Zhibin; Huang, Yan; Wang, Yanzhuo; Zhao, Yuguo; Cui, Zhongli
2014-01-01
Genomic DNA extraction from Gram-positive bacteria is a laborious and time-consuming process. A rapid and convenient method was established to extract genomic DNA from a single colony as a PCR template. KOH-EDTA is used as a lysis buffer to disrupt the cell envelope, releasing genomic DNA, and Tris-HCl (pH = 4) is then added to neutralize the lysate. The lysate can be used directly as a template for PCR amplification. 16S rDNA was successfully amplified from Gram-positive bacteria from the genera of Bacillus, Streptomyces, Micromonospora, Nonomuraea, Microbispora, and Staphylococcus. Amplification of the trpB gene indicated that this method could also be applied to the amplification of functional genes. Compared to colony PCR methods without KOH-EDTA, this method is extremely fast and efficient, and it is applicable to high-throughput PCR amplifications.
Comparing methods of determining Legionella spp. in complex water matrices.
Díaz-Flores, Álvaro; Montero, Juan Carlos; Castro, Francisco Javier; Alejandres, Eva María; Bayón, Carmen; Solís, Inmaculada; Fernández-Lafuente, Roberto; Rodríguez, Guillermo
2015-04-29
Legionella testing conducted at environmental laboratories plays an essential role in assessing the risk of disease transmission associated with water systems. However, drawbacks of culture-based methodology used for Legionella enumeration can have great impact on the results and interpretation which together can lead to underestimation of the actual risk. Up to 20% of the samples analysed by these laboratories produced inconclusive results, making effective risk management impossible. Overgrowth of competing microbiota was reported as an important factor for culture failure. For quantitative polymerase chain reaction (qPCR), the interpretation of the results from the environmental samples still remains a challenge. Inhibitors may cause up to 10% of inconclusive results. This study compared a quantitative method based on immunomagnetic separation (IMS method) with culture and qPCR, as a new approach to routine monitoring of Legionella. First, pilot studies evaluated the recovery and detectability of Legionella spp using an IMS method, in the presence of microbiota and biocides. The IMS method results were not affected by microbiota while culture counts were significantly reduced (1.4 log) or negative in the same samples. Damage by biocides of viable Legionella was detected by the IMS method. Secondly, a total of 65 water samples were assayed by all three techniques (culture, qPCR and the IMS method). Of these, 27 (41.5%) were recorded as positive by at least one test. Legionella spp was detected by culture in 7 (25.9%) of the 27 samples. Eighteen (66.7%) of the 27 samples were positive by the IMS method, thirteen of them reporting counts below 10(3) colony forming units per liter (CFU l(-1)), six presented interfering microbiota and three presented PCR inhibition. Of the 65 water samples, 24 presented interfering microbiota by culture and 8 presented partial or complete inhibition of the PCR reaction. So the rate of inconclusive results of culture and PCR was 36
Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.
Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le
2017-11-01
Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Ming-An Tsai
2017-09-01
Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.
2012-09-11
... automated monitoring method utilizing a measurement principle based on sample collection by filtration and... 58. Questions concerning the commercial availability or technical aspects of the method should be...
Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio
2011-01-01
The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.
Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi
2018-01-01
Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in
Detection of Brucella melitensis and Brucella abortus strains using a single-stage PCR method
Directory of Open Access Journals (Sweden)
Alamian, S.
2015-04-01
Full Text Available Brucella melitensis and Brucella abortus are of the most important causes of brucellosis, an infectious disease which is transmitted either directly or indirectly including consuming unpasteurized dairy products. Both strains are considered endemic in Iran. Common diagnostic methods such as bacteriologic cultures are difficult and time consuming regarding the bacteria. The aim of this study was to suggest a single-stage PCR method using a pair of primers to detect both B. melitensis and B. abortus. The primers were named UF1 and UR1 and the results showed that the final size of PCR products were 84 bp and 99 bp for B. melitensis and B. abortus, respectively. Therefore the method could be useful for rapid detection of B. melitensis and B. abortus simultaneously.
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein
2013-05-01
Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Costa Elena
2011-05-01
Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.
RAPD-PCR – still a suitable Method for Genetically Underexplored Species?
Directory of Open Access Journals (Sweden)
Konstanze Ursula Behrmann
2015-11-01
Full Text Available Saithe (Pollachius virens is a commercially important fish species; the annual catch quota in the Northeast Atlantic exceeds 100.000 t. Despite that saithe is underexplored from a fish population genetically view. Because saithe is a highly migratory species, which undergoes a long larval drift, the population structure of saithe within the Northeast Atlantic is not fully understood. Models used as a basis for the management plan are based on tagging studies, which have been carried out in the 1960th. But still there are doubts regarding the numbers of stocks living in the Northeast Atlantic. Migration routes are affected by salmon farming, growing steadily from the 1990th. In the last years a hyperstability of the saithe stock in the North Sea had been detected underlining the need to have a closer look on the saithe stocks in the Northeast Atlantic. Random amplified polymorphic DNA (RAPD - PCR is a DNA fingerprinting technique often used in species identification and population genetic research for species, whose genome has not been sequenced very extensive as being the case for most of the food fishes. We applied RAPD-PCR in a study of saithe populations from the North Atlantic. The suitability of RAPD-PCR was improved by optimisations for enhanced reproducibility. The “classical” protocol for RAPD-PCR was modified by increasing the annealing temperature and shortening the time of annealing, providing a much better reproducibility. Thus, RAPD-PCR was found to be a straightforward and low-cost way, compared to other population genetic tools, to get a first insight into the population structure of less sequenced fish species within a very short time, being useful for preliminary studies or laboratories without large capacities for DNA sequencing.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
Amara, Khaled; Trimeche, Mounir; Ziadi, Sonia; Sriha, Badreddine; Mokni, Moncef; Korbi, Sadok
2006-01-01
Polymerase chain reaction (PCR)-based analysis, employed for detecting immunoglobulin heavy chain (IgH) gene rearrangements, has become a diagnostic tool widely used in the investigation of B-cell lymphomas, but the overall sensitivity of these methods does not exceed 80%, notably in germinal center (GC) and post-GC B-cell origin lymphomas. Many PCR strategies devised for detecting immunoglobulin light chain (IgL) gene rearrangements have been developed to enhance the clonality detection rates. However, the feasibility of these methods in routine clinical diagnosis using paraffin-embedded tissues has not yet been investigated sufficiently. We studied a large series of 108 cases of B-cell lymphomas, as well as 20 reactive lymphoid tissues using degenerate primers to amplify immunoglobulin kappa (Igkappa) and lambda (Iglambda) light chain genes. B-cell clonality was further investigated using semi-nested PCR for IgH gene rearrangements. B-cell clonality was detected in 74%, 56.5%, and 43.5% of cases using IgH, Igkappa, and Iglambda PCR, respectively. By combining these methods, the clonality detection rate increased to 93.5%. Only polyclonal patterns were noted in reactive lymphoid samples. We concluded that in addition to the established methods for IgH analysis, a PCR-based approach for IgL gene rearrangements analysis improves the clonality detection rate in over 90% of B-cell lymphoma cases using routine histological specimens with poor preservation of the genomic DNA.
International Nuclear Information System (INIS)
Shirinzade, A.; Gasanov, Kh.; Ragimov, R.; Timofeev, A.
2008-01-01
In the paper o the base of aerospatial images of decoding it is studied the problems of using the method of geotechnical diagnostics (GTD) for magistral pipelines. This technique is used for discovering potentially dangerous sections. It has been shown that the processes in geotechnical system have pecular properties on the earth surface which may be identified in terms of aerospace monitoring. Studing these properties one can conclude about state of the system as whole. It is described example of using the GTD method for practical evaluation of magistral pipeline
Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.
Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin
2017-08-01
Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.
Denman, Stuart E; McSweeney, Christopher S
2006-12-01
Traditional methods for enumerating and identifying microbial populations within the rumen can be time consuming and cumbersome. Methods that involve culturing and microscopy can also be inconclusive, particularly when studying anaerobic rumen fungi. A real-time PCR SYBR Green assay, using PCR primers to target total rumen fungi and the cellulolytic bacteria Ruminococcus flavefaciens and Fibrobacter succinogenes, is described, including design and validation. The DNA and crude protein contents with respect to the fungal biomass of both polycentric and monocentric fungal isolates were investigated across the fungal growth stages to aid in standard curve generation. The primer sets used were found to be target specific with no detectable cross-reactivity. Subsequently, the real-time PCR assay was employed in a study to detect these populations within cattle rumen. The anaerobic fungal target was observed to increase 3.6-fold from 0 to 12 h after feeding. The results also indicated a 5.4-fold increase in F. succinogenes target between 0 and 12 h after feeding, whereas R. flavefaciens was observed to maintain more or less consistent levels. This is the first report of a real-time PCR assay to estimate the rumen anaerobic fungal population.
Directory of Open Access Journals (Sweden)
Kröncke, Klaus-Dietrich
2008-08-01
Full Text Available [english] Background: The polymerase chain reaction (PCR is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-relevant data. In addition, they learned the essential features of the PCR with the aid of embedded textual information and audiovisual animations. To check that the learning objectives were fulfilled, the students had to solve medical-related PCR tasks on the computer. Results: In total, 311 students went through the course. They were satisfied with the e-learning teaching unit and evaluated it very positively, independently of their prior knowledge concerning the PCR. Students with low levels of computer skills did not feel over-challenged. Conclusion: Our results show that a computer-based practical training course is an excellent option for teaching undergraduate medical students complex technologies that could otherwise only be taught in a laboratory at great expense of time and effort. [german] Zielsetzung: Es sollte untersucht werden, ob ein E-Learning Praktikumsversuch geeignet ist, Medizin-Studierenden der Vorklinik die Polymerase-Kettenreaktion (PCR begreiflich zu machen. Methodik: Ein Computer-basierter Praktikumsversuch wurde entwickelt, der sowohl das Recherchieren in wissenschaftlich-medizinischen Datenbanken zum Auffinden von PCR-relevanten Informationen beinhaltet als auch Selbstlerneinheiten über die PCR. Als Lernzielkontrollen dienten Aufgaben aus der medizinischen PCR-Diagnostik. Die Akzeptanz der Lehrveranstaltung bei den Studierenden wurde mit einem Fragebogen ermittelt, der 19 Items enthielt. Ergebnisse: 311 Studierende absolvierten den
Directory of Open Access Journals (Sweden)
Amir Aliramezani
2012-01-01
Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.
A MIQE-compliant real-time PCR assay for Aspergillus detection.
Directory of Open Access Journals (Sweden)
Gemma L Johnson
Full Text Available The polymerase chain reaction (PCR is widely used as a diagnostic tool in clinical laboratories and is particularly effective for detecting and identifying infectious agents for which routine culture and microscopy methods are inadequate. Invasive fungal disease (IFD is a major cause of morbidity and mortality in immunosuppressed patients, and optimal diagnostic criteria are contentious. Although PCR-based methods have long been used for the diagnosis of invasive aspergillosis (IA, variable performance in clinical practice has limited their value. This shortcoming is a consequence of differing sample selection, collection and preparation protocols coupled with a lack of standardisation of the PCR itself. Furthermore, it has become clear that the performance of PCR-based assays in general is compromised by the inadequacy of experimental controls, insufficient optimisation of assay performance as well as lack of transparency in reporting experimental details. The recently published "Minimum Information for the publication of real-time Quantitative PCR Experiments" (MIQE guidelines provide a blueprint for good PCR assay design and unambiguous reporting of experimental detail and results. We report the first real-time quantitative PCR (qPCR assay targeting Aspergillus species that has been designed, optimised and validated in strict compliance with the MIQE guidelines. The hydrolysis probe-based assay, designed to target the 18S rRNA DNA sequence of Aspergillus species, has an efficiency of 100% (range 95-107%, a dynamic range of at least six orders of magnitude and limits of quantification and detection of 6 and 0.6 Aspergillus fumigatus genomes, respectively. It does not amplify Candida, Scedosporium, Fusarium or Rhizopus species and its clinical sensitivity is demonstrated in histological material from proven IA cases, as well as concordant PCR and galactomannan data in matched broncho-alveolar lavage and blood samples. The robustness
Development of a qPCR method to rapidly assess the function of NKT cells.
Sohn, Silke; Tiper, Irina; Japp, Emily; Sun, Wenji; Tkaczuk, Katherine; Webb, Tonya J
2014-05-01
NKT cells comprise a rare, but important subset of T cells which account for ~0.2% of the total circulating T cell population. NKT cells are known to have anti-tumor functions and rapidly produce high levels of cytokines following activation. Several clinical trials have sought to exploit the effector functions of NKT cells. While some studies have shown promise, NKT cells are approximately 50% lower in cancer patients compared to healthy donors of the same age and gender, thus limiting their therapeutic efficacy. These studies indicate that baseline levels of activation should be assessed before initiating an NKT cell based immunotherapeutic strategy. The goal of this study was to develop a sensitive method to rapidly assess NKT cell function. We utilized artificial antigen presenting cells in combination with qPCR in order to determine NKT cell function in peripheral blood mononuclear cells from healthy donors and breast cancer patients. We found that NKT cell activation can be detected by qPCR, but not by ELISA, in healthy donors as well as in breast cancer patients following four hour stimulation. This method utilizing CD1d-expressing aAPCs will enhance our knowledge of NKT cell biology and could potentially be used as a novel tool in adoptive immunotherapeutic strategies. Copyright © 2014 Elsevier B.V. All rights reserved.
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
Shell-vial culture and real-time PCR applied to Rickettsia typhi and Rickettsia felis detection.
Segura, Ferran; Pons, Immaculada; Pla, Júlia; Nogueras, María-Mercedes
2015-11-01
Murine typhus is a zoonosis transmitted by fleas, whose etiological agent is Rickettsia typhi. Rickettsia felis infection can produces similar symptoms. Both are intracellular microorganisms. Therefore, their diagnosis is difficult and their infections can be misdiagnosed. Early diagnosis prevents severity and inappropriate treatment regimens. Serology can't be applied during the early stages of infection because it requires seroconversion. Shell-vial (SV) culture assay is a powerful tool to detect Rickettsia. The aim of the study was to optimize SV using a real-time PCR as monitoring method. Moreover, the study analyzes which antibiotics are useful to isolate these microorganisms from fleas avoiding contamination by other bacteria. For the first purpose, SVs were inoculated with each microorganism. They were incubated at different temperatures and monitored by real-time PCR and classical methods (Gimenez staining and indirect immunofluorescence assay). R. typhi grew at all temperatures. R. felis grew at 28 and 32 °C. Real-time PCR was more sensitive than classical methods and it detected microorganisms much earlier. Besides, the assay sensitivity was improved by increasing the number of SV. For the second purpose, microorganisms and fleas were incubated and monitored in different concentrations of antibiotics. Gentamicin, sufamethoxazole, trimethoprim were useful for R. typhi isolation. Gentamicin, streptomycin, penicillin, and amphotericin B were useful for R. felis isolation. Finally, the optimized conditions were used to isolate R. felis from fleas collected at a veterinary clinic. R. felis was isolated at 28 and 32 °C. However, successful establishment of cultures were not possible probably due to sub-optimal conditions of samples.
Video-based respiration monitoring with automatic region of interest detection
Janssen, R.J.M.; Wang, Wenjin; Moço, A.; de Haan, G.
2016-01-01
Vital signs monitoring is ubiquitous in clinical environments and emerging in home-based healthcare applications. Still, since current monitoring methods require uncomfortable sensors, respiration rate remains the least measured vital sign. In this paper, we propose a video-based respiration
Stachler, Elyse; Akyon, Benay; Aquino de Carvalho, Nathalia; Ference, Christian; Bibby, Kyle
2018-06-06
Environmental waters are monitored for fecal pollution to protect public health. Many previously developed human-specific fecal pollution indicators lack adequate sensitivity to be reliably detected in environmental waters or do not correlate well with viral pathogens. Recently, two novel human sewage-associated source tracking qPCR markers were developed based on the bacteriophage crAssphage, CPQ_056 and CPQ_064. These assays are highly human specific, abundant in sewage, and are viral-based, suggesting great promise for environmental application as human fecal pollution indicators. A 30-day sampling study was conducted in an urban stream impacted by combined sewer overflows to evaluate the crAssphage markers' performance in an environmental system. The crAssphage markers were present at concentrations of 4.02-6.04 log10 copies/100 mL throughout the study period, indicating their high abundance and ease of detection in polluted environmental waters. In addition, the crAssphage assays were correlated with rain events, molecular markers for human polyomavirus and HF183, as well as culturable E. coli, enterococci, and somatic coliphage. The CPQ_064 assay correlated strongly to a greater number of biological indicators than the CPQ_056 assay. This study is the first to evaluate both crAssphage qPCR assays in an extended environmental application of crAssphage markers for monitoring of environmental waters. It is also the first study to compare crAssphage marker concentration with other viral-based indicators.
Eckert, C.; Van Broeck, J.; Spigaglia, P.; Burghoffer, B.; Delmée, M.; Mastrantonio, P.; Barbut, F.
2011-01-01
This study compared a repetitive-element PCR (rep-PCR) method (DiversiLab system) to PCR ribotyping. The discriminatory power of rep-PCR was 0.997. Among the PCR ribotype 027 isolates tested, different rep types could be distinguished. rep-PCR showed a higher discriminatory power than PCR ribotyping. Nevertheless, this method requires technical skill, and visual interpretation of rep-PCR fingerprint patterns may be difficult.
DEFF Research Database (Denmark)
Abildgaard, Lotte; Ommen, Hans Beier; Lausen, Birgitte Frederiksen
2013-01-01
OBJECTIVES: Patients with acute myeloid leukaemia (AML) of the monocytic lineage often lack molecular markers for minimal residual disease (MRD) monitoring. The MLL-MLLT3 fusion transcript found in patients with AML harbouring t(9;11) is amenable to RT-qPCR quantification but because...... of the heterogeneity of translocation break points, the MLL-MLLT3 fusion gene is a challenging target. We hypothesised that MRD monitoring using MLL-MLLT3 as a RT-qPCR marker is feasible in the majority of patients with t(9;11)-positive AML. METHODS: Using a locked nucleic acid probe, we developed a sensitive RT......-qPCR assay for quantification of the most common break point region of the MLL-MLLT3 fusion gene. Five paediatric patients with t(9;11)-positive AML were monitored using the MLL-MLLT3 assay. RESULTS: A total of 43 bone marrow (BM) and 52 Peripheral blood (PB) samples were collected from diagnosis until...
Han, J S; Kim, C G
2009-01-01
In general, acid mine drainage (AMD) causes low pH and high metal concentrations in mining areas and surroundings. The aim of this research was to achieve microbiological monitoring for AMD and to assess whether mine water outflows have any ecological effects on the aqueous ecosystem receiving effluents from different types of treatment system. The water quality of aquatic sample was analyzed and the molecular biological diversity of the samples was assessed using 16S rRNA methods, which were implemented to determine which bacteria existed throughout various unit processes for different AMD treatment systems and their receiving water environments. Acidiphilium cryptum, a heterotrophic acidophile, was found at the AMD sites, and Rhodoferax ferrireducens, which can reduce iron using insoluble Fe(III) as an electron acceptor, was detected at many AMD treatment facilities and downstream of the treatment processes. Subsequently, quantitative real-time PCR was conducted on specific genes of selected bacteria. Surprisingly, obvious trends were observed in the relative abundance of the various bacteria that corresponded to the water quality analytical results. The copy number of Desulfosporosinus orientus, a sulfate reducing bacteria, was also observed to decrease in response to decreases in metals according to the downstream flow of the AMD treatment system.
RFID based TLD monitoring system - a prospective development
International Nuclear Information System (INIS)
Jeevanram, S.S.; Pawar, S.T.; Mahule, K.N.; Rath, D.P.
2008-01-01
Thermo Luminescence Dosimetry (TLD) is an established method of monitoring the radiation dose received by workers in radiation environments. In Radiometallurgy Laboratory, BARC, the TLD movement inside a nuclear facility is completely carried out by a radiation worker. However, there is a chance that the TLDs may get lost in laboratories or some places without the knowledge of the concerned TLD user or health physicist. It may later lead to a false effective dose. Effort is being done to initiate a RFID based TLD monitoring system so that the use of TLD can be acknowledged through a self operating software which can prevent misuse of the detector. A novel method of improving the administrative control through Radio Frequency Identification (RFID) based monitoring to avoid such inadvertent misplacement of TLD, is in progress. This paper discusses the method and techniques through which administrative control can be exercised to reduce the number of such in explainable exposures. (author)
Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data
Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.
2003-01-01
Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR
Directory of Open Access Journals (Sweden)
Dafni-Maria Kagkli
Full Text Available Escherichia coli is a group of bacteria which has raised a lot of safety concerns in recent years. Five major intestinal pathogenic groups have been recognized amongst which the verocytotoxin or shiga-toxin (stx1 and/or stx2 producing E. coli (VTEC or STEC respectively have received a lot of attention recently. Indeed, due to the high number of outbreaks related to VTEC strains, the European Food Safety Authority (EFSA has requested the monitoring of the "top-five" serogroups (O26, O103, O111, O145 and O157 most often encountered in food borne diseases and addressed the need for validated VTEC detection methods. Here we report the development of a set of intercalating dye Real-time PCR methods capable of rapidly detecting the presence of the toxin genes together with intimin (eae in the case of VTEC, or aggregative protein (aggR, in the case of the O104:H4 strain responsible for the outbreak in Germany in 2011. All reactions were optimized to perform at the same annealing temperature permitting the multiplex application in order to minimize the need of material and to allow for high-throughput analysis. In addition, High Resolution Melting (HRM analysis allowing the discrimination among strains possessing similar virulence traits was established. The development, application to food samples and the flexibility in use of the methods are thoroughly discussed. Together, these Real-time PCR methods facilitate the detection of VTEC in a new highly efficient way and could represent the basis for developing a simple pathogenic E. coli platform.
Chahorm, Kanchana; Prakitchaiwattana, Cheunjit
2018-01-02
The aim of this research was to evaluate the feasibility of PCR-DGGE and Reverse Transcriptase-PCR-DGGE techniques for rapid detection of Vibrio species in foods. Primers GC567F and 680R were initially evaluated for amplifying DNA and cDNA of ten references Vibrio species by PCR method. The GC-clamp PCR amplicons were separated according to their sequences by the DGGE using 10% (w/v) polyacrylamide gel containing 45-70% urea and formamide denaturants. Two pair of Vibrio species, which could not be differentiated on the gel, was Vibrio fluvialis - Vibrio furnissii and Vibrio parahaemolyticus - Vibrio harveyi. To determine the detection limit, in the community of 10 reference strains containing the same viable population, distinct DNA bands of 3 species; Vibrio cholerae, Vibrio mimicus and Vibrio alginolyticus were consistently observed by PCR-DGGE technique. In fact, 5 species; Vibrio cholerae, Vibrio mimicus, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio fluvialis consistently observed by Reverse Transcriptase-PCR-DGGE. In the community containing different viable population increasing from 10 2 to 10 5 CFU/mL, PCR-DGGE analysis only detected the two most prevalent species, while RT-PCR-DGGE detected the five most prevalent species. Therefore, Reverse Transcriptase-PCR-DGGE was also selected for detection of various Vibrio cell conditions, including viable cell (VC), injured cells from frozen cultures (IVC) and injured cells from frozen cultures with pre-enrichment (PIVC). It was found that cDNA band of all cell conditions gave the same migratory patterns, except that multiple cDNA bands of Plesiomonas shigelloides under IVC and PIVC conditions were found. When Reverse Transcriptase-PCR-DGGE was used for detecting Vibrio parahaemolyticus in the pathogen-spiked food samples, Vibrio parahaemolyticus could be detected in the spiked samples containing at least 10 2 CFU/g of this pathogen. The results obtained also corresponded to standard method (USFDA, 2004
Von Felten, Andreas; Défago, Geneviève; Maurhofer, Monika
2010-05-01
Pseudomonas fluorescens strains F113 and CHA0 are well-known plant growth-promoting rhizobacteria (PGPR) often used as model strains in biocontrol experiments. To monitor their persistence in large scale field experiments, culture-independent methods are needed. In this study, a strain-specific real-time PCR quantification tool was developed based on sequence-characterized amplified regions (SCAR) for P. fluorescens strains F113, CHA0 and Pf153. Differences in DNA extraction efficiencies from rhizosphere samples were circumvented using plasmid APA9 as internal standard to normalize C(T) values after real-time amplification. The detection limits of the real-time PCR assays for all three strains were approximately 10 cells for genomic DNA and 10(4)cells/g rhizosphere for maize samples grown in different natural soils. Population sizes of the three strains in the rhizosphere of maize measured by the new real-time PCR approaches were similar to those measured by most probable number (MPN)-PCR. A persistence study of the three strains indicated that the strains persisted differently over a period of 5weeks. In conclusion the newly developed real-time PCR approach is a fast and resource efficient method for monitoring individual biocontrol strains in natural soil, which makes it an apt quantification tool for future large-scale field experiments. Copyright 2010 Elsevier B.V. All rights reserved.