WorldWideScience

Sample records for pcr gene expression

  1. Real-time PCR gene expression profiling

    Czech Academy of Sciences Publication Activity Database

    Kubista, Mikael; Sjögreen, B.; Forootan, A.; Šindelka, Radek; Jonák, Jiří; Andrade, J.M.

    2007-01-01

    Roč. 1, - (2007), s. 56-60 ISSN 1360-8606 R&D Projects: GA AV ČR KJB500520601 Institutional research plan: CEZ:AV0Z50520514 Keywords : real - time PCR, * expression profiling * statistical analysis Subject RIV: EB - Genetics ; Molecular Biology

  2. Using PCR to Target Misconceptions about Gene Expression

    Directory of Open Access Journals (Sweden)

    Leslie K. Wright

    2013-02-01

    Full Text Available We present a PCR-based laboratory exercise that can be used with first- or second-year biology students to help overcome common misconceptions about gene expression. Biology students typically do not have a clear understanding of the difference between genes (DNA and gene expression (mRNA/protein and often believe that genes exist in an organism or cell only when they are expressed. This laboratory exercise allows students to carry out a PCR-based experiment designed to challenge their misunderstanding of the difference between genes and gene expression. Students first transform E. coli with an inducible GFP gene containing plasmid and observe induced and un-induced colonies. The following exercise creates cognitive dissonance when actual PCR results contradict their initial (incorrect predictions of the presence of the GFP gene in transformed cells. Field testing of this laboratory exercise resulted in learning gains on both knowledge and application questions on concepts related to genes and gene expression.

  3. Gene expression studies of reference genes for quantitative real-time PCR: an overview in insects.

    Science.gov (United States)

    Shakeel, Muhammad; Rodriguez, Alicia; Tahir, Urfa Bin; Jin, Fengliang

    2018-02-01

    Whenever gene expression is being examined, it is essential that a normalization process is carried out to eliminate non-biological variations. The use of reference genes, such as glyceraldehyde-3-phosphate dehydrogenase, actin, and ribosomal protein genes, is the usual method of choice for normalizing gene expression. Although reference genes are used to normalize target gene expression, a major problem is that the stability of these genes differs among tissues, developmental stages, species, and responses to abiotic factors. Therefore, the use and validation of multiple reference genes are required. This review discusses the reasons that why RT-qPCR has become the preferred method for validating results of gene expression profiles, the use of specific and non-specific dyes and the importance of use of primers and probes for qPCR as well as to discuss several statistical algorithms developed to help the validation of potential reference genes. The conflicts arising in the use of classical reference genes in gene normalization and their replacement with novel references are also discussed by citing the high stability and low stability of classical and novel reference genes under various biotic and abiotic experimental conditions by employing various methods applied for the reference genes amplification.

  4. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  5. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  6. Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera.

    Science.gov (United States)

    Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

    2016-01-01

    Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera.

  7. PCR Expression Analysis Of the Estrogeninducible Gene Bcei in Gastrointestinal and Other Human Tumors

    Directory of Open Access Journals (Sweden)

    Iris Wundrack

    1994-01-01

    Full Text Available A polymerase chain reaction (PCR assay was developed to test for tumor cell specific expression of the BCEI gene. This new marker gene, reported at first for human breast cancer, was found specifically active in various gastrointestinal carcinomas by previously applying immunohistochemistry and RNA (Northern blot analysis. Presently, by using reverse transcription -PCR analysis, a series of primary tumor tissues and established tumor cell lines were testcd for BCEI transcription. This approach was compared to immunostaining achieved by an antibody directed against the BCEI gene’s product. The result demonstrate the superior sensitivity of PCR by indicating the gene’ s expression in cases where immunohistochemical testing remained negative.

  8. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

    Directory of Open Access Journals (Sweden)

    Ravid Rivka

    2008-05-01

    Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.

  9. Complementary techniques: validation of gene expression data by quantitative real time PCR.

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone

    2007-01-01

    Microarray technology can be considered the most powerful tool for screening gene expression profiles of biological samples. After data mining, results need to be validated with highly reliable biotechniques allowing for precise quantitation of transcriptional abundance of identified genes. Quantitative real time PCR (qrt-PCR) technology has recently reached a level of sensitivity, accuracy and practical ease that support its use as a routine bioinstrumentation for gene level measurement. Currently, qrt-PCR is considered by most experts the most appropriate method to confirm or confute microarray-generated data. The knowledge of the biochemical principles underlying qrt-PCR as well as some related technical issues must be beard in mind when using this biotechnology.

  10. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    International Nuclear Information System (INIS)

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  11. In search of suitable reference genes for gene expression studies of human renal cell carcinoma by real-time PCR

    Directory of Open Access Journals (Sweden)

    Kristiansen Glen

    2007-06-01

    Full Text Available Abstract Background Housekeeping genes are commonly used as endogenous reference genes for the relative quantification of target genes in gene expression studies. No conclusive systematic study comparing the suitability of different candidate reference genes in clear cell renal cell carcinoma has been published to date. To remedy this situation, 10 housekeeping genes for normalizing purposes of RT-PCR measurements already recommended in various studies were examined with regard to their usefulness as reference genes. Results The expression of the potential reference genes was examined in matched malignant and non-malignant tissue specimens from 25 patients with clear cell renal cell carcinoma. Quality assessment of isolated RNA performed with a 2100 Agilent Bioanalyzer showed a mean RNA integrity number of 8.7 for all samples. The between-run variations related to the crossing points of PCR reactions of a control material ranged from 0.17% to 0.38%. The expression of all genes did not depend on age, sex, and tumour stage. Except the genes TATA box binding protein (TBP and peptidylprolyl isomerase A (PPIA, all genes showed significant differences in expression between malignant and non-malignant pairs. The expression stability of the candidate reference genes was additionally controlled using the software programs geNorm and NormFinder. TBP and PPIA were validated as suitable reference genes by normalizing the target gene ADAM9 using these two most stably expressed genes in comparison with up- and down-regulated housekeeping genes of the panel. Conclusion Our study demonstrated the suitability of the two housekeeping genes PPIA and TBP as endogenous reference genes when comparing malignant tissue samples with adjacent normal tissue samples from clear cell renal cell carcinoma. Both genes are recommended as reference genes for relative gene quantification in gene profiling studies either as single gene or preferably in combination.

  12. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    Directory of Open Access Journals (Sweden)

    Lee Yeon-Su

    2010-05-01

    Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.

  13. DAG expression: high-throughput gene expression analysis of real-time PCR data using standard curves for relative quantification.

    Directory of Open Access Journals (Sweden)

    María Ballester

    Full Text Available BACKGROUND: Real-time quantitative PCR (qPCR is still the gold-standard technique for gene-expression quantification. Recent technological advances of this method allow for the high-throughput gene-expression analysis, without the limitations of sample space and reagent used. However, non-commercial and user-friendly software for the management and analysis of these data is not available. RESULTS: The recently developed commercial microarrays allow for the drawing of standard curves of multiple assays using the same n-fold diluted samples. Data Analysis Gene (DAG Expression software has been developed to perform high-throughput gene-expression data analysis using standard curves for relative quantification and one or multiple reference genes for sample normalization. We discuss the application of DAG Expression in the analysis of data from an experiment performed with Fluidigm technology, in which 48 genes and 115 samples were measured. Furthermore, the quality of our analysis was tested and compared with other available methods. CONCLUSIONS: DAG Expression is a freely available software that permits the automated analysis and visualization of high-throughput qPCR. A detailed manual and a demo-experiment are provided within the DAG Expression software at http://www.dagexpression.com/dage.zip.

  14. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  15. Identification of valid reference genes for gene expression studies of human stomach cancer by reverse transcription-qPCR

    International Nuclear Information System (INIS)

    Rho, Hyun-Wook; Lee, Byoung-Chan; Choi, Eun-Seok; Choi, Il-Ju; Lee, Yeon-Su; Goh, Sung-Ho

    2010-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. We assessed the suitability of six possible reference genes, beta-actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), hypoxanthine phosphoribosyl transferase 1 (HPRT1), beta-2-microglobulin (B2M), ribosomal subunit L29 (RPL29) and 18S ribosomal RNA (18S rRNA) in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. This RT-qPCR study showed that there are statistically significant (p < 0.05) differences in the expression levels of HPRT1 and 18S rRNA in 'normal-' versus 'tumor stomach tissues'. The stability analyses by geNorm suggest B2M-GAPDH, as best reference gene combination for 'stomach cancer cell lines'; RPL29-HPRT1, for 'all stomach tissues'; and ACTB-18S rRNA, for 'all stomach cell lines and tissues'. NormFinder also identified B2M as the best reference gene for 'stomach cancer cell lines', RPL29-B2M for 'all stomach tissues', and 18S rRNA-ACTB for 'all stomach cell lines and tissues'. The comparisons of normalized expression of the target gene, GPNMB, showed different interpretation of target gene expression depend on best single reference gene or combination. This study validated RPL29 and RPL29-B2M as the best single reference

  16. Comprehensive evaluation of candidate reference genes for gene expression studies in Lysiphlebia japonica (Hymenoptera: Aphidiidae) using RT-qPCR.

    Science.gov (United States)

    Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie

    2017-12-30

    Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.

  17. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  18. Expression Stabilities of Ten Candidate Reference Genes for RT-qPCR in Zanthoxylum bungeanum Maxim.

    Science.gov (United States)

    Fei, Xitong; Shi, Qianqian; Yang, Tuxi; Fei, Zhaoxue; Wei, Anzhi

    2018-03-30

    Real-time reverse transcription quantitative PCR has become a common method for studying gene expression, however, the optimal selection of stable reference genes is a prerequisite for obtaining accurate quantification of transcript abundance. Suitable reference genes for RT-qPCR have not yet been identified for Chinese prickly ash ( Zanthoxylum bungeanum Maxim.). Chinese prickly ash is the source of an important food seasoning in China. In recent years, Chinese prickly ash has also been developed as a medicinal plant. The expression stabilities of ten genes ( 18S , 28S , EF , UBA , UBQ , TIF , NTB , TUA , RPS , and TIF5A ) were evaluated in roots, stems, leaves, flowers and fruits at five developmental stages and also under stress from cold, drought, and salt. To do this we used three different statistical algorithms: geNorm, NormFinder and BestKeeper. Among the genes investigated, UBA and UBQ were found to be most stable for the different cultivars and different tissues examined, UBQ and TIF for fruit developmental stage. Meanwhile, EF and TUA were most stable under cold treatment, EF and UBQ under drought treatment and NTB and RPS under salt treatment. UBA and UBQ for all samples evaluated were most stably expressed, but 18S , TUA and RPS were found to be generally unreliable as reference genes. Our results provide a basis for the future selection of reference genes for biological research with Chinese prickly ash, under a variety of conditions.

  19. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  20. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  1. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Directory of Open Access Journals (Sweden)

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  2. Expression analysis of fusarium wilt resistance gene in melon by real-time quantitative pcr

    International Nuclear Information System (INIS)

    Wang, X.; Xu, B.; Zhao, L.; Gao, P.; Luan, F.

    2014-01-01

    Melon Actin gene was used as a reference gene, to explore the gene expression profiles of the Fom-2 gene in roots, stems, and leaves of melon MR-1 under induction by Fusarium oxysporum f. sp. melonis. Monitoring using real-time quantitative PCR showed similar accumulation patterns of Fom-2 in roots, stems, and leaves over the observation period of 1 to 11 days; the expression level in stems was the highest. The expression of the Fom-2 gene was strengthened by the prolongation of induction time. In stems, the expression of Fom-2 was 5.737 times higher than in the control at three days; in roots, expression of Fom-2 was 5.617 times higher than in the control at five days. Similarly, the expression of Fom-2 in leaves obviously increased. It was 4.441 times higher than in the control at 5 days. The expression of Fom-2 was non-tissue specific, up-regulated under induction by Fusarium, and related to early resistance to Fusarium wilt. (author)

  3. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  4. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  5. Pre-amplification in the context of high-throughput qPCR gene expression experiment

    Czech Academy of Sciences Publication Activity Database

    Korenková, Vlasta; Scott, J.; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjoback, R.

    2015-01-01

    Roč. 16, č. 5 (2015) ISSN 1471-2199 R&D Projects: GA ČR(CZ) GAP304/12/1585; GA ČR(CZ) GA15-08239S; GA ČR GA13-02154S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:86652036 Keywords : High-throughput qPCR * Gene expression * Exponential pre-amplification Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.500, year: 2015

  6. Normalizing gene expression by quantitative PCR during somatic embryogenesis in two representative conifer species: Pinus pinaster and Picea abies.

    Science.gov (United States)

    de Vega-Bartol, José J; Santos, Raquen Raissa; Simões, Marta; Miguel, Célia M

    2013-05-01

    Suitable internal control genes to normalize qPCR data from different stages of embryo development and germination were identified in two representative conifer species. Clonal propagation by somatic embryogenesis has a great application potentiality in conifers. Quantitative PCR (qPCR) is widely used for gene expression analysis during somatic embryogenesis and embryo germination. No single reference gene is universal, so a systematic characterization of endogenous genes for concrete conditions is fundamental for accuracy. We identified suitable internal control genes to normalize qPCR data obtained at different steps of somatic embryogenesis (embryonal mass proliferation, embryo maturation and germination) in two representative conifer species, Pinus pinaster and Picea abies. Candidate genes included endogenous genes commonly used in conifers, genes previously tested in model plants, and genes with a lower variation of the expression along embryo development according to genome-wide transcript profiling studies. Three different algorithms were used to evaluate expression stability. The geometric average of the expression values of elongation factor-1α, α-tubulin and histone 3 in P. pinaster, and elongation factor-1α, α-tubulin, adenosine kinase and CAC in P. abies were adequate for expression studies throughout somatic embryogenesis. However, improved accuracy was achieved when using other gene combinations in experiments with samples at a single developmental stage. The importance of studies selecting reference genes to use in different tissues or developmental stages within one or close species, and the instability of commonly used reference genes, is highlighted.

  7. The utility of optical detection system (qPCR) and bioinformatics methods in reference gene expression analysis

    Science.gov (United States)

    Skarzyńska, Agnieszka; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Przybecki, Zbigniew

    2016-09-01

    Real-time quantitative polymerase chain reaction is consider as the most reliable method for gene expression studies. However, the expression of target gene could be misinterpreted due to improper normalization. Therefore, the crucial step for analysing of qPCR data is selection of suitable reference genes, which should be validated experimentally. In order to choice the gene with stable expression in the designed experiment, we performed reference gene expression analysis. In this study genes described in the literature and novel genes predicted as control genes, based on the in silico analysis of transcriptome data were used. Analysis with geNorm and NormFinder algorithms allow to create the ranking of candidate genes and indicate the best reference for flower morphogenesis study. According to the results, genes CACS and CYCL were characterised the most stable expression, but the least suitable genes were TUA and EF.

  8. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  9. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  10. Characterizing bacterial gene expression in nitrogen cycle metabolism with RT-qPCR.

    Science.gov (United States)

    Graham, James E; Wantland, Nicholas B; Campbell, Mark; Klotz, Martin G

    2011-01-01

    Recent advances in DNA sequencing have greatly accelerated our ability to obtain the raw information needed to recognize both known and potential novel modular microbial genomic capacity for nitrogen metabolism. With PCR-based approaches to quantifying microbial mRNA expression now mainstream in most laboratories, researchers can now more efficiently propose and test hypotheses on the contributions of individual microbes to the biological accessibility of nitrogen upon which all other life depends. We review known microbial roles in these key nitrogen transformations, and describe the necessary steps in carrying out relevant gene expression studies. An example experimental design is then provided characterizing Nitrosococcus oceani mRNA expression in cultures responding to ammonia. The approach described, that of assessing microbial genome inventory and testing putative modular gene expression by mRNA quantification, is likely to remain an important tool in understanding individual microbial contributions within microbial community activities that maintain the Earth's nitrogen balance. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Validation of reference genes for RT-qPCR analysis of CYP4T expression in crucian carp

    Directory of Open Access Journals (Sweden)

    Fei Mo

    2014-09-01

    Full Text Available Reference genes are commonly used for normalization of target gene expression during RT-qPCR analysis. However, no housekeeping genes or reference genes have been identified to be stable across different tissue types or under different experimental conditions. To identify the most suitable reference genes for RT-qPCR analysis of target gene expression in the hepatopancreas of crucian carp (Carassius auratus under various conditions (sex, age, water temperature, and drug treatments, seven reference genes, including beta actin (ACTB, beta-2 microglobulin (B2M, embryonic elongation factor-1 alpha (EEF1A, glyceraldehyde phosphate dehydrogenase (GAPDH, alpha tubulin (TUBA, ribosomal protein l8 (RPL8 and glucose-6-phosphate dehydrogenase (G6PDH, were evaluated in this study. The stability and ranking of gene expression were analyzed using three different statistical programs: GeNorm, Normfinder and Bestkeeper. The expression errors associated with selection of the genes were assessed by the relative quantity of CYP4T. The results indicated that all the seven genes exhibited variability under the experimental conditions of this research, and the combination of ACTB/TUBA/EEF1A or of ACTB/EEF1A was the best candidate that raised the accuracy of quantitative analysis of gene expression. The findings highlighted the importance of validation of housekeeping genes for research on gene expression under different conditions of experiment and species.

  12. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    OpenAIRE

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...

  13. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    Science.gov (United States)

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  14. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy.

    Science.gov (United States)

    Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann

    2014-10-01

    Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.

  15. Identification of internal control genes for quantitative expression analysis by real-time PCR in bovine peripheral lymphocytes.

    Science.gov (United States)

    Spalenza, Veronica; Girolami, Flavia; Bevilacqua, Claudia; Riondato, Fulvio; Rasero, Roberto; Nebbia, Carlo; Sacchi, Paola; Martin, Patrice

    2011-09-01

    Gene expression studies in blood cells, particularly lymphocytes, are useful for monitoring potential exposure to toxicants or environmental pollutants in humans and livestock species. Quantitative PCR is the method of choice for obtaining accurate quantification of mRNA transcripts although variations in the amount of starting material, enzymatic efficiency, and the presence of inhibitors can lead to evaluation errors. As a result, normalization of data is of crucial importance. The most common approach is the use of endogenous reference genes as an internal control, whose expression should ideally not vary among individuals and under different experimental conditions. The accurate selection of reference genes is therefore an important step in interpreting quantitative PCR studies. Since no systematic investigation in bovine lymphocytes has been performed, the aim of the present study was to assess the expression stability of seven candidate reference genes in circulating lymphocytes collected from 15 dairy cows. Following the characterization by flow cytometric analysis of the cell populations obtained from blood through a density gradient procedure, three popular softwares were used to evaluate the gene expression data. The results showed that two genes are sufficient for normalization of quantitative PCR studies in cattle lymphocytes and that YWAHZ, S24 and PPIA are the most stable genes. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Identification of reference genes for expression analysis by real-time quantitative PCR in drought-stressed soybean

    Directory of Open Access Journals (Sweden)

    Renata Stolf-Moreira

    2011-01-01

    Full Text Available The objective of this work was to validate, by quantitative PCR in real time (RT-qPCR, genes to be used as reference in studies of gene expression in soybean in drought-stressed trials. Four genes commonly used in soybean were evaluated: Gmβ-actin, GmGAPDH, GmLectin and GmRNAr18S. Total RNA was extracted from six samples: three from roots in a hydroponic system with different drought intensities (0, 25, 50, 75 and 100 minutes of water stress, and three from leaves of plants grown in sand with different soil moistures (15, 5 and 2.5% gravimetric humidity. The raw cycle threshold (Ct data were analyzed, and the efficiency of each primer was calculated for an overall analysis of the Ct range among the different samples. The GeNorm application was used to evaluate the best reference gene, according to its stability. The GmGAPDH was the least stable gene, with the highest mean values of expression stability (M, and the most stable genes, with the lowest M values, were the Gmβ-actin and GmRNAr18S, when both root and leaves samples were tested. These genes can be used in RT-qPCR as reference gene for expression analysis.

  17. In situ PCR detection and significance of IL-3 gene expression in irradiated hematopoietic cells of mouse bone marrow

    International Nuclear Information System (INIS)

    Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Li Yanping; Yang Hong; Cui Yufang

    2000-01-01

    Objective: To study the significance of endogenous interleukin 3(IL-3) gene expression in repair of irradiated mouse bone marrow. Methods: Seventy-eight LACA mice were subjected to total body irradiation with 60 Co γ-rays and were sacrificed within 4 weeks after irradiation. The bone marrow histopathological sections were stained with HE, and the expression of endogenous IL-3 gene was detected by means of immunocytochemistry,in situ hybridization(ISH) and in situ reverse transcription PCR(IS RT-PCR). Results: Obvious injury of bone marrow occurred after irradiation and then recovered within 4 weeks. IL-3 protein was obviously increased in the cytoplasm of recovering hematopoietic cells(HCs), especially on day 21 after irradiation, while its mRNA was poorly positive by ISH on days 10-21, especially day 15.IS RT-PCR showed that IL-3 mRNA was strongly positive in recovering HCs cytoplasm, especially on days 10 to 15. Conclusion: In situ RT-PCR can objectively reflect the regulation of IL-3 gene expression in bone marrow after irradiation, and the expression of endogenous IL-3 gene may play an important role in hematopoietic reconstruction of irradiated bone marrow

  18. Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.).

    Science.gov (United States)

    Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine

    2014-07-22

    Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad

  19. Identification and comprehensive evaluation of reference genes for RT-qPCR analysis of host gene-expression in Brassica juncea-aphid interaction using microarray data.

    Science.gov (United States)

    Ram, Chet; Koramutla, Murali Krishna; Bhattacharya, Ramcharan

    2017-07-01

    Brassica juncea is a chief oil yielding crop in many parts of the world including India. With advancement of molecular techniques, RT-qPCR based study of gene-expression has become an integral part of experimentations in crop breeding. In RT-qPCR, use of appropriate reference gene(s) is pivotal. The virtue of the reference genes, being constant in expression throughout the experimental treatments, needs to be validated case by case. Appropriate reference gene(s) for normalization of gene-expression data in B. juncea during the biotic stress of aphid infestation is not known. In the present investigation, 11 reference genes identified from microarray database of Arabidopsis-aphid interaction at a cut off FDR ≤0.1, along with two known reference genes of B. juncea, were analyzed for their expression stability upon aphid infestation. These included 6 frequently used and 5 newly identified reference genes. Ranking orders of the reference genes in terms of expression stability were calculated using advanced statistical approaches such as geNorm, NormFinder, delta Ct and BestKeeper. The analysis suggested CAC, TUA and DUF179 as the most suitable reference genes. Further, normalization of the gene-expression data of STP4 and PR1 by the most and the least stable reference gene, respectively has demonstrated importance and applicability of the recommended reference genes in aphid infested samples of B. juncea. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  20. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  1. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  2. Expression stabilities of candidate reference genes for RT-qPCR under different stress conditions in soybean.

    Directory of Open Access Journals (Sweden)

    Shuhua Ma

    Full Text Available Due to its accuracy, sensitivity and high throughput, real time quantitative PCR (RT-qPCR has been widely used in analysing gene expression. The quality of data from such analyses is affected by the quality of reference genes used. Expression stabilities for nine candidate reference genes widely used in soybean were evaluated under different stresses in this study. Our results showed that EF1A and ACT11 were the best under salinity stress, TUB4, TUA5 and EF1A were the best under drought stress, ACT11 and UKN2 were the best under dark treatment, and EF1B and UKN2 were the best under virus infection. EF1B and UKN2 were the top two genes which can be reliably used in all of the stress conditions assessed.

  3. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  4. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  5. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Science.gov (United States)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  6. Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Kawaguchi Makoto

    2010-01-01

    Full Text Available Abstract Background Lung cancers are the most common type of human malignancy and are intractable. Lung cancers are generally classified into four histopathological subtypes: adenocarcinoma (AD, squamous cell carcinoma (SQ, large cell carcinoma (LC, and small cell carcinoma (SC. Molecular biological characterization of these subtypes has been performed mainly using DNA microarrays. In this study, we compared the gene expression profiles of these four subtypes using twelve human lung cancer cell lines and the more reliable quantitative real-time PCR (qPCR. Results We selected 100 genes from public DNA microarray data and examined them by DNA microarray analysis in eight test cell lines (A549, ABC-1, EBC-1, LK-2, LU65, LU99, STC 1, RERF-LC-MA and a normal control lung cell line (MRC-9. From this, we extracted 19 candidate genes. We quantified the expression of the 19 genes and a housekeeping gene, GAPDH, with qPCR, using the same eight cell lines plus four additional validation lung cancer cell lines (RERF-LC-MS, LC-1/sq, 86-2, and MS-1-L. Finally, we characterized the four subtypes of lung cancer cell lines using principal component analysis (PCA of gene expression profiling for 12 of the 19 genes (AMY2A, CDH1, FOXG1, IGSF3, ISL1, MALL, PLAU, RAB25, S100P, SLCO4A1, STMN1, and TGM2. The combined PCA and gene pathway analyses suggested that these genes were related to cell adhesion, growth, and invasion. S100P in AD cells and CDH1 in AD and SQ cells were identified as candidate markers of these lung cancer subtypes based on their upregulation and the results of PCA analysis. Immunohistochemistry for S100P and RAB25 was closely correlated to gene expression. Conclusions These results show that the four subtypes, represented by 12 lung cancer cell lines, were well characterized using qPCR and PCA for the 12 genes examined. Certain genes, in particular S100P and CDH1, may be especially important for distinguishing the different subtypes. Our results

  7. Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR

    Directory of Open Access Journals (Sweden)

    Longjian Niu

    2015-06-01

    Full Text Available Real-time quantitative PCR (RT-qPCR is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis, a promising oilseed crop known for its polyunsaturated fatty acid (PUFA-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt, BestKeeper, geNorm, and NormFinder were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE, actin (ACT and phospholipase A22 (PLA were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13, cyclophilin (CYC and elongation factor-1alpha (EF1α were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi.

  8. Selection of Reliable Reference Genes for Gene Expression Studies of a Promising Oilseed Crop, Plukenetia volubilis, by Real-Time Quantitative PCR

    Science.gov (United States)

    Niu, Longjian; Tao, Yan-Bin; Chen, Mao-Sheng; Fu, Qiantang; Li, Chaoqiong; Dong, Yuling; Wang, Xiulan; He, Huiying; Xu, Zeng-Fu

    2015-01-01

    Real-time quantitative PCR (RT-qPCR) is a reliable and widely used method for gene expression analysis. The accuracy of the determination of a target gene expression level by RT-qPCR demands the use of appropriate reference genes to normalize the mRNA levels among different samples. However, suitable reference genes for RT-qPCR have not been identified in Sacha inchi (Plukenetia volubilis), a promising oilseed crop known for its polyunsaturated fatty acid (PUFA)-rich seeds. In this study, using RT-qPCR, twelve candidate reference genes were examined in seedlings and adult plants, during flower and seed development and for the entire growth cycle of Sacha inchi. Four statistical algorithms (delta cycle threshold (ΔCt), BestKeeper, geNorm, and NormFinder) were used to assess the expression stabilities of the candidate genes. The results showed that ubiquitin-conjugating enzyme (UCE), actin (ACT) and phospholipase A22 (PLA) were the most stable genes in Sacha inchi seedlings. For roots, stems, leaves, flowers, and seeds from adult plants, 30S ribosomal protein S13 (RPS13), cyclophilin (CYC) and elongation factor-1alpha (EF1α) were recommended as reference genes for RT-qPCR. During the development of reproductive organs, PLA, ACT and UCE were the optimal reference genes for flower development, whereas UCE, RPS13 and RNA polymerase II subunit (RPII) were optimal for seed development. Considering the entire growth cycle of Sacha inchi, UCE, ACT and EF1α were sufficient for the purpose of normalization. Our results provide useful guidelines for the selection of reliable reference genes for the normalization of RT-qPCR data for seedlings and adult plants, for reproductive organs, and for the entire growth cycle of Sacha inchi. PMID:26047338

  9. Cross-platform comparison of SYBR® Green real-time PCR with TaqMan PCR, microarrays and other gene expression measurement technologies evaluated in the MicroArray Quality Control (MAQC study

    Directory of Open Access Journals (Sweden)

    Dial Stacey L

    2008-07-01

    Full Text Available Abstract Background The MicroArray Quality Control (MAQC project evaluated the inter- and intra-platform reproducibility of seven microarray platforms and three quantitative gene expression assays in profiling the expression of two commercially available Reference RNA samples (Nat Biotechnol 24:1115-22, 2006. The tested microarrays were the platforms from Affymetrix, Agilent Technologies, Applied Biosystems, GE Healthcare, Illumina, Eppendorf and the National Cancer Institute, and quantitative gene expression assays included TaqMan® Gene Expression PCR Assay, Standardized (Sta RT-PCR™ and QuantiGene®. The data showed great consistency in gene expression measurements across different microarray platforms, different technologies and test sites. However, SYBR® Green real-time PCR, another common technique utilized by half of all real-time PCR users for gene expression measurement, was not addressed in the MAQC study. In the present study, we compared the performance of SYBR Green PCR with TaqMan PCR, microarrays and other quantitative technologies using the same two Reference RNA samples as the MAQC project. We assessed SYBR Green real-time PCR using commercially available RT2 Profiler™ PCR Arrays from SuperArray, containing primer pairs that have been experimentally validated to ensure gene-specificity and high amplification efficiency. Results The SYBR Green PCR Arrays exhibit good reproducibility among different users, PCR instruments and test sites. In addition, the SYBR Green PCR Arrays have the highest concordance with TaqMan PCR, and a high level of concordance with other quantitative methods and microarrays that were evaluated in this study in terms of fold-change correlation and overlap of lists of differentially expressed genes. Conclusion These data demonstrate that SYBR Green real-time PCR delivers highly comparable results in gene expression measurement with TaqMan PCR and other high-density microarrays.

  10. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  11. GENE EXPRESSION CHANGES AND ANTI-PROLIFERATIVE EFFECT OF NONI (Morinda citrifolia FRUIT EXTRACT ANALYSED BY REAL TIME-PCR

    Directory of Open Access Journals (Sweden)

    hermansyah hermansyah

    2017-05-01

    Full Text Available To elucidate the anti-proliferative effect of noni (Morinda citrifolia fruit extract for a Saccharomyces cerevisiae model organism, analysis of gene expression changes related to cell cycle associated with inhibition effect of noni fruit extract was carried out. Anti-proliferative of noni fruit extract was analyzed using gene expression changes of Saccharomyces cerevisiae (strains FY833 and BY4741.  Transcriptional analysis of genes that play a role in cell cycle was conducted by growing cells on YPDAde broth medium containing 1% (w/v noni fruit extract, and then subjected using quantitative real-time polymerase chain reaction (RT-PCR.  Transcriptional level of genes CDC6 (Cell Division Cycle-6, CDC20 (Cell Division Cycle-20, FAR1 (Factor ARrest-1, FUS3 (FUSsion-3, SIC1 (Substrate/Subunit Inhibitor of Cyclin-dependent protein kinase-1, WHI5 (WHIskey-5, YOX1 (Yeast homeobOX-1 and YHP1 (Yeast Homeo-Protein-1 increased, oppositely genes expression of DBF4 (DumbBell Forming, MCM1 (Mini Chromosome Maintenance-1 and TAH11 (Topo-A Hypersensitive-11 decreased, while the expression level of genes CDC7 (Cell Division Cycle-7, MBP1 (MIul-box Binding Protein-1 and SWI6 (SWItching deficient-6 relatively unchanged. These results indicated that gene expression changes might associate with anti-proliferative effect from noni fruit extract. These gene expressions changes lead to the growth inhibition of S.cerevisiae cell because of cell cycle defect.

  12. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Science.gov (United States)

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  13. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    Science.gov (United States)

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  14. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  15. Selection and evaluation of potential reference genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae using reverse-transcription quantitative PCR.

    Directory of Open Access Journals (Sweden)

    Miao Yuan

    Full Text Available The brown planthopper (BPH, Nilaparvata lugens (Hemiptera, Delphacidae, is one of the most important rice pests. Abundant genetic studies on BPH have been conducted using reverse-transcription quantitative real-time PCR (qRT-PCR. Using qRT-PCR, the expression levels of target genes are calculated on the basis of endogenous controls. These genes need to be appropriately selected by experimentally assessing whether they are stably expressed under different conditions. However, such studies on potential reference genes in N. lugens are lacking. In this paper, we presented a systematic exploration of eight candidate reference genes in N. lugens, namely, actin 1 (ACT, muscle actin (MACT, ribosomal protein S11 (RPS11, ribosomal protein S15e (RPS15, alpha 2-tubulin (TUB, elongation factor 1 delta (EF, 18S ribosomal RNA (18S, and arginine kinase (AK and used four alternative methods (BestKeeper, geNorm, NormFinder, and the delta Ct method to evaluate the suitability of these genes as endogenous controls. We examined their expression levels among different experimental factors (developmental stage, body part, geographic population, temperature variation, pesticide exposure, diet change, and starvation following the MIQE (Minimum Information for publication of Quantitative real time PCR Experiments guidelines. Based on the results of RefFinder, which integrates four currently available major software programs to compare and rank the tested candidate reference genes, RPS15, RPS11, and TUB were found to be the most suitable reference genes in different developmental stages, body parts, and geographic populations, respectively. RPS15 was the most suitable gene under different temperature and diet conditions, while RPS11 was the most suitable gene under different pesticide exposure and starvation conditions. This work sheds light on establishing a standardized qRT-PCR procedure in N. lugens, and serves as a starting point for screening for reference genes for

  16. Quantitative Real Time PCR approach to study gene expression profile during prenatal growth of skeletal muscle in pig of Duroc and Pietrain breeds

    Directory of Open Access Journals (Sweden)

    M. Cagnazzo

    2010-01-01

    Full Text Available The quantitative real time-PCR (QRT-PCR is a very sensitive method used to quantify mRNA level in gene expression analysis. Combining amplification, detection and quantification in a single step, allows a more accurate measurement compared to the traditional PCR end point analysis (Pfaffl, 2001; Bustin, 2002.

  17. Housekeeping gene expression during fetal brain development in the rat-validation by semi-quantitative RT-PCR.

    Science.gov (United States)

    Al-Bader, Maie Dawoud; Al-Sarraf, Hameed Ali

    2005-04-21

    Mammalian gene expression is usually carried out at the level of mRNA where the amount of mRNA of interest is measured under different conditions such as growth and development. It is therefore important to use a "housekeeping gene", that does not change in relative abundance during the experimental conditions, as a standard or internal control. However, recent data suggest that expression of some housekeeping genes may vary with the extent of cell proliferation, differentiation and under various experimental conditions. In this study, the expression of various housekeeping genes (18S rRNA [18S], glyceraldehydes-3-phosphate dehydrogenase [G3PDH], beta-glucuronidase [BGLU], histone H4 [HH4], ribosomal protein L19 [RPL19] and cyclophilin [CY]) was investigated during fetal rat brain development using semi-quantitative RT-PCR at 16, 19 and 21 days gestation. It was found that all genes studied, with exception to G3PDH, did not show any change in their expression levels during development. G3PDH, on the other hand, showed increased expression with development. These results suggest that the choice of a housekeeping gene is critical to the interpretation of experimental results and should be modified according to the nature of the study.

  18. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Directory of Open Access Journals (Sweden)

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  19. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Science.gov (United States)

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

  20. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli.

    Science.gov (United States)

    Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael

    2008-04-16

    The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

  1. Multiway real-time PCR gene expression profiling in yeast Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

    Directory of Open Access Journals (Sweden)

    Andrade-Garda José

    2008-04-01

    Full Text Available Abstract Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.

  2. Identification and validation of superior reference gene for gene expression normalization via RT-qPCR in staminate and pistillate flowers of Jatropha curcas - A biodiesel plant.

    Science.gov (United States)

    Karuppaiya, Palaniyandi; Yan, Xiao-Xue; Liao, Wang; Wu, Jun; Chen, Fang; Tang, Lin

    2017-01-01

    Physic nut (Jatropha curcas L) seed oil is a natural resource for the alternative production of fossil fuel. Seed oil production is mainly depended on seed yield, which was restricted by the low ratio of staminate flowers to pistillate flowers. Further, the mechanism of physic nut flower sex differentiation has not been fully understood yet. Quantitative Real Time-Polymerase Chain Reaction is a reliable and widely used technique to quantify the gene expression pattern in biological samples. However, for accuracy of qRT-PCR, appropriate reference gene is highly desirable to quantify the target gene level. Hence, the present study was aimed to identify the stable reference genes in staminate and pistillate flowers of J. curcas. In this study, 10 candidate reference genes were selected and evaluated for their expression stability in staminate and pistillate flowers, and their stability was validated by five different algorithms (ΔCt, BestKeeper, NormFinder, GeNorm and RefFinder). Resulting, TUB and EF found to be the two most stably expressed reference for staminate flower; while GAPDH1 and EF found to be the most stably expressed reference gene for pistillate flowers. Finally, RT-qPCR assays of target gene AGAMOUS using the identified most stable reference genes confirmed the reliability of selected reference genes in different stages of flower development. AGAMOUS gene expression levels at different stages were further proved by gene copy number analysis. Therefore, the present study provides guidance for selecting appropriate reference genes for analyzing the expression pattern of floral developmental genes in staminate and pistillate flowers of J. curcas.

  3. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Directory of Open Access Journals (Sweden)

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  4. Wetlab-2 - Quantitative PCR Tools for Spaceflight Studies of Gene Expression Aboard the International Space Station

    Science.gov (United States)

    Schonfeld, Julie E.

    2015-01-01

    Wetlab-2 is a research platform for conducting real-time quantitative gene expression analysis aboard the International Space Station. The system enables spaceflight genomic studies involving a wide variety of biospecimen types in the unique microgravity environment of space. Currently, gene expression analyses of space flown biospecimens must be conducted post flight after living cultures or frozen or chemically fixed samples are returned to Earth from the space station. Post-flight analysis is limited for several reasons. First, changes in gene expression can be transient, changing over a timescale of minutes. The delay between sampling on Earth can range from days to months, and RNA may degrade during this period of time, even in fixed or frozen samples. Second, living organisms that return to Earth may quickly re-adapt to terrestrial conditions. Third, forces exerted on samples during reentry and return to Earth may affect results. Lastly, follow up experiments designed in response to post-flight results must wait for a new flight opportunity to be tested.

  5. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  6. Predator-induced defences in Daphnia pulex: Selection and evaluation of internal reference genes for gene expression studies with real-time PCR

    Directory of Open Access Journals (Sweden)

    Gilbert Don

    2010-06-01

    Full Text Available Abstract Background The planktonic microcrustacean Daphnia pulex is among the best-studied animals in ecological, toxicological and evolutionary research. One aspect that has sustained interest in the study system is the ability of D. pulex to develop inducible defence structures when exposed to predators, such as the phantom midge larvae Chaoborus. The available draft genome sequence for D. pulex is accelerating research to identify genes that confer plastic phenotypes that are regularly cued by environmental stimuli. Yet for quantifying gene expression levels, no experimentally validated set of internal control genes exists for the accurate normalization of qRT-PCR data. Results In this study, we tested six candidate reference genes for normalizing transcription levels of D. pulex genes; alpha tubulin (aTub, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, TATA box binding protein (Tbp syntaxin 16 (Stx16, X-box binding protein 1 (Xbp1 and CAPON, a protein associated with the neuronal nitric oxide synthase, were selected on the basis of an earlier study and from microarray studies. One additional gene, a matrix metalloproteinase (MMP, was tested to validate its transcriptional response to Chaoborus, which was earlier observed in a microarray study. The transcription profiles of these seven genes were assessed by qRT-PCR from RNA of juvenile D. pulex that showed induced defences in comparison to untreated control animals. We tested the individual suitability of genes for expression normalization using the programs geNorm, NormFinder and BestKeeper. Intriguingly, Xbp1, Tbp, CAPON and Stx16 were selected as ideal reference genes. Analyses on the relative expression level using the software REST showed that both classical housekeeping candidate genes (aTub and GAPDH were significantly downregulated, whereas the MMP gene was shown to be significantly upregulated, as predicted. aTub is a particularly ill suited reference gene because five copies are

  7. Bone to pick: the importance of evaluating reference genes for RT-qPCR quantification of gene expression in craniosynostosis and bone-related tissues and cells

    Directory of Open Access Journals (Sweden)

    Yang Xianxian

    2012-05-01

    Full Text Available Abstract Background RT-qPCR is a common tool for quantification of gene expression, but its accuracy is dependent on the choice and stability (steady state expression levels of the reference gene/s used for normalization. To date, in the bone field, there have been few studies to determine the most stable reference genes and, usually, RT-qPCR data is normalised to non-validated reference genes, most commonly GAPDH, ACTB and 18 S rRNA. Here we draw attention to the potential deleterious impact of using classical reference genes to normalise expression data for bone studies without prior validation of their stability. Results Using the geNorm and Normfinder programs, panels of mouse and human genes were assessed for their stability under three different experimental conditions: 1 disease progression of Crouzon syndrome (craniosynostosis in a mouse model, 2 proliferative culture of cranial suture cells isolated from craniosynostosis patients and 3 osteogenesis of a mouse bone marrow stromal cell line. We demonstrate that classical reference genes are not always the most ‘stable’ genes and that gene ‘stability’ is highly dependent on experimental conditions. Selected stable genes, individually or in combination, were then used to normalise osteocalcin and alkaline phosphatase gene expression data during cranial suture fusion in the craniosynostosis mouse model and strategies compared. Strikingly, the expression trends of alkaline phosphatase and osteocalcin varied significantly when normalised to the least stable, the most stable or the three most stable genes. Conclusion To minimise errors in evaluating gene expression levels, analysis of a reference panel and subsequent normalization to several stable genes is strongly recommended over normalization to a single gene. In particular, we conclude that use of single, non-validated “housekeeping” genes such as GAPDH, ACTB and 18 S rRNA, currently a widespread practice by researchers in

  8. Selection of reference genes for gene expression studies in pig tissues using SYBR green qPCR

    DEFF Research Database (Denmark)

    Hillig, Ann-Britt Nygaard; Jørgensen, Claus Bøttcher; Cirera, Susanna

    2007-01-01

    -microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethylbilane synthase (HMBS), hypoxanthine phosphoribosyltransferase I (HPRT I), ribosomal protein L4 (RPL4), succinate dehydrogenase complex subunit A (SDHA), TATA box binding protein (TPB) and tyrosine 3-monooxygenase/tryptophan 5......-monooxygenase activation protein zeta polypeptide (YWHAZ). The stability of these reference genes in different pig tissues was investigated using the geNorm application. The range of expression stability in the genes analysed was (from the most stable to the least stable): ACTB/RPL4, TBP, HPRT, HMBS, YWHAZ...

  9. Selection of Reliable Reference Genes for Gene Expression Studies in the Biofuel Plant Jatropha curcas Using Real-Time Quantitative PCR

    Directory of Open Access Journals (Sweden)

    Lu Zhang

    2013-12-01

    Full Text Available Jatropha curcas is a promising renewable feedstock for biodiesel and bio-jet fuel production. To study gene expression in Jatropha in different tissues throughout development and under stress conditions, we examined a total of 11 typical candidate reference genes using real-time quantitative polymerase chain reaction (RT-qPCR analysis, which is widely used for validating transcript levels in gene expression studies. The expression stability of these candidate reference genes was assessed across a total of 20 samples, including various tissues at vegetative and reproductive stages and under desiccation and cold stress treatments. The results obtained using software qBasePLUS showed that the top-ranked reference genes differed across the sample subsets. The combination of actin, GAPDH, and EF1α would be appropriate as a reference panel for normalizing gene expression data across samples at different developmental stages; the combination of actin, GAPDH, and TUB5 should be used as a reference panel for normalizing gene expression data across samples under various abiotic stress treatments. With regard to different developmental stages, we recommend the use of actin and TUB8 for normalization at the vegetative stage and GAPDH and EF1α for normalization at the reproductive stage. For abiotic stress treatments, we recommend the use of TUB5 and TUB8 for normalization under desiccation stress and GAPDH and actin for normalization under cold stress. These results are valuable for future research on gene expression during development or under abiotic stress in Jatropha. To our knowledge, this is the first report on the stability of reference genes in Jatropha.

  10. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Directory of Open Access Journals (Sweden)

    Jing Cai

    Full Text Available Hulless barley (Hordeum vulgare L. var. nudum. hook. f. has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin, E2 (Ubiquitin conjugating enzyme 2, TUBα (Alpha-tubulin, TUBβ6 (Beta-tubulin 6, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase, EF-1α (Elongation factor 1-alpha, SAMDC (S-adenosylmethionine decarboxylase, PKABA1 (Gene for protein kinase HvPKABA1, PGK (Phosphoglycerate kinase, and HSP90 (Heat shock protein 90-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression

  11. Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

    Science.gov (United States)

    Cai, Jing; Li, Pengfei; Luo, Xiao; Chang, Tianliang; Li, Jiaxing; Zhao, Yuwei; Xu, Yao

    2018-01-01

    Hulless barley (Hordeum vulgare L. var. nudum. hook. f.) has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin), E2 (Ubiquitin conjugating enzyme 2), TUBα (Alpha-tubulin), TUBβ6 (Beta-tubulin 6), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), EF-1α (Elongation factor 1-alpha), SAMDC (S-adenosylmethionine decarboxylase), PKABA1 (Gene for protein kinase HvPKABA1), PGK (Phosphoglycerate kinase), and HSP90 (Heat shock protein 90)-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression analysis

  12. Localisation of Abundant and Organ-Specific Genes Expressed in Rosa hybrida Leaves and Flower Buds by Direct In Situ RT-PCR

    Directory of Open Access Journals (Sweden)

    Agata Jedrzejuk

    2012-01-01

    Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.

  13. Identification and validation of reference genes for quantification of target gene expression with quantitative real-time PCR for tall fescue under four abiotic stresses.

    Directory of Open Access Journals (Sweden)

    Zhimin Yang

    Full Text Available Tall fescue (Festuca arundinacea Schreb. is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanisms of grass stress tolerance due to its superior drought and heat tolerance among cool-season species. Selection of suitable reference genes for quantification of target gene expression is important for the discovery of molecular mechanisms underlying improved growth traits and stress tolerance. The stability of nine potential reference genes (ACT, TUB, EF1a, GAPDH, SAND, CACS, F-box, PEPKR1 and TIP41 was evaluated using four programs, GeNorm, NormFinder, BestKeeper, and RefFinder. The combinations of SAND and TUB or TIP41 and TUB were most stably expressed in salt-treated roots or leaves. The combinations of GAPDH with TIP41 or TUB were stable in roots and leaves under drought stress. TIP41 and PEPKR1 exhibited stable expression in cold-treated roots, and the combination of F-box, TIP41 and TUB was also stable in cold-treated leaves. CACS and TUB were the two most stable reference genes in heat-stressed roots. TIP41 combined with TUB and ACT was stably expressed in heat-stressed leaves. Finally, quantitative real-time polymerase chain reaction (qRT-PCR assays of the target gene FaWRKY1 using the identified most stable reference genes confirmed the reliability of selected reference genes. The selection of suitable reference genes in tall fescue will allow for more accurate identification of stress-tolerance genes and molecular mechanisms conferring stress tolerance in this stress-tolerant species.

  14. Validating Internal Control Genes for the Accurate Normalization of qPCR Expression Analysis of the Novel Model Plant Setaria viridis.

    Directory of Open Access Journals (Sweden)

    Julia Lambret-Frotté

    Full Text Available Employing reference genes to normalize the data generated with quantitative PCR (qPCR can increase the accuracy and reliability of this method. Previous results have shown that no single housekeeping gene can be universally applied to all experiments. Thus, the identification of a suitable reference gene represents a critical step of any qPCR analysis. Setaria viridis has recently been proposed as a model system for the study of Panicoid grasses, a crop family of major agronomic importance. Therefore, this paper aims to identify suitable S. viridis reference genes that can enhance the analysis of gene expression in this novel model plant. The first aim of this study was the identification of a suitable RNA extraction method that could retrieve a high quality and yield of RNA. After this, two distinct algorithms were used to assess the gene expression of fifteen different candidate genes in eighteen different samples, which were divided into two major datasets, the developmental and the leaf gradient. The best-ranked pair of reference genes from the developmental dataset included genes that encoded a phosphoglucomutase and a folylpolyglutamate synthase; genes that encoded a cullin and the same phosphoglucomutase as above were the most stable genes in the leaf gradient dataset. Additionally, the expression pattern of two target genes, a SvAP3/PI MADS-box transcription factor and the carbon-fixation enzyme PEPC, were assessed to illustrate the reliability of the chosen reference genes. This study has shown that novel reference genes may perform better than traditional housekeeping genes, a phenomenon which has been previously reported. These results illustrate the importance of carefully validating reference gene candidates for each experimental set before employing them as universal standards. Additionally, the robustness of the expression of the target genes may increase the utility of S. viridis as a model for Panicoid grasses.

  15. Identification of Suitable Reference Genes for Investigating Gene Expression in Anterior Cruciate Ligament Injury by Using Reverse Transcription-Quantitative PCR.

    Directory of Open Access Journals (Sweden)

    Mariana Ferreira Leal

    Full Text Available The anterior cruciate ligament (ACL is one of the most frequently injured structures during high-impact sporting activities. Gene expression analysis may be a useful tool for understanding ACL tears and healing failure. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR has emerged as an effective method for such studies. However, this technique requires the use of suitable reference genes for data normalization. Here, we evaluated the suitability of six reference genes (18S, ACTB, B2M, GAPDH, HPRT1, and TBP by using ACL samples of 39 individuals with ACL tears (20 with isolated ACL tears and 19 with ACL tear and combined meniscal injury and of 13 controls. The stability of the candidate reference genes was determined by using the NormFinder, geNorm, BestKeeper DataAssist, and RefFinder software packages and the comparative ΔCt method. ACTB was the best single reference gene and ACTB+TBP was the best gene pair. The GenEx software showed that the accumulated standard deviation is reduced when a larger number of reference genes is used for gene expression normalization. However, the use of a single reference gene may not be suitable. To identify the optimal combination of reference genes, we evaluated the expression of FN1 and PLOD1. We observed that at least 3 reference genes should be used. ACTB+HPRT1+18S is the best trio for the analyses involving isolated ACL tears and controls. Conversely, ACTB+TBP+18S is the best trio for the analyses involving (1 injured ACL tears and controls, and (2 ACL tears of patients with meniscal tears and controls. Therefore, if the gene expression study aims to compare non-injured ACL, isolated ACL tears and ACL tears from patients with meniscal tear as three independent groups ACTB+TBP+18S+HPRT1 should be used. In conclusion, 3 or more genes should be used as reference genes for analysis of ACL samples of individuals with and without ACL tears.

  16. Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

    Directory of Open Access Journals (Sweden)

    Kathleen D Cusick

    Full Text Available Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1 light/dark cycling: btl, asl, and vma1; (2 all-dark growth: btl, tbp, vma1, and vma2; (3 temperature flux: btl, vma1, act, and asl; (4 all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated, expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring

  17. Selection and evaluation of reference genes for expression studies with quantitative PCR in the model fungus Neurospora crassa under different environmental conditions in continuous culture.

    Science.gov (United States)

    Cusick, Kathleen D; Fitzgerald, Lisa A; Pirlo, Russell K; Cockrell, Allison L; Petersen, Emily R; Biffinger, Justin C

    2014-01-01

    Neurospora crassa has served as a model organism for studying circadian pathways and more recently has gained attention in the biofuel industry due to its enhanced capacity for cellulase production. However, in order to optimize N. crassa for biotechnological applications, metabolic pathways during growth under different environmental conditions must be addressed. Reverse-transcription quantitative PCR (RT-qPCR) is a technique that provides a high-throughput platform from which to measure the expression of a large set of genes over time. The selection of a suitable reference gene is critical for gene expression studies using relative quantification, as this strategy is based on normalization of target gene expression to a reference gene whose expression is stable under the experimental conditions. This study evaluated twelve candidate reference genes for use with N. crassa when grown in continuous culture bioreactors under different light and temperature conditions. Based on combined stability values from NormFinder and Best Keeper software packages, the following are the most appropriate reference genes under conditions of: (1) light/dark cycling: btl, asl, and vma1; (2) all-dark growth: btl, tbp, vma1, and vma2; (3) temperature flux: btl, vma1, act, and asl; (4) all conditions combined: vma1, vma2, tbp, and btl. Since N. crassa exists as different cell types (uni- or multi-nucleated), expression changes in a subset of the candidate genes was further assessed using absolute quantification. A strong negative correlation was found to exist between ratio and threshold cycle (CT) values, demonstrating that CT changes serve as a reliable reflection of transcript, and not gene copy number, fluctuations. The results of this study identified genes that are appropriate for use as reference genes in RT-qPCR studies with N. crassa and demonstrated that even with the presence of different cell types, relative quantification is an acceptable method for measuring gene

  18. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  19. Environmental Regulation of Plant Gene Expression: An Rt-qPCR Laboratory Project for an Upper-Level Undergraduate Biochemistry or Molecular Biology Course

    Science.gov (United States)

    Eickelberg, Garrett J.; Fisher, Alison J.

    2013-01-01

    We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the "FLOWERING LOCUS C" gene, a key regulator of floral timing in "Arabidopsis thaliana" plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate…

  20. In situ reverse transcription-PCR for monitoring gene expression in individual Methanosarcina mazei S-6 cells

    DEFF Research Database (Denmark)

    Lange, Marianne; Tolker-Nielsen, Tim; Molin, Søren

    2000-01-01

    An in situ reverse transcription-PCR protocol for detecting specific mRNA in Methanosarcina mazei S-6 is described. This method allowed us to detect heat shock-induced increases in the intracellular levels of the transcript of the universal stress gene dnaK. The cell walls of paraformaldehyde...

  1. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    Science.gov (United States)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  2. Environmental regulation of plant gene expression: an RT-qPCR laboratory project for an upper-level undergraduate biochemistry or molecular biology course.

    Science.gov (United States)

    Eickelberg, Garrett J; Fisher, Alison J

    2013-01-01

    We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.

  3. Bayesian mixture models for assessment of gene differential behaviour and prediction of pCR through the integration of copy number and gene expression data.

    Directory of Open Access Journals (Sweden)

    Filippo Trentini

    Full Text Available We consider modeling jointly microarray RNA expression and DNA copy number data. We propose Bayesian mixture models that define latent Gaussian probit scores for the DNA and RNA, and integrate between the two platforms via a regression of the RNA probit scores on the DNA probit scores. Such a regression conveniently allows us to include additional sample specific covariates such as biological conditions and clinical outcomes. The two developed methods are aimed respectively to make inference on differential behaviour of genes in patients showing different subtypes of breast cancer and to predict the pathological complete response (pCR of patients borrowing strength across the genomic platforms. Posterior inference is carried out via MCMC simulations. We demonstrate the proposed methodology using a published data set consisting of 121 breast cancer patients.

  4. Selection and Verification of Candidate Reference Genes for Mature MicroRNA Expression by Quantitative RT-PCR in the Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Song

    2016-05-01

    Full Text Available Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is a rapid and sensitive method for analyzing microRNA (miRNA expression. However, accurate qRT-PCR results depend on the selection of reliable reference genes as internal positive controls. To date, few studies have identified reliable reference genes for differential expression analysis of miRNAs among tissues, and among experimental conditions in plants. In this study, three miRNAs and four non-coding small RNAs (ncRNA were selected as reference candidates, and the stability of their expression was evaluated among different tissues and under different experimental conditions in the tea plant (Camellia sinensis using the geNorm and NormFinder programs. It was shown that miR159a was the best single reference gene in the bud to the fifth leaf, 5S rRNA was the most suitable gene in different organs, miR6149 was the most stable gene when the leaves were attacked by Ectropis oblique and U4, miR5368n and miR159a were the best genes when the leaves were treated by methyl jasmonate (MeJA, salicylic acid (SA and abscisic acid (ABA, respectively. Our results provide suitable reference genes for future investigations on miRNA functions in tea plants.

  5. Identification of valid reference genes for the normalization of RT-qPCR expression studies in human breast cancer cell lines treated with and without transient transfection.

    Directory of Open Access Journals (Sweden)

    Lin-Lin Liu

    Full Text Available Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is a powerful technique for examining gene expression changes during tumorigenesis. Target gene expression is generally normalized by a stably expressed endogenous reference gene; however, reference gene expression may differ among tissues under various circumstances. Because no valid reference genes have been documented for human breast cancer cell lines containing different cancer subtypes treated with transient transfection, we identified appropriate and reliable reference genes from thirteen candidates in a panel of 10 normal and cancerous human breast cell lines under experimental conditions with/without transfection treatments with two transfection reagents. Reference gene expression stability was calculated using four algorithms (geNorm, NormFinder, BestKeeper and comparative delta Ct, and the recommended comprehensive ranking was provided using geometric means of the ranking values using the RefFinder tool. GeNorm analysis revealed that two reference genes should be sufficient for all cases in this study. A stability analysis suggests that 18S rRNA-ACTB is the best reference gene combination across all cell lines; ACTB-GAPDH is best for basal breast cancer cell lines; and HSPCB-ACTB is best for ER+ breast cancer cells. After transfection, the stability ranking of the reference gene fluctuated, especially with Lipofectamine 2000 transfection reagent in two subtypes of basal and ER+ breast cell lines. Comparisons of relative target gene (HER2 expression revealed different expressional patterns depending on the reference genes used for normalization. We suggest that identifying the most stable and suitable reference genes is critical for studying specific cell lines under certain circumstances.

  6. How to perform RT-qPCR accurately in plant species? A case study on flower colour gene expression in an azalea (Rhododendron simsii hybrids) mapping population.

    Science.gov (United States)

    De Keyser, Ellen; Desmet, Laurence; Van Bockstaele, Erik; De Riek, Jan

    2013-06-24

    Flower colour variation is one of the most crucial selection criteria in the breeding of a flowering pot plant, as is also the case for azalea (Rhododendron simsii hybrids). Flavonoid biosynthesis was studied intensively in several species. In azalea, flower colour can be described by means of a 3-gene model. However, this model does not clarify pink-coloration. The last decade gene expression studies have been implemented widely for studying flower colour. However, the methods used were often only semi-quantitative or quantification was not done according to the MIQE-guidelines. We aimed to develop an accurate protocol for RT-qPCR and to validate the protocol to study flower colour in an azalea mapping population. An accurate RT-qPCR protocol had to be established. RNA quality was evaluated in a combined approach by means of different techniques e.g. SPUD-assay and Experion-analysis. We demonstrated the importance of testing noRT-samples for all genes under study to detect contaminating DNA. In spite of the limited sequence information available, we prepared a set of 11 reference genes which was validated in flower petals; a combination of three reference genes was most optimal. Finally we also used plasmids for the construction of standard curves. This allowed us to calculate gene-specific PCR efficiencies for every gene to assure an accurate quantification. The validity of the protocol was demonstrated by means of the study of six genes of the flavonoid biosynthesis pathway. No correlations were found between flower colour and the individual expression profiles. However, the combination of early pathway genes (CHS, F3H, F3'H and FLS) is clearly related to co-pigmentation with flavonols. The late pathway genes DFR and ANS are to a minor extent involved in differentiating between coloured and white flowers. Concerning pink coloration, we could demonstrate that the lower intensity in this type of flowers is correlated to the expression of F3'H. Currently in plant

  7. Gene expression

    International Nuclear Information System (INIS)

    Hildebrand, C.E.; Crawford, B.D.; Walters, R.A.; Enger, M.D.

    1983-01-01

    We prepared probes for isolating functional pieces of the metallothionein locus. The probes enabled a variety of experiments, eventually revealing two mechanisms for metallothionein gene expression, the order of the DNA coding units at the locus, and the location of the gene site in its chromosome. Once the switch regulating metallothionein synthesis was located, it could be joined by recombinant DNA methods to other, unrelated genes, then reintroduced into cells by gene-transfer techniques. The expression of these recombinant genes could then be induced by exposing the cells to Zn 2+ or Cd 2+ . We would thus take advantage of the clearly defined switching properties of the metallothionein gene to manipulate the expression of other, perhaps normally constitutive, genes. Already, despite an incomplete understanding of how the regulatory switch of the metallothionein locus operates, such experiments have been performed successfully

  8. In vitro and in vivo MMP gene expression localisation by In Situ-RT-PCR in cell culture and paraffin embedded human breast cancer cell line xenografts

    International Nuclear Information System (INIS)

    Haupt, Larisa M; Thompson, Erik W; Trezise, Ann EO; Irving, Rachel E; Irving, Michael G; Griffiths, Lyn R

    2006-01-01

    Members of the matrix metalloproteinase (MMP) family of proteases are required for the degradation of the basement membrane and extracellular matrix in both normal and pathological conditions. In vitro, MT1-MMP (MMP-14, membrane type-1-MMP) expression is higher in more invasive human breast cancer (HBC) cell lines, whilst in vivo its expression has been associated with the stroma surrounding breast tumours. MMP-1 (interstitial collagenase) has been associated with MDA-MB-231 invasion in vitro, while MMP-3 (stromelysin-1) has been localised around invasive cells of breast tumours in vivo. As MMPs are not stored intracellularly, the ability to localise their expression to their cells of origin is difficult. We utilised the unique in situ-reverse transcription-polymerase chain reaction (IS-RT-PCR) methodology to localise the in vitro and in vivo gene expression of MT1-MMP, MMP-1 and MMP-3 in human breast cancer. In vitro, MMP induction was examined in the MDA-MB-231 and MCF-7 HBC cell lines following exposure to Concanavalin A (Con A). In vivo, we examined their expression in archival paraffin embedded xenografts derived from a range of HBC cell lines of varied invasive and metastatic potential. Mouse xenografts are heterogenous, containing neoplastic human parenchyma with mouse stroma and vasculature and provide a reproducible in vivo model system correlated to the human disease state. In vitro, exposure to Con A increased MT1-MMP gene expression in MDA-MB-231 cells and decreased MT1-MMP gene expression in MCF-7 cells. MMP-1 and MMP-3 gene expression remained unchanged in both cell lines. In vivo, stromal cells recruited into each xenograft demonstrated differences in localised levels of MMP gene expression. Specifically, MDA-MB-231, MDA-MB-435 and Hs578T HBC cell lines are able to influence MMP gene expression in the surrounding stroma. We have demonstrated the applicability and sensitivity of IS-RT-PCR for the examination of MMP gene expression both in vitro and in

  9. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris (Hemiptera, Aphidiae.

    Directory of Open Access Journals (Sweden)

    Chunxiao Yang

    Full Text Available To facilitate gene expression study and obtain accurate qRT-PCR analysis, normalization relative to stable expressed housekeeping genes is required. In this study, expression profiles of 11 candidate reference genes, including actin (Actin, elongation factor 1 α (EF1A, TATA-box-binding protein (TATA, ribosomal protein L12 (RPL12, β-tubulin (Tubulin, NADH dehydrogenase (NADH, vacuolar-type H+-ATPase (v-ATPase, succinate dehydrogenase B (SDHB, 28S ribosomal RNA (28S, 16S ribosomal RNA (16S, and 18S ribosomal RNA (18S from the pea aphid Acyrthosiphon pisum, under different developmental stages and temperature conditions, were investigated. A total of four analytical tools, geNorm, Normfinder, BestKeeper, and the ΔCt method, were used to evaluate the suitability of these genes as endogenous controls. According to RefFinder, a web-based software tool which integrates all four above-mentioned algorithms to compare and rank the reference genes, SDHB, 16S, and NADH were the three most stable house-keeping genes under different developmental stages and temperatures. This work is intended to establish a standardized qRT-PCR protocol in pea aphid and serves as a starting point for the genomics and functional genomics research in this emerging insect model.

  10. A probe-based qRT-PCR method to profile immunological gene expression in blood of captive beluga whales (Delphinapterus leucas

    Directory of Open Access Journals (Sweden)

    Ming-An Tsai

    2017-09-01

    Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.

  11. Altered Gene Expression by Low-Dose Arsenic Exposure in Humans and Cultured Cardiomyocytes: Assessment by Real-Time PCR Arrays

    Directory of Open Access Journals (Sweden)

    Judy Mumford

    2011-06-01

    Full Text Available Chronic arsenic exposure results in higher risk of skin, lung, and bladder cancer, as well as cardiovascular disease and diabetes. The purpose of this study was to investigate the effects on expression of selected genes in the blood lymphocytes from 159 people exposed chronically to arsenic in their drinking water using a novel RT-PCR TaqMan low-density array (TLDA. We found that expression of tumor necrosis factor-α (TNF-α, which activates both inflammation and NF-κB-dependent survival pathways, was strongly associated with water and urinary arsenic levels. Expression of KCNA5, which encodes a potassium ion channel protein, was positively associated with water and toe nail arsenic levels. Expression of 2 and 11 genes were positively associated with nail and urinary arsenic, respectively. Because arsenic exposure has been reported to be associated with long QT intervals and vascular disease in humans, we also used this TLDA for analysis of gene expression in human cardiomyocytes exposed to arsenic in vitro. Expression of the ion-channel genes CACNA1, KCNH2, KCNQ1 and KCNE1 were down-regulated by 1-mM arsenic. Alteration of some common pathways, including those involved in oxidative stress, inflammatory signaling, and ion-channel function, may underlay the seemingly disparate array of arsenic-associated diseases, such as cancer, cardiovascular disease, and diabetes.

  12. Temporal changes in gene expression in the liver of male plaice (Pleuronectes platessa) in response to exposure to ethynyl oestradiol analysed by macroarray and Real-Time PCR

    International Nuclear Information System (INIS)

    Brown, Margaret; Robinson, Craig; Davies, Ian M.; Moffat, Colin F.; Redshaw, John; Craft, John A.

    2004-01-01

    Suppression subtractive hybridisation (SSH) was used to generate cDNA libraries representing genes differentially-expressed in liver from male plaice (Pleuronectes platessa) exposed to ethynyl oestradiol (EE2). BLAST analysis and alignments of the clones with database sequence suggested at least three vitellogenin (VTG) genes and three zona radiata protein (ZRP) genes were represented. Clones with unique sequence (62 up-, 13 down-regulated) were arrayed as probes on nylon membranes to investigate temporal expression of oestrogen-responsive genes in experimental animals. Arrays were hybridised with radiolabelled cDNAs prepared from hepatic mRNA from animals treated with EE2 for various times upto 21 days and from treated animals transferred to clean water for upto a further 31 days. By day 21 of treatment 11 out of 17 probes from unidentified genes, 21/22 VTG, 13/14 ZRP, 2/2 liver aspartic proteinase (LAP) and 8/10 other gene sequences were induced by EE2 exposure. Of the down-regulated sequences, only three showed significant, decreased expression and these encode cytochrome b and two with cryptic functions. Based on the pattern of temporal response the up-regulated probes fell into two classes. Pattern A reached maximum expression by day 16 of exposure and then declined prior to removal of EE2 at 21 days. Pattern B genes reached maximal expression between day 16 and 22, declining only after removal of EE2. Independent investigation of the expression patterns of selected probes using quantitative Real-Time PCR reproduced the distinctive patterns. The results indicate a previously unrecognised mechanism for oestrogenic toxicity in which there is a selective down-regulation of some egg proteins, potentially diminishing the quality of eggs and this may contribute to reproductive failure described elsewhere

  13. Differentially expressed genes of Tetrahymena thermophila in response to tributyltin (TBT) identified by suppression subtractive hybridization and real time quantitative PCR.

    Science.gov (United States)

    Feng, Lifang; Miao, Wei; Wu, Yuxuan

    2007-02-15

    Tributyltin (TBT) is widely used as antifouling paints, agriculture biocides, and plastic stabilizers around the world, resulting in great pollution problem in aquatic environments. However, it has been short of the biomonitor to detect TBT in freshwater. We constructed the suppression subtractive hybridization library of Tetrahymena thermophila exposed to TBT, and screened out 101 Expressed Sequence Tags whose expressions were significantly up- or down-regulated with TBT treatment. From this, a series of genes related to the TBT toxicity were discovered, such as glutathione-S-transferase gene (down-regulated), plasma membrane Ca2+ ATPase isoforms 3 gene (up-regulated) and NgoA (up-regulated). Furthermore, their expressions under different concentrations of TBT treatment (0.5-40 ppb) were detected by real time fluorescent quantitative PCR. The differentially expressed genes of T. thermophila in response to TBT were identified, which provide the basic to make Tetrahymena as a sensitive, rapid and convenient TBT biomonitor in freshwater based on rDNA inducible expression system.

  14. Development of a new comprehensive and reliable endometrial receptivity map (ER Map/ER Grade) based on RT-qPCR gene expression analysis.

    Science.gov (United States)

    Enciso, M; Carrascosa, J P; Sarasa, J; Martínez-Ortiz, P A; Munné, S; Horcajadas, J A; Aizpurua, J

    2018-02-01

    Is it possible to determine the receptivity status of an endometrium by combined quantitative reverse transcription PCR (RT-qPCR) expression analysis of genes involved in endometrial proliferation and immunity? The new ER Map®/ER Grade® test can predict endometrial receptivity status by RT-qPCR using a new panel of genes involved in endometrial proliferation and the maternal immune response associated to embryonic implantation. The human endometrium reaches a receptive status adequate for embryonic implantation around Days 19-21 of the menstrual cycle. During this period, known as the window of implantation (WOI), the endometrium shows a specific gene expression profile suitable for endometrial function evaluation. The number of molecular diagnostic tools currently available to characterize this process is very limited. In this study, a new system for human endometrial receptivity evaluation was optimized and presented for the first time. ER Map®/ER Grade® validation was achieved on 312 endometrial samples including fertile women and patients undergoing fertility treatment between July 2014 and March 2016. Expression analyses of 184 genes involved in endometrial receptivity and immune response were performed. Samples were additionally tested with an independent endometrial receptivity test. A total of 96 fertile women and 120 assisted reproduction treatment (ART) patients participated in the study. Endometrial biopsy samples were obtained at LH + 2 and LH + 7 days in fertile subjects in a natural cycle and at the window of implantation (WOI) in patients in a hormone-replacement therapy (HRT) cycle. Total RNA was purified, quality-checked and reverse-transcribed. Gene expression was quantified by high-throughput RT-qPCR and statistically analyzed. Informative genes were selected and used to classify samples into four different groups of endometrial receptivity status. Significantly different gene expression levels were found in 85 out of 184 selected genes when

  15. Multiway real-time PCR gene expression profiling in yeast. Saccharomyces cerevisiae reveals altered transcriptional response of ADH-genes to glucose stimuli

    Czech Academy of Sciences Publication Activity Database

    Stahlberg, A.; Elbing, K.; Andrade-Garda, J.M.; Sjögreen, B.; Forootan, A.; Kubista, Mikael

    2008-01-01

    Roč. 9, č. 170 (2008), s. 1-41 ISSN 1471-2164 Institutional research plan: CEZ:AV0Z50520701 Keywords : Expression Profiling * Real-time PCR * Yeast Subject RIV: EI - Biotechnology ; Bionics Impact factor: 3.926, year: 2008

  16. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  17. Expressão dos genes nodC, nodW e nopP em Bradyrhizobium japonicum estirpe CPAC 15 avaliada por RT-qPCR Expression of nodC, nodW and nopP genes in Bradyrhizobium japonicum CPAC 15 strain evaluated by RT-qPCR

    Directory of Open Access Journals (Sweden)

    Simone Bortolan

    2009-11-01

    Full Text Available O objetivo deste trabalho foi avaliar a expressão, por RT-qPCR, dos genes de nodulação nodC e nodW e do gene nopP da estirpe CPAC 15, que provavelmente atuam na infecção das raízes da soja. Foram realizados dois experimentos. No primeiro, a expressão dos genes foi avaliada nas células após a incubação com genisteína por 15 min, 1, 4 e 8 horas. Os resultados revelaram que os três genes apresentaram maior expressão imediatamente após o contato com o indutor (15 min. No segundo experimento, a bactéria foi cultivada na presença de indutores (genisteína ou exsudatos de sementes de soja por 48 horas. A expressão dos três genes foi maior na presença de genisteína, com valores de expressão para nodC, nodW e nopP superiores ao controle. Os resultados obtidos confirmam a funcionalidade dos três genes na estirpe CPAC 15, com ênfase para o nopP, cuja funcionalidade em Bradyrhizobium japonicum foi descrita pela primeira vez.The objective of this work was to evaluate, by RT-qPCR, the expression of the nodC and nodW nodulation genes and of the nopP gene of the CPAC 15 strain, which probably play a role in the infection of soybean roots. Two experiments were done. In the first, the gene expression was evaluated in cells after incubation with genistein for 15 min, 1, 4 and 8 hours. Results showed that the three genes showed higher expression immediately after contact with the inducer (15 min. In the second experiment, the bacterium was grown in the presence of inducers (genistein or soybean seed exudates for 48 hours. The expression of the three genes was greater when induced by genistein, and the expression of nodC, nodW and nopP had higher values than the control. The results confirm the functionality of the three genes in the CPAC 15 strain, with an emphasis on the nopP, whose functionality in Bradyrhizobium japonicum was described for the first time.

  18. Gene expression profiling of acute myeloid leukemia samples from adult patients with AML-M1 and -M2 through boutique microarrays, real-time PCR and droplet digital PCR.

    Science.gov (United States)

    Handschuh, Luiza; Kaźmierczak, Maciej; Milewski, Marek C; Góralski, Michał; Łuczak, Magdalena; Wojtaszewska, Marzena; Uszczyńska-Ratajczak, Barbara; Lewandowski, Krzysztof; Komarnicki, Mieczysław; Figlerowicz, Marek

    2018-03-01

    Acute myeloid leukemia (AML) is the most common and severe form of acute leukemia diagnosed in adults. Owing to its heterogeneity, AML is divided into classes associated with different treatment outcomes and specific gene expression profiles. Based on previous studies on AML, in this study, we designed and generated an AML-array containing 900 oligonucleotide probes complementary to human genes implicated in hematopoietic cell differentiation and maturation, proliferation, apoptosis and leukemic transformation. The AML-array was used to hybridize 118 samples from 33 patients with AML of the M1 and M2 subtypes of the French-American‑British (FAB) classification and 15 healthy volunteers (HV). Rigorous analysis of the microarray data revealed that 83 genes were differentially expressed between the patients with AML and the HV, including genes not yet discussed in the context of AML pathogenesis. The most overexpressed genes in AML were STMN1, KITLG, CDK6, MCM5, KRAS, CEBPA, MYC, ANGPT1, SRGN, RPLP0, ENO1 and SET, whereas the most underexpressed genes were IFITM1, LTB, FCN1, BIRC3, LYZ, ADD3, S100A9, FCER1G, PTRPE, CD74 and TMSB4X. The overexpression of the CPA3 gene was specific for AML with mutated NPM1 and FLT3. Although the microarray-based method was insufficient to differentiate between any other AML subgroups, quantitative PCR approaches enabled us to identify 3 genes (ANXA3, S100A9 and WT1) whose expression can be used to discriminate between the 2 studied AML FAB subtypes. The expression levels of the ANXA3 and S100A9 genes were increased, whereas those of WT1 were decreased in the AML-M2 compared to the AML-M1 group. We also examined the association between the STMN1, CAT and ABL1 genes, and the FLT3 and NPM1 mutation status. FLT3+/NPM1- AML was associated with the highest expression of STMN1, and ABL1 was upregulated in FLT3+ AML and CAT in FLT3- AML, irrespectively of the NPM1 mutation status. Moreover, our results indicated that CAT and WT1

  19. Microgravity validation of a novel system for RNA isolation and multiplex quantitative real time PCR analysis of gene expression on the International Space Station.

    Directory of Open Access Journals (Sweden)

    Macarena Parra

    Full Text Available The International Space Station (ISS National Laboratory is dedicated to studying the effects of space on life and physical systems, and to developing new science and technologies for space exploration. A key aspect of achieving these goals is to operate the ISS National Lab more like an Earth-based laboratory, conducting complex end-to-end experimentation, not limited to simple microgravity exposure. Towards that end NASA developed a novel suite of molecular biology laboratory tools, reagents, and methods, named WetLab-2, uniquely designed to operate in microgravity, and to process biological samples for real-time gene expression analysis on-orbit. This includes a novel fluidic RNA Sample Preparation Module and fluid transfer devices, all-in-one lyophilized PCR assays, centrifuge, and a real-time PCR thermal cycler. Here we describe the results from the WetLab-2 validation experiments conducted in microgravity during ISS increment 47/SPX-8. Specifically, quantitative PCR was performed on a concentration series of DNA calibration standards, and Reverse Transcriptase-quantitative PCR was conducted on RNA extracted and purified on-orbit from frozen Escherichia coli and mouse liver tissue. Cycle threshold (Ct values and PCR efficiencies obtained on-orbit from DNA standards were similar to Earth (1 g controls. Also, on-orbit multiplex analysis of gene expression from bacterial cells and mammalian tissue RNA samples was successfully conducted in about 3 h, with data transmitted within 2 h of experiment completion. Thermal cycling in microgravity resulted in the trapping of gas bubbles inside septa cap assay tubes, causing small but measurable increases in Ct curve noise and variability. Bubble formation was successfully suppressed in a rapid follow-up on-orbit experiment using standard caps to pressurize PCR tubes and reduce gas release during heating cycles. The WetLab-2 facility now provides a novel operational on-orbit research capability for

  20. A PCR-aided transcript titration assay revealing very low expression of a gene at band 3p21 in 33 cells lines derived from all types of lung cancer

    NARCIS (Netherlands)

    Kok, K; Buchhagen, D L; Carritt, B; Buys, C H; van den Berg, Anke

    1993-01-01

    We have developed a general PCR-based method to quantify the amount of a specific mRNA present in a given cell line or tissue. We applied this quantitative PCR to analyse the expression of D8, a human gene which we recently identified in the chromosomal region 3p21, the common deletion region of

  1. Expression patterns of WRKY genes in di-haploid Populus simonii × P. nigra in response to salinity stress revealed by quantitative real-time PCR and RNA sequencing.

    Science.gov (United States)

    Wang, Shengji; Wang, Jiying; Yao, Wenjing; Zhou, Boru; Li, Renhua; Jiang, Tingbo

    2014-10-01

    Spatio-temporal expression patterns of 13 out of 119 poplar WRKY genes indicated dynamic and tissue-specific roles of WRKY family proteins in salinity stress tolerance. To understand the expression patterns of poplar WRKY genes under salinity stress, 51 of the 119 WRKY genes were selected from di-haploid Populus simonii × P. nigra by quantitative real-time PCR (qRT-PCR). We used qRT-PCR to profile the expression of the top 13 genes under salinity stress across seven time points, and employed RNA-Seq platforms to cross-validate it. Results demonstrated that all the 13 WRKY genes were expressed in root, stem, and leaf tissues, but their expression levels and overall patterns varied notably in these tissues. Regarding overall gene expression in roots, the 13 genes were significantly highly expressed at all six time points after the treatment, reaching the plateau of expression at hour 9. In leaves, the 13 genes were similarly up-regulated from 3 to 12 h in response to NaCl treatment. In stems, however, expression levels of the 13 genes did not show significant changes after the NaCl treatment. Regarding individual gene expression across the time points and the three tissues, the 13 genes can be classified into three clusters: the lowly expressed Cluster 1 containing PthWRKY28, 45 and 105; intermediately expressed Clusters 2 including PthWRKY56, 88 and 116; and highly expressed Cluster 3 consisting of PthWRKY41, 44, 51, 61, 62, 75 and 106. In general, genes in Cluster 2 and 3 displayed a dynamic pattern of "induced amplification-recovering", suggesting that these WRKY genes and corresponding pathways may play a critical role in mediating salt response and tolerance in a dynamic and tissue-specific manner.

  2. RAP-PCR fingerprinting reveals time-dependent expression of development-related genes following differentiation process of Bacillus thuringiensis

    Czech Academy of Sciences Publication Activity Database

    Huang, T.; Yu, X.; Gelbič, Ivan; Guan, X.

    2015-01-01

    Roč. 61, č. 9 (2015), s. 683-690 ISSN 0008-4166 Institutional support: RVO:60077344 Keywords : Bacillus thuringiensis * development * RNA arbitrarily primed PCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.335, year: 2015

  3. Gene expression profile and immunological evaluation of unique hypothetical unknown proteins of Mycobacterium leprae by using quantitative real-time PCR.

    Science.gov (United States)

    Kim, Hee Jin; Prithiviraj, Kalyani; Groathouse, Nathan; Brennan, Patrick J; Spencer, John S

    2013-02-01

    The cell-mediated immunity (CMI)-based in vitro gamma interferon release assay (IGRA) of Mycobacterium leprae-specific antigens has potential as a promising diagnostic means to detect those individuals in the early stages of M. leprae infection. Diagnosis of leprosy is a major obstacle toward ultimate disease control and has been compromised in the past by the lack of specific markers. Comparative bioinformatic analysis among mycobacterial genomes identified potential M. leprae-specific proteins called "hypothetical unknowns." Due to massive gene decay and the prevalence of pseudogenes, it is unclear whether any of these proteins are expressed or are immunologically relevant. In this study, we performed cDNA-based quantitative real-time PCR to investigate the expression status of 131 putative open reading frames (ORFs) encoding hypothetical unknowns. Twenty-six of the M. leprae-specific antigen candidates showed significant levels of gene expression compared to that of ESAT-6 (ML0049), which is an important T cell antigen of low abundance in M. leprae. Fifteen of 26 selected antigen candidates were expressed and purified in Escherichia coli. The seroreactivity to these proteins of pooled sera from lepromatous leprosy patients and cavitary tuberculosis patients revealed that 9 of 15 recombinant hypothetical unknowns elicited M. leprae-specific immune responses. These nine proteins may be good diagnostic reagents to improve both the sensitivity and specificity of detection of individuals with asymptomatic leprosy.

  4. Evaluation of the CBL family gene expression under drought stress and virus attack in two susceptible and drought tolerant tomato cultivars using semi-quantitative PCR analysis

    Directory of Open Access Journals (Sweden)

    Peyman Aghaie

    2017-08-01

    Full Text Available Eleven genes encoding Calcineurin B-Like proteins with a high degree of sequence conservation were identified using bioinformatics approaches in tomato. These proteins classified into five clusters including SlCBL1, SlCBL3, SlCBL4, SlCBL8 and SlCBL10 using orthology-based method of nomenclature. Sequence analysis showed that all five members of SlCBL1 and SlCBL4 contained a myristoylation conserved motif (MGXXXS/T at their N-terminals. Semi-quantitative RT-PCR showed that among the SlCBL1 members, SlCBL1-3 up-regulated under both drought and virus stresses, as well as the combined treatment. Although, both SlCBL3-1 and SlCBL3-2 up-regulated under both drought and virus stresses in both susceptive and resistant cultivars, the combined stress did not have any additional effect on the expression. Among SlCBL4 members, only SlCBL4-1 up-regulated under drought or virus attack. There was a diverse pattern of expression between the two SlCBL8 members under different stresses in both cultivars. SlCBL10 showed no change in expression pattern under drought or virus stresses in susceptive cultivar and this gene showed to be up-regulated under drought in resistant cultivar. Overall, it was concluded that changes in the expression pattern of CBL genes under biotic and abiotic stresses seemingly induced various CBL/CIPK patways in suseptive or resistant plants.

  5. The normally expressed kappa immunoglobulin light chain gene repertoire and somatic mutations studied by single-sided specific polymerase chain reaction (PCR); frequent occurrence of features often assigned to autoimmunity

    DEFF Research Database (Denmark)

    Juul, L; Hougs, L; Andersen, V

    1997-01-01

    The expressed human kappa light chain gene repertoire utilized by healthy individuals was studied by two different single-sided specific PCR techniques to avoid bias for certain V genes. A total of 103 rearranged kappa sequences from peripheral blood mononuclear cells from healthy individuals were...

  6. Tissue- and cell-specific expression of metallothionein genes in cadmium- and copper-exposed mussels analyzed by in situ hybridization and RT-PCR

    International Nuclear Information System (INIS)

    Zorita, I.; Bilbao, E.; Schad, A.; Cancio, I.; Soto, M.; Cajaraville, M.P.

    2007-01-01

    Metallothioneins (MTs) are metal-inducible proteins that can be used as biomarkers of metal exposure. In mussels two families of MT isoforms (MT10 and MT20) have been characterized. In this study, mussels (Mytilus galloprovincialis) were exposed to 200 ppb Cd and 40 ppb Cu for 2 and 9 days to characterize the tissue and isoform specificity of metal-induced MT expression. Non-radioactive in situ hybridization demonstrated that both MT isoforms were mainly transcribed in digestive tubule epithelial cells, especially in basophilic cells. Weaker MT expression was detected in non-ciliated duct cells, stomach and gill epithelial cells, haemocytes, adipogranular cells, spermatic follicles and oocytes. RT-PCR resulted in cloning of a novel M. galloprovincialis isoform homologous to recently cloned Mytilus edulis intron-less MT10B isoform. In gills, Cd only affected MT10 gene expression after 2 days of exposure while increases in MT protein levels occurred at day 9. In the digestive gland, a marked increase of both isoforms, but especially of MT20, was accompanied by increased levels of MT proteins and basophilic cell volume density (Vv BAS ) after 2 and 9 days and of intralysosomal metal accumulation in digestive cells after 9 days. Conversely, although metal was accumulated in digestive cells lysosomes and the Vv BAS increased in Cu-exposed mussels, Cu exposure did not produce an increase of MT gene expression or MT protein levels. These data suggest that MTs are expressed in a tissue-, cell- and isoform-specific way in response to different metals

  7. Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus plantarum 423, monitored with real-time PCR.

    Science.gov (United States)

    Ramiah, K; van Reenen, C A; Dicks, L M T

    2007-05-30

    Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA by Lactobacillus plantarum 423, grown in the presence of bile, pancreatin and at low pH, was studied by real-time PCR. Mub, MapA and EF-Tu were up-regulated in the presence of mucus, proportional to increasing concentrations. Expression of MapA was up-regulated in the presence of 3.0 g/l bile and 3.0 g/l pancreatin at pH 6.5. Similar results were recorded in the presence of 10.0 g/l bile and 10.0 g/l pancreatin at pH 6.5. Expression of Mub was down-regulated in the presence of bile and pancreatin, whilst the expression of EF-Tu and plaA remained unchanged. Expression of Mub and MapA remained unchanged at pH 4.0, whilst expression of EF-Tu and plaA were up-regulated. Expression of MapA was down-regulated in the presence of 1.0 g/l l-cysteine HCl, suggesting that the gene is regulated by transcription attenuation that involves cysteine.

  8. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Science.gov (United States)

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Validation of reference genes for normalization of qPCR mRNA expression levels in Staphylococcus aureus exposed to osmotic and lactic acid stress conditions encountered during food production and preservation.

    Science.gov (United States)

    Sihto, Henna-Maria; Tasara, Taurai; Stephan, Roger; Johler, Sophia

    2014-07-01

    Staphylococcus aureus represents the most prevalent cause of food-borne intoxications worldwide. While being repressed by competing bacteria in most matrices, this pathogen exhibits crucial competitive advantages during growth at high salt concentrations or low pH, conditions frequently encountered in food production and preservation. We aimed to identify reference genes that could be used to normalize qPCR mRNA expression levels during growth of S. aureus in food-related osmotic (NaCl) and acidic (lactic acid) stress adaptation models. Expression stability of nine housekeeping genes was evaluated in full (LB) and nutrient-deficient (CYGP w/o glucose) medium under conditions of osmotic (4.5% NaCl) and acidic stress (lactic acid, pH 6.0) after 2-h exposure. Among the set of candidate reference genes investigated, rplD, rpoB,gyrB, and rho were most stably expressed in LB and thus represent the most suitable reference genes for normalization of qPCR data in osmotic or lactic acid stress models in a rich medium. Under nutrient-deficient conditions, expression of rho and rpoB was highly stable across all tested conditions. The presented comprehensive data on changes in expression of various S. aureus housekeeping genes under conditions of osmotic and lactic acid stress facilitate selection of reference genes for qPCR-based stress response models. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  10. Selection of reference genes for quantitative real-time PCR expression studies of microdissected reproductive tissues in apomictic and sexual Boechera

    Directory of Open Access Journals (Sweden)

    Amiteye Samuel

    2011-08-01

    Full Text Available Abstract Background Apomixis, a natural form of asexual seed production in plants, is considered to have great biotechnological potential for agriculture. It has been hypothesised that de-regulation of the sexual developmental pathway could trigger apomictic reproduction. The genus Boechera represents an interesting model system for understanding apomixis, having both sexual and apomictic genotypes at the diploid level. Quantitative qRT-PCR is the most extensively used method for validating genome-wide gene expression analyses, but in order to obtain reliable results, suitable reference genes are necessary. In this work we have evaluated six potential reference genes isolated from a 454 (FLX derived cDNA library of Boechera. RNA from live microdissected ovules and anthers at different developmental stages, as well as vegetative tissues of apomictic and sexual Boechera, were used to validate the candidates. Results Based on homologies with Arabidopsis, six genes were selected from a 454 cDNA library of Boechera: RPS18 (Ribosomal sub protein 18, Efalpha1 (Elongation factor 1 alpha, ACT 2 (Actin2, UBQ (polyubiquitin, PEX4 (Peroxisomal ubiquitin conjugating enzyme and At1g09770.1 (Arabidopsis thaliana cell division cycle 5. Total RNA was extracted from 17 different tissues, qRT-PCRs were performed, and raw Ct values were analyzed for primer efficiencies and gene ratios. The geNorm and normFinder applications were used for selecting the most stable genes among all tissues and specific tissue groups (ovule, anthers and vegetative tissues in both apomictic and sexual plants separately. Our results show that BoechRPS18, BoechEfα1, BoechACT2 and BoechUBQ were the most stable genes. Based on geNorm, the combinations of BoechRPS18 and BoechEfα1 or BoechUBQ and BoechEfα1 were the most stable in the apomictic plant, while BoechRPS18 and BoechACT2 or BoechUBQ and BoechACT2 performed best in the sexual plant. When subgroups of tissue samples were analyzed

  11. A comparative expression analysis of gene transcripts in brain tissue of non-transgenic and GH-transgenic zebrafish (Danio rerio using a DDRT-PCR approach

    Directory of Open Access Journals (Sweden)

    Fernanda A. Alves-Costa

    2012-06-01

    Full Text Available The presence of higher level of exogenous growth hormone (GH in transgenic animals could lead to several physiological alterations. A GH transgenic zebrafish (Danio rerio line was compared to nontransgenic (NT samples of the species through a DDRT-PCR approach, with the goal of identifying candidate differentially expressed transcripts in brain tissues that could be involved in GH overexpression. Densitometric analyses of two selected amplification products, p300 and ADCY2, pointed to a significant lower gene expression in the transgenic zebrafish (104.02 ± 57.71; 224.10 ± 91.73 when compared to NT samples (249.75 ± 30.08; 342.95 ± 65.19. The present data indicate that p300 and ADCY2 are involved in a regulation system for GH when high circulating levels of this hormone are found in zebrafishes.A presença de níveis mais elevados do hormônio de crescimento (GH em animais transgênicos poderia levar a várias alterações fisiológicas. Uma linhagem transgênica de paulistinha (Danio rerio para o GH foi comparada com amostras não transgênicas (NT desta espécie, através de uma abordagem de DDRT-PCR, com o objetivo de identificar transcritos candidatos diferencialmente expressos em tecido cerebral que poderiam estar envolvidos na superexpressão de GH. Análises densitométricas de dois produtos de amplificação selecionados, p300 e ADCY2, apontaram uma expressão gênica significativamente menor nas amostras transgênicas de paulistinha (104.02 ± 57.71; 224.10 ± 91.73, quando comparadas com as amostras NT (249.75 ± 30.08; 342.95±65.19. Os presentes dados indicam que p300 e ADCY2 estão envolvidos em um sistema de regulação do GH, quando altos níveis circulantes desse hormônio são encontrados em paulistinha.

  12. Use of quantitative real time PCR for a genome-wide study of AYWB phytoplasma gene expression in plant and insect hosts

    DEFF Research Database (Denmark)

    Makarova, Olga; MacLean, Allyson M.; Hogenhout, Saskia A.

    2011-01-01

    this technique for reliable gene expression quantification of phytoplasmas on a large scale. In our experimental setup, 242 genes of aster yellows phytoplasma strain witches' broom (AY-WB) were tested for differences in expression in plant and insect host environments, and were shown to be predominantly...

  13. Selection and evaluation of reference genes for RT-qPCR expression studies on Burkholderia tropica strain Ppe8, a sugarcane-associated diazotrophic bacterium grown with different carbon sources or sugarcane juice.

    Science.gov (United States)

    da Silva, Paula Renata Alves; Vidal, Marcia Soares; de Paula Soares, Cleiton; Polese, Valéria; Simões-Araújo, Jean Luís; Baldani, José Ivo

    2016-11-01

    Among the members of the genus Burkholderia, Burkholderia tropica has the ability to fix nitrogen and promote sugarcane plant growth as well as act as a biological control agent. There is little information about how this bacterium metabolizes carbohydrates as well as those carbon sources found in the sugarcane juice that accumulates in stems during plant growth. Reverse transcription quantitative PCR (RT-qPCR) can be used to evaluate changes in gene expression during bacterial growth on different carbon sources. Here we tested the expression of six reference genes, lpxC, gyrB, recA, rpoA, rpoB, and rpoD, when cells were grown with glucose, fructose, sucrose, mannitol, aconitic acid, and sugarcane juice as carbon sources. The lpxC, gyrB, and recA were selected as the most stable reference genes based on geNorm and NormFinder software analyses. Validation of these three reference genes during strain Ppe8 growth on the same carbon sources showed that genes involved in glycogen biosynthesis (glgA, glgB, glgC) and trehalose biosynthesis (treY and treZ) were highly expressed when Ppe8 was grown in aconitic acid relative to other carbon sources, while otsA expression (trehalose biosynthesis) was reduced with all carbon sources. In addition, the expression level of the ORF_6066 (gluconolactonase) gene was reduced on sugarcane juice. The results confirmed the stability of the three selected reference genes (lpxC, gyrB, and recA) during the RT-qPCR and also their robustness by evaluating the relative expression of genes involved in glycogen and trehalose biosynthesis when strain Ppe8 was grown on different carbon sources and sugarcane juice.

  14. Real-time quantitative reverse transcription-PCR analysis of expression stability of Actinobacillus pleuropneumoniae housekeeping genes during in vitro growth under iron-depleted conditions

    DEFF Research Database (Denmark)

    Nielsen, K. K.; Boye, Mette

    2005-01-01

    up-regulation under iron-restricted conditions compared to bacteria grown in medium with sufficient iron. The observed expression patterns of the genes of interest were consistent with previous observations. This study therefore lends further support to the use of real-time quantitative RT...... controls, as such controls have not been defined yet for this bacterium. Bacterial gene expression was studied during in vitro exponential and early stationary growth in medium with and without sufficient iron, respectively. First, the stability of expression of five genes, the glyA, tpiA, pykA, rec......F, and rhoAP genes involved in basic housekeeping, was evaluated on the basis of the mean pairwise variation. All the housekeeping genes included were stably expressed under the conditions investigated and consequently were included in the normalization procedure. Next, the geometric mean of the internal...

  15. Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

    Science.gov (United States)

    Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

    2008-01-01

    Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

  16. Clinical utility of RT-PCR in assessing HER 2 gene expression versus traditional IHC and FISH in breast cancer patients.

    Science.gov (United States)

    Suryavanshi, Moushumi; Mehta, Anurag; Jaipuria, Jiten; Kumar, Dushyant; Vishwakarma, Gayatri; Panigrahi, Manoj Kumar; Verma, Haristuti; Saifi, Mumtaz; Sharma, Sanjeev; Tandon, Simran; Doval, D C; Das, Bhudev C

    2018-02-09

    IHC and FISH are used for categorizing HER 2 status in breast cancer at the protein and DNA level, respectively. HER 2 expression at the RNA level is quantitative, cheaper, easier to standardize and free from interobserver variation. 115 consecutive patients were tested by IHC, FISH and RT-PCR (test cohort). Assuming FISH result to be the response variable, ROC curves for RT-PCR ratio were analyzed to label HER 2 negative, equivocal and positive cases as RT-PCR score 1, 2 and 3, respectively. Inter-relationships between RT-PCR, IHC and FISH were defined. 'Clinical benefit' of a test was defined as proportion of patients labeled unequivocally as HER 2 positive or negative. Population for 1 year was simulated constraint to previous reports of HER 2 positivity and IHC category distribution by a meta-analysis of previous studies that evaluated concordance between IHC and FISH to determine HER 2 status (simulation cohort). Four diagnostic pathways in the simulation cohort were defined-(1) initial IHC, followed by FISH (conventional pathway); (2) initial RT-PCR, followed by FISH; (3) initial IHC, followed by RT-PCR and then by FISH; (4) initial RT-PCR, followed by IHC and then by FISH. The clinical benefit of IHC and RT-PCR in the four pathways was analyzed and sensitivity analysis for incremental cost-effectiveness ratio and cost-benefit comapring RT-PCR against IHC, both as first-line tests and among those with IHC score 2 as a reflex second-line test was performed by the Monte Carlo technique. 115 patients comprised the study population. While none with IHC score of 0 or 1 was FISH positive for HER 2, all cases with IHC score of 3 were FISH positive. 43 cases were assigned IHC score of 2. Thus, 72 patients benefited from the initial IHC testing [clinical benefit 62.6%], with the overall concordance between IHC and FISH being 100% for those with IHC score of 0, 1 and 3 (conclusive IHC categories). For RT-PCR with 100% concordance, 15.7% (115-97 = 18) patients

  17. Detection of gene expression changes in Capsicum annuum L. leaf foliar blight caused by Phytophthora capsici Leon. using qRT-PCR and leaf discs

    Science.gov (United States)

    Phytophthora capsici is responsible for multiple disease syndromes of Capsicum annuum but the resistance mechanism is still unknown. Evaluating gene expression during foliar blight can be used to identify expression patterns associated with resistance in Capsicum species. This study reports a direct...

  18. Determining Physical Mechanisms of Gene Expression Regulation from Single Cell Gene Expression Data

    OpenAIRE

    Ezer, Daphne; Moignard, Victoria; G?ttgens, Berthold; Adryan, Boris

    2016-01-01

    Many genes are expressed in bursts, which can contribute to cell-to-cell heterogeneity. It is now possible to measure this heterogeneity with high throughput single cell gene expression assays (single cell qPCR and RNA-seq). These experimental approaches generate gene expression distributions which can be used to estimate the kinetic parameters of gene expression bursting, namely the rate that genes turn on, the rate that genes turn off, and the rate of transcription. We construct a complete ...

  19. Improved soluble expression and characterization of the Hc domain of Clostridium botulinum neurotoxin serotype A in Escherichia coli by using a PCR-synthesized gene and a Trx co-expression strain.

    Science.gov (United States)

    Chen, Rongchang; Shi, Jing; Cai, Kun; Tu, Wei; Hou, Xiaojun; Liu, Hao; Xiao, Le; Wang, Qin; Tang, Yunming; Wang, Hui

    2010-05-01

    Botulinum neurotoxin serotype A (BoNT/A) is an extremely potent bacterial protein toxin. The Hc fragment of BoNT/A (AHc) was shown to be non-toxic, antigenic, and capable of eliciting a protective immunity in animals challenged with homologous BoNT. In this study, we synthesized AHc gene by using T4 DNA ligase and PCR. The AHc was expressed at a high level in Escherichia coli successfully. Because of using the Trx co-expression strain, the expressed AHc is in a soluble and active form. The yield of the purified AHc was about 70mg/L, and its purity was up to 90% through one-step affinity chromatography. The AHc was positively identified by the antibodies raised against BoNT/A using immunological-dot-blot and Western blot assays. AHc was shown to bind with gangliosides and elicit immunity against BoNT/A, indicating that the expressed and purified AHc protein retains a functionally active conformation. Furthermore, the purified AHc has a strong immunogenicity and can be used as a potential subunit candidate vaccine for botulinum toxin serotype A. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  20. Evaluation of suitable reference genes for gene expression studies ...

    Indian Academy of Sciences (India)

    2011-12-14

    Dec 14, 2011 ... MADS family of TFs control floral organ identity within each whorl of the flower by activating downstream genes. Measuring gene expression in different tissue types and developmental stages is of fundamental importance in TFs functional research. In last few years, quantitative real-time. PCR (qRT-PCR) ...

  1. Efficacy of laser capture microdissection plus RT-PCR technique in analyzing gene expression levels in human gastric cancer and colon cancer

    International Nuclear Information System (INIS)

    Makino, Hiroshi; Uetake, Hiroyuki; Danenberg, Kathleen; Danenberg, Peter V; Sugihara, Kenichi

    2008-01-01

    Thymidylate synthase, dihydropyrimidine dehydrogenase, thymidine phosphorylase, and orotate phosphoribosyltransferase gene expressions are reported to be valid predictive markers for 5-fluorouracil sensitivity to gastrointestinal cancer. For more reliable predictability, their expressions in cancer cells and stromal cells in the cancerous tissue (cancerous stroma) have been separately investigated using laser capture microdissection. Thymidylate synthase, dihydropyrimidine dehydrogenase, thymidine phosphorylase, and orotate phosphoribosyltransferase mRNA in cancer cells and cancerous stroma from samples of 47 gastric and 43 colon cancers were separately quantified by reverse transcription polymerase chain reaction after laser capture microdissection. In both gastric and colon cancers, thymidylate synthase and orotate phosphoribosyltransferase mRNA expressions were higher (p < 0.0001, p <0.0001 respectively in gastric cancer and P = 0.0002, p < 0.0001 respectively in colon cancer) and dihydropyrimidine dehydrogenase mRNA expressions were lower in cancer cells than in cancerous stroma (P = 0.0136 in gastric cancer and p < 0.0001 in colon cancer). In contrast, thymidine phosphorylase mRNA was higher in cancer cells than in cancerous stroma in gastric cancer (p < 0.0001) and lower in cancer cells than in cancerous stroma in colon cancer (P = 0.0055). By using this method, we could estimate gene expressions separately in cancer cells and stromal cells from colon and gastric cancers, in spite of the amount of stromal tissue. Our method is thought to be useful for accurately evaluating intratumoral gene expressions

  2. Differential expression analysis of boron transporters and some stress-related genes in response to 24-epibrassinolide and boron by semi-quantitative RT-PCR in Arabidopsis thaliana (L. Heynh

    Directory of Open Access Journals (Sweden)

    Surgun Yonca

    2016-01-01

    Full Text Available Plant steroidal hormones, brassinosteroids (BRs, promote plant developmental processes and enhance tolerance to several abiotic stresses including high boron (B stress. To examine the possible role of BR in high B-induced stress at the transcriptional level, we investigated the response of B transporter genes (BOR1-4, high B-induced genes (MATE, Hsp-like, BR-induced genes (Hsp70-4, Hsp90-1 and other stress-related genes (LTI/COR78, LEA4-5 upon exogenous treatments of 24-epibrassinolide (EBL on Arabidopsis thaliana (L. Heynh exposed to high concentrations of boric acid (BA using semi-quantitative RT-PCR. BA treatments led to down regulation of BOR1 and BOR3 genes in leaf and root tissues and higher concentration of EBL further decreased expression of these genes in roots. The expression of high B-induced genes was observed to be upregulated by 1 μM EBL treatment under high B stress in both tissues of the seedlings. The upregulation of BR-induced genes were clearly evident in root tissues co-treated with 1 μM EBL and BA as compared to BA alone. Higher concentration of EBL was found to be more effective in increasing expression of LTI/COR78 gene in root and LEA4-5 gene in shoot tissues. To our knowledge, this is the first report how exogenous application of EBL modulates high B stress responses at molecular level in model plant Arabidopsis thaliana.

  3. Reference Gene Screening for Analyzing Gene Expression Across Goat Tissue

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2013-12-01

    Full Text Available Real-time quantitative PCR (qRT-PCR is one of the important methods for investigating the changes in mRNA expression levels in cells and tissues. Selection of the proper reference genes is very important when calibrating the results of real-time quantitative PCR. Studies on the selection of reference genes in goat tissues are limited, despite the economic importance of their meat and dairy products. We used real-time quantitative PCR to detect the expression levels of eight reference gene candidates (18S, TBP, HMBS, YWHAZ, ACTB, HPRT1, GAPDH and EEF1A2 in ten tissues types sourced from Boer goats. The optimal reference gene combination was selected according to the results determined by geNorm, NormFinder and Bestkeeper software packages. The analyses showed that tissue is an important variability factor in genes expression stability. When all tissues were considered, 18S, TBP and HMBS is the optimal reference combination for calibrating quantitative PCR analysis of gene expression from goat tissues. Dividing data set by tissues, ACTB was the most stable in stomach, small intestine and ovary, 18S in heart and spleen, HMBS in uterus and lung, TBP in liver, HPRT1 in kidney and GAPDH in muscle. Overall, this study provided valuable information about the goat reference genes that can be used in order to perform a proper normalisation when relative quantification by qRT-PCR studies is undertaken.

  4. Detoxification and antioxidant effects of garlic and curcumin in Oreochromis niloticus injected with aflatoxin B₁ with reference to gene expression of glutathione peroxidase (GPx) by RT-PCR.

    Science.gov (United States)

    El-Barbary, Manal I

    2016-04-01

    The present study aims to investigate the effects of both garlic and curcumin through evaluating their therapeutic properties as antioxidants on liver and kidney functions, hepatic antioxidants and GPx gene expression against aflatoxicosis of O. niloticus. In total, 180 of tilapia were divided into ten groups; T1 represented the negative control fed on a basal diet, and T2 was injected with a single intraperitoneal (i.p.) dose of AFB1 (6 mg/kg b.w.). Fish in T3-T6 were fed on a basal diet supplemented with both garlic (T3 and T4) and curcumin (T5 and T6) at the two concentrations of 10 and 20 g/kg diet, respectively. Fish in T7-T10 groups were injected with AFB1 and fed on the garlic (T7 and T8) and curcumin (T9 and T10) dietaries. The results showed that AFB1 has significant potency for increasing the activity of plasma AST, ALT, creatinine and uric acid values, and hepatic MDA as well as for reducing the concentrations of plasma TP, AL, GL and hepatic activity of TAC, while AFB1 led to up-regulated GPx gene expression when compared to the control (T1). These harmful effects of AFB1 were alleviated due to the garlic and curcumin dietaries in some studied parameters. Garlic reflected the highest induction of gene expression (T7); however, curcumin showed significant down-regulated (T9). These results concluded that the effects of garlic were better than curcumin at the two concentrations and the low concentration of them is more beneficial than the high concentration when it used against AFB1 in O. niloticus.

  5. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  6. Assessing gene expression during pathogenesis: Use of qRT-PCR to follow toxin production in the entomopathogenic fungus Beauveria bassiana during infection and immune response of the insect host Triatoma infestans.

    Science.gov (United States)

    Lobo, Luciana S; Luz, Christian; Fernandes, Éverton K K; Juárez, M Patricia; Pedrini, Nicolás

    2015-06-01

    Entomopathogenic fungi secrete toxic secondary metabolites during the invasion of the insect hemocoel as part of the infection process. Although these compounds have been frequently mentioned as virulence factors, the roles of many of them remain poorly understood, including the question of whether they are expressed during the infection process. A major hurdle to this issue remains the low sensitivity of biochemical detection techniques (e.g., HPLC) within the complex samples that may contain trace quantities of fungal molecules inside the insect. In this study, quantitative reverse transcription real-time PCR (qRT-PCR) was used to measure the transcript levels within the insect fungal pathogen Beauveria bassiana, that encode for the synthetase enzymes of the secondary metabolites tenellin (BbtenS), beauvericin (BbbeaS) and bassianolide (BbbslS) during the infection of Triatoma infestans, a Chagas disease insect vector. Absolute quantification was performed at different time periods after insect treatment with various concentrations of propagules, either by immersing the insects in conidial suspensions or by injecting them with blastospores. Both BbtenS and BbbeaS were highly expressed in conidia-treated insects at days 3 and 12 post-treatment. In blastospore-injected insects, BbtenS and BbbeaS expression peaked at 24h post-injection and were also highly expressed in insect cadavers. The levels of BbbslS transcripts were much lower in all conditions tested. The expression patterns of insect genes encoding proteins that belong to the T. infestans humoral immune system were also evaluated with the same technique. This qPCR-based methodology can contribute to decifering the dynamics of entomopathogenic fungal infection at the molecular level. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  8. Identification of Reference Genes for Normalizing Quantitative Real-Time PCR in Urechis unicinctus

    Science.gov (United States)

    Bai, Yajiao; Zhou, Di; Wei, Maokai; Xie, Yueyang; Gao, Beibei; Qin, Zhenkui; Zhang, Zhifeng

    2018-06-01

    The reverse transcription quantitative real-time PCR (RT-qPCR) has become one of the most important techniques of studying gene expression. A set of valid reference genes are essential for the accurate normalization of data. In this study, five candidate genes were analyzed with geNorm, NormFinder, BestKeeper and ΔCt methods to identify the genes stably expressed in echiuran Urechis unicinctus, an important commercial marine benthic worm, under abiotic (sulfide stress) and normal (adult tissues, embryos and larvae at different development stages) conditions. The comprehensive results indicated that the expression of TBP was the most stable at sulfide stress and in developmental process, while the expression of EF- 1- α was the most stable at sulfide stress and in various tissues. TBP and EF- 1- α were recommended as a suitable reference gene combination to accurately normalize the expression of target genes at sulfide stress; and EF- 1- α, TBP and TUB were considered as a potential reference gene combination for normalizing the expression of target genes in different tissues. No suitable gene combination was obtained among these five candidate genes for normalizing the expression of target genes for developmental process of U. unicinctus. Our results provided a valuable support for quantifying gene expression using RT-qPCR in U. unicinctus.

  9. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...

  10. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    OpenAIRE

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain sampl...

  11. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  12. Validation of reference genes for RT-qPCR analysis in Herbaspirillum seropedicae.

    Science.gov (United States)

    Pessoa, Daniella Duarte Villarinho; Vidal, Marcia Soares; Baldani, José Ivo; Simoes-Araujo, Jean Luiz

    2016-08-01

    The RT-qPCR technique needs a validated set of reference genes for ensuring the consistency of the results from the gene expression. Expression stabilities for 9 genes from Herbaspirillum seropedicae, strain HRC54, grown with different carbon sources were calculated using geNorm and NormFinder, and the gene rpoA showed the best stability values. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Selection of reference genes for quantitative RT-PCR (RT-qPCR) analysis of rat tissues under physiological and toxicological conditions

    DEFF Research Database (Denmark)

    Svingen, Terje; Letting, Heidi; Hadrup, Niels

    2015-01-01

    In biological research the analysis of gene expression levels in cells and tissues can be a powerful tool to gain insights into biological processes. For this, quantitative RT-PCR (RT-qPCR) is a popular method that often involve the use of constitutively expressed endogenous reference (or...... ‘housekeeping’) gene for normalization of data. Thus, it is essential to use reference genes that have been verified to be stably expressed within the specific experimental setting. Here, we have analysed the expression stability of 12 commonly used reference genes (Actb, B2m, Gapdh, Hprt, Pgk1, Rn18s, Rpl13a...

  14. Regulation of bacterial photosynthesis genes by the small noncoding RNA PcrZ.

    Science.gov (United States)

    Mank, Nils N; Berghoff, Bork A; Hermanns, Yannick N; Klug, Gabriele

    2012-10-02

    The small RNA PcrZ (photosynthesis control RNA Z) of the facultative phototrophic bacterium Rhodobacter sphaeroides is induced upon a drop of oxygen tension with similar kinetics to those of genes for components of photosynthetic complexes. High expression of PcrZ depends on PrrA, the response regulator of the PrrB/PrrA two-component system with a central role in redox regulation in R. sphaeroides. In addition the FnrL protein, an activator of some photosynthesis genes at low oxygen tension, is involved in redox-dependent expression of this small (s)RNA. Overexpression of full-length PcrZ in R. sphaeroides affects expression of a small subset of genes, most of them with a function in photosynthesis. Some mRNAs from the photosynthetic gene cluster were predicted to be putative PcrZ targets and results from an in vivo reporter system support these predictions. Our data reveal a negative effect of PcrZ on expression of its target mRNAs. Thus, PcrZ counteracts the redox-dependent induction of photosynthesis genes, which is mediated by protein regulators. Because PrrA directly activates photosynthesis genes and at the same time PcrZ, which negatively affects photosynthesis gene expression, this is one of the rare cases of an incoherent feed-forward loop including an sRNA. Our data identified PcrZ as a trans acting sRNA with a direct regulatory function in formation of photosynthetic complexes and provide a model for the control of photosynthesis gene expression by a regulatory network consisting of proteins and a small noncoding RNA.

  15. Gene Expression Omnibus (GEO)

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene Expression Omnibus is a public functional genomics data repository supporting MIAME-compliant submissions of array- and sequence-based data. Tools are provided...

  16. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  17. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  18. Gene expression of inflammation and bone healing in peri-implant crevicular fluid after placement and loading of dental implants. A kinetic clinical pilot study using quantitative real-time PCR.

    Science.gov (United States)

    Slotte, Christer; Lennerås, Maria; Göthberg, Catharina; Suska, Felicia; Zoric, Neven; Thomsen, Peter; Nannmark, Ulf

    2012-10-01

    Early detection of healing complications after placement of dental implants is a pressing but elusive goal. This paper proposes a non-invasive diagnostic tool for monitoring healing- and peri-implant disease specific genes, complementary to clinical evaluations. Eighteen partially edentulous patients were recruited to this pilot study. Three Brånemark TiUnite® implants/patient (Nobel Biocare) were placed in a one-stage procedure. Abutments with smooth or rough (TiUnite®) surface were placed. The test group (n = 9) received fixed bridges (immediate loading), whereas the control group (n = 9) implants were loaded 3 months after surgery. In addition to clinical measurements, crevicular fluid was collected using paper strips at the implant abutments 2, 14, 28, and 90 days postoperative. mRNA was extracted, purified, and converted to cDNA. Quantitative PCR assays for IL-1β, TNF-α, Osteocalcin (OC), Alkaline Phosphatase (ALP), Cathepsin K, Tartrate Resistant Acid Phosphatase, and 18S ribosomal RNA were designed and validated. Relative gene expression levels were calculated. One implant was lost in the control group and three in the test group. In one test patient, one implant showed lowered stability after 2 to 4 weeks and was unloaded. Later implant stability improved which allowed for loading after 3 to 4 months. TNF-α and ALP most commonly showed correlation with clinical parameters followed by IL-1β and OC. The strongest correlation was found for TNF-α with clinical complications at 2 and 14 days (p = .01/r = -048, and p = .0004/r = -0.56, respectively; test and control groups together). In some cases, gene expression predicted clinical complications (TNF-α, ALP, CK). This study is based on samples from few individuals; still, some genes showed correlation with clinical findings. Further studies are needed to refine and optimize the sampling process, to find the appropriate panel, and to validate gene expression for monitoring implant healing. © 2010 Wiley

  19. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator

    Science.gov (United States)

    Quantitative real-time PCR (qRT-PCR) is a reliable and reproducible technique for measuring and evaluating changes in gene expression. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. In this study, expres...

  20. Identification of stable reference genes for quantitative PCR in cells derived from chicken lymphoid organs.

    Science.gov (United States)

    Borowska, D; Rothwell, L; Bailey, R A; Watson, K; Kaiser, P

    2016-02-01

    Quantitative polymerase chain reaction (qPCR) is a powerful technique for quantification of gene expression, especially genes involved in immune responses. Although qPCR is a very efficient and sensitive tool, variations in the enzymatic efficiency, quality of RNA and the presence of inhibitors can lead to errors. Therefore, qPCR needs to be normalised to obtain reliable results and allow comparison. The most common approach is to use reference genes as internal controls in qPCR analyses. In this study, expression of seven genes, including β-actin (ACTB), β-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-glucuronidase (GUSB), TATA box binding protein (TBP), α-tubulin (TUBAT) and 28S ribosomal RNA (r28S), was determined in cells isolated from chicken lymphoid tissues and stimulated with three different mitogens. The stability of the genes was measured using geNorm, NormFinder and BestKeeper software. The results from both geNorm and NormFinder were that the three most stably expressed genes in this panel were TBP, GAPDH and r28S. BestKeeper did not generate clear answers because of the highly heterogeneous sample set. Based on these data we will include TBP in future qPCR normalisation. The study shows the importance of appropriate reference gene normalisation in other tissues before qPCR analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Circadian expression of clock genes and clock-controlled genes in the rat retina

    NARCIS (Netherlands)

    Kamphuis, Willem; Cailotto, Cathy; Dijk, Frederike; Bergen, Arthur; Buijs, Ruud M.

    2005-01-01

    The circadian expression patterns of genes encoding for proteins that make up the core of the circadian clock were measured in rat retina using real-time quantitative PCR (qPCR). Transcript levels of several genes previously used for normalization of qPCR assays were determined and the effect of

  2. Selecting and validating reference genes for quantitative real-time PCR in Plutella xylostella (L.).

    Science.gov (United States)

    You, Yanchun; Xie, Miao; Vasseur, Liette; You, Minsheng

    2018-05-01

    Gene expression analysis provides important clues regarding gene functions, and quantitative real-time PCR (qRT-PCR) is a widely used method in gene expression studies. Reference genes are essential for normalizing and accurately assessing gene expression. In the present study, 16 candidate reference genes (ACTB, CyPA, EF1-α, GAPDH, HSP90, NDPk, RPL13a, RPL18, RPL19, RPL32, RPL4, RPL8, RPS13, RPS4, α-TUB, and β-TUB) from Plutella xylostella were selected to evaluate gene expression stability across different experimental conditions using five statistical algorithms (geNorm, NormFinder, Delta Ct, BestKeeper, and RefFinder). The results suggest that different reference genes or combinations of reference genes are suitable for normalization in gene expression studies of P. xylostella according to the different developmental stages, strains, tissues, and insecticide treatments. Based on the given experimental sets, the most stable reference genes were RPS4 across different developmental stages, RPL8 across different strains and tissues, and EF1-α across different insecticide treatments. A comprehensive and systematic assessment of potential reference genes for gene expression normalization is essential for post-genomic functional research in P. xylostella, a notorious pest with worldwide distribution and a high capacity to adapt and develop resistance to insecticides.

  3. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    DEFF Research Database (Denmark)

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results......, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected...... by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori...

  4. Novel reference genes for quantifying transcriptional responses of Escherichia coli to protein overexpression by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Zou Ruiyang

    2011-04-01

    Full Text Available Abstract Background Accurate interpretation of quantitative PCR (qPCR data requires normalization using constitutively expressed reference genes. Ribosomal RNA is often used as a reference gene for transcriptional studies in E. coli. However, the choice of reliable reference genes has not been systematically validated. The objective of this study is to identify a set of reliable reference genes for transcription analysis in recombinant protein over-expression studies in E. coli. Results In this study, the meta-analysis of 240 sets of single-channel Affymetrix microarray data representing over-expressions of 63 distinct recombinant proteins in various E. coli strains identified twenty candidate reference genes that were stably expressed across all conditions. The expression of these twenty genes and two commonly used reference genes, rrsA encoding ribosomal RNA 16S and ihfB, was quantified by qPCR in E. coli cells over-expressing four genes of the 1-Deoxy-D-Xylulose 5-Phosphate pathway. From these results, two independent statistical algorithms identified three novel reference genes cysG, hcaT, and idnT but not rrsA and ihfB as highly invariant in two E. coli strains, across different growth temperatures and induction conditions. Transcriptomic data normalized by the geometric average of these three genes demonstrated that genes of the lycopene synthetic pathway maintained steady expression upon enzyme overexpression. In contrast, the use of rrsA or ihfB as reference genes led to the mis-interpretation that lycopene pathway genes were regulated during enzyme over-expression. Conclusion This study identified cysG/hcaT/idnT to be reliable novel reference genes for transcription analysis in recombinant protein producing E. coli.

  5. ICG: a wiki-driven knowledgebase of internal control genes for RT-qPCR normalization.

    Science.gov (United States)

    Sang, Jian; Wang, Zhennan; Li, Man; Cao, Jiabao; Niu, Guangyi; Xia, Lin; Zou, Dong; Wang, Fan; Xu, Xingjian; Han, Xiaojiao; Fan, Jinqi; Yang, Ye; Zuo, Wanzhu; Zhang, Yang; Zhao, Wenming; Bao, Yiming; Xiao, Jingfa; Hu, Songnian; Hao, Lili; Zhang, Zhang

    2018-01-04

    Real-time quantitative PCR (RT-qPCR) has become a widely used method for accurate expression profiling of targeted mRNA and ncRNA. Selection of appropriate internal control genes for RT-qPCR normalization is an elementary prerequisite for reliable expression measurement. Here, we present ICG (http://icg.big.ac.cn), a wiki-driven knowledgebase for community curation of experimentally validated internal control genes as well as their associated experimental conditions. Unlike extant related databases that focus on qPCR primers in model organisms (mainly human and mouse), ICG features harnessing collective intelligence in community integration of internal control genes for a variety of species. Specifically, it integrates a comprehensive collection of more than 750 internal control genes for 73 animals, 115 plants, 12 fungi and 9 bacteria, and incorporates detailed information on recommended application scenarios corresponding to specific experimental conditions, which, collectively, are of great help for researchers to adopt appropriate internal control genes for their own experiments. Taken together, ICG serves as a publicly editable and open-content encyclopaedia of internal control genes and accordingly bears broad utility for reliable RT-qPCR normalization and gene expression characterization in both model and non-model organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Selection of reference genes for qPCR in hairy root cultures of peanut

    Directory of Open Access Journals (Sweden)

    Medrano Giuliana

    2011-10-01

    Full Text Available Abstract Background Hairy root cultures produced via Agrobacterium rhizogenes-mediated transformation have emerged as practical biological models to elucidate the biosynthesis of specialized metabolites. To effectively understand the expression patterns of the genes involved in the metabolic pathways of these compounds, reference genes need to be systematically validated under specific experimental conditions as established by the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines. In the present report we describe the first validation of reference genes for RT-qPCR in hairy root cultures of peanut which produce stilbenoids upon elicitor treatments. Results A total of 21 candidate reference genes were evaluated. Nineteen genes were selected based on previous qPCR studies in plants and two were from the T-DNAs transferred from A. rhizogenes. Nucleotide sequences of peanut candidate genes were obtained using their homologous sequences in Arabidopsis. To identify the suitable primers, calibration curves were obtained for each candidate reference gene. After data analysis, 12 candidate genes meeting standard efficiency criteria were selected. The expression stability of these genes was analyzed using geNorm and NormFinder algorithms and a ranking was established based on expression stability of the genes. Candidate reference gene expression was shown to have less variation in methyl jasmonate (MeJA treated root cultures than those treated with sodium acetate (NaOAc. Conclusions This work constitutes the first effort to validate reference genes for RT-qPCR in hairy roots. While these genes were selected under conditions of NaOAc and MeJA treatment, we anticipate these genes to provide good targets for reference genes for hairy roots under a variety of stress conditions. The lead reference genes were a gene encoding for a TATA box binding protein (TBP2 and a gene encoding a ribosomal protein (RPL8C. A

  7. Optimal Reference Genes for Gene Expression Normalization in Trichomonas vaginalis

    Science.gov (United States)

    dos Santos, Odelta; de Vargas Rigo, Graziela; Frasson, Amanda Piccoli; Macedo, Alexandre José; Tasca, Tiana

    2015-01-01

    Trichomonas vaginalis is the etiologic agent of trichomonosis, the most common non-viral sexually transmitted disease worldwide. This infection is associated with several health consequences, including cervical and prostate cancers and HIV acquisition. Gene expression analysis has been facilitated because of available genome sequences and large-scale transcriptomes in T. vaginalis, particularly using quantitative real-time polymerase chain reaction (qRT-PCR), one of the most used methods for molecular studies. Reference genes for normalization are crucial to ensure the accuracy of this method. However, to the best of our knowledge, a systematic validation of reference genes has not been performed for T. vaginalis. In this study, the transcripts of nine candidate reference genes were quantified using qRT-PCR under different cultivation conditions, and the stability of these genes was compared using the geNorm and NormFinder algorithms. The most stable reference genes were α-tubulin, actin and DNATopII, and, conversely, the widely used T. vaginalis reference genes GAPDH and β-tubulin were less stable. The PFOR gene was used to validate the reliability of the use of these candidate reference genes. As expected, the PFOR gene was upregulated when the trophozoites were cultivated with ferrous ammonium sulfate when the DNATopII, α-tubulin and actin genes were used as normalizing gene. By contrast, the PFOR gene was downregulated when the GAPDH gene was used as an internal control, leading to misinterpretation of the data. These results provide an important starting point for reference gene selection and gene expression analysis with qRT-PCR studies of T. vaginalis. PMID:26393928

  8. Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

    Science.gov (United States)

    Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

    2013-01-01

    Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

  9. Cloning and evaluation of reference genes for quantitative real-time PCR analysis in Amorphophallus

    Directory of Open Access Journals (Sweden)

    Kai Wang

    2017-04-01

    Full Text Available Quantitative real-time reverse transcription PCR (RT-qPCR has been widely used in the detection and quantification of gene expression levels because of its high accuracy, sensitivity, and reproducibility as well as its large dynamic range. However, the reliability and accuracy of RT-qPCR depends on accurate transcript normalization using stably expressed reference genes. Amorphophallus is a perennial plant with a high content of konjac glucomannan (KGM in its corm. This crop has been used as a food source and as a traditional medicine for thousands of years. Without adequate knowledge of gene expression profiles, there has been no report of validated reference genes in Amorphophallus. In this study, nine genes that are usually used as reference genes in other crops were selected as candidate reference genes. These putative sequences of these genes Amorphophallus were cloned by the use of degenerate primers. The expression stability of each gene was assessed in different tissues and under two abiotic stresses (heat and waterlogging in A. albus and A. konjac. Three distinct algorithms were used to evaluate the expression stability of the candidate reference genes. The results demonstrated that EF1-a, EIF4A, H3 and UBQ were the best reference genes under heat stress in Amorphophallus. Furthermore, EF1-a, EIF4A, TUB, and RP were the best reference genes in waterlogged conditions. By comparing different tissues from all samples, we determined that EF1-α, EIF4A, and CYP were stable in these sets. In addition, the suitability of these reference genes was confirmed by validating the expression of a gene encoding the small heat shock protein SHSP, which is related to heat stress in Amorphophallus. In sum, EF1-α and EIF4A were the two best reference genes for normalizing mRNA levels in different tissues and under various stress treatments, and we suggest using one of these genes in combination with 1 or 2 reference genes associated with different

  10. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  11. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  12. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues

    Directory of Open Access Journals (Sweden)

    Lauralie Mangeot-Peter

    2016-09-01

    Full Text Available Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L., whose tissues (isolated bast fibres and core are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  13. Identification of Reference Genes for RT-qPCR Data Normalization in Cannabis sativa Stem Tissues.

    Science.gov (United States)

    Mangeot-Peter, Lauralie; Legay, Sylvain; Hausman, Jean-Francois; Esposito, Sergio; Guerriero, Gea

    2016-09-15

    Gene expression profiling via quantitative real-time PCR is a robust technique widely used in the life sciences to compare gene expression patterns in, e.g., different tissues, growth conditions, or after specific treatments. In the field of plant science, real-time PCR is the gold standard to study the dynamics of gene expression and is used to validate the results generated with high throughput techniques, e.g., RNA-Seq. An accurate relative quantification of gene expression relies on the identification of appropriate reference genes, that need to be determined for each experimental set-up used and plant tissue studied. Here, we identify suitable reference genes for expression profiling in stems of textile hemp (Cannabis sativa L.), whose tissues (isolated bast fibres and core) are characterized by remarkable differences in cell wall composition. We additionally validate the reference genes by analysing the expression of putative candidates involved in the non-oxidative phase of the pentose phosphate pathway and in the first step of the shikimate pathway. The goal is to describe the possible regulation pattern of some genes involved in the provision of the precursors needed for lignin biosynthesis in the different hemp stem tissues. The results here shown are useful to design future studies focused on gene expression analyses in hemp.

  14. Selection of Suitable Reference Genes for Quantitative Real-time PCR in Sapium sebiferum

    Directory of Open Access Journals (Sweden)

    Xue Chen

    2017-05-01

    Full Text Available Chinese tallow (Sapium sebiferum L. is a promising landscape and bioenergy plant. Measuring gene expression by quantitative real-time polymerase chain reaction (qRT-PCR can provide valuable information on gene function. Stably expressed reference genes for normalization are a prerequisite for ensuring the accuracy of the target gene expression level among different samples. However, the reference genes in Chinese tallow have not been systematically validated. In this study, 12 candidate reference genes (18S, GAPDH, UBQ, RPS15, SAND, TIP41, 60S, ACT7, PDF2, APT, TBP, and TUB were investigated with qRT-PCR in 18 samples, including those from different tissues, from plants treated with sucrose and cold stresses. The data were calculated with four common algorithms, geNorm, BestKeeper, NormFinder, and the delta cycle threshold (ΔCt. TIP41 and GAPDH were the most stable for the tissue-specific experiment, GAPDH and 60S for cold treatment, and GAPDH and UBQ for sucrose stresses, while the least stable genes were 60S, TIP41, and 18S respectively. The comprehensive results showed APT, GAPDH, and UBQ to be the top-ranked stable genes across all the samples. The stability of 60S was the lowest during all experiments. These selected reference genes were further validated by comparing the expression profiles of the chalcone synthase gene in Chinese tallow in different samples. The results will help to improve the accuracy of gene expression studies in Chinese tallow.

  15. Expression profiling identifies genes involved in emphysema severity

    Directory of Open Access Journals (Sweden)

    Bowman Rayleen V

    2009-09-01

    Full Text Available Abstract Chronic obstructive pulmonary disease (COPD is a major public health problem. The aim of this study was to identify genes involved in emphysema severity in COPD patients. Gene expression profiling was performed on total RNA extracted from non-tumor lung tissue from 30 smokers with emphysema. Class comparison analysis based on gas transfer measurement was performed to identify differentially expressed genes. Genes were then selected for technical validation by quantitative reverse transcriptase-PCR (qRT-PCR if also represented on microarray platforms used in previously published emphysema studies. Genes technically validated advanced to tests of biological replication by qRT-PCR using an independent test set of 62 lung samples. Class comparison identified 98 differentially expressed genes (p p Gene expression profiling of lung from emphysema patients identified seven candidate genes associated with emphysema severity including COL6A3, SERPINF1, ZNHIT6, NEDD4, CDKN2A, NRN1 and GSTM3.

  16. Reference gene validation for gene expression normalization in canine osteosarcoma : a geNorm algorithm approach

    NARCIS (Netherlands)

    Selvarajah, G.T.; Bonestroo, F.A.S.; Timmermans Sprang, E.P.M.; Kirpensteijn, J.|info:eu-repo/dai/nl/189846992; Mol, J.A.|info:eu-repo/dai/nl/070918775

    2017-01-01

    Background Quantitative PCR (qPCR) is a common method for quantifying mRNA expression. Given the heterogeneity present in tumor tissues, it is crucial to normalize target mRNA expression data using appropriate reference genes that are stably expressed under a variety of pathological and experimental

  17. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae.

    Directory of Open Access Journals (Sweden)

    Meng Sun

    Full Text Available The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA, elongation factor 1 (EF1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ribosomal protein S13 (RPS13, ribosomal protein S20 (RPS20, tubulin (TUB, and β-actin (ACTB were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1 were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands. 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults. 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C. To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83 was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  18. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  19. Selection of reliable reference genes for quantitative real-time PCR in human T cells and neutrophils

    Directory of Open Access Journals (Sweden)

    Ledderose Carola

    2011-10-01

    Full Text Available Abstract Background The choice of reliable reference genes is a prerequisite for valid results when analyzing gene expression with real-time quantitative PCR (qPCR. This method is frequently applied to study gene expression patterns in immune cells, yet a thorough validation of potential reference genes is still lacking for most leukocyte subtypes and most models of their in vitro stimulation. In the current study, we evaluated the expression stability of common reference genes in two widely used cell culture models-anti-CD3/CD28 activated T cells and lipopolysaccharide stimulated neutrophils-as well as in unselected untreated leukocytes. Results The mRNA expression of 17 (T cells, 7 (neutrophils or 8 (unselected leukocytes potential reference genes was quantified by reverse transcription qPCR, and a ranking of the preselected candidate genes according to their expression stability was calculated using the programs NormFinder, geNorm and BestKeeper. IPO8, RPL13A, TBP and SDHA were identified as suitable reference genes in T cells. TBP, ACTB and SDHA were stably expressed in neutrophils. TBP and SDHA were also the most stable genes in untreated total blood leukocytes. The critical impact of reference gene selection on the estimated target gene expression is demonstrated for IL-2 and FIH expression in T cells. Conclusions The study provides a shortlist of suitable reference genes for normalization of gene expression data in unstimulated and stimulated T cells, unstimulated and stimulated neutrophils and in unselected leukocytes.

  20. Evaluation of Housekeeping Genes for Quantitative Real-Time PCR Analysis of Bradysia odoriphaga (Diptera: Sciaridae

    Directory of Open Access Journals (Sweden)

    Caihua Shi

    2016-07-01

    Full Text Available The soil insect Bradysia odoriphaga (Diptera: Sciaridae causes substantial damage to Chinese chive. Suitable reference genes in B. odoriphaga (Bradysia odoriphaga have yet to be identified for normalizing target gene expression among samples by quantitative real-time PCR (qRT-PCR. This study was focused on identifying the expression stability of 12 candidate housekeeping genes in B. odoriphaga under various experiment conditions. The final stability ranking of 12 housekeeping genes was obtained with RefFinder, and the most suitable number of reference genes was analyzed by GeNorm. The results revealed that the most appropriate sets of internal controls were RPS15, RPL18, and RPS18 across developmental phases; RPS15, RPL28, and GAPDH across temperatures; RPS15 and RPL18 across pesticide treatments; RSP5, RPS18, and SDHA across photoperiods; ACTb, RPS18, and RPS15 across diets; RPS13 and RPL28 across populations; and RPS15, ACTb, and RPS18 across all samples. The use of the most suitable reference genes versus an arbitrarily selected reference gene resulted in significant differences in the analysis of a target gene expression. HSP23 in B. odoriphaga was found to be up-regulated under low temperatures. These results will contribute to the standardization of qRT-PCR and will also be valuable for further research on gene function in B. odoriphaga.

  1. PRAME gene expression profile in medulloblastoma

    Directory of Open Access Journals (Sweden)

    Tânia Maria Vulcani-Freitas

    2011-02-01

    Full Text Available Medulloblastoma is the most common malignant tumors of central nervous system in the childhood. The treatment is severe, harmful and, thus, has a dismal prognosis. As PRAME is present in various cancers, including meduloblastoma, and has limited expression in normal tissues, this antigen can be an ideal vaccine target for tumor immunotherapy. In order to find a potential molecular target, we investigated PRAME expression in medulloblastoma fragments and we compare the results with the clinical features of each patient. Analysis of gene expression was performed by real-time quantitative PCR from 37 tumor samples. The Mann-Whitney test was used to analysis the relationship between gene expression and clinical characteristics. Kaplan-Meier curves were used to evaluate survival. PRAME was overexpressed in 84% samples. But no statistical association was found between clinical features and PRAME overexpression. Despite that PRAME gene could be a strong candidate for immunotherapy since it is highly expressed in medulloblastomas.

  2. Differential gene expression during Trypanosoma cruzi metacyclogenesis

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Krieger

    1999-09-01

    Full Text Available The transformation of epimastigotes into metacyclic trypomastigotes involves changes in the pattern of expressed genes, resulting in important morphological and functional differences between these developmental forms of Trypanosoma cruzi. In order to identify and characterize genes involved in triggering the metacyclogenesis process and in conferring to metacyclic trypomastigotes their stage specific biological properties, we have developed a method allowing the isolation of genes specifically expressed when comparing two close related cell populations (representation of differential expression or RDE. The method is based on the PCR amplification of gene sequences selected by hybridizing and subtracting the populations in such a way that after some cycles of hybridization-amplification genes specific to a given population are highly enriched. The use of this method in the analysis of differential gene expression during T. cruzi metacyclogenesis (6 hr and 24 hr of differentiation and metacyclic trypomastigotes resulted in the isolation of several clones from each time point. Northern blot analysis showed that some genes are transiently expressed (6 hr and 24 hr differentiating cells, while others are present in differentiating cells and in metacyclic trypomastigotes. Nucleotide sequencing of six clones characterized so far showed that they do not display any homology to gene sequences available in the GeneBank.

  3. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus by qRT-PCR

    Directory of Open Access Journals (Sweden)

    Iona E. Maher

    2014-03-01

    Full Text Available Investigation of the immune response of the koala (Phascolarctos cinereus is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV, which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala’s susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1 and Th2 lymphocyte responses are important to an individual’s susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala’s adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4, interleukin 6 (IL-6, interleukin 10 (IL-10 and interferon gamma (IFNγ along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A. Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not

  4. Expression profiles of the immune genes CD4, CD8β, IFNγ, IL-4, IL-6 and IL-10 in mitogen-stimulated koala lymphocytes (Phascolarctos cinereus) by qRT-PCR.

    Science.gov (United States)

    Maher, Iona E; Griffith, Joanna E; Lau, Quintin; Reeves, Thomas; Higgins, Damien P

    2014-01-01

    Investigation of the immune response of the koala (Phascolarctos cinereus) is needed urgently, but has been limited by scarcity of species-specific reagents and methods for this unique and divergent marsupial. Infectious disease is an important threat to wild populations of koalas; the most widespread and important of these is Chlamydial disease, caused by Chlamydia pecorum and Chlamydia pneumoniae. In addition, koala retrovirus (KoRV), which is of 100% prevalence in northern Australia, has been proposed as an important agent of immune suppression that could explain the koala's susceptibility to disease. The correct balance of T regulatory, T helper 1 (Th1) and Th2 lymphocyte responses are important to an individual's susceptibility or resistance to chlamydial infection. The ability to study chlamydial or KoRV pathogenesis, effects of environmental stressors on immunity, and the response of koalas to vaccines under development, by examining the koala's adaptive response to natural infection or in-vitro stimulation, has been limited to date by a paucity of species- specific reagents. In this study we have used cytokine sequences from four marsupial genomes to identify mRNA sequences for key T regulatory, Th1 and Th2 cytokines interleukin 4 (IL-4), interleukin 6 (IL-6), interleukin 10 (IL-10) and interferon gamma (IFNγ) along with CD4 and CD8β. The koala sequences used for primer design showed >58% homology with grey short-tailed opossum, >71% with tammar wallaby and 78% with Tasmanian devil amino acid sequences. We report the development of real-time RT-PCR assays to measure the expression of these genes in unstimulated cells and after three common mitogen stimulation protocols (phorbol myristate acetate/ionomycin, phorbol myristate acetate/phytohemagglutinin and concanavalin A). Phorbol myristate acetate/ionomycin was found to be the most effective mitogen to up-regulate the production of IL-4, IL-10 and IFNγ. IL-6 production was not consistently up-regulated by

  5. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

    Science.gov (United States)

    Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

    2018-01-01

    Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

  6. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  7. Gene expression results in lipopolysaccharide-stimulated monocytes depend significantly on the choice of reference genes

    Directory of Open Access Journals (Sweden)

    Øvstebø Reidun

    2010-05-01

    Full Text Available Abstract Background Gene expression in lipopolysaccharide (LPS-stimulated monocytes is mainly studied by quantitative real-time reverse transcription PCR (RT-qPCR using GAPDH (glyceraldehyde 3-phosphate dehydrogenase or ACTB (beta-actin as reference gene for normalization. Expression of traditional reference genes has been shown to vary substantially under certain conditions leading to invalid results. To investigate whether traditional reference genes are stably expressed in LPS-stimulated monocytes or if RT-qPCR results are dependent on the choice of reference genes, we have assessed and evaluated gene expression stability of twelve candidate reference genes in this model system. Results Twelve candidate reference genes were quantified by RT-qPCR in LPS-stimulated, human monocytes and evaluated using the programs geNorm, Normfinder and BestKeeper. geNorm ranked PPIB (cyclophilin B, B2M (beta-2-microglobulin and PPIA (cyclophilin A as the best combination for gene expression normalization in LPS-stimulated monocytes. Normfinder suggested TBP (TATA-box binding protein and B2M as the best combination. Compared to these combinations, normalization using GAPDH alone resulted in significantly higher changes of TNF-α (tumor necrosis factor-alpha and IL10 (interleukin 10 expression. Moreover, a significant difference in TNF-α expression between monocytes stimulated with equimolar concentrations of LPS from N. meningitides and E. coli, respectively, was identified when using the suggested combinations of reference genes for normalization, but stayed unrecognized when employing a single reference gene, ACTB or GAPDH. Conclusions Gene expression levels in LPS-stimulated monocytes based on RT-qPCR results differ significantly when normalized to a single gene or a combination of stably expressed reference genes. Proper evaluation of reference gene stabiliy is therefore mandatory before reporting RT-qPCR results in LPS-stimulated monocytes.

  8. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  9. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  10. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  11. SCREENING OF COMMON FLAX FAD GENES BY PCR

    Directory of Open Access Journals (Sweden)

    Veronika Štefúnová

    2013-02-01

    Full Text Available Currently, flax (Linum usitatissimum L. is an important crop from commercial and economical aspects. In the spotlight is the linseed oil as a source of α-linolenic acid. The aim of presented study was to analyse fatty acid desaturase (FAD genes in flax. Several genotypes of flax (Hohenheim, La Plata 1938, Redwing USA and Escalina were used. The primers described by Vrinten et al. (2005 were used for PCR amplification reactions. Two FAD3 genes, LuFAD3A and LuFAD3B, were identified in a genome of flax. Subsequently the nucleotide sequences between origins and genotypes of flax FAD genes were compared. Primarily were used the nucleotide sequences of FAD2 and FAD3C genes available in NCBI database. Differences were found using BLAST program in nucleotide sequences of FAD genes and the specific primers were designed to amplify a specific target sequences in a genome of flax. These primers were used in PCR amplification reactions to identification of FAD2 and FAD3C genes. The PCR products were separated by electrophoresis on agarose gel.

  12. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases.

    Science.gov (United States)

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-11-17

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain samples from two brain regions from Alzheimer's disease (AD), Parkinson's disease (PD), Multiple System Atrophy, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori validation of RGs for RT-qPCR studies.

  13. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  14. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  15. Gene expression in periodontal tissues following treatment

    Directory of Open Access Journals (Sweden)

    Eisenacher Martin

    2008-07-01

    Full Text Available Abstract Background In periodontitis, treatment aimed at controlling the periodontal biofilm infection results in a resolution of the clinical and histological signs of inflammation. Although the cell types found in periodontal tissues following treatment have been well described, information on gene expression is limited to few candidate genes. Therefore, the aim of the study was to determine the expression profiles of immune and inflammatory genes in periodontal tissues from sites with severe chronic periodontitis following periodontal therapy in order to identify genes involved in tissue homeostasis. Gingival biopsies from 12 patients with severe chronic periodontitis were taken six to eight weeks following non-surgical periodontal therapy, and from 11 healthy controls. As internal standard, RNA of an immortalized human keratinocyte line (HaCaT was used. Total RNA was subjected to gene expression profiling using a commercially available microarray system focusing on inflammation-related genes. Post-hoc confirmation of selected genes was done by Realtime-PCR. Results Out of the 136 genes analyzed, the 5% most strongly expressed genes compared to healthy controls were Interleukin-12A (IL-12A, Versican (CSPG-2, Matrixmetalloproteinase-1 (MMP-1, Down syndrome critical region protein-1 (DSCR-1, Macrophage inflammatory protein-2β (Cxcl-3, Inhibitor of apoptosis protein-1 (BIRC-1, Cluster of differentiation antigen 38 (CD38, Regulator of G-protein signalling-1 (RGS-1, and Finkel-Biskis-Jinkins murine osteosarcoma virus oncogene (C-FOS; the 5% least strongly expressed genes were Receptor-interacting Serine/Threonine Kinase-2 (RIP-2, Complement component 3 (C3, Prostaglandin-endoperoxide synthase-2 (COX-2, Interleukin-8 (IL-8, Endothelin-1 (EDN-1, Plasminogen activator inhibitor type-2 (PAI-2, Matrix-metalloproteinase-14 (MMP-14, and Interferon regulating factor-7 (IRF-7. Conclusion Gene expression profiles found in periodontal tissues following

  16. Expression profiles of genes involved in tanshinone biosynthesis of ...

    Indian Academy of Sciences (India)

    Expression profiles of genes involved in tanshinone biosynthesis of two. Salvia miltiorrhiza genotypes with different tanshinone contents. Zhenqiao Song, Jianhua Wang and Xingfeng Li. J. Genet. 95, 433–439. Table 1. S. miltiorrhiza genes and primer pairs used for qRT-PCR. Gene. GenBank accession. Primer name.

  17. A comparative study of three different gene expression analysis methods.

    Science.gov (United States)

    Choe, Jae Young; Han, Hyung Soo; Lee, Seon Duk; Lee, Hanna; Lee, Dong Eun; Ahn, Jae Yun; Ryoo, Hyun Wook; Seo, Kang Suk; Kim, Jong Kun

    2017-12-04

    TNF-α regulates immune cells and acts as an endogenous pyrogen. Reverse transcription polymerase chain reaction (RT-PCR) is one of the most commonly used methods for gene expression analysis. Among the alternatives to PCR, loop-mediated isothermal amplification (LAMP) shows good potential in terms of specificity and sensitivity. However, few studies have compared RT-PCR and LAMP for human gene expression analysis. Therefore, in the present study, we compared one-step RT-PCR, two-step RT-LAMP and one-step RT-LAMP for human gene expression analysis. We compared three gene expression analysis methods using the human TNF-α gene as a biomarker from peripheral blood cells. Total RNA from the three selected febrile patients were subjected to the three different methods of gene expression analysis. In the comparison of three gene expression analysis methods, the detection limit of both one-step RT-PCR and one-step RT-LAMP were the same, while that of two-step RT-LAMP was inferior. One-step RT-LAMP takes less time, and the experimental result is easy to determine. One-step RT-LAMP is a potentially useful and complementary tool that is fast and reasonably sensitive. In addition, one-step RT-LAMP could be useful in environments lacking specialized equipment or expertise.

  18. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  19. Regulation of eucaryotic gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Brent, R.; Ptashne, M.S

    1989-05-23

    This patent describes a method of regulating the expression of a gene in a eucaryotic cell. The method consists of: providing in the eucaryotic cell, a peptide, derived from or substantially similar to a peptide of a procaryotic cell able to bind to DNA upstream from or within the gene, the amount of the peptide being sufficient to bind to the gene and thereby control expression of the gene.

  20. Identification of Optimal Reference Genes for Normalization of qPCR Analysis during Pepper Fruit Development

    Directory of Open Access Journals (Sweden)

    Yuan Cheng

    2017-06-01

    Full Text Available Due to its high sensitivity and reproducibility, quantitative real-time PCR (qPCR is practiced as a useful research tool for targeted gene expression analysis. For qPCR operations, the normalization with suitable reference genes (RGs is a crucial step that eventually determines the reliability of the obtained results. Although pepper is considered an ideal model plant for the study of non-climacteric fruit development, at present no specific RG have been developed or validated for the qPCR analyses of pepper fruit. Therefore, this study aimed to identify stably expressed genes for their potential use as RGs in pepper fruit studies. Initially, a total of 35 putative RGs were selected by mining the pepper transcriptome data sets derived from the PGP (Pepper Genome Platform and PGD (Pepper Genome Database. Their expression stabilities were further measured in a set of pepper (Capsicum annuum L. var. 007e fruit samples, which represented four different fruit developmental stages (IM: Immature; MG: Mature green; B: Break; MR: Mature red using the qPCR analysis. Then, based on the qPCR results, three different statistical algorithms, namely geNorm, Normfinder, and boxplot, were chosen to evaluate the expression stabilities of these putative RGs. It should be noted that nine genes were proven to be qualified as RGs during pepper fruit development, namely CaREV05 (CA00g79660; CaREV08 (CA06g02180; CaREV09 (CA06g05650; CaREV16 (Capana12g002666; CaREV21 (Capana10g001439; CaREV23 (Capana05g000680; CaREV26 (Capana01g002973; CaREV27 (Capana11g000123; CaREV31 (Capana04g002411; and CaREV33 (Capana08g001826. Further analysis based on geNorm suggested that the application of the two most stably expressed genes (CaREV05 and CaREV08 would provide optimal transcript normalization in the qPCR experiments. Therefore, a new and comprehensive strategy for the identification of optimal RGs was developed. This strategy allowed for the effective normalization of the qPCR

  1. Differential Gene Expression and Aging

    Directory of Open Access Journals (Sweden)

    Laurent Seroude

    2002-01-01

    Full Text Available It has been established that an intricate program of gene expression controls progression through the different stages in development. The equally complex biological phenomenon known as aging is genetically determined and environmentally modulated. This review focuses on the genetic component of aging, with a special emphasis on differential gene expression. At least two genetic pathways regulating organism longevity act by modifying gene expression. Many genes are also subjected to age-dependent transcriptional regulation. Some age-related gene expression changes are prevented by caloric restriction, the most robust intervention that slows down the aging process. Manipulating the expression of some age-regulated genes can extend an organism's life span. Remarkably, the activity of many transcription regulatory elements is linked to physiological age as opposed to chronological age, indicating that orderly and tightly controlled regulatory pathways are active during aging.

  2. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae.

    Directory of Open Access Journals (Sweden)

    Yifan Zhai

    Full Text Available To accurately evaluate gene expression levels and obtain more accurate quantitative real-time RT-PCR (qRT-PCR data, normalization relative to reliable reference gene(s is required. Drosophila suzukii, is an invasive fruit pest native to East Asia, and recently invaded Europe and North America, the stability of its reference genes have not been previously investigated. In this study, ten candidate reference genes (RPL18, RPS3, AK, EF-1β, TBP, NADH, HSP22, GAPDH, Actin, α-Tubulin, were evaluated for their suitability as normalization genes under different biotic (developmental stage, tissue and population, and abiotic (photoperiod, temperature conditions. The three statistical approaches (geNorm, NormFinder and BestKeeper and one web-based comprehensive tool (RefFinder were used to normalize analysis of the ten candidate reference genes identified α-Tubulin, TBP and AK as the most stable candidates, while HSP22 and Actin showed the lowest expression stability. We used three most stable genes (α-Tubulin, TBP and AK and one unstably expressed gene to analyze the expression of P-glycoprotein in abamectin-resistant and sensitive strains, and the results were similar to reference genes α-Tubulin, TBP and AK, which show good stability, while the result of HSP22 has a certain bias. The three validated reference genes can be widely used for quantification of target gene expression with qRT-PCR technology in D.suzukii.

  3. RT-qPCR normalization genes in the red alga Chondrus crispus.

    Directory of Open Access Journals (Sweden)

    Nathalie Kowalczyk

    Full Text Available Chondrus crispus is a common red macroalga living on the rocky shores of the North Atlantic Ocean. It has a long research history, being a major source of carrageenan, a thickener widely used in the food industry, but also for physiological and ecological studies. To establish it as a model for red algae, its genome has been sequenced, allowing the development of molecular tools such as quantification of gene expression, including RNAseq and RT-qPCR. To determine appropriate genes for RT-qPCR normalization, the expression of 14 genes was monitored in 18 conditions using two sets of algal samples: samples from the sequenced strain, cultured and stressed in laboratory conditions and C. crispus collected on the shore and stressed in situ. The expression stability of the genes between the samples was evaluated by comparing the Ct range and using the programs geNorm and NormFinder. The candidate genes encoded translation related proteins (initiation factors IF4A-1 and IF4A-2, elongation factor EF1α and eRF3, an eukaryotic polypeptide chain release factor, cytoskeleton proteins (two β-tubulins, α-tubulin and actin, enzymes involved in the pentose phosphate pathway (glucose 6-phosphate deshydrogenase, protein recycling process (ubiquitin and ubiquitin-conjugating enzyme and glycolysis (isocitrate dehydrogenase. The two sets of samples showed different expression patterns. Most of the genes were stable in the algae cultivated in the laboratory, whereas environmental samples showed a more important variation in gene expression. When analyzing the two sets separately, the ranking of the most stables genes were different from one method to another. When considering all samples, the two statistical methods were concordant, revealing translation initiation factor 4A-2 and eukaryotic polypeptide chain release factor 3 as pertinent normalization genes. This study highlights thus the importance of testing reference genes according to the experiments as well

  4. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  5. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  6. The workflow of single-cell expression profiling using quantitative real-time PCR

    Czech Academy of Sciences Publication Activity Database

    Stahlberg, A.; Kubista, Mikael

    2014-01-01

    Roč. 14, č. 3 (2014), s. 323-331 ISSN 1473-7159 R&D Projects: GA ČR GA13-02154S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:86652036 Keywords : single-cell workflow * gene expression profiling * RT-qPCR Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.516, year: 2014

  7. Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Filipe Pinto

    Full Text Available Cyanobacteria are a group of photosynthetic prokaryotes that have a diverse morphology, minimal nutritional requirements and metabolic plasticity that has made them attractive organisms to use in biotechnological applications. The use of these organisms as cell factories requires the knowledge of their physiology and metabolism at a systems level. For the quantification of gene transcripts real-time quantitative polymerase chain reaction (RT-qPCR is the standard technique. However, to obtain reliable RT-qPCR results the use and validation of reference genes is mandatory. Towards this goal we have selected and analyzed twelve candidate reference genes from three morphologically distinct cyanobacteria grown under routinely used laboratory conditions. The six genes exhibiting less variation in each organism were evaluated in terms of their expression stability using geNorm, NormFinder and BestKeeper. In addition, the minimum number of reference genes required for normalization was determined. Based on the three algorithms, we provide a list of genes for cyanobacterial RT-qPCR data normalization. To our knowledge, this is the first work on the validation of reference genes for cyanobacteria constituting a valuable starting point for future works.

  8. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  9. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  10. Selection of reference genes for quantitative real-time PCR in bovine preimplantation embryos

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2005-12-01

    Full Text Available Abstract Background Real-time quantitative PCR is a sensitive and very efficient technique to examine gene transcription patterns in preimplantation embryos, in order to gain information about embryo development and to optimize assisted reproductive technologies. Critical to the succesful application of real-time PCR is careful assay design, reaction optimization and validation to maximize sensitivity and accuracy. In most of the studies published GAPD, ACTB or 18S rRNA have been used as a single reference gene without prior verification of their expression stability. Normalization of the data using unstable controls can result in erroneous conclusions, especially when only one reference gene is used. Results In this study the transcription levels of 8 commonly used reference genes (ACTB, GAPD, Histone H2A, TBP, HPRT1, SDHA, YWHAZ and 18S rRNA were determined at different preimplantation stages (2-cell, 8-cell, blastocyst and hatched blastocyst in order to select the most stable genes to normalize quantitative data within different preimplantation embryo stages. Conclusion Using the geNorm application YWHAZ, GAPD and SDHA were found to be the most stable genes across the examined embryonic stages, while the commonly used ACTB was shown to be highly regulated. We recommend the use of the geometric mean of those 3 reference genes as an accurate normalization factor, which allows small expression differences to be reliably measured.

  11. Identification of endogenous control genes for normalisation of real-time quantitative PCR data in colorectal cancer.

    LENUS (Irish Health Repository)

    Kheirelseid, Elrasheid A H

    2010-01-01

    BACKGROUND: Gene expression analysis has many applications in cancer diagnosis, prognosis and therapeutic care. Relative quantification is the most widely adopted approach whereby quantification of gene expression is normalised relative to an endogenously expressed control (EC) gene. Central to the reliable determination of gene expression is the choice of control gene. The purpose of this study was to evaluate a panel of candidate EC genes from which to identify the most stably expressed gene(s) to normalise RQ-PCR data derived from primary colorectal cancer tissue. RESULTS: The expression of thirteen candidate EC genes: B2M, HPRT, GAPDH, ACTB, PPIA, HCRT, SLC25A23, DTX3, APOC4, RTDR1, KRTAP12-3, CHRNB4 and MRPL19 were analysed in a cohort of 64 colorectal tumours and tumour associated normal specimens. CXCL12, FABP1, MUC2 and PDCD4 genes were chosen as target genes against which a comparison of the effect of each EC gene on gene expression could be determined. Data analysis using descriptive statistics, geNorm, NormFinder and qBasePlus indicated significant difference in variances between candidate EC genes. We determined that two genes were required for optimal normalisation and identified B2M and PPIA as the most stably expressed and reliable EC genes. CONCLUSION: This study identified that the combination of two EC genes (B2M and PPIA) more accurately normalised RQ-PCR data in colorectal tissue. Although these control genes might not be optimal for use in other cancer studies, the approach described herein could serve as a template for the identification of valid ECs in other cancer types.

  12. CDX2 gene expression in acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Arnaoaut, H.H.; Mokhtar, D.A.; Samy, R.M.; Omar, Sh.A.; Khames, S.A.

    2014-01-01

    CDX genes are classically known as regulators of axial elongation during early embryogenesis. An unsuspected role for CDX genes has been revealed during hematopoietic development. The CDX gene family member CDX2 belongs to the most frequent aberrantly expressed proto-oncogenes in human acute leukemias and is highly leukemogenic in experimental models. We used reversed transcriptase polymerase chain reaction (RT-PCR) to determine the expression level of CDX2 gene in 30 pediatric patients with acute lymphoblastic leukemia (ALL) at diagnosis and 30 healthy volunteers. ALL patients were followed up to detect minimal residual disease (MRD) on days 15 and 42 of induction. We found that CDX2 gene was expressed in 50% of patients and not expressed in controls. Associations between gene expression and different clinical and laboratory data of patients revealed no impact on different findings. With follow up, we could not confirm that CDX2 expression had a prognostic significance.

  13. Recommended Reference Genes for Quantitative PCR Analysis in Soybean Have Variable Stabilities during Diverse Biotic Stresses.

    Directory of Open Access Journals (Sweden)

    Raman Bansal

    Full Text Available For real-time reverse transcription-PCR (qRT-PCR in soybean, reference genes in different tissues, developmental stages, various cultivars, and under stress conditions have been suggested but their usefulness for research on soybean under various biotic stresses occurring in North-Central U.S. is not known. Here, we investigated the expression stabilities of ten previously recommended reference genes (ABCT, CYP, EF1A, FBOX, GPDH, RPL30, TUA4, TUB4, TUA5, and UNK2 in soybean under biotic stress from Bean pod mottle virus (BPMV, powdery mildew (PMD, soybean aphid (SBA, and two-spotted spider mite (TSSM. BPMV, PMD, SBA, and TSSM are amongst the most common pest problems on soybean in North-Central U.S. and other regions. Reference gene stability was determined using three software algorithms (geNorm, NormFinder, BestKeeper and a web-based tool (RefFinder. Reference genes showed variability in their expression as well as stability across various stressors and the best reference genes were stress-dependent. ABCT and FBOX were found to be the most stable in soybean under both BPMV and SBA stress but these genes had only minimal to moderate stability during PMD and TSSM stress. Expression of TUA4 and CYP was found to be most stable during PMD stress; TUB4 and TUA4 were stable under TSSM stress. Under various biotic stresses on soybean analyzed, GPDH expression was found to be consistently unstable. For all biotic stressors on soybean, we obtained pairwise variation (V2/3 values less than 0.15 which suggested that combined use of the two most stable reference genes would be sufficient for normalization. Further, we demonstrated the utility of normalizing the qRT-PCR data for target genes using the most stable reference genes validated in current study. Following of the recommendations from our current study will enable an accurate and reliable normalization of qRT-PCR data in soybean under biotic stress.

  14. Evaluation of reference genes for quantitative real-time PCR in oil palm elite planting materials propagated by tissue culture.

    Directory of Open Access Journals (Sweden)

    Pek-Lan Chan

    Full Text Available BACKGROUND: The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR. With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. RESULTS: In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569 outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN. PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. CONCLUSIONS: Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection

  15. Evaluation and validation of candidate endogenous control genes for real-time quantitative PCR studies of breast cancer

    Directory of Open Access Journals (Sweden)

    Miller Nicola

    2007-11-01

    Full Text Available Abstract Background Real-time quantitative PCR (RQ-PCR forms the basis of many breast cancer biomarker studies and novel prognostic assays, paving the way towards personalised cancer treatments. Normalisation of relative RQ-PCR data is required to control for non-biological variation introduced during sample preparation. Endogenous control (EC genes, used in this context, should ideally be expressed constitutively and uniformly across treatments in all test samples. Despite widespread recognition that the accuracy of the normalised data is largely dependent on the reliability of the EC, there are no reports of the systematic validation of genes commonly used for this purpose in the analysis of gene expression by RQ-PCR in primary breast cancer tissues. The aim of this study was to identify the most suitable endogenous control genes for RQ-PCR analysis of primary breast tissue from a panel of eleven candidates in current use. Oestrogen receptor alpha (ESR1 was used a target gene to compare the effect of choice of EC on the estimate of gene quantity. Results The expression and validity of candidate ECs (GAPDH, TFRC, ABL, PPIA, HPRT1, RPLP0, B2M, GUSB, MRPL19, PUM1 and PSMC4 was determined in 6 benign and 21 malignant primary breast cancer tissues. Gene expression data was analysed using two different statistical models. MRPL19 and PPIA were identified as the most stable and reliable EC genes, while GUSB, RPLP0 and ABL were least stable. There was a highly significant difference in variance between ECs. ESR1 expression was appreciably higher in malignant compared to benign tissues and there was a significant effect of EC on the magnitude of the error associated with the relative quantity of ESR1. Conclusion We have validated two endogenous control genes, MRPL19 and PPIA, for RQ-PCR analysis of gene expression in primary breast tissue. Of the genes in current use in this field, the above combination offers increased accuracy and resolution in the

  16. Evaluation of Reference Genes for Quantitative Real-Time PCR in Oil Palm Elite Planting Materials Propagated by Tissue Culture

    Science.gov (United States)

    Chan, Pek-Lan; Rose, Ray J.; Abdul Murad, Abdul Munir; Zainal, Zamri; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ooi, Siew-Eng; Yahya, Suzaini; Singh, Rajinder

    2014-01-01

    Background The somatic embryogenesis tissue culture process has been utilized to propagate high yielding oil palm. Due to the low callogenesis and embryogenesis rates, molecular studies were initiated to identify genes regulating the process, and their expression levels are usually quantified using reverse transcription quantitative real-time PCR (RT-qPCR). With the recent release of oil palm genome sequences, it is crucial to establish a proper strategy for gene analysis using RT-qPCR. Selection of the most suitable reference genes should be performed for accurate quantification of gene expression levels. Results In this study, eight candidate reference genes selected from cDNA microarray study and literature review were evaluated comprehensively across 26 tissue culture samples using RT-qPCR. These samples were collected from two tissue culture lines and media treatments, which consisted of leaf explants cultures, callus and embryoids from consecutive developmental stages. Three statistical algorithms (geNorm, NormFinder and BestKeeper) confirmed that the expression stability of novel reference genes (pOP-EA01332, PD00380 and PD00569) outperformed classical housekeeping genes (GAPDH, NAD5, TUBULIN, UBIQUITIN and ACTIN). PD00380 and PD00569 were identified as the most stably expressed genes in total samples, MA2 and MA8 tissue culture lines. Their applicability to validate the expression profiles of a putative ethylene-responsive transcription factor 3-like gene demonstrated the importance of using the geometric mean of two genes for normalization. Conclusions Systematic selection of the most stably expressed reference genes for RT-qPCR was established in oil palm tissue culture samples. PD00380 and PD00569 were selected for accurate and reliable normalization of gene expression data from RT-qPCR. These data will be valuable to the research associated with the tissue culture process. Also, the method described here will facilitate the selection of appropriate

  17. With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies.

    Science.gov (United States)

    Chapman, Joanne R; Waldenström, Jonas

    2015-01-01

    The choice of reference genes that are stably expressed amongst treatment groups is a crucial step in real-time quantitative PCR gene expression studies. Recent guidelines have specified that a minimum of two validated reference genes should be used for normalisation. However, a quantitative review of the literature showed that the average number of reference genes used across all studies was 1.2. Thus, the vast majority of studies continue to use a single gene, with β-actin (ACTB) and/or glyceraldehyde 3-phosphate dehydrogenase (GAPDH) being commonly selected in studies of vertebrate gene expression. Few studies (15%) tested a panel of potential reference genes for stability of expression before using them to normalise data. Amongst studies specifically testing reference gene stability, few found ACTB or GAPDH to be optimal, whereby these genes were significantly less likely to be chosen when larger panels of potential reference genes were screened. Fewer reference genes were tested for stability in non-model organisms, presumably owing to a dearth of available primers in less well characterised species. Furthermore, the experimental conditions under which real-time quantitative PCR analyses were conducted had a large influence on the choice of reference genes, whereby different studies of rat brain tissue showed different reference genes to be the most stable. These results highlight the importance of validating the choice of normalising reference genes before conducting gene expression studies.

  18. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Gene expression analysis in watermelon (Citrullus lanatus fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC, β-actin (ClACT, and alpha tubulin 5 (ClTUA5 as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1, a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  19. Evaluation of Appropriate Reference Genes for Gene Expression Normalization during Watermelon Fruit Development.

    Science.gov (United States)

    Kong, Qiusheng; Yuan, Jingxian; Gao, Lingyun; Zhao, Liqiang; Cheng, Fei; Huang, Yuan; Bie, Zhilong

    2015-01-01

    Gene expression analysis in watermelon (Citrullus lanatus) fruit has drawn considerable attention with the availability of genome sequences to understand the regulatory mechanism of fruit development and to improve its quality. Real-time quantitative reverse-transcription PCR (qRT-PCR) is a routine technique for gene expression analysis. However, appropriate reference genes for transcript normalization in watermelon fruits have not been well characterized. The aim of this study was to evaluate the appropriateness of 12 genes for their potential use as reference genes in watermelon fruits. Expression variations of these genes were measured in 48 samples obtained from 12 successive developmental stages of parthenocarpic and fertilized fruits of two watermelon genotypes by using qRT-PCR analysis. Considering the effects of genotype, fruit setting method, and developmental stage, geNorm determined clathrin adaptor complex subunit (ClCAC), β-actin (ClACT), and alpha tubulin 5 (ClTUA5) as the multiple reference genes in watermelon fruit. Furthermore, ClCAC alone or together with SAND family protein (ClSAND) was ranked as the single or two best reference genes by NormFinder. By using the top-ranked reference genes to normalize the transcript abundance of phytoene synthase (ClPSY1), a good correlation between lycopene accumulation and ClPSY1 expression pattern was observed in ripening watermelon fruit. These validated reference genes will facilitate the accurate measurement of gene expression in the studies on watermelon fruit biology.

  20. Gene expression in colorectal cancer

    DEFF Research Database (Denmark)

    Birkenkamp-Demtroder, Karin; Christensen, Lise Lotte; Olesen, Sanne Harder

    2002-01-01

    Understanding molecular alterations in colorectal cancer (CRC) is needed to define new biomarkers and treatment targets. We used oligonucleotide microarrays to monitor gene expression of about 6,800 known genes and 35,000 expressed sequence tags (ESTs) on five pools (four to six samples in each...... pool) of total RNA from left-sided sporadic colorectal carcinomas. We compared normal tissue to carcinoma tissue from Dukes' stages A-D (noninvasive to distant metastasis) and identified 908 known genes and 4,155 ESTs that changed remarkably from normal to tumor tissue. Based on intensive filtering 226...

  1. Correction of gene expression data

    DEFF Research Database (Denmark)

    Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin

    2014-01-01

    This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies....... For maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce...

  2. Validation of Suitable Reference Genes for RT-qPCR Data in Achyranthes bidentata Blume under Different Experimental Conditions

    Directory of Open Access Journals (Sweden)

    Jinting Li

    2017-05-01

    Full Text Available Real-time quantitative polymerase chain reaction (RT-qPCR is a sensitive technique for gene expression studies. However, choosing the appropriate reference gene is essential to obtain reliable results for RT-qPCR assays. In the present work, the expression of eight candidate reference genes, EF1-α (elongation factor 1-α, GAPDH (glyceraldehyde 3-phosphate dehydrogenase, UBC (ubiquitin-conjugating enzyme, UBQ (polyubiquitin, ACT (actin, β-TUB (β-tubulin, APT1 (adenine phosphoribosyltransferase 1, and 18S rRNA (18S ribosomal RNA, was evaluated in Achyranthes bidentata samples using two algorithms, geNorm and NormFinder. The samples were classified into groups according to developmental stages, various tissues, stresses (cold, heat, drought, NaCl, and hormone treatments (MeJA, IBA, SA. Suitable combination of reference genes for RT-qPCR normalization should be applied according to different experimental conditions. In this study, EF1-α, UBC, and ACT genes were verified as the suitable reference genes across all tested samples. To validate the suitability of the reference genes, we evaluated the relative expression of CAS, which is a gene that may be involved in phytosterol synthesis. Our results provide the foundation for gene expression analysis in A. bidentata and other species of Amaranthaceae.

  3. Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions

    Directory of Open Access Journals (Sweden)

    Liang Rubing

    2010-08-01

    Full Text Available Abstract Background The lambda Red recombination system has been used to inactivate chromosomal genes in various bacteria and fungi. The procedure consists of electroporating a polymerase chain reaction (PCR fragment containing antibiotic cassette flanked by homology regions to the target locus into a strain that can express the lambda Red proteins (Gam, Bet, Exo. Results Here a scarless gene modification strategy based on the Red recombination system has been developed to modify Pseudomonas genome DNA via sequential deletion of multiple targets. This process was mediated by plasmid pRKaraRed encoding the Red proteins regulated by PBAD promoter, which was functional in P. aeruginosa as well as in other bacteria. First the target gene was substituted for the sacB-bla cassette flanked by short homology regions (50 bp, and then this marker gene cassette could be replaced by the PCR fragment flanking itself, generating target-deleted genome without any remnants and no change happened to the surrounding region. Twenty genes involved in the synthesis and regulation pathways of the phenazine derivate, pyocyanin, were modified, including one single-point mutation and deletion of two large operons. The recombination efficiencies ranged from 88% to 98%. Multiple-gene modification was also achieved, generating a triple-gene deletion strain PCA (PAO1, ΔphzHΔphzMΔphzS, which could produce another phenazine derivate, phenazine-1-carboxylic acid (PCA, efficiently and exclusively. Conclusions This lambda Red-based technique can be used to generate scarless and sequential gene modification mutants of P. aeruginosa efficiently, using one-step PCR product flanked by short homology regions. Single-point mutation, scarless deletion of genes can be achieved easily in less than three days. This method may give a new way to construct genetically modified P. aeruginosa strains more efficiently and advance the regulatory network study of this organism.

  4. Assessment of reference gene stability in Rice stripe virus and Rice black streaked dwarf virus infection rice by quantitative Real-time PCR.

    Science.gov (United States)

    Fang, Peng; Lu, Rongfei; Sun, Feng; Lan, Ying; Shen, Wenbiao; Du, Linlin; Zhou, Yijun; Zhou, Tong

    2015-10-24

    Stably expressed reference gene(s) normalization is important for the understanding of gene expression patterns by quantitative Real-time PCR (RT-qPCR), particularly for Rice stripe virus (RSV) and Rice black streaked dwarf virus (RBSDV) that caused seriously damage on rice plants in China and Southeast Asia. The expression of fourteen common used reference genes of Oryza sativa L. were evaluated by RT-qPCR in RSV and RBSDV infected rice plants. Suitable normalization reference gene(s) were identified by geNorm and NormFinder algorithms. UBQ 10 + GAPDH and UBC + Actin1 were identified as suitable reference genes for RT-qPCR normalization under RSV and RBSDV infection, respectively. When using multiple reference genes, the expression patterns of OsPRIb and OsWRKY, two virus resistance genes, were approximately similar with that reported previously. Comparatively, by using single reference gene (TIP41-Like), a weaker inducible response was observed. We proposed that the combination of two reference genes could obtain more accurate and reliable normalization of RT-qPCR results in RSV- and RBSDV-infected plants. This work therefore sheds light on establishing a standardized RT-qPCR procedure in RSV- and RBSDV-infected rice plants, and might serve as an important point for discovering complex regulatory networks and identifying genes relevant to biological processes or implicated in virus.

  5. PCR-based detection of gene transfer vectors: application to gene doping surveillance.

    Science.gov (United States)

    Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

    2013-12-01

    Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

  6. Reference gene validation for qPCR in rat carotid body during postnatal development

    Directory of Open Access Journals (Sweden)

    Carroll John L

    2011-10-01

    Full Text Available Abstract Background The carotid bodies are the main arterial oxygen chemoreceptors in mammals. Afferent neural output from the carotid bodies to brainstem respiratory and cardiovascular nuclei provides tonic input and mediates important protective responses to acute and chronic hypoxia. It is widely accepted that the selection of reference genes for mRNA normalization in quantitative real-time PCR must be validated for a given tissue and set of conditions. This is particularly important for studies in carotid body during early postnatal maturation as the arterial oxygen tension undergoes major changes from fetal to postnatal life, which may affect reference gene expression. In order to determine the most stable and suitable reference genes for the study of rat carotid body during development, six commonly used reference genes, β-actin, RPII (RNA polymerase II, PPIA (peptidyl-proyl-isomerase A, TBP (TATA-box binding protein, GAPDH, and 18s rRNA, were evaluated in two age groups (P0-1 and P14-16 under three environmental oxygen conditions (normoxia, chronic hypoxia and chronic hyperoxia using the three most commonly used software programs, geNorm, NormFinder and BestKeeper. Findings The three programs produced similar results but the reference gene rankings were not identical between programs or experimental conditions. Overall, 18s rRNA was the least stable reference gene for carotid body and, when hyperoxia and/or hypoxia conditions were included, actin was similarly unstable. Conclusions Reference or housekeeping gene expression for qPCR studies of carotid body during postnatal development may vary with developmental stage and environmental conditions. Selection of the best reference gene or combination of reference genes for carotid body development studies should take environmental conditions into account. Two commonly used reference genes, 18s rRNA and actin, may be unsuitable for studies of carotid body maturation, especially if the study

  7. Identification and validation of suitable endogenous reference genes for gene expression studies in human peripheral blood

    Directory of Open Access Journals (Sweden)

    Turner Renee J

    2009-08-01

    Full Text Available Abstract Background Gene expression studies require appropriate normalization methods. One such method uses stably expressed reference genes. Since suitable reference genes appear to be unique for each tissue, we have identified an optimal set of the most stably expressed genes in human blood that can be used for normalization. Methods Whole-genome Affymetrix Human 2.0 Plus arrays were examined from 526 samples of males and females ages 2 to 78, including control subjects and patients with Tourette syndrome, stroke, migraine, muscular dystrophy, and autism. The top 100 most stably expressed genes with a broad range of expression levels were identified. To validate the best candidate genes, we performed quantitative RT-PCR on a subset of 10 genes (TRAP1, DECR1, FPGS, FARP1, MAPRE2, PEX16, GINS2, CRY2, CSNK1G2 and A4GALT, 4 commonly employed reference genes (GAPDH, ACTB, B2M and HMBS and PPIB, previously reported to be stably expressed in blood. Expression stability and ranking analysis were performed using GeNorm and NormFinder algorithms. Results Reference genes were ranked based on their expression stability and the minimum number of genes needed for nomalization as calculated using GeNorm showed that the fewest, most stably expressed genes needed for acurate normalization in RNA expression studies of human whole blood is a combination of TRAP1, FPGS, DECR1 and PPIB. We confirmed the ranking of the best candidate control genes by using an alternative algorithm (NormFinder. Conclusion The reference genes identified in this study are stably expressed in whole blood of humans of both genders with multiple disease conditions and ages 2 to 78. Importantly, they also have different functions within cells and thus should be expressed independently of each other. These genes should be useful as normalization genes for microarray and RT-PCR whole blood studies of human physiology, metabolism and disease.

  8. Metallothionein gene expression in renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Deeksha Pal

    2014-01-01

    Full Text Available Introduction: Metallothioneins (MTs are a group of low-molecular weight, cysteine-rich proteins. In general, MT is known to modulate three fundamental processes: (1 the release of gaseous mediators such as hydroxyl radical or nitric oxide, (2 apoptosis and (3 the binding and exchange of heavy metals such as zinc, cadmium or copper. Previous studies have shown a positive correlation between the expression of MT with invasion, metastasis and poor prognosis in various cancers. Most of the previous studies primarily used immunohistochemistry to analyze localization of MT in renal cell carcinoma (RCC. No information is available on the gene expression of MT2A isoform in different types and grades of RCC. Materials and Methods: In the present study, total RNA was isolated from 38 histopathologically confirmed cases of RCC of different types and grades. Corresponding adjacent normal renal parenchyma was taken as control. Real-time polymerase chain reaction (RT PCR analysis was done for the MT2A gene expression using b-actin as an internal control. All statistical calculations were performed using SPSS software. Results: The MT2A gene expression was found to be significantly increased (P < 0.01 in clear cell RCC in comparison with the adjacent normal renal parenchyma. The expression of MT2A was two to three-fold higher in sarcomatoid RCC, whereas there was no change in papillary and collecting duct RCC. MT2A gene expression was significantly higher in lower grade (grades I and II, P < 0.05, while no change was observed in high-grade tumor (grade III and IV in comparison to adjacent normal renal tissue. Conclusion: The first report of the expression of MT2A in different types and grades of RCC and also these data further support the role of MT2A in tumorigenesis.

  9. Selection of reference genes for gene expression studies in heart failure for left and right ventricles.

    Science.gov (United States)

    Li, Mengmeng; Rao, Man; Chen, Kai; Zhou, Jianye; Song, Jiangping

    2017-07-15

    Real-time quantitative reverse transcriptase-PCR (qRT-PCR) is a feasible tool for determining gene expression profiles, but the accuracy and reliability of the results depends on the stable expression of selected housekeeping genes in different samples. By far, researches on stable housekeeping genes in human heart failure samples are rare. Moreover the effect of heart failure on the expression of housekeeping genes in right and left ventricles is yet to be studied. Therefore we aim to provide stable housekeeping genes for both ventricles in heart failure and normal heart samples. In this study, we selected seven commonly used housekeeping genes as candidates. By using the qRT-PCR, the expression levels of ACTB, RAB7A, GAPDH, REEP5, RPL5, PSMB4 and VCP in eight heart failure and four normal heart samples were assessed. The stability of candidate housekeeping genes was evaluated by geNorm and Normfinder softwares. GAPDH showed the least variation in all heart samples. Results also indicated the difference of gene expression existed in heart failure left and right ventricles. GAPDH had the highest expression stability in both heart failure and normal heart samples. We also propose using different sets of housekeeping genes for left and right ventricles respectively. The combination of RPL5, GAPDH and PSMB4 is suitable for the right ventricle and the combination of GAPDH, REEP5 and RAB7A is suitable for the left ventricle. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  11. Selection of internal control genes for real-time quantitative PCR in ovary and uterus of sows across pregnancy.

    Directory of Open Access Journals (Sweden)

    María Martínez-Giner

    Full Text Available BACKGROUND: Reproductive traits play a key role in pig production in order to reduce costs and increase economic returns. Among others, gene expression analyses represent a useful approach to study genetic mechanisms underlying reproductive traits in pigs. The application of reverse-transcription quantitative PCR requires the selection of appropriate reference genes, whose expression levels should not be affected by the experimental conditions, especially when comparing gene expression across different physiological stages. RESULTS: The gene expression stability of ten potential reference genes was studied by three different methods (geNorm, NormFinder and BestKeeper in ovary and uterus collected at five different physiological time points (heat, and 15, 30, 45 and 60 days of pregnancy. Although final ranking differed, the three algorithms gave very similar results. Thus, the most stable genes across time were TBP and UBC in uterus and TBP and HPRT1 in ovary, while HMBS and ACTB showed the less stable expression in uterus and ovary, respectively. When studied as a systematic effect, the reproductive stage did not significantly affect the expression of the candidate reference genes except at 30d and 60d of pregnancy, when a general drop in expression was observed in ovary. CONCLUSIONS: Based in our results, we propose the use of TBP, UBC and SDHA in uterus and TBP, GNB2L1 and HPRT1 in ovary for normalization of longitudinal expression studies using quantitative PCR in sows.

  12. Unstable Expression of Commonly Used Reference Genes in Rat Pancreatic Islets Early after Isolation Affects Results of Gene Expression Studies.

    Directory of Open Access Journals (Sweden)

    Lucie Kosinová

    Full Text Available The use of RT-qPCR provides a powerful tool for gene expression studies; however, the proper interpretation of the obtained data is crucially dependent on accurate normalization based on stable reference genes. Recently, strong evidence has been shown indicating that the expression of many commonly used reference genes may vary significantly due to diverse experimental conditions. The isolation of pancreatic islets is a complicated procedure which creates severe mechanical and metabolic stress leading possibly to cellular damage and alteration of gene expression. Despite of this, freshly isolated islets frequently serve as a control in various gene expression and intervention studies. The aim of our study was to determine expression of 16 candidate reference genes and one gene of interest (F3 in isolated rat pancreatic islets during short-term cultivation in order to find a suitable endogenous control for gene expression studies. We compared the expression stability of the most commonly used reference genes and evaluated the reliability of relative and absolute quantification using RT-qPCR during 0-120 hrs after isolation. In freshly isolated islets, the expression of all tested genes was markedly depressed and it increased several times throughout the first 48 hrs of cultivation. We observed significant variability among samples at 0 and 24 hrs but substantial stabilization from 48 hrs onwards. During the first 48 hrs, relative quantification failed to reflect the real changes in respective mRNA concentrations while in the interval 48-120 hrs, the relative expression generally paralleled the results determined by absolute quantification. Thus, our data call into question the suitability of relative quantification for gene expression analysis in pancreatic islets during the first 48 hrs of cultivation, as the results may be significantly affected by unstable expression of reference genes. However, this method could provide reliable information

  13. Application of anti-listerial bacteriocins: monitoring enterocin expression by multiplex relative reverse transcription-PCR.

    Science.gov (United States)

    Williams, D Ross; Chanos, Panagiotis

    2012-12-01

    Listeriosis is a deadly food-borne disease, and its incidence may be limited through the biotechnological exploitation of a number of anti-listerial biocontrol agents. The most widely used of these agents are bacteriocins and the Class II enterocins are characterized by their activity against Listeria. Enterocins are primarily produced by enterococci, particularly Enterococcus faecium and many strains have been described, often encoding multiple bacteriocins. The use of these strains in food will require that they are free of virulence functions and that they exhibit a high level expression of anti-listerial enterocins in fermentation conditions. Multiplex relative RT (reverse transcription)-PCR is a technique that is useful in the discovery of advantageous expression characteristics among enterocin-producing strains. It allows the levels of individual enterocin gene expression to be monitored and determination of how expression is altered under different growth conditions.

  14. Identification of appropriate reference genes for human mesenchymal stem cell analysis by quantitative real-time PCR.

    Science.gov (United States)

    Li, Xiuying; Yang, Qiwei; Bai, Jinping; Xuan, Yali; Wang, Yimin

    2015-01-01

    Normalization to a reference gene is the method of choice for quantitative reverse transcription-PCR (RT-qPCR) analysis. The stability of reference genes is critical for accurate experimental results and conclusions. We have evaluated the expression stability of eight commonly used reference genes found in four different human mesenchymal stem cells (MSC). Using geNorm, NormFinder and BestKeeper algorithms, we show that beta-2-microglobulin and peptidyl-prolylisomerase A were the optimal reference genes for normalizing RT-qPCR data obtained from MSC, whereas the TATA box binding protein was not suitable due to its extensive variability in expression. Our findings emphasize the significance of validating reference genes for qPCR analyses. We offer a short list of reference genes to use for normalization and recommend some commercially-available software programs as a rapid approach to validate reference genes. We also demonstrate that the two reference genes, β-actin and glyceraldehyde-3-phosphate dehydrogenase, are frequently used are not always successful in many cases.

  15. Differential expression of granulopoiesis related genes in neutrophil subsets distinguished by membrane expression of CD177

    DEFF Research Database (Denmark)

    Hu, Nan; Mora-Jensen, Helena; Theilgaard-Mønch, Kim

    2014-01-01

    OBJECTIVE: Differential gene expression in CD177+ and CD177- neutrophils was investigated, in order to detect possible differences in neutrophil function which could be related to the pathogenesis of ANCA-associated Vasculitides (AAV). METHODS: Neutrophils were isolated from healthy controls (HC......) with high, negative or bimodal CD177 expression, and sorted into CD177+ and CD177- subpopulations. Total RNA was screened for expression of 24,000 probes with Illumina Ref-8 Beadchips. Genes showing differential expression between CD177+ and CD177- subsets in microarray analysis were re-assessed using...... quantitative-PCR. CD177 expression on neutrophil precursors in bone marrow was analyzed using quantitative PCR and flowcytometry. RESULTS: The proportion of CD177+ cells increased during neutrophil maturation in bone marrow. Fold change analysis of gene expression profile of sorted CD177+ and CD177...

  16. Validation of potential reference genes for qPCR in maize across abiotic stresses, hormone treatments, and tissue types.

    Directory of Open Access Journals (Sweden)

    Yueai Lin

    Full Text Available The reverse transcription quantitative polymerase chain reaction (RT-qPCR is a powerful and widely used technique for the measurement of gene expression. Reference genes, which serve as endogenous controls ensure that the results are accurate and reproducible, are vital for data normalization. To bolster the literature on reference gene selection in maize, ten candidate reference genes, including eight traditionally used internal control genes and two potential candidate genes from our microarray datasets, were evaluated for expression level in maize across abiotic stresses (cold, heat, salinity, and PEG, phytohormone treatments (abscisic acid, salicylic acid, jasmonic acid, ethylene, and gibberellins, and different tissue types. Three analytical software packages, geNorm, NormFinder, and Bestkeeper, were used to assess the stability of reference gene expression. The results revealed that elongation factor 1 alpha (EF1α, tubulin beta (β-TUB, cyclophilin (CYP, and eukaryotic initiation factor 4A (EIF4A were the most reliable reference genes for overall gene expression normalization in maize, while GRP (Glycine-rich RNA-binding protein, GLU1(beta-glucosidase, and UBQ9 (ubiquitin 9 were the least stable and most unsuitable genes. In addition, the suitability of EF1α, β-TUB, and their combination as reference genes was confirmed by validating the expression of WRKY50 in various samples. The current study indicates the appropriate reference genes for the urgent requirement of gene expression normalization in maize across certain abiotic stresses, hormones, and tissue types.

  17. Defining suitable reference genes for RT-qPCR analysis on human sertoli cells after 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure.

    Science.gov (United States)

    Ribeiro, Mariana Antunes; dos Reis, Mariana Bisarro; de Moraes, Leonardo Nazário; Briton-Jones, Christine; Rainho, Cláudia Aparecida; Scarano, Wellerson Rodrigo

    2014-11-01

    Quantitative real-time RT-PCR (qPCR) has proven to be a valuable molecular technique to quantify gene expression. There are few studies in the literature that describe suitable reference genes to normalize gene expression data. Studies of transcriptionally disruptive toxins, like tetrachlorodibenzo-p-dioxin (TCDD), require careful consideration of reference genes. The present study was designed to validate potential reference genes in human Sertoli cells after exposure to TCDD. 32 candidate reference genes were analyzed to determine their applicability. geNorm and NormFinder softwares were used to obtain an estimation of the expression stability of the 32 genes and to identify the most suitable genes for qPCR data normalization.

  18. Transgenic Arabidopsis Gene Expression System

    Science.gov (United States)

    Ferl, Robert; Paul, Anna-Lisa

    2009-01-01

    The Transgenic Arabidopsis Gene Expression System (TAGES) investigation is one in a pair of investigations that use the Advanced Biological Research System (ABRS) facility. TAGES uses Arabidopsis thaliana, thale cress, with sensor promoter-reporter gene constructs that render the plants as biomonitors (an organism used to determine the quality of the surrounding environment) of their environment using real-time nondestructive Green Fluorescent Protein (GFP) imagery and traditional postflight analyses.

  19. Validation of suitable reference genes for quantitative gene expression analysis in Panax ginseng

    Directory of Open Access Journals (Sweden)

    Meizhen eWang

    2016-01-01

    Full Text Available Reverse transcription-qPCR (RT-qPCR has become a popular method for gene expression studies. Its results require data normalization by housekeeping genes. No single gene is proved to be stably expressed under all experimental conditions. Therefore, systematic evaluation of reference genes is necessary. With the aim to identify optimum reference genes for RT-qPCR analysis of gene expression in different tissues of Panax ginseng and the seedlings grown under heat stress, we investigated the expression stability of eight candidate reference genes, including elongation factor 1-beta (EF1-β, elongation factor 1-gamma (EF1-γ, eukaryotic translation initiation factor 3G (IF3G, eukaryotic translation initiation factor 3B (IF3B, actin (ACT, actin11 (ACT11, glyceraldehyde-3-phosphate dehydrogenase (GAPDH and cyclophilin ABH-like protein (CYC, using four widely used computational programs: geNorm, Normfinder, BestKeeper, and the comparative ΔCt method. The results were then integrated using the web-based tool RefFinder. As a result, EF1-γ, IF3G and EF1-β were the three most stable genes in different tissues of P. ginseng, while IF3G, ACT11 and GAPDH were the top three-ranked genes in seedlings treated with heat. Using three better reference genes alone or in combination as internal control, we examined the expression profiles of MAR, a multiple function-associated mRNA-like non-coding RNA (mlncRNA in P. ginseng. Taken together, we recommended EF1-γ/IF3G and IF3G/ACT11 as the suitable pair of reference genes for RT-qPCR analysis of gene expression in different tissues of P. ginseng and the seedlings grown under heat stress, respectively. The results serve as a foundation for future studies on P. ginseng functional genomics.

  20. Human papillomavirus gene expression

    International Nuclear Information System (INIS)

    Chow, L.T.; Hirochika, H.; Nasseri, M.; Stoler, M.H.; Wolinsky, S.M.; Chin, M.T.; Hirochika, R.; Arvan, D.S.; Broker, T.R.

    1987-01-01

    To determine the role of tissue differentiation on expression of each of the papillomavirus mRNA species identified by electron microscopy, the authors prepared exon-specific RNA probes that could distinguish the alternatively spliced mRNA species. Radioactively labeled single-stranded RNA probes were generated from a dual promoter vector system and individually hybridized to adjacent serial sections of formalin-fixed, paraffin-embedded biopsies of condylomata. Autoradiography showed that each of the message species had a characteristic tissue distribution and relative abundance. The authors have characterized a portion of the regulatory network of the HPVs by showing that the E2 ORF encodes a trans-acting enhancer-stimulating protein, as it does in BPV-1 (Spalholz et al. 1985). The HPV-11 enhancer was mapped to a 150-bp tract near the 3' end of the URR. Portions of this region are duplicated in some aggressive strains of HPV-6 (Boshart and zur Hausen 1986; Rando et al. 1986). To test the possible biological relevance of these duplications, they cloned tandem arrays of the enhancer and demonstrated, using a chloramphenicol acetyltransferase (CAT) assay, that they led to dramatically increased transcription proportional to copy number. Using the CAT assays, the authors found that the E2 proteins of several papillomavirus types can cross-stimulate the enhancers of most other types. This suggests that prior infection of a tissue with one papillomavirus type may provide a helper effect for superinfection and might account fo the HPV-6/HPV-16 coinfections in condylomata that they have observed

  1. Elasmobranch qPCR reference genes: a case study of hypoxia preconditioned epaulette sharks

    Directory of Open Access Journals (Sweden)

    Ashton Kevin J

    2010-04-01

    Full Text Available Abstract Background Elasmobranch fishes are an ancient group of vertebrates which have high potential as model species for research into evolutionary physiology and genomics. However, no comparative studies have established suitable reference genes for quantitative PCR (qPCR in elasmobranchs for any physiological conditions. Oxygen availability has been a major force shaping the physiological evolution of vertebrates, especially fishes. Here we examined the suitability of 9 reference candidates from various functional categories after a single hypoxic insult or after hypoxia preconditioning in epaulette shark (Hemiscyllium ocellatum. Results Epaulette sharks were caught and exposed to hypoxia. Tissues were collected from 10 controls, 10 individuals with single hypoxic insult and 10 individuals with hypoxia preconditioning (8 hypoxic insults, 12 hours apart. We produced sequence information for reference gene candidates and monitored mRNA expression levels in four tissues: cerebellum, heart, gill and eye. The stability of the genes was examined with analysis of variance, geNorm and NormFinder. The best ranking genes in our study were eukaryotic translation elongation factor 1 beta (eef1b, ubiquitin (ubq and polymerase (RNA II (DNA directed polypeptide F (polr2f. The performance of the ribosomal protein L6 (rpl6 was tissue-dependent. Notably, in one tissue the analysis of variance indicated statistically significant differences between treatments for genes that were ranked as the most stable candidates by reference gene software. Conclusions Our results indicate that eef1b and ubq are generally the most suitable reference genes for the conditions and tissues in the present epaulette shark studies. These genes could also be potential reference gene candidates for other physiological studies examining stress in elasmobranchs. The results emphasise the importance of inter-group variation in reference gene evaluation.

  2. Gene expression profiling of placentas affected by pre-eclampsia

    DEFF Research Database (Denmark)

    Hoegh, Anne Mette; Borup, Rehannah; Nielsen, Finn Cilius

    2010-01-01

    Several studies point to the placenta as the primary cause of pre-eclampsia. Our objective was to identify placental genes that may contribute to the development of pre-eclampsia. RNA was purified from tissue biopsies from eleven pre-eclamptic placentas and eighteen normal controls. Messenger RNA...... expression from pooled samples was analysed by microarrays. Verification of the expression of selected genes was performed using real-time PCR. A surprisingly low number of genes (21 out of 15,000) were identified as differentially expressed. Among these were genes not previously associated with pre-eclampsia...... as bradykinin B1 receptor and a 14-3-3 protein, but also genes that have already been connected with pre-eclampsia, for example, inhibin beta A subunit and leptin. A low number of genes were repeatedly identified as differentially expressed, because they may represent the endpoint of a cascade of events...

  3. A Marfan syndrome gene expression phenotype in cultured skin fibroblasts

    Directory of Open Access Journals (Sweden)

    Emond Mary

    2007-09-01

    Full Text Available Abstract Background Marfan syndrome (MFS is a heritable connective tissue disorder caused by mutations in the fibrillin-1 gene. This syndrome constitutes a significant identifiable subtype of aortic aneurysmal disease, accounting for over 5% of ascending and thoracic aortic aneurysms. Results We used spotted membrane DNA macroarrays to identify genes whose altered expression levels may contribute to the phenotype of the disease. Our analysis of 4132 genes identified a subset with significant expression differences between skin fibroblast cultures from unaffected controls versus cultures from affected individuals with known fibrillin-1 mutations. Subsequently, 10 genes were chosen for validation by quantitative RT-PCR. Conclusion Differential expression of many of the validated genes was associated with MFS samples when an additional group of unaffected and MFS affected subjects were analyzed (p-value -6 under the null hypothesis that expression levels in cultured fibroblasts are unaffected by MFS status. An unexpected observation was the range of individual gene expression. In unaffected control subjects, expression ranges exceeding 10 fold were seen in many of the genes selected for qRT-PCR validation. The variation in expression in the MFS affected subjects was even greater.

  4. Evaluation of reference genes for real-time quantitative PCR studies in Candida glabrata following azole treatment

    Directory of Open Access Journals (Sweden)

    Li Qingdi

    2012-06-01

    Full Text Available Abstract Background The selection of stable and suitable reference genes for real-time quantitative PCR (RT-qPCR is a crucial prerequisite for reliable gene expression analysis under different experimental conditions. The present study aimed to identify reference genes as internal controls for gene expression studies by RT-qPCR in azole-stimulated Candida glabrata. Results The expression stability of 16 reference genes under fluconazole stress was evaluated using fold change and standard deviation computations with the hkgFinder tool. Our data revealed that the mRNA expression levels of three ribosomal RNAs (RDN5.8, RDN18, and RDN25 remained stable in response to fluconazole, while PGK1, UBC7, and UBC13 mRNAs showed only approximately 2.9-, 3.0-, and 2.5-fold induction by azole, respectively. By contrast, mRNA levels of the other 10 reference genes (ACT1, EF1α, GAPDH, PPIA, RPL2A, RPL10, RPL13A, SDHA, TUB1, and UBC4 were dramatically increased in C. glabrata following antifungal treatment, exhibiting changes ranging from 4.5- to 32.7-fold. We also assessed the expression stability of these reference genes using the 2-ΔΔCT method and three other software packages. The stability rankings of the reference genes by geNorm and the 2-ΔΔCT method were identical to those by hkgFinder, whereas the stability rankings by BestKeeper and NormFinder were notably different. We then validated the suitability of six candidate reference genes (ACT1, PGK1, RDN5.8, RDN18, UBC7, and UBC13 as internal controls for ten target genes in this system using the comparative CT method. Our validation experiments passed for all six reference genes analyzed except RDN18, where the amplification efficiency of RDN18 was different from that of the ten target genes. Finally, we demonstrated that the relative quantification of target gene expression varied according to the endogenous control used, highlighting the importance of the choice of internal controls in such

  5. Gene expression analysis in prostate cancer: the importance of the endogenous control.

    LENUS (Irish Health Repository)

    Vajda, Alice

    2013-03-01

    Aberrant gene expression is a hallmark of cancer. Quantitative reverse-transcription PCR (qRT-PCR) is the gold-standard for quantifying gene expression, and commonly employs a house-keeping gene (HKG) as an endogenous control to normalize results; the choice of which is critical for accurate data interpretation. Many factors, including sample type, pathological state, and oxygen levels influence gene expression including putative HKGs. The aim of this study was to determine the suitability of commonly used HKGs for qRT-PCR in prostate cancer.

  6. Analysis on the arcelin expression in bruchid pest resistant wild pulses using real time RT-qPCR.

    Science.gov (United States)

    Sakthivelkumar, Shanmugavel; Veeramani, Velayutham; Hilda, Karuppiah; Arumugam, Munusamy; Janarthanan, Sundaram

    2014-12-01

    Arcelin, the antimetabolic protein from wild pulses is a known natural insecticidal molecule. Wild pulses with high arcelin content could serve as potential source to. increase the levels of insect resistance in cultivated pulse crops. In this study, arcelin (Arl) gene expression was screened in seven stored product insect pest resistant wild pulse varieties using real time RT-qPCR. Arcelin gene specific real time PCR primers were synthesized from arcelin mRNA sequence of the wild pulse variety, Lablab purpureus. The results revealed different levels of arcelin gene expression in the tested varieties. Canavalia virosa registered significantly high content indicating its suitability for utilization of arcelin gene in developing stored product insect pest resistance with other cultivated pulses.

  7. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula.

    Directory of Open Access Journals (Sweden)

    Wun S Chao

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference genes. The aim of this study was to find internal reference genes for qRT-PCR analysis in various experimental conditions for seed, adventitious underground bud, and other organs of leafy spurge. Eleven candidate reference genes (BAM4, PU1, TRP-like, FRO1, ORE9, BAM1, SEU, ARF2, KAPP, ZTL, and MPK4 were selected from among 171 genes based on expression stabilities during seed germination and bud growth. The other ten candidate reference genes were selected from three different sources: (1 3 stably expressed leafy spurge genes (60S, bZIP21, and MD-100 identified from the analyses of leafy spurge microarray data; (2 3 orthologs of Arabidopsis "general purpose" traditional reference genes (GAPDH_1, GAPDH_2, and UBC; and (3 4 orthologs of Arabidopsis stably expressed genes (UBC9, SAND, PTB, and F-box identified from Affymetrix ATH1 whole-genome GeneChip studies. The expression stabilities of these 21 genes were ranked based on the C(T values of 72 samples using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ΔC(T method. Our analyses revealed SAND, PTB, ORE9, and ARF2 to be the most appropriate reference genes for accurate normalization of gene expression data. Since SAND and PTB were obtained from 4 orthologs of Arabidopsis, while ORE9 and ARF2 were selected from 171 leafy spurge genes, it was more efficient to identify good reference genes from the orthologs of other plant species that were known to be stably expressed than that of randomly testing endogenous genes. Nevertheless, the two newly identified leafy spurge genes, ORE9 and ARF2, can serve as orthologous candidates in the search for reference genes

  8. Selection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Neutelings Godfrey

    2010-04-01

    Full Text Available Abstract Background Quantitative real-time PCR (qRT-PCR is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs. Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L. Results Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups. qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59. LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both ge

  9. Selection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Huis, Rudy; Hawkins, Simon; Neutelings, Godfrey

    2010-04-19

    Quantitative real-time PCR (qRT-PCR) is currently the most accurate method for detecting differential gene expression. Such an approach depends on the identification of uniformly expressed 'housekeeping genes' (HKGs). Extensive transcriptomic data mining and experimental validation in different model plants have shown that the reliability of these endogenous controls can be influenced by the plant species, growth conditions and organs/tissues examined. It is therefore important to identify the best reference genes to use in each biological system before using qRT-PCR to investigate differential gene expression. In this paper we evaluate different candidate HKGs for developmental transcriptomic studies in the economically-important flax fiber- and oil-crop (Linum usitatissimum L). Specific primers were designed in order to quantify the expression levels of 20 different potential housekeeping genes in flax roots, internal- and external-stem tissues, leaves and flowers at different developmental stages. After calculations of PCR efficiencies, 13 HKGs were retained and their expression stabilities evaluated by the computer algorithms geNorm and NormFinder. According to geNorm, 2 Transcriptional Elongation Factors (TEFs) and 1 Ubiquitin gene are necessary for normalizing gene expression when all studied samples are considered. However, only 2 TEFs are required for normalizing expression in stem tissues. In contrast, NormFinder identified glyceraldehyde-3-phosphate dehydrogenase (GADPH) as the most stably expressed gene when all samples were grouped together, as well as when samples were classed into different sub-groups.qRT-PCR was then used to investigate the relative expression levels of two splice variants of the flax LuMYB1 gene (homologue of AtMYB59). LuMYB1-1 and LuMYB1-2 were highly expressed in the internal stem tissues as compared to outer stem tissues and other samples. This result was confirmed with both geNorm-designated- and Norm

  10. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development.

    Science.gov (United States)

    Cheng, Yuan; Bian, Wuying; Pang, Xin; Yu, Jiahong; Ahammed, Golam J; Zhou, Guozhi; Wang, Rongqing; Ruan, Meiying; Li, Zhimiao; Ye, Qingjing; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian

    2017-01-01

    Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR) is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs). Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red) using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170), SlFRG12 (Solyc04g009770), SlFRG16 (Solyc10g081190), SlFRG27 (Solyc06g007510), and SlFRG37 (Solyc11g005330) were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070) and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  11. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development

    Directory of Open Access Journals (Sweden)

    Yuan Cheng

    2017-08-01

    Full Text Available Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs. Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170, SlFRG12 (Solyc04g009770, SlFRG16 (Solyc10g081190, SlFRG27 (Solyc06g007510, and SlFRG37 (Solyc11g005330 were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070 and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  12. PRAME Gene Expression in Acute Leukemia and Its Clinical Significance

    International Nuclear Information System (INIS)

    Ding, Kai; Wang, Xiao-ming; Fu, Rong; Ruan, Er-bao; Liu, Hui; Shao, Zong-hong

    2012-01-01

    To investigate the expression of the preferentially expressed antigen of melanoma (PRAME) gene in acute leukemia and its clinical significance. The level of expressed PRAME mRNA in bone marrow mononuclear cells from 34 patients with acute leukemia (AL) and in 12 bone marrow samples from healthy volunteers was measured via RT-PCR. Correlation analyses between PRAME gene expression and the clinical characteristics (gender, age, white blood count, immunophenotype of leukemia, percentage of blast cells, and karyotype) of the patients were performed. The PRAME gene was expressed in 38.2% of all 34 patients, in 40.7% of the patients with acute myelogenous leukemia (AML, n=27), and in 28.6% of the patients with acute lymphoblastic leukemia (ALL, n=7), but was not expressed in the healthy volunteers. The difference in the expression levels between AML and ALL patients was statistically significant. The rate of gene expression was 80% in M 3 , 33.3% in M 2 , and 28.6% in M 5 . Gene expression was also found to be correlated with CD15 and CD33 expression and abnormal karyotype, but not with age, gender, white blood count or percentage of blast cells. The PRAME gene is highly expressed in acute leukemia and could be a useful marker to monitor minimal residual disease. This gene is also a candidate target for the immunotherapy of acute leukemia

  13. Homeobox gene expression in Brachiopoda

    DEFF Research Database (Denmark)

    Altenburger, Andreas; Martinez, Pedro; Wanninger, Andreas

    2011-01-01

    (ectoderm) specification with co-opted functions in notochord formation in chordates and left/right determination in ambulacrarians and vertebrates. The caudal ortholog, TtrCdx, is first expressed in the ectoderm of the gastrulating embryo in the posterior region of the blastopore. Its expression stays......The molecular control that underlies brachiopod ontogeny is largely unknown. In order to contribute to this issue we analyzed the expression pattern of two homeobox containing genes, Not and Cdx, during development of the rhynchonelliform (i.e., articulate) brachiopod Terebratalia transversa...... completion of larval development, which is marked by a three-lobed body with larval setae. Expression starts at gastrulation in two areas lateral to the blastopore and subsequently extends over the animal pole of the gastrula. With elongation of the gastrula, expression at the animal pole narrows to a small...

  14. Suitable reference genes for real-time PCR in human HBV-related hepatocellular carcinoma with different clinical prognoses

    International Nuclear Information System (INIS)

    Fu, Li-Yun; Jia, Hu-Liang; Dong, Qiong-Zhu; Wu, Jin-Cai; Zhao, Yue; Zhou, Hai-Jun; Ren, Ning; Ye, Qin-Hai; Qin, Lun-Xiu

    2009-01-01

    Housekeeping genes are routinely used as endogenous references to account for experimental differences in gene expression assays. However, recent reports show that they could be de-regulated in different diseases, model animals, or even under varied experimental conditions, which may lead to unreliable results and consequently misinterpretations. This study focused on the selection of suitable reference genes for quantitative PCR in human hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC) with different clinical outcomes. We evaluated 6 commonly used housekeeping genes' expression levels in 108 HBV-related HCCs' matched tumor and non-tomor tissue samples with different clinical outcomes and 26 normal liver specimens by real-time PCR. The expression stability of the 6 genes was compared using the software programs geNorm and NormFinder. To show the impact of reference genes on data analysis, we took PGK1 as a target gene normalized by each reference gene, and performed one-way ANOVA and the equivalence test. With the geNorm and NormFinder software programs, analysis of TBP and HPRT1 showed the best stability in all tissue samples, while 18s and ACTB were less stable. When 18s or ACTB was used for normalization, no significant difference of PGK1 expression (p > 0.05) was found among HCC tissues with and without metastasis, and normal liver specimens; however, dramatically differences (p < 0.001) were observed when either TBP or the combination of TBP and HPRT1 were selected as reference genes. TBP and HPRT1 are the most reliable reference genes for q-PCR normalization in HBV-related HCC specimens. However, the well-used ACTB and 18S are not suitable, which actually lead to the misinterpretation of the results in gene expression analysis

  15. Vascular Gene Expression: A Hypothesis

    Directory of Open Access Journals (Sweden)

    Angélica Concepción eMartínez-Navarro

    2013-07-01

    Full Text Available The phloem is the conduit through which photoassimilates are distributed from autotrophic to heterotrophic tissues and is involved in the distribution of signaling molecules that coordinate plant growth and responses to the environment. Phloem function depends on the coordinate expression of a large array of genes. We have previously identified conserved motifs in upstream regions of the Arabidopsis genes, encoding the homologs of pumpkin phloem sap mRNAs, displaying expression in vascular tissues. This tissue-specific expression in Arabidopsis is predicted by the overrepresentation of GA/CT-rich motifs in gene promoters. In this work we have searched for common motifs in upstream regions of the homologous genes from plants considered to possess a primitive vascular tissue (a lycophyte, as well as from others that lack a true vascular tissue (a bryophyte, and finally from chlorophytes. Both lycophyte and bryophyte display motifs similar to those found in Arabidopsis with a significantly low E-value, while the chlorophytes showed either a different conserved motif or no conserved motif at all. These results suggest that these same genes are expressed coordinately in non- vascular plants; this coordinate expression may have been one of the prerequisites for the development of conducting tissues in plants. We have also analyzed the phylogeny of conserved proteins that may be involved in phloem function and development. The presence of CmPP16, APL, FT and YDA in chlorophytes suggests the recruitment of ancient regulatory networks for the development of the vascular tissue during evolution while OPS is a novel protein specific to vascular plants.

  16. Blood Gene Expression Predicts Bronchiolitis Obliterans Syndrome

    Directory of Open Access Journals (Sweden)

    Richard Danger

    2018-01-01

    Full Text Available Bronchiolitis obliterans syndrome (BOS, the main manifestation of chronic lung allograft dysfunction, leads to poor long-term survival after lung transplantation. Identifying predictors of BOS is essential to prevent the progression of dysfunction before irreversible damage occurs. By using a large set of 107 samples from lung recipients, we performed microarray gene expression profiling of whole blood to identify early biomarkers of BOS, including samples from 49 patients with stable function for at least 3 years, 32 samples collected at least 6 months before BOS diagnosis (prediction group, and 26 samples at or after BOS diagnosis (diagnosis group. An independent set from 25 lung recipients was used for validation by quantitative PCR (13 stables, 11 in the prediction group, and 8 in the diagnosis group. We identified 50 transcripts differentially expressed between stable and BOS recipients. Three genes, namely POU class 2 associating factor 1 (POU2AF1, T-cell leukemia/lymphoma protein 1A (TCL1A, and B cell lymphocyte kinase, were validated as predictive biomarkers of BOS more than 6 months before diagnosis, with areas under the curve of 0.83, 0.77, and 0.78 respectively. These genes allow stratification based on BOS risk (log-rank test p < 0.01 and are not associated with time posttransplantation. This is the first published large-scale gene expression analysis of blood after lung transplantation. The three-gene blood signature could provide clinicians with new tools to improve follow-up and adapt treatment of patients likely to develop BOS.

  17. Neighboring Genes Show Correlated Evolution in Gene Expression

    Science.gov (United States)

    Ghanbarian, Avazeh T.; Hurst, Laurence D.

    2015-01-01

    When considering the evolution of a gene’s expression profile, we commonly assume that this is unaffected by its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between neighboring genes in gene expression profiles in extant taxa. Indeed, in all eukaryotic genomes genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their expression or is gene expression evolution autonomous? To address this here we consider evolution of human gene expression since the human-chimp common ancestor, allowing for both variation in estimation of current expression level and error in Bayesian estimation of the ancestral state. We find that in all tissues and both sexes, the change in gene expression of a focal gene on average predicts the change in gene expression of neighbors. The effect is highly pronounced in the immediate vicinity (genes increasing their expression in humans tend to avoid nuclear lamina domains and be enriched for the gene activator 5-hydroxymethylcytosine, we conclude that, most probably owing to chromatin level control of gene expression, a change in gene expression of one gene likely affects the expression evolution of neighbors, what we term expression piggybacking, an analog of hitchhiking. PMID:25743543

  18. Sleep Deprivation Influences Circadian Gene Expression in the Lateral Habenula.

    Science.gov (United States)

    Zhang, Beilin; Gao, Yanxia; Li, Yang; Yang, Jing; Zhao, Hua

    2016-01-01

    Sleep is governed by homeostasis and the circadian clock. Clock genes play an important role in the generation and maintenance of circadian rhythms but are also involved in regulating sleep homeostasis. The lateral habenular nucleus (LHb) has been implicated in sleep-wake regulation, since LHb gene expression demonstrates circadian oscillation characteristics. This study focuses on the participation of LHb clock genes in regulating sleep homeostasis, as the nature of their involvement is unclear. In this study, we observed changes in sleep pattern following sleep deprivation in LHb-lesioned rats using EEG recording techniques. And then the changes of clock gene expression (Per1, Per2, and Bmal1) in the LHb after 6 hours of sleep deprivation were detected by using real-time quantitative PCR (qPCR). We found that sleep deprivation increased the length of Non-Rapid Eye Movement Sleep (NREMS) and decreased wakefulness. LHb-lesioning decreased the amplitude of reduced wake time and increased NREMS following sleep deprivation in rats. qPCR results demonstrated that Per2 expression was elevated after sleep deprivation, while the other two genes were unaffected. Following sleep recovery, Per2 expression was comparable to the control group. This study provides the basis for further research on the role of LHb Per2 gene in the regulation of sleep homeostasis.

  19. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events

    Directory of Open Access Journals (Sweden)

    Tigst Demeke

    2018-05-01

    Full Text Available Droplet digital PCR (ddPCR has been used for absolute quantification of genetically engineered (GE events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences (HMG-I/Y, FatA(A, CruA and Ccf for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A, reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes. Keywords: Canola, Digital PCR, DNA extraction, GMO, Reference genes

  20. Gene expression profile of pulpitis.

    Science.gov (United States)

    Galicia, J C; Henson, B R; Parker, J S; Khan, A A

    2016-06-01

    The cost, prevalence and pain associated with endodontic disease necessitate an understanding of the fundamental molecular aspects of its pathogenesis. This study was aimed to identify the genetic contributors to pulpal pain and inflammation. Inflamed pulps were collected from patients diagnosed with irreversible pulpitis (n=20). Normal pulps from teeth extracted for various reasons served as controls (n=20). Pain level was assessed using a visual analog scale (VAS). Genome-wide microarray analysis was performed using Affymetrix GeneTitan Multichannel Instrument. The difference in gene expression levels were determined by the significance analysis of microarray program using a false discovery rate (q-value) of 5%. Genes involved in immune response, cytokine-cytokine receptor interaction and signaling, integrin cell surface interactions, and others were expressed at relatively higher levels in the pulpitis group. Moreover, several genes known to modulate pain and inflammation showed differential expression in asymptomatic and mild pain patients (⩾30 mm on VAS) compared with those with moderate to severe pain. This exploratory study provides a molecular basis for the clinical diagnosis of pulpitis. With an enhanced understanding of pulpal inflammation, future studies on treatment and management of pulpitis and on pain associated with it can have a biological reference to bridge treatment strategies with pulpal biology.

  1. Expression profiles for six zebrafish genes during gonadal sex differentiation

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Morthorst, Jane Ebsen; Andersen, Ole

    2008-01-01

    BACKGROUND: The mechanism of sex determination in zebrafish is largely unknown and neither sex chromosomes nor a sex-determining gene have been identified. This indicates that sex determination in zebrafish is mediated by genetic signals from autosomal genes. The aim of this study was to determine...... the precise timing of expression of six genes previously suggested to be associated with sex differentiation in zebrafish. The current study investigates the expression of all six genes in the same individual fish with extensive sampling dates during sex determination and -differentiation. RESULTS......: In the present study, we have used quantitative real-time PCR to investigate the expression of ar, sox9a, dmrt1, fig alpha, cyp19a1a and cyp19a1b during the expected sex determination and gonadal sex differentiation period. The expression of the genes expected to be high in males (ar, sox9a and dmrt1a) and high...

  2. Identification and Evaluation of Reliable Reference Genes for Quantitative Real-Time PCR Analysis in Tea Plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin

    2014-01-01

    Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086

  3. A longitudinal study of gene expression in healthy individuals

    Directory of Open Access Journals (Sweden)

    Tessier Michel

    2009-06-01

    Full Text Available Abstract Background The use of gene expression in venous blood either as a pharmacodynamic marker in clinical trials of drugs or as a diagnostic test requires knowledge of the variability in expression over time in healthy volunteers. Here we defined a normal range of gene expression over 6 months in the blood of four cohorts of healthy men and women who were stratified by age (22–55 years and > 55 years and gender. Methods Eleven immunomodulatory genes likely to play important roles in inflammatory conditions such as rheumatoid arthritis and infection in addition to four genes typically used as reference genes were examined by quantitative reverse transcription-polymerase chain reaction (qRT-PCR, as well as the full genome as represented by Affymetrix HG U133 Plus 2.0 microarrays. Results Gene expression levels as assessed by qRT-PCR and microarray were relatively stable over time with ~2% of genes as measured by microarray showing intra-subject differences over time periods longer than one month. Fifteen genes varied by gender. The eleven genes examined by qRT-PCR remained within a limited dynamic range for all individuals. Specifically, for the seven most stably expressed genes (CXCL1, HMOX1, IL1RN, IL1B, IL6R, PTGS2, and TNF, 95% of all samples profiled fell within 1.5–2.5 Ct, the equivalent of a 4- to 6-fold dynamic range. Two subjects who experienced severe adverse events of cancer and anemia, had microarray gene expression profiles that were distinct from normal while subjects who experienced an infection had only slightly elevated levels of inflammatory markers. Conclusion This study defines the range and variability of gene expression in healthy men and women over a six-month period. These parameters can be used to estimate the number of subjects needed to observe significant differences from normal gene expression in clinical studies. A set of genes that varied by gender was also identified as were a set of genes with elevated

  4. Droplet digital PCR analysis of NOTCH1 gene mutations in chronic lymphocytic leukemia.

    Science.gov (United States)

    Minervini, Angela; Francesco Minervini, Crescenzio; Anelli, Luisa; Zagaria, Antonella; Casieri, Paola; Coccaro, Nicoletta; Cumbo, Cosimo; Tota, Giuseppina; Impera, Luciana; Orsini, Paola; Brunetti, Claudia; Giordano, Annamaria; Specchia, Giorgina; Albano, Francesco

    2016-12-27

    In chronic lymphocytic leukemia (CLL), NOTCH1 gene mutations (NOTCH1mut) have been associated with adverse prognostic features but the independence of these as a prognostic factor is still controversial. In our study we validated a c.7541-7542delCT NOTCH1 mutation assay based on droplet digital PCR (ddPCR); we also analyzed the NOTCH1mut allelic burden, expressed as fractional abundance (FA), in 88 CLL patients at diagnosis to assess its prognostic role and made a longitudinal ddPCR analysis in 10 cases harboring NOTCH1mut to verify the FA variation over time. Our data revealed that with the ddPCR approach the incidence of NOTCH1mut in CLL was much higher (53.4%) than expected. However, longitudinal ddPCR analysis of CLL cases showed a statistically significant reduction of the NOTCH1mut FA detected at diagnosis after treatment (median FA 11.67 % vs 0.09 %, respectively, p = 0.01); the same difference, in terms of NOTCH1mut FA, was observed in the relapsed cases compared to the NOTCH1mut allelic fraction observed in patients in complete or partial remission (median FA 4.75% vs 0.43%, respectively, p = 0.007). Our study demonstrated a much higher incidence of NOTCH1mut in CLL than has previously been reported, and showed that the NOTCH1mut allelic burden evaluation by ddPCR might identify patients in need of a closer clinical follow-up during the "watch and wait" interval and after standard chemotherapy.

  5. Real-time PCR analysis of genes encoding tumor antigens in esophageal tumors and a cancer vaccine

    DEFF Research Database (Denmark)

    Weinert, Brian T; Krishnadath, Kausilia K; Milano, Francesca

    2009-01-01

    Tumor antigens are the primary target of therapeutic cancer vaccines. We set out to define and compare the expression pattern of tumor antigen genes in esophagus carcinoma biopsies and in an allogeneic tumor lysate-based cancer vaccine, MelCancerVac. Cells used for vaccine production were treated...... in the production of the vaccine. Quantitative PCR was used to assay 74 tumor antigen genes in patients with squamous cell carcinoma of the esophagus. 81% (13/16) of tumors expressed more than five cancer/testis (CT) antigens. A total of 96 genes were assayed in the tumor cell clone (DDM1.7) used to make tumor cell...

  6. Cloning of the koi herpesvirus (KHV gene encoding thymidine kinase and its use for a highly sensitive PCR based diagnosis

    Directory of Open Access Journals (Sweden)

    Gilad Oren

    2005-03-01

    Full Text Available Abstract Background Outbreaks with mass mortality among common carp Cyprinus carpio carpio and koi Cyprinus carpio koi have occurred worldwide since 1998. The herpes-like virus isolated from diseased fish is different from Herpesvirus cyprini and channel catfish virus and was accordingly designated koi herpesvirus (KHV. Diagnosis of KHV infection based on viral isolation and current PCR assays has a limited sensitivity and therefore new tools for the diagnosis of KHV infections are necessary. Results A robust and sensitive PCR assay based on a defined gene sequence of KHV was developed to improve the diagnosis of KHV infection. From a KHV genomic library, a hypothetical thymidine kinase gene (TK was identified, subcloned and expressed as a recombinant protein. Preliminary characterization of the recombinant TK showed that it has a kinase activity using dTTP but not dCTP as a substrate. A PCR assay based on primers selected from the defined DNA sequence of the TK gene was developed and resulted in a 409 bp amplified fragment. The TK based PCR assay did not amplify the DNAs of other fish herpesviruses such as Herpesvirus cyprini (CHV and the channel catfish virus (CCV. The TK based PCR assay was specific for the detection of KHV and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions. The TK based PCR was compared to previously described PCR assays and to viral culture in diseased fish and was shown to be the most sensitive method of diagnosis of KHV infection. Conclusion The TK based PCR assay developed in this work was shown to be specific for the detection of KHV. The TK based PCR assay was more sensitive for the detection of KHV than previously described PCR assays; it was as sensitive as virus isolation which is the golden standard method for KHV diagnosis and was able to detect as little as 10 fentograms of KHV DNA corresponding to 30 virions.

  7. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

  8. Xylella fastidiosa gene expression analysis by DNA microarrays

    OpenAIRE

    Travensolo,Regiane F.; Carareto-Alves,Lucia M.; Costa,Maria V.C.G.; Lopes,Tiago J.S.; Carrilho,Emanuel; Lemos,Eliana G.M.

    2009-01-01

    Xylella fastidiosa genome sequencing has generated valuable data by identifying genes acting either on metabolic pathways or in associated pathogenicity and virulence. Based on available information on these genes, new strategies for studying their expression patterns, such as microarray technology, were employed. A total of 2,600 primer pairs were synthesized and then used to generate fragments using the PCR technique. The arrays were hybridized against cDNAs labeled during reverse transcrip...

  9. The characterization of four gene expression analysis in circulating tumor cells made by Multiplex-PCR from the AdnaTest kit on the lab-on-a-chip Agilent DNA 1000 platform.

    Science.gov (United States)

    Škereňová, Markéta; Mikulová, Veronika; Čapoun, Otakar; Zima, Tomáš

    2016-01-01

    Nowadays, on-a-chip capillary electrophoresis is a routine method for the detection of PCR fragments. The Agilent 2100 Bioanalyzer was one of the first commercial devices in this field. Our project was designed to study the characteristics of Agilent DNA 1000 kit in PCR fragment analysis as a part of circulating tumour cell (CTC) detection technique. Despite the common use of this kit a complex analysis of the results from a long-term project is still missing. A commercially available Agilent DNA 1000 kit was used as a final step in the CTC detection (AdnaTest) for the determination of the presence of PCR fragments generated by Multiplex PCR. Data from 30 prostate cancer patients obtained during two years of research were analyzed to determine the trueness and precision of the PCR fragment size determination. Additional experiments were performed to demonstrate the precision (repeatability, reproducibility) and robustness of PCR fragment concentration determination. The trueness and precision of the size determination was below 3% and 2% respectively. The repeatability of the concentration determination was below 15%. The difference in concentration determination increases when Multiplex-PCR/storage step is added between the two measurements of one sample. The characteristics established in our study are in concordance with the manufacturer's specifications established for a ladder as a sample. However, the concentration determination may vary depending on chip preparation, sample storage and concentration. The 15% variation of concentration determination repeatability was shown to be partly proportional and can be suppressed by proper normalization.

  10. Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

    Science.gov (United States)

    Rueda-Martínez, Carmen; Fernández, M Carmen; Soto-Navarrete, María Teresa; Jiménez-Navarro, Manuel; Durán, Ana Carmen; Fernández, Borja

    2016-01-01

    Bicuspid aortic valve (BAV) is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40%) incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR) assays. A total of 51 adult (180-240 days old) and 56 old (300-440 days old) animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30), or to the affected strain of hamsters with TAV (n = 45) or BAV (n = 32). The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

  11. Identification of Reference Genes for Quantitative Real Time PCR Assays in Aortic Tissue of Syrian Hamsters with Bicuspid Aortic Valve.

    Directory of Open Access Journals (Sweden)

    Carmen Rueda-Martínez

    Full Text Available Bicuspid aortic valve (BAV is the most frequent congenital cardiac malformation in humans, and appears frequently associated with dilatation of the ascending aorta. This association is likely the result of a common aetiology. Currently, a Syrian hamster strain with a relatively high (∼40% incidence of BAV constitutes the only spontaneous animal model of BAV disease. The characterization of molecular alterations in the aorta of hamsters with BAV may serve to identify pathophysiological mechanisms and molecular markers of disease in humans. In this report, we evaluate the expression of ten candidate reference genes in aortic tissue of hamsters in order to identify housekeeping genes for normalization using quantitative real time PCR (RT-qPCR assays. A total of 51 adult (180-240 days old and 56 old (300-440 days old animals were used. They belonged to a control strain of hamsters with normal, tricuspid aortic valve (TAV; n = 30, or to the affected strain of hamsters with TAV (n = 45 or BAV (n = 32. The expression stability of the candidate reference genes was determined by RT-qPCR using three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable reference genes for the three algorithms employed were Cdkn1β, G3pdh and Polr2a. We propose the use of Cdkn1β, or both Cdkn1β and G3pdh as reference genes for mRNA expression analyses in Syrian hamster aorta.

  12. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages

    OpenAIRE

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, inc...

  13. Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don.

    Science.gov (United States)

    Xiao, Zheng; Sun, Xiaobo; Liu, Xiaoqing; Li, Chang; He, Lisi; Chen, Shangping; Su, Jiale

    2016-01-01

    The quantitative real-time polymerase chain reaction (qRT-PCR) approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder, and BestKeeper. The results showed that EF1- α (elongation factor 1-alpha), 18S (18s ribosomal RNA), and RPL3 (ribosomal protein L3) were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin ( TUB ) was the least stable. ACT5 (actin), RPL3 , 18S , and EF1- α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle . Furthermore, the expression profiles of RmPSY (phytoene synthase) and RmPDS (phytoene dehydrogenase) were assessed using EF1- α, 18S , ACT5 , RPL3 , and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle .

  14. Selection of Reliable Reference Genes for Gene Expression Studies on Rhododendron molle G. Don

    Directory of Open Access Journals (Sweden)

    Zheng Xiao

    2016-10-01

    Full Text Available The quantitative real-time polymerase chain reaction (qRT-PCR approach has become a widely used method to analyze expression patterns of target genes. The selection of an optimal reference gene is a prerequisite for the accurate normalization of gene expression in qRT-PCR. The present study constitutes the first systematic evaluation of potential reference genes in Rhododendron molle G. Don. Eleven candidate reference genes in different tissues and flowers at different developmental stages of R. molle were assessed using the following three software packages: GeNorm, NormFinder and BestKeeper. The results showed that EF1-α (elongation factor 1-alpha, 18S (18s ribosomal RNA and RPL3 (ribosomal protein L3 were the most stable reference genes in developing rhododendron flowers and, thus, in all of the tested samples, while tublin (TUB was the least stable. ACT5 (actin, RPL3, 18S and EF1-α were found to be the top four choices for different tissues, whereas TUB was not found to favor qRT-PCR normalization in these tissues. Three stable reference genes are recommended for the normalization of qRT-PCR data in R. molle. Furthermore, the expression profiles of RmPSY (phytoene synthase and RmPDS (phytoene dehydrogenase were assessed using EF1-α, 18S, ACT5, and RPL3 and their combination as internals. Similar trends were found, but these trends varied when the least stable reference gene TUB was used. The results further prove that it is necessary to validate the stability of reference genes prior to their use for normalization under different experimental conditions. This study provides useful information for reliable qRT-PCR data normalization in gene studies of R. molle.

  15. Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue

    Directory of Open Access Journals (Sweden)

    Dunner Susana

    2008-09-01

    Full Text Available Abstract Background Real-time reverse transcriptase quantitative polymerase chain reaction (real-time RTqPCR is a technique used to measure mRNA species copy number as a way to determine key genes involved in different biological processes. However, the expression level of these key genes may vary among tissues or cells not only as a consequence of differential expression but also due to different factors, including choice of reference genes to normalize the expression levels of the target genes; thus the selection of reference genes is critical for expression studies. For this purpose, ten candidate reference genes were investigated in bovine muscular tissue. Results The value of stability of ten candidate reference genes included in three groups was estimated: the so called 'classical housekeeping' genes (18S, GAPDH and ACTB, a second set of genes used in expression studies conducted on other tissues (B2M, RPII, UBC and HMBS and a third set of novel genes (SF3A1, EEF1A2 and CASC3. Three different statistical algorithms were used to rank the genes by their stability measures as produced by geNorm, NormFinder and Bestkeeper. The three methods tend to agree on the most stably expressed genes and the least in muscular tissue. EEF1A2 and HMBS followed by SF3A1, ACTB, and CASC3 can be considered as stable reference genes, and B2M, RPII, UBC and GAPDH would not be appropriate. Although the rRNA-18S stability measure seems to be within the range of acceptance, its use is not recommended because its synthesis regulation is not representative of mRNA levels. Conclusion Based on geNorm algorithm, we propose the use of three genes SF3A1, EEF1A2 and HMBS as references for normalization of real-time RTqPCR in muscle expression studies.

  16. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Directory of Open Access Journals (Sweden)

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real

  17. Predicting response to primary chemotherapy: gene expression profiling of paraffin-embedded core biopsy tissue.

    Science.gov (United States)

    Mina, Lida; Soule, Sharon E; Badve, Sunil; Baehner, Fredrick L; Baker, Joffre; Cronin, Maureen; Watson, Drew; Liu, Mei-Lan; Sledge, George W; Shak, Steve; Miller, Kathy D

    2007-06-01

    Primary chemotherapy provides an ideal opportunity to correlate gene expression with response to treatment. We used paraffin-embedded core biopsies from a completed phase II trial to identify genes that correlate with response to primary chemotherapy. Patients with newly diagnosed stage II or III breast cancer were treated with sequential doxorubicin 75 mg/M2 q2 wks x 3 and docetaxel 40 mg/M2 weekly x 6; treatment order was randomly assigned. Pretreatment core biopsy samples were interrogated for genes that might correlate with pathologic complete response (pCR). In addition to the individual genes, the correlation of the Oncotype DX Recurrence Score with pCR was examined. Of 70 patients enrolled in the parent trial, core biopsies samples with sufficient RNA for gene analyses were available from 45 patients; 9 (20%) had inflammatory breast cancer (IBC). Six (14%) patients achieved a pCR. Twenty-two of the 274 candidate genes assessed correlated with pCR (p < 0.05). Genes correlating with pCR could be grouped into three large clusters: angiogenesis-related genes, proliferation related genes, and invasion-related genes. Expression of estrogen receptor (ER)-related genes and Recurrence Score did not correlate with pCR. In an exploratory analysis we compared gene expression in IBC to non-inflammatory breast cancer; twenty-four (9%) of the genes were differentially expressed (p < 0.05), 5 were upregulated and 19 were downregulated in IBC. Gene expression analysis on core biopsy samples is feasible and identifies candidate genes that correlate with pCR to primary chemotherapy. Gene expression in IBC differs significantly from noninflammatory breast cancer.

  18. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period.

    Directory of Open Access Journals (Sweden)

    Pengfei Lin

    Full Text Available The study of uterine gene expression patterns is valuable for understanding the biological and molecular mechanisms that occur during embryo implantation. Real-time quantitative RT-PCR (qRT-PCR is an extremely sensitive technique that allows for the precise quantification of mRNA abundance; however, selecting stable reference genes suitable for the normalization of qRT-PCR data is required to avoid the misinterpretation of experimental results and erroneous analyses. This study employs several mouse models, including an early pregnancy, a pseudopregnancy, a delayed implantation and activation, an artificial decidualization and a hormonal treatment model; ten candidate reference genes (PPIA, RPLP0, HPRT1, GAPDH, ACTB, TBP, B2M, 18S, UBC and TUBA that are found in uterine tissues were assessed for their suitability as internal controls for relative qRT-PCR quantification. GeNorm(PLUS, NormFinder, and BestKeeper were used to evaluate these candidate reference genes, and all of these methods identified RPLP0 and GAPDH as the most stable candidates and B2M and 18S as the least stable candidates. However, when the different models were analyzed separately, the reference genes exhibited some variation in their expression levels.

  19. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    Science.gov (United States)

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  20. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Science.gov (United States)

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  1. rpb2 is a reliable reference gene for quantitative gene expression analysis in the dermatophyte Trichophyton rubrum.

    Science.gov (United States)

    Jacob, Tiago R; Peres, Nalu T A; Persinoti, Gabriela F; Silva, Larissa G; Mazucato, Mendelson; Rossi, Antonio; Martinez-Rossi, Nilce M

    2012-05-01

    The selection of reference genes used for data normalization to quantify gene expression by real-time PCR amplifications (qRT-PCR) is crucial for the accuracy of this technique. In spite of this, little information regarding such genes for qRT-PCR is available for gene expression analyses in pathogenic fungi. Thus, we investigated the suitability of eight candidate reference genes in isolates of the human dermatophyte Trichophyton rubrum subjected to several environmental challenges, such as drug exposure, interaction with human nail and skin, and heat stress. The stability of these genes was determined by geNorm, NormFinder and Best-Keeper programs. The gene with the most stable expression in the majority of the conditions tested was rpb2 (DNA-dependent RNA polymerase II), which was validated in three T. rubrum strains. Moreover, the combination of rpb2 and chs1 (chitin synthase) genes provided for the most reliable qRT-PCR data normalization in T. rubrum under a broad range of biological conditions. To the best of our knowledge this is the first report on the selection of reference genes for qRT-PCR data normalization in dermatophytes and the results of these studies should permit further analysis of gene expression under several experimental conditions, with improved accuracy and reliability.

  2. Using gene expression noise to understand gene regulation

    NARCIS (Netherlands)

    Munsky, B.; Neuert, G.; van Oudenaarden, A.

    2012-01-01

    Phenotypic variation is ubiquitous in biology and is often traceable to underlying genetic and environmental variation. However, even genetically identical cells in identical environments display variable phenotypes. Stochastic gene expression, or gene expression "noise," has been suggested as a

  3. IDENTIFIKASI DAGING BABI MENGGUNAKAN METODE PCR-RFLP GEN Cytochrome b DAN PCR PRIMER SPESIFIK GEN AMELOGENIN (Pork Identification Using PCR-RFLP of Cytochrome b Gene and Species Specific PCR of Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2013-03-01

    Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction   ABSTRAK   Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang

  4. RNA-seq reveals more consistent reference genes for gene expression studies in human non-melanoma skin cancers

    Directory of Open Access Journals (Sweden)

    Van L.T. Hoang

    2017-08-01

    Full Text Available Identification of appropriate reference genes (RGs is critical to accurate data interpretation in quantitative real-time PCR (qPCR experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer.

  5. Serial analysis of gene expression (SAGE) in rat liver regeneration

    International Nuclear Information System (INIS)

    Cimica, Velasco; Batusic, Danko; Haralanova-Ilieva, Borislava; Chen, Yonglong; Hollemann, Thomas; Pieler, Tomas; Ramadori, Giuliano

    2007-01-01

    We have applied serial analysis of gene expression for studying the molecular mechanism of the rat liver regeneration in the model of 70% partial hepatectomy. We generated three SAGE libraries from a normal control liver (NL library: 52,343 tags), from a sham control operated liver (Sham library: 51,028 tags), and from a regenerating liver (PH library: 53,061 tags). By SAGE bioinformatics analysis we identified 40 induced genes and 20 repressed genes during the liver regeneration. We verified temporal expression of such genes by real time PCR during the regeneration process and we characterized 13 induced genes and 3 repressed genes. We found connective tissue growth factor transcript and protein induced very early at 4 h after PH operation before hepatocytes proliferation is triggered. Our study suggests CTGF as a growth factor signaling mediator that could be involved directly in the mechanism of liver regeneration induction

  6. Using RNA-Seq Data to Evaluate Reference Genes Suitable for Gene Expression Studies in Soybean.

    Directory of Open Access Journals (Sweden)

    Aldrin Kay-Yuen Yim

    Full Text Available Differential gene expression profiles often provide important clues for gene functions. While reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is an important tool, the validity of the results depends heavily on the choice of proper reference genes. In this study, we employed new and published RNA-sequencing (RNA-Seq datasets (26 sequencing libraries in total to evaluate reference genes reported in previous soybean studies. In silico PCR showed that 13 out of 37 previously reported primer sets have multiple targets, and 4 of them have amplicons with different sizes. Using a probabilistic approach, we identified new and improved candidate reference genes. We further performed 2 validation tests (with 26 RNA samples on 8 commonly used reference genes and 7 newly identified candidates, using RT-qPCR. In general, the new candidate reference genes exhibited more stable expression levels under the tested experimental conditions. The three newly identified candidate reference genes Bic-C2, F-box protein2, and VPS-like gave the best overall performance, together with the commonly used ELF1b. It is expected that the proposed probabilistic model could serve as an important tool to identify stable reference genes when more soybean RNA-Seq data from different growth stages and treatments are used.

  7. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis.

    Directory of Open Access Journals (Sweden)

    Nour Eissa

    Full Text Available Many animal models have been developed to characterize the complexity of colonic inflammation. In dextran sodium sulfate (DSS experimental colitis in mice the choice of reference genes is critical for accurate quantification of target genes using quantitative real time PCR (RT-qPCR. No studies have addressed the performance of reference genes in mice DSS-experimental colitis. This study aimed to determine the stability of reference genes expression (RGE in DSS-experimental murine colitis.Colitis was induced in male C57BL/6 mice using DSS5% for 5 days, control group received water. RNA was extracted from inflamed and non-inflamed colon. Using RT-qPCR, comparative analysis of 13 RGE was performed according to predefined criteria and relative colonic TNF-α and IL-1β gene expression was determined by calculating the difference in the threshold cycle.Colitis significantly altered the stability of mucosal RGE. Commonly used glyceraldehyde-3-phosphate dehydrogenase (Gapdh, β-actin (Actb, or β2-microglobulin (β2m showed the highest variability within the inflamed and control groups. Conversely, TATA-box-binding protein (Tbp and eukaryotic translation elongation factor 2 (Eef2 were not affected by inflammation and were the most stable genes. Normalization of colonic TNF-α and IL-1β mRNA levels was dependent on the reference gene used. Depending on the genes used to normalize the data, statistical significance varied from significant when TBP / Eef2 were used to non-significant when Gapdh, Actb or β2m were used.This study highlights the appropriate choice of RGE to ensure adequate normalization of RT-qPCR data when using this model. Suboptimal RGE may explain controversial results from published studies. We recommend using Tbp and Eef2 instead of Gapdh, Actb or β2m as reference genes.

  8. Microarray gene expression profiling and analysis in renal cell carcinoma

    Directory of Open Access Journals (Sweden)

    Sadhukhan Provash

    2004-06-01

    Full Text Available Abstract Background Renal cell carcinoma (RCC is the most common cancer in adult kidney. The accuracy of current diagnosis and prognosis of the disease and the effectiveness of the treatment for the disease are limited by the poor understanding of the disease at the molecular level. To better understand the genetics and biology of RCC, we profiled the expression of 7,129 genes in both clear cell RCC tissue and cell lines using oligonucleotide arrays. Methods Total RNAs isolated from renal cell tumors, adjacent normal tissue and metastatic RCC cell lines were hybridized to affymatrix HuFL oligonucleotide arrays. Genes were categorized into different functional groups based on the description of the Gene Ontology Consortium and analyzed based on the gene expression levels. Gene expression profiles of the tissue and cell line samples were visualized and classified by singular value decomposition. Reverse transcription polymerase chain reaction was performed to confirm the expression alterations of selected genes in RCC. Results Selected genes were annotated based on biological processes and clustered into functional groups. The expression levels of genes in each group were also analyzed. Seventy-four commonly differentially expressed genes with more than five-fold changes in RCC tissues were identified. The expression alterations of selected genes from these seventy-four genes were further verified using reverse transcription polymerase chain reaction (RT-PCR. Detailed comparison of gene expression patterns in RCC tissue and RCC cell lines shows significant differences between the two types of samples, but many important expression patterns were preserved. Conclusions This is one of the initial studies that examine the functional ontology of a large number of genes in RCC. Extensive annotation, clustering and analysis of a large number of genes based on the gene functional ontology revealed many interesting gene expression patterns in RCC. Most

  9. A constructive approach to gene expression dynamics

    International Nuclear Information System (INIS)

    Ochiai, T.; Nacher, J.C.; Akutsu, T.

    2004-01-01

    Recently, experiments on mRNA abundance (gene expression) have revealed that gene expression shows a stationary organization described by a scale-free distribution. Here we propose a constructive approach to gene expression dynamics which restores the scale-free exponent and describes the intermediate state dynamics. This approach requires only one assumption: Markov property

  10. Heterologous Reconstitution of the Intact Geodin Gene Cluster in Aspergillus nidulans through a Simple and Versatile PCR Based Approach

    DEFF Research Database (Denmark)

    Nielsen, Morten Thrane; Nielsen, Jakob Blæsbjerg; Anyaogu, Dianna Chinyere

    2013-01-01

    was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to ransformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were...... of solid methodology for genetic manipulation of most species severely hampers pathway haracterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus...... successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC) encodes a polyketide synthase, ATEG_08453 (gedR) encodes a transcription factor...

  11. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions.

    Directory of Open Access Journals (Sweden)

    Dung Tien Le

    Full Text Available Quantitative RT-PCR can be a very sensitive and powerful technique for measuring differential gene expression. Changes in gene expression induced by abiotic stresses are complex and multifaceted, which make determining stably expressed genes for data normalization difficult. To identify the most suitable reference genes for abiotic stress studies in soybean, 13 candidate genes collected from literature were evaluated for stability of expression under dehydration, high salinity, cold and ABA (abscisic acid treatments using delta CT and geNorm approaches. Validation of reference genes indicated that the best reference genes are tissue- and stress-dependent. With respect to dehydration treatment, the Fbox/ABC, Fbox/60s gene pairs were found to have the highest expression stability in the root and shoot tissues of soybean seedlings, respectively. Fbox and 60s genes are the most suitable reference genes across dehydrated root and shoot tissues. Under salt stress the ELF1b/IDE and Fbox/ELF1b are the most stably expressed gene pairs in roots and shoots, respectively, while 60s/Fbox is the best gene pair in both tissues. For studying cold stress in roots or shoots, IDE/60s and Fbox/Act27 are good reference gene pairs, respectively. With regard to gene expression analysis under ABA treatment in either roots, shoots or across these tissues, 60s/ELF1b, ELF1b/Fbox and 60s/ELF1b are the most suitable reference genes, respectively. The expression of ELF1b/60s, 60s/Fbox and 60s/Fbox genes was most stable in roots, shoots and both tissues, respectively, under various stresses studied. Among the genes tested, 60s was found to be the best reference gene in different tissues and under various stress conditions. The highly ranked reference genes identified from this study were proved to be capable of detecting subtle differences in expression rates that otherwise would be missed if a less stable reference gene was used.

  12. Alteration in follistatin gene expression detected in prenatally androgenized rats.

    Science.gov (United States)

    Salehi Jahromi, Marziyeh; Ramezani Tehrani, Fahimeh; Hill, Jennifer W; Noroozzadeh, Mahsa; Zarkesh, Maryam; Ghasemi, Asghar; Zadeh-Vakili, Azita

    2017-06-01

    Impaired ovarian follicle development, the hallmark of polycystic ovarian syndrome (PCOS), is believed to be due to the changes in expression of related genes such as follistatin (FST). Expression of FST gene and methylation level of its promoter in theca cells from adult female rats, prenatally exposed to androgen excess, during different phases of the estrus cycle was determined and compared with controls. Eight pregnant Wistar rats (experimental group) were treated by subcutaneous injection of 5 mg free testosterone on day 20 of pregnancy, while controls (n = 8) received 500 ml solvent. Based on observed vaginal smear, adult female offspring of mothers were divided into three groups. Levels of serum steroidogenic sexual hormones and gonadotropins, expression and promoter methylation of the FST gene were measured using ELISA, cyber-green real-time PCR and bisulfite sequence PCR (BSP), respectively. Compared to controls, the relative expression of FST gene in the treated group decreased overall by 0.85 fold; despite significant changes in different phases, but no significant differences in methylation of FST promoter. Our results reveal that manifestation of PCOS-like phenotype following prenatal exposure to excess androgen is associated with irregularity in expression of the FST gene during the estrus cycle.

  13. Modulation of gene expression made easy

    DEFF Research Database (Denmark)

    Solem, Christian; Jensen, Peter Ruhdal

    2002-01-01

    A new approach for modulating gene expression, based on randomization of promoter (spacer) sequences, was developed. The method was applied to chromosomal genes in Lactococcus lactis and shown to generate libraries of clones with broad ranges of expression levels of target genes. In one example...... that the method can be applied to modulating the expression of native genes on the chromosome. We constructed a series of strains in which the expression of the las operon, containing the genes pfk, pyk, and ldh, was modulated by integrating a truncated copy of the pfk gene. Importantly, the modulation affected...

  14. Synthetic promoter libraries- tuning of gene expression

    DEFF Research Database (Denmark)

    Hammer, Karin; Mijakovic, Ivan; Jensen, Peter Ruhdal

    2006-01-01

    knockout and strong overexpression. However, applications such as metabolic optimization and control analysis necessitate a continuous set of expression levels with only slight increments in strength to cover a specific window around the wildtype expression level of the studied gene; this requirement can......The study of gene function often requires changing the expression of a gene and evaluating the consequences. In principle, the expression of any given gene can be modulated in a quasi-continuum of discrete expression levels but the traditional approaches are usually limited to two extremes: gene...

  15. Selection and validation of appropriate reference genes for quantitative real-time PCR analysis in Salvia hispanica.

    Directory of Open Access Journals (Sweden)

    Rahul Gopalam

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR has become the most popular choice for gene expression studies. For accurate expression analysis, it is pertinent to select a stable reference gene to normalize the data. It is now known that the expression of internal reference genes varies considerably during developmental stages and under different experimental conditions. For Salvia hispanica, an economically important oilseed crop, there are no reports of stable reference genes till date. In this study, we chose 13 candidate reference genes viz. Actin11 (ACT, Elongation factor 1-alpha (EF1-α, Eukaryotic translation initiation factor 3E (ETIF3E, alpha tubulin (α-TUB, beta tubulin (β-TUB, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Cyclophilin (CYP, Clathrin adaptor complex (CAC, Serine/threonine-protein phosphatase 2A (PP2A, FtsH protease (FtsH, 18S ribosomal RNA (18S rRNA, S-adenosyl methionine decarboxylase (SAMDC and Rubisco activase (RCA and the expression levels of these genes were assessed in a diverse set of tissue samples representing vegetative stages, reproductive stages and various abiotic stress treatments. Two of the widely used softwares, geNorm and Normfinder were used to evaluate the expression stabilities of these 13 candidate reference genes under different conditions. Results showed that GAPDH and CYP expression remain stable throughout in the different abiotic stress treatments, CAC and PP2A expression were relatively stable under reproductive stages and α-TUB, PP2A and ETIF3E were found to be stably expressed in vegetative stages. Further, the expression levels of Diacylglycerol acyltransferase (DGAT1, a key enzyme in triacylglycerol synthesis was analyzed to confirm the validity of reference genes identified in the study. This is the first systematic study of selection of reference genes in S. hispanica, and will benefit future expression studies in this crop.

  16. Digital gene expression profiling of flax (Linum usitatissimum L.) stem peel identifies genes enriched in fiber-bearing phloem tissue.

    Science.gov (United States)

    Guo, Yuan; Qiu, Caisheng; Long, Songhua; Chen, Ping; Hao, Dongmei; Preisner, Marta; Wang, Hui; Wang, Yufu

    2017-08-30

    To better understand the molecular mechanisms and gene expression characteristics associated with development of bast fiber cell within flax stem phloem, the gene expression profiling of flax stem peels and leaves were screened, using Illumina's Digital Gene Expression (DGE) analysis. Four DGE libraries (2 for stem peel and 2 for leaf), ranging from 6.7 to 9.2 million clean reads were obtained, which produced 7.0 million and 6.8 million mapped reads for flax stem peel and leave, respectively. By differential gene expression analysis, a total of 975 genes, of which 708 (73%) genes have protein-coding annotation, were identified as phloem enriched genes putatively involved in the processes of polysaccharide and cell wall metabolism. Differential expression genes (DEGs) was validated using quantitative RT-PCR, the expression pattern of all nine genes determined by qRT-PCR fitted in well with that obtained by sequencing analysis. Cluster and Gene Ontology (GO) analysis revealed that a large number of genes related to metabolic process, catalytic activity and binding category were expressed predominantly in the stem peels. The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of the phloem enriched genes suggested approximately 111 biological pathways. The large number of genes and pathways produced from DGE sequencing will expand our understanding of the complex molecular and cellular events in flax bast fiber development and provide a foundation for future studies on fiber development in other bast fiber crops. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Measurement of Gene Expression in Archival Paraffin-Embedded Tissues

    Science.gov (United States)

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C.; Shak, Steven; Kiefer, Michael C.; Esteban, Jose M.; Baker, Joffre B.

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10-μm FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests. PMID:14695316

  18. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  19. Screening suitable reference genes for normalization in reverse transcription quantitative real-time PCR analysis in melon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Melon (Cucumis melo. L is not only an economically important cucurbitaceous crop but also an attractive model for studying many biological characteristics. Screening appropriate reference genes is essential to reverse transcription quantitative real-time PCR (RT-qPCR, which is key to many studies involving gene expression analysis. In this study, 14 candidate reference genes were selected, and the variations in their expression in roots and leaves of plants subjected to biotic stress, abiotic stress, and plant growth regulator treatment were assessed by RT-qPCR. The stability of the expression of the selected genes was determined and ranked using geNorm and NormFinder. geNorm identified the two most stable genes for each set of conditions: CmADP and CmUBIep across all samples, CmUBIep and CmRPL in roots, CmRAN and CmACT in leaves, CmADP and CmRPL under abiotic stress conditions, CmTUA and CmACT under biotic stress conditions, and CmRAN and CmACT under plant growth regulator treatments. NormFinder determined CmRPL to be the best reference gene in roots and under biotic stress conditions and CmADP under the other experimental conditions. CmUBC2 and CmPP2A were not found to be suitable under many experimental conditions. The catalase family genes CmCAT1, CmCAT2, and CmCAT3 were identified in melon genome and used as target genes to validate the reliability of identified reference genes. The catalase family genes showed the most upregulation 3 days after inoculation with Fusarium wilt in roots, after which they were downregulated. Their levels of expression were significantly overestimated when the unsuitable reference gene was used for normalization. These results not only provide guidelines for the selection of reference genes for gene expression analyses in melons but may also provide valuable information for studying the functions of catalase family genes in stress responses.

  20. [Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

    Science.gov (United States)

    Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

    2012-05-01

    To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, PNested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, Pnested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

  1. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad

    2017-08-01

    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  2. Evaluation of Reference Genes for Real-Time Quantitative PCR Analysis in Larvae of Spodoptera litura Exposed to Azadirachtin Stress Conditions

    OpenAIRE

    Benshui Shu; Jingjing Zhang; Gaofeng Cui; Ranran Sun; Veeran Sethuraman; Xin Yi; Guohua Zhong

    2018-01-01

    Azadirachtin is an efficient and broad-spectrum botanical insecticide against more than 150 kinds of agricultural pests with the effects of mortality, antifeedant and growth regulation. Real-time quantitative polymerase chain reaction (RT-qPCR) could be one of the powerful tools to analyze the gene expression level and investigate the mechanism of azadirachtin at transcriptional level, however, the ideal reference genes are needed to normalize the expression profiling of target genes. In this...

  3. Transcriptional expression of type I interferon response genes and stability of housekeeping genes in the human endometrium and endometriosis

    DEFF Research Database (Denmark)

    Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben

    2011-01-01

    Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic locations. The pathogenesis is much debated, and type I interferons could be involved. The expression of genes of the type I interferon response were profiled by a specific PCR Array...... of RNA obtained from ectopic and eutopic endometrium collected from 9 endometriosis patients and 9 healthy control women. Transcriptional expression levels of selected interferon-regulated and housekeeping genes were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably...... expressed housekeeping genes for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven housekeeping genes were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP, and YWHAZ expression...

  4. Gene expression and 18FDG uptake in atherosclerotic carotid plaques

    DEFF Research Database (Denmark)

    Pedersen, Sune Folke; Graebe, Martin; Fisker Hag, Anne Mette

    2010-01-01

    ) and an additional ipsilateral internal carotid artery stenosis of greater than 60% were recruited. FDG uptake in the carotids was determined by PET/computed tomography and expressed as mean and maximal standardized uptake values (SUVmean and SUVmax). The atherosclerotic plaques were subsequently recovered...... by carotid endarterectomy. The gene expression of markers of vulnerability - CD68, IL-18, matrix metalloproteinase 9, cathepsin K, GLUT-1, and hexokinase type II (HK2) - were measured in plaques by quantitative PCR. RESULTS: In a multivariate linear regression model, GLUT-1, CD68, cathepsin K, and HK2 gene...... expression remained in the final model as predictive variables of FDG accumulation calculated as SUVmean (R=0.26, PK, and HK2 gene expression as independent predictive variables of FDG accumulation calculated...

  5. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  6. Evaluation of Reference Genes to Analyze Gene Expression in Silverside Odontesthes humensis Under Different Environmental Conditions

    Directory of Open Access Journals (Sweden)

    Tony L. R. Silveira

    2018-03-01

    Full Text Available Some mammalian reference genes, which are widely used to normalize the qRT-PCR, could not be used for this purpose due to its high expression variation. The normalization with false reference genes leads to misinterpretation of results. The silversides (Odontesthes spp. has been used as models for evolutionary, osmoregulatory and environmental pollution studies but, up to now, there are no studies about reference genes in any Odontesthes species. Furthermore, many studies on silversides have used reference genes without previous validations. Thus, present study aimed to was to clone and sequence potential reference genes, thereby identifying the best ones in Odontesthes humensis considering different tissues, ages and conditions. For this purpose, animals belonging to three ages (adults, juveniles, and immature were exposed to control, Roundup®, and seawater treatments for 24 h. Blood samples were subjected to flow-cytometry and other collected tissues to RNA extraction; cDNA synthesis; molecular cloning; DNA sequencing; and qRT-PCR. The candidate genes tested included 18s, actb, ef1a, eif3g, gapdh, h3a, atp1a, and tuba. Gene expression results were analyzed using five algorithms that ranked the candidate genes. The flow-cytometry data showed that the environmental challenges could trigger a systemic response in the treated fish. Even during this systemic physiological disorder, the consensus analysis of gene expression revealed h3a to be the most stable gene expression when only the treatments were considered. On the other hand, tuba was the least stable gene in the control and gapdh was the least stable in both Roundup® and seawater groups. In conclusion, the consensus analyses of different tissues, ages, and treatments groups revealed that h3a is the most stable gene whereas gapdh and tuba are the least stable genes, even being considered two constitutive genes.

  7. The evolution of gene expression in primates

    OpenAIRE

    Tashakkori Ghanbarian, Avazeh

    2015-01-01

    The evolution of a gene’s expression profile is commonly assumed to be independent of its genomic neighborhood. This is, however, in contrast to what we know about the lack of autonomy between expression of neighboring genes in extant taxa. Indeed, in all eukaryotic genomes, genes of similar expression-profile tend to cluster, reflecting chromatin level dynamics. Does it follow that if a gene increases expression in a particular lineage then the genomic neighbors will also increase in their e...

  8. The gsdf gene locus harbors evolutionary conserved and clustered genes preferentially expressed in fish previtellogenic oocytes.

    Science.gov (United States)

    Gautier, Aude; Le Gac, Florence; Lareyre, Jean-Jacques

    2011-02-01

    The gonadal soma-derived factor (GSDF) belongs to the transforming growth factor-β superfamily and is conserved in teleostean fish species. Gsdf is specifically expressed in the gonads, and gene expression is restricted to the granulosa and Sertoli cells in trout and medaka. The gsdf gene expression is correlated to early testis differentiation in medaka and was shown to stimulate primordial germ cell and spermatogonia proliferation in trout. In the present study, we show that the gsdf gene localizes to a syntenic chromosomal fragment conserved among vertebrates although no gsdf-related gene is detected on the corresponding genomic region in tetrapods. We demonstrate using quantitative RT-PCR that most of the genes localized in the synteny are specifically expressed in medaka gonads. Gsdf is the only gene of the synteny with a much higher expression in the testis compared to the ovary. In contrast, gene expression pattern analysis of the gsdf surrounding genes (nup54, aff1, klhl8, sdad1, and ptpn13) indicates that these genes are preferentially expressed in the female gonads. The tissue distribution of these genes is highly similar in medaka and zebrafish, two teleostean species that have diverged more than 110 million years ago. The cellular localization of these genes was determined in medaka gonads using the whole-mount in situ hybridization technique. We confirm that gsdf gene expression is restricted to Sertoli and granulosa cells in contact with the premeiotic and meiotic cells. The nup54 gene is expressed in spermatocytes and previtellogenic oocytes. Transcripts corresponding to the ovary-specific genes (aff1, klhl8, and sdad1) are detected only in previtellogenic oocytes. No expression was detected in the gonocytes in 10 dpf embryos. In conclusion, we show that the gsdf gene localizes to a syntenic chromosomal fragment harboring evolutionary conserved genes in vertebrates. These genes are preferentially expressed in previtelloogenic oocytes, and thus, they

  9. Validation of commonly used reference genes for sleep-related gene expression studies

    Directory of Open Access Journals (Sweden)

    Castro Rosa MRPS

    2009-05-01

    Full Text Available Abstract Background Sleep is a restorative process and is essential for maintenance of mental and physical health. In an attempt to understand the complexity of sleep, multidisciplinary strategies, including genetic approaches, have been applied to sleep research. Although quantitative real time PCR has been used in previous sleep-related gene expression studies, proper validation of reference genes is currently lacking. Thus, we examined the effect of total or paradoxical sleep deprivation (TSD or PSD on the expression stability of the following frequently used reference genes in brain and blood: beta-actin (b-actin, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, and hypoxanthine guanine phosphoribosyl transferase (HPRT. Results Neither TSD nor PSD affected the expression stability of all tested genes in both tissues indicating that b-actin, B2M, GAPDH and HPRT are appropriate reference genes for the sleep-related gene expression studies. In order to further verify these results, the relative expression of brain derived neurotrophic factor (BDNF and glycerol-3-phosphate dehydrogenase1 (GPD1 was evaluated in brain and blood, respectively. The normalization with each of four reference genes produced similar pattern of expression in control and sleep deprived rats, but subtle differences in the magnitude of expression fold change were observed which might affect the statistical significance. Conclusion This study demonstrated that sleep deprivation does not alter the expression stability of commonly used reference genes in brain and blood. Nonetheless, the use of multiple reference genes in quantitative RT-PCR is required for the accurate results.

  10. Identification of reference genes for RT-qPCR in ovine mammary tissue during late pregnancy and lactation and in response to maternal nutritional programming.

    Science.gov (United States)

    Paten, A M; Pain, S J; Peterson, S W; Blair, H T; Kenyon, P R; Dearden, P K; Duncan, E J

    2014-08-01

    The mammary gland is a complex tissue consisting of multiple cell types which, over the lifetime of an animal, go through repeated cycles of development associated with pregnancy, lactation and involution. The mammary gland is also known to be sensitive to maternal programming by environmental stimuli such as nutrition. The molecular basis of these adaptations is of significant interest, but requires robust methods to measure gene expression. Reverse-transcription quantitative PCR (RT-qPCR) is commonly used to measure gene expression, and is currently the method of choice for validating genome-wide expression studies. RT-qPCR requires the selection of reference genes that are stably expressed over physiological states and treatments. In this study we identify suitable reference genes to normalize RT-qPCR data for the ovine mammary gland in two physiological states; late pregnancy and lactation. Biopsies were collected from offspring of ewes that had been subjected to different nutritional paradigms during pregnancy to examine effects of maternal programming on the mammary gland of the offspring. We evaluated eight candidate reference genes and found that two reference genes (PRPF3 and CUL1) are required for normalising RT-qPCR data from pooled RNA samples, but five reference genes are required for analyzing gene expression in individual animals (SENP2, EIF6, MRPL39, ATP1A1, CUL1). Using these stable reference genes, we showed that TET1, a key regulator of DNA methylation, is responsive to maternal programming and physiological state. The identification of these novel reference genes will be of utility to future studies of gene expression in the ovine mammary gland. Copyright © 2014 the American Physiological Society.

  11. 18S rRNA is a reliable normalisation gene for real time PCR based on influenza virus infected cells

    Directory of Open Access Journals (Sweden)

    Kuchipudi Suresh V

    2012-10-01

    Full Text Available Abstract Background One requisite of quantitative reverse transcription PCR (qRT-PCR is to normalise the data with an internal reference gene that is invariant regardless of treatment, such as virus infection. Several studies have found variability in the expression of commonly used housekeeping genes, such as beta-actin (ACTB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, under different experimental settings. However, ACTB and GAPDH remain widely used in the studies of host gene response to virus infections, including influenza viruses. To date no detailed study has been described that compares the suitability of commonly used housekeeping genes in influenza virus infections. The present study evaluated several commonly used housekeeping genes [ACTB, GAPDH, 18S ribosomal RNA (18S rRNA, ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9 (ATP5G1] to identify the most stably expressed gene in human, pig, chicken and duck cells infected with a range of influenza A virus subtypes. Results The relative expression stability of commonly used housekeeping genes were determined in primary human bronchial epithelial cells (HBECs, pig tracheal epithelial cells (PTECs, and chicken and duck primary lung-derived cells infected with five influenza A virus subtypes. Analysis of qRT-PCR data from virus and mock infected cells using NormFinder and BestKeeper software programmes found that 18S rRNA was the most stable gene in HBECs, PTECs and avian lung cells. Conclusions Based on the presented data from cell culture models (HBECs, PTECs, chicken and duck lung cells infected with a range of influenza viruses, we found that 18S rRNA is the most stable reference gene for normalising qRT-PCR data. Expression levels of the other housekeeping genes evaluated in this study (including ACTB and GPADH were highly affected by influenza virus infection and

  12. Screening for the Most Suitable Reference Genes for Gene Expression Studies in Equine Milk Somatic Cells.

    Directory of Open Access Journals (Sweden)

    Jakub Cieslak

    Full Text Available Apart from the well-known role of somatic cell count as a parameter reflecting the inflammatory status of the mammary gland, the composition of cells isolated from milk is considered as a valuable material for gene expression studies in mammals. Due to its unique composition, in recent years an increasing interest in mare's milk consumption has been observed. Thus, investigating the genetic background of horse's milk variability presents and interesting study model. Relying on 39 milk samples collected from mares representing three breeds (Polish Primitive Horse, Polish Cold-blooded Horse, Polish Warmblood Horse we aimed to investigate the utility of equine milk somatic cells as a source of mRNA and to screen the best reference genes for RT-qPCR using geNorm and NormFinder algorithms. The results showed that despite relatively low somatic cell counts in mare's milk, the amount and the quality of the extracted RNA are sufficient for gene expression studies. The analysis of the utility of 7 potential reference genes for RT-qPCR experiments for the normalization of equine milk somatic cells revealed some differences between the outcomes of the applied algorithms, although in both cases the KRT8 and TOP2B genes were pointed as the most stable. Analysis by geNorm showed that the combination of 4 reference genes (ACTB, GAPDH, TOP2B and KRT8 is required for apropriate RT-qPCR experiments normalization, whereas NormFinder algorithm pointed the combination of KRT8 and RPS9 genes as the most suitable. The trial study of the relative transcript abundance of the beta-casein gene with the use of various types and numbers of internal control genes confirmed once again that the selection of proper reference gene combinations is crucial for the final results of each real-time PCR experiment.

  13. Gene Expression Measurement Module (GEMM) - a fully automated, miniaturized instrument for measuring gene expression in space

    Science.gov (United States)

    Karouia, Fathi; Ricco, Antonio; Pohorille, Andrew; Peyvan, Kianoosh

    2012-07-01

    The capability to measure gene expression on board spacecrafts opens the doors to a large number of experiments on the influence of space environment on biological systems that will profoundly impact our ability to conduct safe and effective space travel, and might also shed light on terrestrial physiology or biological function and human disease and aging processes. Measurements of gene expression will help us to understand adaptation of terrestrial life to conditions beyond the planet of origin, identify deleterious effects of the space environment on a wide range of organisms from microbes to humans, develop effective countermeasures against these effects, determine metabolic basis of microbial pathogenicity and drug resistance, test our ability to sustain and grow in space organisms that can be used for life support and in situ resource utilization during long-duration space exploration, and monitor both the spacecraft environment and crew health. These and other applications hold significant potential for discoveries in space biology, biotechnology and medicine. Accordingly, supported by funding from the NASA Astrobiology Science and Technology Instrument Development Program, we are developing a fully automated, miniaturized, integrated fluidic system for small spacecraft capable of in-situ measuring microbial expression of thousands of genes from multiple samples. The instrument will be capable of (1) lysing bacterial cell walls, (2) extracting and purifying RNA released from cells, (3) hybridizing it on a microarray and (4) providing electrochemical readout, all in a microfluidics cartridge. The prototype under development is suitable for deployment on nanosatellite platforms developed by the NASA Small Spacecraft Office. The first target application is to cultivate and measure gene expression of the photosynthetic bacterium Synechococcus elongatus, i.e. a cyanobacterium known to exhibit remarkable metabolic diversity and resilience to adverse conditions

  14. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    African Journals Online (AJOL)

    Calpastatin has been known as candidate gene in muscle growth efficiency and meat quality. This gene has been located to chromosome 5 of sheep. In order to evaluate the calpastatin gene polymorphism, random blood sample were collected from 111 Arabic ram sheep from different regions. The DNA extraction was ...

  15. Identification of potential internal control genes for real-time PCR analysis during stress response in Pyropia haitanensis

    Science.gov (United States)

    Wang, Xia; Feng, Jianhua; Huang, Aiyou; He, Linwen; Niu, Jianfeng; Wang, Guangce

    2017-11-01

    Pyropia haitanensis has prominent stress-resistance characteristics and is endemic to China. Studies into the stress responses in these algae could provide valuable information on the stress-response mechanisms in the intertidal Rhodophyta. Here, the effects of salinity and light intensity on the quantum yield of photosystem II in Py. haitanensis were investigated using pulse-amplitude-modulation fluorometry. Total RNA and genomic DNA of the samples under different stress conditions were isolated. By normalizing to the genomic DNA quantity, the RNA content in each sample was evaluated. The cDNA was synthesized and the expression levels of seven potential internal control genes were evaluated using qRT-PCR method. Then, we used geNorm, a common statistical algorithm, to analyze the qRT-PCR data of seven reference genes. Potential genes that may constantly be expressed under different conditions were selected, and these genes showed stable expression levels in samples under a salinity treatment, while tubulin, glyceraldehyde-3-phosphate dehydrogenase and actin showed stability in samples stressed by strong light. Based on the results of the pulse amplitude-modulation fluorometry, an absolute quantification was performed to obtain gene copy numbers in certain stress-treated samples. The stably expressed genes as determined by the absolute quantification in certain samples conformed to the results of the geNorm screening. Based on the results of the software analysis and absolute quantification, we proposed that elongation factor 3 and 18S ribosomal RNA could be used as internal control genes when the Py. haitanensis blades were subjected to salinity stress, and that α-tubulin and 18S ribosomal RNA could be used as the internal control genes when the stress was from strong light. In general, our findings provide a convenient reference for the selection of internal control genes when designing experiments related to stress responses in Py. haitanensis.

  16. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

    NARCIS (Netherlands)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-01-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

  17. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Directory of Open Access Journals (Sweden)

    Shutao Zhang

    Full Text Available The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae. Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25 and Chitinase 1(CHI1 genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  18. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    Science.gov (United States)

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  19. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    Science.gov (United States)

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Amplification biases: possible differences among deviating gene expressions

    Directory of Open Access Journals (Sweden)

    Piumi Francois

    2008-01-01

    Full Text Available Abstract Background Gene expression profiling has become a tool of choice to study pathological or developmental questions but in most cases the material is scarce and requires sample amplification. Two main procedures have been used: in vitro transcription (IVT and polymerase chain reaction (PCR, the former known as linear and the latter as exponential. Previous reports identified enzymatic pitfalls in PCR and IVT protocols; however the possible differences between the sequences affected by these amplification defaults were only rarely explored. Results Screening a bovine cDNA array dedicated to embryonic stages with embryonic (n = 3 and somatic tissues (n = 2, we proceeded to moderate amplifications starting from 1 μg of total RNA (global PCR or IVT one round. Whatever the tissue, 16% of the probes were involved in deviating gene expressions due to amplification defaults. These distortions were likely due to the molecular features of the affected sequences (position within a gene, GC content, hairpin number but also to the relative abundance of these transcripts within the tissues. These deviating genes mainly encoded housekeeping genes from physiological or cellular processes (70% and constituted 2 subsets which did not overlap (molecular features, signal intensities, gene ID. However, the differential expressions identified between embryonic stages were both reliable (minor intersect with biased expressions and relevant (biologically validated. In addition, the relative expression levels of those genes were biologically similar between amplified and unamplified samples. Conclusion Conversely to the most recent reports which challenged the use of intense amplification procedures on minute amounts of RNA, we chose moderate PCR and IVT amplifications for our gene profiling study. Conclusively, it appeared that systematic biases arose even with moderate amplification procedures, independently of (i the sample used: brain, ovary or embryos, (ii

  1. Estradiol-induced gene expression in largemouth bass (Micropterus salmoides)

    Science.gov (United States)

    Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.

    2002-01-01

    Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.

  2. PCR-RFLP analyses for studying the diversity of GH and Pit-1 genes in Slovak Simmental cattle

    Directory of Open Access Journals (Sweden)

    Anna Trakovická

    2013-10-01

    Full Text Available The aim of this study was evaluation of growth hormone (GH and specific pituitary transcription factor (Pit-1 genes diversity in population of 353 Slovak Simmental cows. The analyses were based on single nucleotide polymorphisms GH/AluI and Pit-1/HinfI detections. A polymorphic site of GH gene (AluI has been linked to differences in circulating metabolites, metabolic hormones and milk yield. Bovine Pit-1 is responsible for pituitary development and hormone secreting gene expression, including GH gene. The Pit-1/HinfI locus was associated with growth, milk production and reproduction performance in cattle. Samples of genomic DNA were analyzed by PCR-RFLP method. Digestion of GH gene PCR products with restriction enzyme AluI revealed allele L and V with frequency 0.695 and 0.305, respectively. The digested Pit-1 gene PCR products with enzyme HinfI revealed alleles A (0.249 and B (0.751. Dominant genotypes were for GH gene heterozygous LV (0.47 and for Pit-1 gene homozygous BB (0.56 animals. The observed heterozygosity, effective allele numbers and polymorphism information content of GH/AluI and Pit-1/HinfI bovine loci population were 0.42/0.37, 1.73/1.59 and 0.33/0.30, respectively. The median polymorphic information content of loci was also transferred to the higher observed homozygosity in population (0.58/0.63. Keywords: cattle, growth hormone, leptin, PCR, Pit-1, polymorphism.

  3. Validation and comparison of reference genes for qPCR normalization of celery (Apium graveolens at different development stages

    Directory of Open Access Journals (Sweden)

    Meng-Yao eLi

    2016-03-01

    Full Text Available A suitable reference gene is an important prerequisite for guarantying accurate and reliable results in qPCR analysis. Celery is one of the representative vegetable in Apiaceae and is widely cultivated and consumed in the world. However, no reports have been previously published concerning reference genes in celery. In this study, the expression stabilities of nine candidate reference genes in leaf blade and petiole at different development stages were evaluated using three statistics algorithms geNorm, NormFinder, and BestKeeper. Our results showed that TUB-B, TUB-A, and UBC were the most reference genes among all tested samples. GAPDH represented the maximum stability for most individual sample, while the UBQ displayed the minimum stability. To further validate the stability of reference genes, the expression pattern of AgAP2-2 was calculated by using the selected genes for normalization. In addition, the expression patterns of several development-related genes were studied using the selected reference gene. Our results will be beneficial for further studies on gene transcription in celery.

  4. Differential neutrophil gene expression in early bovine pregnancy

    Directory of Open Access Journals (Sweden)

    Kizaki Keiichiro

    2013-02-01

    Full Text Available Abstract Background In food production animals, especially cattle, the diagnosis of gestation is important because the timing of gestation directly affects the running of farms. Various methods have been used to detect gestation, but none of them are ideal because of problems with the timing of detection or the accuracy, simplicity, or cost of the method. A new method for detecting gestation, which involves assessing interferon-tau (IFNT-stimulated gene expression in peripheral blood leukocytes (PBL, was recently proposed. PBL fractionation methods were used to examine whether the expression profiles of various PBL populations could be used as reliable diagnostic markers of bovine gestation. Methods PBL were collected on days 0 (just before artificial insemination, 7, 14, 17, 21, and 28 of gestation. The gene expression levels of the PBL were assessed with microarray analysis and/or quantitative real-time reverse transcription (q PCR. PBL fractions were collected by flow cytometry or density gradient cell separation using Histopaque 1083 or Ficoll-Conray solutions. The expression levels of four IFNT-stimulated genes, interferon-stimulated protein 15 kDa (ISG15, myxovirus-resistance (MX 1 and 2, and 2′-5′-oligoadenylate synthetase (OAS1, were then analyzed in each fraction through day 28 of gestation using qPCR. Results Microarray analysis detected 72 and 28 genes in whole PBL that were significantly higher on days 14 and 21 of gestation, respectively, than on day 0. The upregulated genes included IFNT-stimulated genes. The expression levels of these genes increased with the progression of gestation until day 21. In flow cytometry experiments, on day 14 the expression levels of all of the genes were significantly higher in the granulocyte fraction than in the other fractions. Their expression gradually decreased through day 28 of gestation. Strong correlations were observed between the expression levels of the four genes in the granulocyte

  5. Gene Expression Profiling in Fish Toxicology: A Review.

    Science.gov (United States)

    Kumar, Girish; Denslow, Nancy D

    In this review, we present an overview of transcriptomic responses to chemical exposures in a variety of fish species. We have discussed the use of several molecular approaches such as northern blotting, differential display reverse transcription-polymerase chain reaction (DDRT-PCR), suppression subtractive hybridization (SSH), real time quantitative PCR (RT-qPCR), microarrays, and next-generation sequencing (NGS) for measuring gene expression. These techniques have been mainly used to measure the toxic effects of single compounds or simple mixtures in laboratory conditions. In addition, only few studies have been conducted to examine the biological significance of differentially expressed gene sets following chemical exposure. Therefore, future studies should focus more under field conditions using a multidisciplinary approach (genomics, proteomics and metabolomics) to understand the synergetic effects of multiple environmental stressors and to determine the functional significance of differentially expressed genes. Nevertheless, recent developments in NGS technologies and decreasing costs of sequencing holds the promise to uncover the complexity of anthropogenic impacts and biological effects in wild fish populations.

  6. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  7. Expression studies of the obesity candidate gene FTO in pig

    DEFF Research Database (Denmark)

    Madsen, Majbritt Busk; Birck, Malene Muusfeldt; Fredholm, Merete

    2010-01-01

    Obesity is an increasing problem worldwide and research on candidate genes in good animal models is highly needed. The pig is an excellent model as its metabolism, organ size, and eating habits resemble that of humans. The present study is focused on the characterization of the fat mass and obesity...... associated gene (FTO) in pig. This gene has recently been associated with increased body mass index in several human populations. To establish information on the expression profile of FTO in the pig we performed quantitative PCR in a panel of adult pig tissues and in tissues sampled at different...... and cerebellum). Additionally, in order to see the involvement of the FTO gene in obesity, the changes in expression level were investigated in a nutritional study in brain of Gottingen minipigs under a high cholesterol diet. Significantly higher (P

  8. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy [Davis, CA; Bachkirova, Elena [Davis, CA; Rey, Michael [Davis, CA

    2012-05-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  9. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2013-10-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  10. Effects of brachytherapy on gene expressions of elastin and elastase

    International Nuclear Information System (INIS)

    Li Junming; Zhou Jingqun; Hu Bin; Li Shuguo

    2004-01-01

    Objective: To study the effects of brachytherapy on the gene expressions of elastin and elastase in cultured rat vascular smooth muscle cells (VSMCs). Methods: Rat VSMCs cultured in DMEM containing 10% FBS were irradiated by 60 Co γ-rays at 0, 7, 14, 28 Gy respectively. Then mRNA levels of elastin and elastase were determined by reverse transcription competitive PCR(RT-PCR). Results: Brachytherapy inhibited the expressions of elastase. Elastase mRNA decreased 25.3% and 50.1% in VSMC irradiated with 14, 28 Gy, respectively (P<0.05). The elastin mRNA level increased 80.7% and 102.3% in VSMC irradiated with 14, 25 Gy, respectively (P<0.05). Conclusion: Brachytherapy inhabits the expressions of elastase and increased elastin in VSMC cells

  11. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin

    2007-08-01

    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  12. Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis

    Directory of Open Access Journals (Sweden)

    Timotijević Gordana S.

    2015-01-01

    Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028

  13. Selection of reference genes for quantitative real-time RT-PCR studies in tomato fruit of the genotype MT-Rg1

    Directory of Open Access Journals (Sweden)

    Karla L. González-Aguilera

    2016-09-01

    Full Text Available Quantitative real-time RT-PCR (qRT-PCR has become one of the most widely used methods for accurate quantification of gene expression. Since there are no universal reference genes for normalization, the optimal strategy to normalize raw qRT-PCR data is to perform an initial comparison of a set of independent reference genes to assess the most stable ones in each biological model. Normalization of a qRT-PCR experiment helps to ensure that the results are both statistically significant and biologically meaningful. Tomato is the model of choice to study fleshy fruit development. The miniature tomato (Solanum lycopersicum L. cultivar Micro-Tom (MT is considered a model system for tomato genetics and functional genomics. A new genotype, containing the Rg1 allele, improves tomato in vitro regeneration. In this work, we evaluated the expression stability of four tomato reference genes, namely CAC, SAND, Expressed and ACTIN2. We showed that the genes CAC and Exp are the best reference genes of the four we tested during fruit development in the MT-Rg1 genotype. Furthermore, we validated the reference genes by showing that the expression profiles of the transcription factors FRUITFULL1 (FUL1 and APETALA2c (AP2c during fruit development are comparable to previous reports using other tomato cultivars.

  14. Identification of suitable reference genes for gene expression studies of shoulder instability.

    Directory of Open Access Journals (Sweden)

    Mariana Ferreira Leal

    Full Text Available Shoulder instability is a common shoulder injury, and patients present with plastic deformation of the glenohumeral capsule. Gene expression analysis may be a useful tool for increasing the general understanding of capsule deformation, and reverse-transcription quantitative polymerase chain reaction (RT-qPCR has become an effective method for such studies. Although RT-qPCR is highly sensitive and specific, it requires the use of suitable reference genes for data normalization to guarantee meaningful and reproducible results. In the present study, we evaluated the suitability of a set of reference genes using samples from the glenohumeral capsules of individuals with and without shoulder instability. We analyzed the expression of six commonly used reference genes (ACTB, B2M, GAPDH, HPRT1, TBP and TFRC in the antero-inferior, antero-superior and posterior portions of the glenohumeral capsules of cases and controls. The stability of the candidate reference gene expression was determined using four software packages: NormFinder, geNorm, BestKeeper and DataAssist. Overall, HPRT1 was the best single reference gene, and HPRT1 and B2M composed the best pair of reference genes from different analysis groups, including simultaneous analysis of all tissue samples. GenEx software was used to identify the optimal number of reference genes to be used for normalization and demonstrated that the accumulated standard deviation resulting from the use of 2 reference genes was similar to that resulting from the use of 3 or more reference genes. To identify the optimal combination of reference genes, we evaluated the expression of COL1A1. Although the use of different reference gene combinations yielded variable normalized quantities, the relative quantities within sample groups were similar and confirmed that no obvious differences were observed when using 2, 3 or 4 reference genes. Consequently, the use of 2 stable reference genes for normalization, especially

  15. PCR-Internal Transcribed Spacer (ITS) genes sequencing and ...

    African Journals Online (AJOL)

    Methods: DNA extraction, purification, amplification and sequencing of Internal Transcribed Spacer (ITS) genes were per- formed using ... Keywords: Internal transcribed spacer genes, phylogenetic, genetic relationship, clinical and environmental fungi, HIV-TB. ... Nigeria. An Ethical clearance was obtained from the Eth-.

  16. Gene expression inference with deep learning.

    Science.gov (United States)

    Chen, Yifei; Li, Yi; Narayan, Rajiv; Subramanian, Aravind; Xie, Xiaohui

    2016-06-15

    Large-scale gene expression profiling has been widely used to characterize cellular states in response to various disease conditions, genetic perturbations, etc. Although the cost of whole-genome expression profiles has been dropping steadily, generating a compendium of expression profiling over thousands of samples is still very expensive. Recognizing that gene expressions are often highly correlated, researchers from the NIH LINCS program have developed a cost-effective strategy of profiling only ∼1000 carefully selected landmark genes and relying on computational methods to infer the expression of remaining target genes. However, the computational approach adopted by the LINCS program is currently based on linear regression (LR), limiting its accuracy since it does not capture complex nonlinear relationship between expressions of genes. We present a deep learning method (abbreviated as D-GEX) to infer the expression of target genes from the expression of landmark genes. We used the microarray-based Gene Expression Omnibus dataset, consisting of 111K expression profiles, to train our model and compare its performance to those from other methods. In terms of mean absolute error averaged across all genes, deep learning significantly outperforms LR with 15.33% relative improvement. A gene-wise comparative analysis shows that deep learning achieves lower error than LR in 99.97% of the target genes. We also tested the performance of our learned model on an independent RNA-Seq-based GTEx dataset, which consists of 2921 expression profiles. Deep learning still outperforms LR with 6.57% relative improvement, and achieves lower error in 81.31% of the target genes. D-GEX is available at https://github.com/uci-cbcl/D-GEX CONTACT: xhx@ics.uci.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Identification of differentially expressed genes in childhood asthma.

    Science.gov (United States)

    Zhang, Nian-Zhen; Chen, Xiu-Juan; Mu, Yu-Hua; Wang, Hewen

    2018-05-01

    Asthma has been the most common chronic disease in children that places a major burden for affected people and their families.An integrated analysis of microarrays studies was performed to identify differentially expressed genes (DEGs) in childhood asthma compared with normal control. We also obtained the differentially methylated genes (DMGs) in childhood asthma according to GEO. The genes that were both differentially expressed and differentially methylated were identified. Functional annotation and protein-protein interaction network construction were performed to interpret biological functions of DEGs. We performed q-RT-PCR to verify the expression of selected DEGs.One DNA methylation and 3 gene expression datasets were obtained. Four hundred forty-one DEGs and 1209 DMGs in childhood asthma were identified. Among which, 16 genes were both differentially expressed and differentially methylated in childhood asthma. Natural killer cell mediated cytotoxicity pathway, Jak-STAT signaling pathway, and Wnt signaling pathway were 3 significantly enriched pathways in childhood asthma according to our KEGG enrichment analysis. The PPI network of top 20 up- and downregulated DEGs consisted of 822 nodes and 904 edges and 2 hub proteins (UBQLN4 and MID2) were identified. The expression of 8 DEGs (GZMB, FGFBP2, CLC, TBX21, ALOX15, IL12RB2, UBQLN4) was verified by qRT-PCR and only the expression of GZMB and FGFBP2 was inconsistent with our integrated analysis.Our finding was helpful to elucidate the underlying mechanism of childhood asthma and develop new potential diagnostic biomarker and provide clues for drug design.

  18. Real-time PCR detection of aldoxime dehydratase genes in nitrile-degrading microorganisms.

    Science.gov (United States)

    Dooley-Cullinane, Tríona Marie; O'Reilly, Catherine; Coffey, Lee

    2017-02-01

    Aldoxime dehydratase catalyses the conversion of aldoximes to their corresponding nitriles. Utilization of the aldoxime-nitrile metabolising enzyme pathway can facilitate the move towards a greener chemistry. In this work, a real-time PCR assay was developed for the detection of aldoxime dehydratase genes in aldoxime/nitrile metabolising microorganisms which have been purified from environmental sources. A conventional PCR assay was also designed allowing gene confirmation via sequencing. Aldoxime dehydratase genes were identified in 30 microorganisms across 11 genera including some not previously shown to harbour the gene. The assay displayed a limit of detection of 1 pg/μL DNA or 7 CFU/reaction. This real-time PCR assay should prove valuable in the high-throughput screening of micro-organisms for novel aldoxime dehydratase genes towards pharmaceutical and industrial applications.

  19. Evaluation of reference genes for RT-qPCR study in abalone Haliotis discus hannai during heavy metal overload stress

    Directory of Open Access Journals (Sweden)

    Sang Yoon Lee

    2016-06-01

    Full Text Available Abstract Background The evaluation of suitable reference genes as normalization controls is a prerequisite requirement for launching quantitative reverse transcription-PCR (RT-qPCR-based expression study. In order to select the stable reference genes in abalone Haliotis discus hannai tissues (gill and hepatopancreas under heavy metal exposure conditions (Cu, Zn, and Cd, 12 potential candidate housekeeping genes were subjected to expression stability based on the comprehensive ranking while integrating four different statistical algorithms (geNorm, NormFinder, BestKeeper, and ΔCT method. Results Expression stability in the gill subset was determined as RPL7 > RPL8 > ACTB > RPL3 > PPIB > RPL7A > EF1A > RPL4 > GAPDH > RPL5 > UBE2 > B-TU. On the other hand, the ranking in the subset for hepatopancreas was RPL7 > RPL3 > RPL8 > ACTB > RPL4 > EF1A > RPL5 > RPL7A > B-TU > UBE2 > PPIB > GAPDH. The pairwise variation assessed by the geNorm program indicates that two reference genes could be sufficient for accurate normalization in both gill and hepatopancreas subsets. Overall, both gill and hepatopancreas subsets recommended ribosomal protein genes (particularly RPL7 as stable references, whereas traditional housekeepers such as β-tubulin (B-TU and glyceraldehyde-3-phosphate dehydrogenase (GAPDH genes were ranked as unstable genes. The validation of reference gene selection was confirmed with the quantitative assay of MT transcripts. Conclusions The present analysis showed the importance of validating reference genes with multiple algorithmic approaches to select genes that are truly stable. Our results indicate that expression stability of a given reference gene could not always have consensus across tissue types. The data from this study could be a good guide for the future design of RT-qPCR studies with respect to metal regulation/detoxification and other related

  20. Alteration of gene expression by alcohol exposure at early neurulation.

    Science.gov (United States)

    Zhou, Feng C; Zhao, Qianqian; Liu, Yunlong; Goodlett, Charles R; Liang, Tiebing; McClintick, Jeanette N; Edenberg, Howard J; Li, Lang

    2011-02-21

    We have previously demonstrated that alcohol exposure at early neurulation induces growth retardation, neural tube abnormalities, and alteration of DNA methylation. To explore the global gene expression changes which may underline these developmental defects, microarray analyses were performed in a whole embryo mouse culture model that allows control over alcohol and embryonic variables. Alcohol caused teratogenesis in brain, heart, forelimb, and optic vesicle; a subset of the embryos also showed cranial neural tube defects. In microarray analysis (accession number GSM9545), adopting hypothesis-driven Gene Set Enrichment Analysis (GSEA) informatics and intersection analysis of two independent experiments, we found that there was a collective reduction in expression of neural specification genes (neurogenin, Sox5, Bhlhe22), neural growth factor genes [Igf1, Efemp1, Klf10 (Tieg), and Edil3], and alteration of genes involved in cell growth, apoptosis, histone variants, eye and heart development. There was also a reduction of retinol binding protein 1 (Rbp1), and de novo expression of aldehyde dehydrogenase 1B1 (Aldh1B1). Remarkably, four key hematopoiesis genes (glycophorin A, adducin 2, beta-2 microglobulin, and ceruloplasmin) were absent after alcohol treatment, and histone variant genes were reduced. The down-regulation of the neurospecification and the neurotrophic genes were further confirmed by quantitative RT-PCR. Furthermore, the gene expression profile demonstrated distinct subgroups which corresponded with two distinct alcohol-related neural tube phenotypes: an open (ALC-NTO) and a closed neural tube (ALC-NTC). Further, the epidermal growth factor signaling pathway and histone variants were specifically altered in ALC-NTO, and a greater number of neurotrophic/growth factor genes were down-regulated in the ALC-NTO than in the ALC-NTC embryos. This study revealed a set of genes vulnerable to alcohol exposure and genes that were associated with neural tube

  1. Determinants of human adipose tissue gene expression

    DEFF Research Database (Denmark)

    Viguerie, Nathalie; Montastier, Emilie; Maoret, Jean-José

    2012-01-01

    weight maintenance diets. For 175 genes, opposite regulation was observed during calorie restriction and weight maintenance phases, independently of variations in body weight. Metabolism and immunity genes showed inverse profiles. During the dietary intervention, network-based analyses revealed strong...... interconnection between expression of genes involved in de novo lipogenesis and components of the metabolic syndrome. Sex had a marked influence on AT expression of 88 transcripts, which persisted during the entire dietary intervention and after control for fat mass. In women, the influence of body mass index...... on expression of a subset of genes persisted during the dietary intervention. Twenty-two genes revealed a metabolic syndrome signature common to men and women. Genetic control of AT gene expression by cis signals was observed for 46 genes. Dietary intervention, sex, and cis genetic variants independently...

  2. Deriving Trading Rules Using Gene Expression Programming

    Directory of Open Access Journals (Sweden)

    Adrian VISOIU

    2011-01-01

    Full Text Available This paper presents how buy and sell trading rules are generated using gene expression programming with special setup. Market concepts are presented and market analysis is discussed with emphasis on technical analysis and quantitative methods. The use of genetic algorithms in deriving trading rules is presented. Gene expression programming is applied in a form where multiple types of operators and operands are used. This gives birth to multiple gene contexts and references between genes in order to keep the linear structure of the gene expression programming chromosome. The setup of multiple gene contexts is presented. The case study shows how to use the proposed gene setup to derive trading rules encoded by Boolean expressions, using a dataset with the reference exchange rates between the Euro and the Romanian leu. The conclusions highlight the positive results obtained in deriving useful trading rules.

  3. Development of expression vectors for Escherichia coli based on the pCR2 replicon

    Directory of Open Access Journals (Sweden)

    Deb J K

    2007-05-01

    Full Text Available Abstract Background Recent developments in metabolic engineering and the need for expanded compatibility required for co-expression studies, underscore the importance of developing new plasmid vectors with properties such as stability and compatibility. Results We utilized the pCR2 replicon of Corynebacterium renale, which harbours multiple plasmids, for constructing a range of expression vectors. Different antibiotic-resistance markers were introduced and the vectors were found to be 100% stable over a large number of generations in the absence of selection pressure. Compatibility of this plasmid was studied with different Escherichia coli plasmid replicons viz. pMB1 and p15A. It was observed that pCR2 was able to coexist with these E.coli plasmids for 60 generations in the absence of selection pressure. Soluble intracellular production was checked by expressing GFP under the lac promoter in an expression plasmid pCR2GFP. Also high level production of human IFNγ was obtained by cloning the h-IFNγ under a T7 promoter in the expression plasmid pCR2-IFNγ and using a dual plasmid heat shock system for expression. Repeated sub-culturing in the absence of selection pressure for six days did not lead to any fall in the production levels post induction, for both GFP and h-IFNγ, demonstrating that pCR2 is a useful plasmid in terms of stability and compatibility. Conclusion We have constructed a series of expression vectors based on the pCR2 replicon and demonstrated its high stability and sustained expression capacity, in the absence of selection pressure which will make it an efficient tool for metabolic engineering and co-expression studies, as well as for scale up of expression.

  4. Rapid direct identification of Cryptococcus neoformans from pigeon droppings by nested PCR using CNLAC1 gene.

    Science.gov (United States)

    Chae, H S; Park, G N; Kim, S H; Jo, H J; Kim, J T; Jeoung, H Y; An, D J; Kim, N H; Shin, B W; Kang, Y I; Chang, K S

    2012-08-01

    Isolation and identification of Cryptococcus neoformans and pathogenic yeast-like fungi from pigeon droppings has been taken for a long time and requires various nutrients for its growth. In this study, we attempted to establish a rapid direct identification method of Cr. neoformans from pigeon dropping samples by nested-PCR using internal transcribed spacer (ITS) CAP64 and CNLAC1 genes, polysaccharide capsule gene and laccase-associated gene to produce melanin pigment, respectively, which are common genes of yeasts. The ITS and CAP64 genes were amplified in all pathogenic yeasts, but CNLAC1 was amplified only in Cr. neoformans. The ITS gene was useful for yeast genotyping depending on nucleotide sequence. Homology of CAP64 genes among the yeasts were very high. The specificity of PCR using CNLAC1 was demonstrated in Cr. neoformans environmental strains but not in other yeast-like fungi. The CNLAC1 gene was detected in 5 serotypes of Cr. neoformans. The nested-PCR amplified up to 10(-11) μg of the genomic DNA and showed high sensitivity. All pigeon droppings among 31 Cr. neoformans-positive samples were positive and all pigeon droppings among 348 Cr. neoformans-negative samples were negative by the direct nested-PCR. In addition, after primary enrichment of pigeon droppings in Sabouraud dextrose broth, all Cr. neoformans-negative samples were negative by the nested-PCR, which showed high specificity. The nested-PCR showed high sensitivity without culture of pigeon droppings. Nested-PCR using CNLAC1 provides a rapid and reliable molecular diagnostic method to overcome weak points such as long culture time of many conventional methods.

  5. A novel BDNF gene promoter directs expression to skeletal muscle

    Directory of Open Access Journals (Sweden)

    Heinrich Gerhard

    2003-06-01

    Full Text Available Abstract Background Cell-specific expression of the gene that encodes brain-derived neurotrophic factor (BDNF is required for the normal development of peripheral sensory neurons and efficient synaptic transmission in the mature central and peripheral nervous system. The control of BDNF gene expression involves multiple tissue and cell-specific promoters that are differentially regulated. The molecular mechanisms that are responsible for tissue and cell-specific expression of these promoters are still incompletely understood. Results The cloning and analysis of three additional zebrafish (Danio rerio BDNF gene exons and two associated promoters, is reported. Among them are two exons that generate a novel tripartite mature transcript. The exons were located on the transcription unit, whose overall organization was determined by cloning, Southern blot hybridization and sequence analysis, and compared with the pufferfish (Fugu rubripes and mammalian BDNF loci, revealing a conserved but more compact organization. Structural and functional analysis of the exons, their adjacent promoters and 5' flanks, showed that they are expressed cell-specifically. The promoter associated with the 5' exon of the tripartite transcript is GC-rich, TATA-less and the 5' flank adjacent to it contains multiple Sp1, Mef2, and AP1 elements. A fusion gene containing the promoter and 1.5 KB of 5' flank is directed exclusively to skeletal muscle of transiently transfected embryos. The second promoter, whose associated 5' exon contains a 25-nucleotide segment of identity with a mammalian BDNF gene exon, was transiently expressed in yolk of the early embryo. RT-PCR analysis of total RNA from whole juvenile fish and adult female skeletal muscle revealed tissue-specific expression of the 5' exons but the novel exon could not be detected even after two rounds of nested PCR. Conclusion The zebrafish BDNF gene is as complex as the mammalian gene yet much more compact. Its exons are

  6. Polycistronic gene expression in Aspergillus niger.

    Science.gov (United States)

    Schuetze, Tabea; Meyer, Vera

    2017-09-25

    Genome mining approaches predict dozens of biosynthetic gene clusters in each of the filamentous fungal genomes sequenced so far. However, the majority of these gene clusters still remain cryptic because they are not expressed in their natural host. Simultaneous expression of all genes belonging to a biosynthetic pathway in a heterologous host is one approach to activate biosynthetic gene clusters and to screen the metabolites produced for bioactivities. Polycistronic expression of all pathway genes under control of a single and tunable promoter would be the method of choice, as this does not only simplify cloning procedures, but also offers control on timing and strength of expression. However, polycistronic gene expression is a feature not commonly found in eukaryotic host systems, such as Aspergillus niger. In this study, we tested the suitability of the viral P2A peptide for co-expression of three genes in A. niger. Two genes descend from Fusarium oxysporum and are essential to produce the secondary metabolite enniatin (esyn1, ekivR). The third gene (luc) encodes the reporter luciferase which was included to study position effects. Expression of the polycistronic gene cassette was put under control of the Tet-On system to ensure tunable gene expression in A. niger. In total, three polycistronic expression cassettes which differed in the position of luc were constructed and targeted to the pyrG locus in A. niger. This allowed direct comparison of the luciferase activity based on the position of the luciferase gene. Doxycycline-mediated induction of the Tet-On expression cassettes resulted in the production of one long polycistronic mRNA as proven by Northern analyses, and ensured comparable production of enniatin in all three strains. Notably, gene position within the polycistronic expression cassette matters, as, luciferase activity was lowest at position one and had a comparable activity at positions two and three. The P2A peptide can be used to express at

  7. Gene expression of manganese superoxide dismutase in human glioma cells

    Directory of Open Access Journals (Sweden)

    Novi S. Hardiany

    2010-02-01

    Full Text Available Aim This study analyze the MnSOD gene expression as endogenous antioxidant in human glioma cells compared with leucocyte cells as control.Methods MnSOD gene expression of 20 glioma patients was analyzed by measuring the relative expression of mRNA and enzyme activity of MnSOD in brain and leucocyte cells. The relative expression of mRNA MnSOD was determined by using quantitative Real Time RT-PCR and the enzyme activity of MnSOD using biochemical kit assay (xantine oxidase inhibition. Statistic analysis for mRNA and enzyme activity of MnSOD was performed using Kruskal Wallis test.Results mRNA of MnSOD in glioma cells of 70% sample was 0.015–0.627 lower, 10% was 1.002-1.059 and 20% was 1.409-6.915 higher than in leucocyte cells. Also the specific activity of MnSOD enzyme in glioma cells of 80% sample showed 0,064-0,506 lower and 20% sample was 1.249-2.718 higher than in leucocyte cells.Conclusion MnSOD gene expression in human glioma cells are significantly lower than its expression in leucocytes cells. (Med J Indones 2010; 19:21-5Keywords : MnSOD, glioma, gene expression

  8. Profiling Gene Expression in Germinating Brassica Roots.

    Science.gov (United States)

    Park, Myoung Ryoul; Wang, Yi-Hong; Hasenstein, Karl H

    2014-01-01

    Based on previously developed solid-phase gene extraction (SPGE) we examined the mRNA profile in primary roots of Brassica rapa seedlings for highly expressed genes like ACT7 (actin7), TUB (tubulin1), UBQ (ubiquitin), and low expressed GLK (glucokinase) during the first day post-germination. The assessment was based on the mRNA load of the SPGE probe of about 2.1 ng. The number of copies of the investigated genes changed spatially along the length of primary roots. The expression level of all genes differed significantly at each sample position. Among the examined genes ACT7 expression was most even along the root. UBQ was highest at the tip and root-shoot junction (RS). TUB and GLK showed a basipetal gradient. The temporal expression of UBQ was highest in the MZ 9 h after primary root emergence and higher than at any other sample position. Expressions of GLK in EZ and RS increased gradually over time. SPGE extraction is the result of oligo-dT and oligo-dA hybridization and the results illustrate that SPGE can be used for gene expression profiling at high spatial and temporal resolution. SPGE needles can be used within two weeks when stored at 4 °C. Our data indicate that gene expression studies that are based on the entire root miss important differences in gene expression that SPGE is able to resolve for example growth adjustments during gravitropism.

  9. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... Calpastatin has been known as candidate gene in muscle growth efficiency and ... population, AA, AB, BB genotype have been identified with the 70.27, .... of cimaterol on rabbit growth and myofibrillar protein degradation.

  10. Increased expression of electron transport chain genes in uterine leiomyoma.

    Science.gov (United States)

    Tuncal, Akile; Aydin, Hikmet Hakan; Askar, Niyazi; Ozkaya, Ali Burak; Ergenoglu, Ahmet Mete; Yeniel, Ahmet Ozgur; Akdemir, Ali; Ak, Handan

    2014-01-01

    The etiology and pathophysiology of uterine leiomyomas, benign smooth muscle tumors of the uterus, are not well understood. To evaluate the role of mitochondria in uterine leiomyoma, we compared electron transport gene expressions of uterine leiomyoma tissue with myometrium tissue in six uterine leiomyoma patients by RT-PCR array. Our results showed an average of 1.562 (±0.445) fold increase in nuclear-encoded electron transport genes. These results might suggest an increase in size, number, or activity of mitochondria in uterine leiomyoma that, to our knowledge, has not been previously reported. © 2014 by the Association of Clinical Scientists, Inc.

  11. Gene expression of circulating tumour cells in breast cancer patients

    Directory of Open Access Journals (Sweden)

    Bölke E

    2009-09-01

    Full Text Available Abstract Background The diagnostic tools to predict the prognosis in patients suffering from breast cancer (BC need further improvements. New technological achievements like the gene profiling of circulating tumour cells (CTC could help identify new prognostic markers in the clinical setting. Furthermore, gene expression patterns of CTC might provide important informations on the mechanisms of tumour cell metastasation. Materials and methods We performed realtime-PCR and multiplex-PCR analyses following immunomagnetic separation of CTC. Peripheral blood (PB samples of 63 patients with breast cancer of various stages were analyzed and compared to a control group of 14 healthy individuals. After reverse-transcription, we performed multiplex PCR using primers for the genes ga733.3, muc-1 and c-erbB2. Mammaglobin1, spdef and c-erbB2 were analyzed applying realtime-PCR. Results ga733.2 overexpression was found in 12.7% of breast cancer cases, muc-1 in 15.9%, mgb1 in 9.1% and spdef in 12.1%. In this study, c-erbB2 did not show any significant correlation to BC, possibly due to a highly ambient expression. Besides single gene analyses, gene profiles were additionally evaluated. Highly significant correlations to BC were found in single gene analyses of ga733.2 and muc-1 and in gene profile analyses of ga733.3*muc-1 and GA7 ga733.3*muc-1*mgb1*spdef. Conclusion Our study reveals that the single genes ga733.3, muc-1 and the gene profiles ga733.3*muc-1 and ga733.3*3muc-1*mgb1*spdef can serve as markers for the detection of CTC in BC. The multigene analyses found highly positive levels in BC patients. Our study indicates that not single gene analyses but subtle patterns of multiple genes lead to rising accuracy and low loss of specificity in detection of breast cancer cases.

  12. Chromatin loops, gene positioning, and gene expression

    NARCIS (Netherlands)

    Holwerda, S.; de Laat, W.

    2012-01-01

    Technological developments and intense research over the last years have led to a better understanding of the 3D structure of the genome and its influence on genome function inside the cell nucleus. We will summarize topological studies performed on four model gene loci: the alpha- and beta-globin

  13. Gene expression profiles reveal key genes for early diagnosis and treatment of adamantinomatous craniopharyngioma.

    Science.gov (United States)

    Yang, Jun; Hou, Ziming; Wang, Changjiang; Wang, Hao; Zhang, Hongbing

    2018-04-23

    Adamantinomatous craniopharyngioma (ACP) is an aggressive brain tumor that occurs predominantly in the pediatric population. Conventional diagnosis method and standard therapy cannot treat ACPs effectively. In this paper, we aimed to identify key genes for ACP early diagnosis and treatment. Datasets GSE94349 and GSE68015 were obtained from Gene Expression Omnibus database. Consensus clustering was applied to discover the gene clusters in the expression data of GSE94349 and functional enrichment analysis was performed on gene set in each cluster. The protein-protein interaction (PPI) network was built by the Search Tool for the Retrieval of Interacting Genes, and hubs were selected. Support vector machine (SVM) model was built based on the signature genes identified from enrichment analysis and PPI network. Dataset GSE94349 was used for training and testing, and GSE68015 was used for validation. Besides, RT-qPCR analysis was performed to analyze the expression of signature genes in ACP samples compared with normal controls. Seven gene clusters were discovered in the differentially expressed genes identified from GSE94349 dataset. Enrichment analysis of each cluster identified 25 pathways that highly associated with ACP. PPI network was built and 46 hubs were determined. Twenty-five pathway-related genes that overlapped with the hubs in PPI network were used as signatures to establish the SVM diagnosis model for ACP. The prediction accuracy of SVM model for training, testing, and validation data were 94, 85, and 74%, respectively. The expression of CDH1, CCL2, ITGA2, COL8A1, COL6A2, and COL6A3 were significantly upregulated in ACP tumor samples, while CAMK2A, RIMS1, NEFL, SYT1, and STX1A were significantly downregulated, which were consistent with the differentially expressed gene analysis. SVM model is a promising classification tool for screening and early diagnosis of ACP. The ACP-related pathways and signature genes will advance our knowledge of ACP pathogenesis

  14. Serial analysis of gene expression (SAGE)

    NARCIS (Netherlands)

    van Ruissen, Fred; Baas, Frank

    2007-01-01

    In 1995, serial analysis of gene expression (SAGE) was developed as a versatile tool for gene expression studies. SAGE technology does not require pre-existing knowledge of the genome that is being examined and therefore SAGE can be applied to many different model systems. In this chapter, the SAGE

  15. Utility of the cytochrome c oxidase subunit I gene for the diagnosis of toxoplasmosis using PCR.

    Science.gov (United States)

    Feng, Xue; Norose, Kazumi; Li, Kexin; Hikosaka, Kenji

    2017-10-01

    Toxoplasmosis is caused by the protozoan parasite Toxoplasma gondii, which belongs to the phylum Apicomplexa. Since this parasite causes severe clinical symptoms in immunocompromised patients, early diagnosis of toxoplasmosis is essential. PCR is currently used for early diagnosis, but there is no consensus regarding the most effective method for amplifying Toxoplasma DNA. In this study, we considered the utility of the cytochrome c subunit I (cox1) gene, which is encoded in the mitochondrial DNA of this parasite, as a novel target of PCR for the diagnosis of toxoplasmosis. To do this, we compared its copy number per haploid nuclear genome and the detection sensitivity of cox1-PCR with the previously reported target genes B1 and 18S rRNA and the AF146527 repeat element. We found that the copy number of cox1 was high and that the PCR using cox1 primers was more efficient at amplifying Toxoplasma DNA than the other PCR targets examined. In addition, PCR using clinical samples indicated that the cox1 gene would be useful for the diagnosis of toxoplasmosis. These findings suggest that use of cox1-PCR would facilitate the diagnosis of toxoplasmosis in clinical laboratories. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Sequence characterisation of deletion breakpoints in the dystrophin gene by PCR

    Energy Technology Data Exchange (ETDEWEB)

    Abbs, S.; Sandhu, S.; Bobrow, M. [Guy`s Hospital, London (United Kingdom)

    1994-09-01

    Partial deletions of the dystrophin gene account for 65% of cases of Duchenne muscular dystrophy. A high proportion of these structural changes are generated by new mutational events, and lie predominantly within two `hotspot` regions, yet the underlying reasons for this are not known. We are characterizing and sequencing the regions surrounding deletion breakpoints in order to: (i) investigate the mechanisms of deletion mutation, and (ii) enable the design of PCR assays to specifically amplify mutant and normal sequences, allowing us to search for the presence of somatic mosaicism in appropriate family members. Using this approach we have been able to demonstrate the presence of somatic mosaicism in a maternal grandfather of a DMD-affected male, deleted for exons 49-50. Three deletions, namely of exons 48-49, 49-50, and 50, have been characterized using a PCR approach that avoids any cloning procedures. Breakpoints were initially localized to within regions of a few kilobases using Southern blot restriction analyses with exon-specific probes and PCR amplification of exonic and intronic loci. Sequencing was performed directly on PCR products: (i) mutant sequences were obtained from long-range or inverse-PCR across the deletion junction fragments, and (ii) normal sequences were obtained from the products of standard PCR, vectorette PCR, or inverse-PCR performed on YACs. Further characterization of intronic sequences will allow us to amplify and sequence across other deletion breakpoints and increase our knowledge of the mechanisms of mutation in the dystophin gene.

  17. Digital PCR (dPCR) analysis reveals that the homozygous c.315-48T>C variant in the FECH gene might cause erythropoietic protoporphyria (EPP).

    Science.gov (United States)

    Brancaleoni, Valentina; Granata, Francesca; Missineo, Pasquale; Fustinoni, Silvia; Graziadei, Giovanna; Di Pierro, Elena

    2018-06-13

    Alterations in the ferrochelatase gene (FECH) are the basis of the phenotypic expressions in erythropoietic protoporphyria. The phenotype is due to the presence of a mutation in the FECH gene associated in trans to the c.315-48 T > C variant in the intron 3. The latter is able to increase the physiological quota of alternative splicing events in the intron 3. Other two variants in the FECH gene (c.1-252A > G and c.68-23C > T) have been found to be associated to the intron 3 variant in some populations and together, they constitute a haplotype (ACT/GTC), but eventually, their role in the alternative splicing event has never been elucidated. The absolute number of the aberrantly spliced FECH mRNA molecules and the absolute expression of the FECH gene were evaluated by digital PCR technique in a comprehensive cohort. The number of splicing events that rose in the presence of the c.315-48 T > C variant, both in the heterozygous and homozygous condition was reported for the first time. Also, the percentage of the inserted FECH mRNA increased, even doubled in the T/C cases, compared to T/T cases. The constant presence of variants in the promoter and intron 2 did not influence or modulate the aberrant splicing. The results of FECH gene expression suggested that the homozygosity for the c.315-48 T > C variant could be considered pathological. Thus, this study identified the homozygotes for the c.315-48 T > C variant as pathological. By extension, when the samples were categorised according to the haplotypes, the GTC haplotype in homozygosis was pathological. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression

    Science.gov (United States)

    Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula

    2014-01-01

    Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

  19. Xylella fastidiosa gene expression analysis by DNA microarrays

    Directory of Open Access Journals (Sweden)

    Regiane F. Travensolo

    2009-01-01

    Full Text Available Xylella fastidiosa genome sequencing has generated valuable data by identifying genes acting either on metabolic pathways or in associated pathogenicity and virulence. Based on available information on these genes, new strategies for studying their expression patterns, such as microarray technology, were employed. A total of 2,600 primer pairs were synthesized and then used to generate fragments using the PCR technique. The arrays were hybridized against cDNAs labeled during reverse transcription reactions and which were obtained from bacteria grown under two different conditions (liquid XDM2 and liquid BCYE. All data were statistically analyzed to verify which genes were differentially expressed. In addition to exploring conditions for X. fastidiosa genome-wide transcriptome analysis, the present work observed the differential expression of several classes of genes (energy, protein, amino acid and nucleotide metabolism, transport, degradation of substances, toxins and hypothetical proteins, among others. The understanding of expressed genes in these two different media will be useful in comprehending the metabolic characteristics of X. fastidiosa, and in evaluating how important certain genes are for the functioning and survival of these bacteria in plants.

  20. Molecular Characterization and Expression Analysis of Equine ( Gene in Horse (

    Directory of Open Access Journals (Sweden)

    Ki-Duk Song

    2014-05-01

    Full Text Available The objective of this study was to determine the molecular characteristics of the horse vascular endothelial growth factor alpha gene (VEGFα by constructing a phylogenetic tree, and to investigate gene expression profiles in tissues and blood leukocytes after exercise for development of suitable biomarkers. Using published amino acid sequences of other vertebrate species (human, chimpanzee, mouse, rat, cow, pig, chicken and dog, we constructed a phylogenetic tree which showed that equine VEGFα belonged to the same clade of the pig VEGFα. Analysis for synonymous (Ks and non-synonymous substitution ratios (Ka revealed that the horse VEGFα underwent positive selection. RNA was extracted from blood samples before and after exercise and different tissue samples of three horses. Expression analyses using reverse transcription-polymerase chain reaction (RT-PCR and quantitative-polymerase chain reaction (qPCR showed ubiquitous expression of VEGFα mRNA in skeletal muscle, kidney, thyroid, lung, appendix, colon, spinal cord, and heart tissues. Analysis of differential expression of VEGFα gene in blood leukocytes after exercise indicated a unimodal pattern. These results will be useful in developing biomarkers that can predict the recovery capacity of racing horses.

  1. ABCG2 in peptic ulcer: gene expression and mutation analysis.

    Science.gov (United States)

    Salagacka-Kubiak, Aleksandra; Żebrowska, Marta; Wosiak, Agnieszka; Balcerczak, Mariusz; Mirowski, Marek; Balcerczak, Ewa

    2016-08-01

    The aim of this study was to evaluate the participation of polymorphism at position C421A and mRNA expression of the ABCG2 gene in the development of peptic ulcers, which is a very common and severe disease. ABCG2, encoded by the ABCG2 gene, has been found inter alia in the gastrointestinal tract, where it plays a protective role eliminating xenobiotics from cells into the extracellular environment. The materials for the study were biopsies of gastric mucosa taken during a routine endoscopy. For genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at position C421A, DNA was isolated from 201 samples, while for the mRNA expression level by real-time PCR, RNA was isolated from 60 patients. The control group of healthy individuals consisted of 97 blood donors. The dominant genotype in the group of peptic ulcer patients and healthy individuals was homozygous CC. No statistically significant differences between healthy individuals and the whole group of peptic ulcer patients and, likewise, between the subgroups of peptic ulcer patients (infected and uninfected with Helicobacter pylori) were found. ABCG2 expression relative to GAPDH expression was found in 38 of the 60 gastric mucosa samples. The expression level of the gene varies greatly among cases. The statistically significant differences between the intensity (p = 0.0375) of H. pylori infection and ABCG2 gene expression have been shown. It was observed that the more intense the infection, the higher the level of ABCG2 expression.

  2. Expression of Sox genes in tooth development.

    Science.gov (United States)

    Kawasaki, Katsushige; Kawasaki, Maiko; Watanabe, Momoko; Idrus, Erik; Nagai, Takahiro; Oommen, Shelly; Maeda, Takeyasu; Hagiwara, Nobuko; Que, Jianwen; Sharpe, Paul T; Ohazama, Atsushi

    2015-01-01

    Members of the Sox gene family play roles in many biological processes including organogenesis. We carried out comparative in situ hybridization analysis of seventeen sox genes (Sox1-14, 17, 18, 21) during murine odontogenesis from the epithelial thickening to the cytodifferentiation stages. Localized expression of five Sox genes (Sox6, 9, 13, 14 and 21) was observed in tooth bud epithelium. Sox13 showed restricted expression in the primary enamel knots. At the early bell stage, three Sox genes (Sox8, 11, 17 and 21) were expressed in pre-ameloblasts, whereas two others (Sox5 and 18) showed expression in odontoblasts. Sox genes thus showed a dynamic spatio-temporal expression during tooth development.

  3. Expression of a transferred nuclear gene in a mitochondrial genome

    Directory of Open Access Journals (Sweden)

    Yichun Qiu

    2014-08-01

    Full Text Available Transfer of mitochondrial genes to the nucleus, and subsequent gain of regulatory elements for expression, is an ongoing evolutionary process in plants. Many examples have been characterized, which in some cases have revealed sources of mitochondrial targeting sequences and cis-regulatory elements. In contrast, there have been no reports of a nuclear gene that has undergone intracellular transfer to the mitochondrial genome and become expressed. Here we show that the orf164 gene in the mitochondrial genome of several Brassicaceae species, including Arabidopsis, is derived from the nuclear ARF17 gene that codes for an auxin responsive protein and is present across flowering plants. Orf164 corresponds to a portion of ARF17, and the nucleotide and amino acid sequences are 79% and 81% identical, respectively. Orf164 is transcribed in several organ types of Arabidopsis thaliana, as detected by RT-PCR. In addition, orf164 is transcribed in five other Brassicaceae within the tribes Camelineae, Erysimeae and Cardamineae, but the gene is not present in Brassica or Raphanus. This study shows that nuclear genes can be transferred to the mitochondrial genome and become expressed, providing a new perspective on the movement of genes between the genomes of subcellular compartments.

  4. Positron emission tomography imaging of gene expression

    International Nuclear Information System (INIS)

    Tang Ganghua

    2001-01-01

    The merging of molecular biology and nuclear medicine is developed into molecular nuclear medicine. Positron emission tomography (PET) of gene expression in molecular nuclear medicine has become an attractive area. Positron emission tomography imaging gene expression includes the antisense PET imaging and the reporter gene PET imaging. It is likely that the antisense PET imaging will lag behind the reporter gene PET imaging because of the numerous issues that have not yet to be resolved with this approach. The reporter gene PET imaging has wide application into animal experimental research and human applications of this approach will likely be reported soon

  5. Selecting a set of housekeeping genes for quantitative real-time PCR in normal and tetraploid haemocytes of soft-shell clams, Mya arenaria.

    Science.gov (United States)

    Siah, A; Dohoo, C; McKenna, P; Delaporte, M; Berthe, F C J

    2008-09-01

    The transcripts involved in the molecular mechanisms of haemic neoplasia in relation to the haemocyte ploidy status of the soft-shell clam, Mya arenaria, have yet to be identified. For this purpose, real-time quantitative RT-PCR constitutes a sensitive and efficient technique, which can help determine the gene expression involved in haemocyte tetraploid status in clams affected by haemic neoplasia. One of the critical steps in comparing transcription profiles is the stability of selected housekeeping genes, as well as an accurate normalization. In this study, we selected five reference genes, S18, L37, EF1, EF2 and actin, generally used as single control genes. Their expression was analyzed by real-time quantitative RT-PCR at different levels of haemocyte ploidy status in order to select the most stable genes. Using the geNorm software, our results showed that L37, EF1 and S18 represent the most stable gene expressions related to various ploidy status ranging from 0 to 78% of tetraploid haemocytes in clams sampled in North River (Prince Edward Island, Canada). However, actin gene expression appeared to be highly regulated. Hence, using it as a housekeeping gene in tetraploid haemocytes can result in inaccurate data. To compare gene expression levels related to haemocyte ploidy status in Mya arenaria, using L37, EF1 and S18 as housekeeping genes for accurate normalization is therefore recommended.

  6. Selection and validation of a set of reliable reference genes for quantitative RT-PCR studies in the brain of the Cephalopod Mollusc Octopus vulgaris

    Directory of Open Access Journals (Sweden)

    Biffali Elio

    2009-07-01

    Full Text Available Abstract Background Quantitative real-time polymerase chain reaction (RT-qPCR is valuable for studying the molecular events underlying physiological and behavioral phenomena. Normalization of real-time PCR data is critical for a reliable mRNA quantification. Here we identify reference genes to be utilized in RT-qPCR experiments to normalize and monitor the expression of target genes in the brain of the cephalopod mollusc Octopus vulgaris, an invertebrate. Such an approach is novel for this taxon and of advantage in future experiments given the complexity of the behavioral repertoire of this species when compared with its relatively simple neural organization. Results We chose 16S, and 18S rRNA, actB, EEF1A, tubA and ubi as candidate reference genes (housekeeping genes, HKG. The expression of 16S and 18S was highly variable and did not meet the requirements of candidate HKG. The expression of the other genes was almost stable and uniform among samples. We analyzed the expression of HKG into two different set of animals using tissues taken from the central nervous system (brain parts and mantle (here considered as control tissue by BestKeeper, geNorm and NormFinder. We found that HKG expressions differed considerably with respect to brain area and octopus samples in an HKG-specific manner. However, when the mantle is treated as control tissue and the entire central nervous system is considered, NormFinder revealed tubA and ubi as the most suitable HKG pair. These two genes were utilized to evaluate the relative expression of the genes FoxP, creb, dat and TH in O. vulgaris. Conclusion We analyzed the expression profiles of some genes here identified for O. vulgaris by applying RT-qPCR analysis for the first time in cephalopods. We validated candidate reference genes and found the expression of ubi and tubA to be the most appropriate to evaluate the expression of target genes in the brain of different octopuses. Our results also underline the

  7. Identification of gene expression modifications in myostatin-stimulated myoblasts

    International Nuclear Information System (INIS)

    Yang Wei; Zhang Yong; Ma Guoda; Zhao Xinyi; Chen Yan; Zhu Dahai

    2005-01-01

    Myostatin belongs to the transforming growth factor beta superfamily and has been shown to function as an inhibitor of skeletal muscle proliferation and differentiation. To gain insight into the molecular mechanisms of myostatin function during myogenesis, differential display reverse transcription PCR was employed to identify altered gene expressions associated with myostatin inhibitory function in chicken fetal myoblasts (CFMs). In this work, we have identified seven up-regulated and 12 down-regulated genes in myostatin stimulated CFMs. Those genes are involved in myogenic differentiation, cell architecture, energy metabolism, signal transduction, and apoptosis. The down-regulation of muscle creatine kinase B, troponin C, and myosin regulatory light chain is in agreement with the myostatin negative role in myocyte differentiation. In addition, the expression alteration of skeletal muscle-specific cardiac ankyrin repeat protein and the bcl-2 related anti-apoptotic protein Nr-13 suggests possible unique roles for myostatin in regulating myogenesis by controlling cofactors participated transcriptional regulation and apoptosis

  8. Selection of reliable reference genes for gene expression studies in Trichoderma afroharzianum LTR-2 under oxalic acid stress.

    Science.gov (United States)

    Lyu, Yuping; Wu, Xiaoqing; Ren, He; Zhou, Fangyuan; Zhou, Hongzi; Zhang, Xinjian; Yang, Hetong

    2017-10-01

    An appropriate reference gene is required to get reliable results from gene expression analysis by quantitative real-time reverse transcription PCR (qRT-PCR). In order to identify stable and reliable reference genes in Trichoderma afroharzianum under oxalic acid (OA) stress, six commonly used housekeeping genes, i.e., elongation factor 1, ubiquitin, ubiquitin-conjugating enzyme, glyceraldehyde-3-phosphate dehydrogenase, α-tubulin, actin, from the effective biocontrol isolate T. afroharzianum strain LTR-2 were tested for their expression during growth in liquid culture amended with OA. Four in silico programs (comparative ΔCt, NormFinder, geNorm and BestKeeper) were used to evaluate the expression stabilities of six candidate reference genes. The elongation factor 1 gene EF-1 was identified as the most stably expressed reference gene, and was used as the normalizer to quantify the expression level of the oxalate decarboxylase coding gene OXDC in T. afroharzianum strain LTR-2 under OA stress. The result showed that the expression of OXDC was significantly up-regulated as expected. This study provides an effective method to quantify expression changes of target genes in T. afroharzianum under OA stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Identification of reference genes and validation for gene expression studies in diverse axolotl (Ambystoma mexicanum) tissues.

    Science.gov (United States)

    Guelke, Eileen; Bucan, Vesna; Liebsch, Christina; Lazaridis, Andrea; Radtke, Christine; Vogt, Peter M; Reimers, Kerstin

    2015-04-10

    For the precise quantitative RT-PCR normalization a set of valid reference genes is obligatory. Moreover have to be taken into concern the experimental conditions as they bias the regulation of reference genes. Up till now, no reference targets have been described for the axolotl (Ambystoma mexicanum). In a search in the public database SalSite for genetic information of the axolotl we identified fourteen presumptive reference genes, eleven of which were further tested for their gene expression stability. This study characterizes the expressional patterns of 11 putative endogenous control genes during axolotl limb regeneration and in an axolotl tissue panel. All 11 reference genes showed variable expression. Strikingly, ACTB was to be found most stable expressed in all comparative tissue groups, so we reason it to be suitable for all different kinds of axolotl tissue-type investigations. Moreover do we suggest GAPDH and RPLP0 as suitable for certain axolotl tissue analysis. When it comes to axolotl limb regeneration, a validated pair of reference genes is ODC and RPLP0. With these findings, new insights into axolotl gene expression profiling might be gained. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Biofilm-Associated Gene Expression in Staphylococcus pseudintermedius on a Variety of Implant Materials.

    Science.gov (United States)

    Crawford, Evan C; Singh, Ameet; Gibson, Thomas W G; Scott Weese, J

    2016-05-01

    To evaluate the expression of biofilm-associated genes in Staphylococcus pseudintermedius on multiple clinically relevant surfaces. In vitro experimental study. Two strains of methicillin-resistant S. pseudintermedius isolated from clinical infections representing the most common international isolates. A quantitative polymerase chain reaction (qPCR) assay for expression of genes related to biofilm initial adhesion, formation/maturation, antimicrobial resistance, and intracellular communication was developed and validated. S. pseudintermedius biofilms were grown on 8 clinically relevant surfaces (polymethylmethacrylate, stainless steel, titanium, latex, silicone, polydioxanone, polystyrene, and glass) and samples of logarithmic and stationary growth phases were collected. Gene expression in samples was measured by qPCR. Significant differences in gene expression were identified between surfaces and between bacterial strains for most gene/strain/surface combinations studied. Expression of genes responsible for production of extracellular matrix were increased in biofilms. Expression of genes responsible for initial adhesion and intracellular communication was markedly variable. Antimicrobial resistance gene expression was increased on multiple surfaces, including stainless steel and titanium. A method for evaluation of expression of multiple biofilm-associated genes in S. pseudintermedius was successfully developed and applied to the study of biofilms on multiple surfaces. Variations in expression of these genes have a bearing on understanding the development and treatment of implant-associated biofilm infections and will inform future clinical research. © Copyright 2016 by The American College of Veterinary Surgeons.

  11. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  12. A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

    Directory of Open Access Journals (Sweden)

    Mateusz G Adamski

    Full Text Available Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1 the achievement of absolute quantification and (2 a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

  13. Transcriptome database resource and gene expression atlas for the rose

    Science.gov (United States)

    2012-01-01

    Background For centuries roses have been selected based on a number of traits. Little information exists on the genetic and molecular basis that contributes to these traits, mainly because information on expressed genes for this economically important ornamental plant is scarce. Results Here, we used a combination of Illumina and 454 sequencing technologies to generate information on Rosa sp. transcripts using RNA from various tissues and in response to biotic and abiotic stresses. A total of 80714 transcript clusters were identified and 76611 peptides have been predicted among which 20997 have been clustered into 13900 protein families. BLASTp hits in closely related Rosaceae species revealed that about half of the predicted peptides in the strawberry and peach genomes have orthologs in Rosa dataset. Digital expression was obtained using RNA samples from organs at different development stages and under different stress conditions. qPCR validated the digital expression data for a selection of 23 genes with high or low expression levels. Comparative gene expression analyses between the different tissues and organs allowed the identification of clusters that are highly enriched in given tissues or under particular conditions, demonstrating the usefulness of the digital gene expression analysis. A web interface ROSAseq was created that allows data interrogation by BLAST, subsequent analysis of DNA clusters and access to thorough transcript annotation including best BLAST matches on Fragaria vesca, Prunus persica and Arabidopsis. The rose peptides dataset was used to create the ROSAcyc resource pathway database that allows access to the putative genes and enzymatic pathways. Conclusions The study provides useful information on Rosa expressed genes, with thorough annotation and an overview of expression patterns for transcripts with good accuracy. PMID:23164410

  14. Assessing reference genes for accurate transcript normalization using quantitative real-time PCR in pearl millet [Pennisetum glaucum (L. R. Br].

    Directory of Open Access Journals (Sweden)

    Prasenjit Saha

    Full Text Available Pearl millet [Pennisetum glaucum (L. R.Br.], a close relative of Panicoideae food crops and bioenergy grasses, offers an ideal system to perform functional genomics studies related to C4 photosynthesis and abiotic stress tolerance. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR provides a sensitive platform to conduct such gene expression analyses. However, the lack of suitable internal control reference genes for accurate transcript normalization during qRT-PCR analysis in pearl millet is the major limitation. Here, we conducted a comprehensive assessment of 18 reference genes on 234 samples which included an array of different developmental tissues, hormone treatments and abiotic stress conditions from three genotypes to determine appropriate reference genes for accurate normalization of qRT-PCR data. Analyses of Ct values using Stability Index, BestKeeper, ΔCt, Normfinder, geNorm and RefFinder programs ranked PP2A, TIP41, UBC2, UBQ5 and ACT as the most reliable reference genes for accurate transcript normalization under different experimental conditions. Furthermore, we validated the specificity of these genes for precise quantification of relative gene expression and provided evidence that a combination of the best reference genes are required to obtain optimal expression patterns for both endogeneous genes as well as transgenes in pearl millet.

  15. Heterologous reconstitution of the intact geodin gene cluster in Aspergillus nidulans through a simple and versatile PCR based approach.

    Directory of Open Access Journals (Sweden)

    Morten Thrane Nielsen

    Full Text Available Fungal natural products are a rich resource for bioactive molecules. To fully exploit this potential it is necessary to link genes to metabolites. Genetic information for numerous putative biosynthetic pathways has become available in recent years through genome sequencing. However, the lack of solid methodology for genetic manipulation of most species severely hampers pathway characterization. Here we present a simple PCR based approach for heterologous reconstitution of intact gene clusters. Specifically, the putative gene cluster responsible for geodin production from Aspergillus terreus was transferred in a two step procedure to an expression platform in A. nidulans. The individual cluster fragments were generated by PCR and assembled via efficient USER fusion prior to transformation and integration via re-iterative gene targeting. A total of 13 open reading frames contained in 25 kb of DNA were successfully transferred between the two species enabling geodin synthesis in A. nidulans. Subsequently, functions of three genes in the cluster were validated by genetic and chemical analyses. Specifically, ATEG_08451 (gedC encodes a polyketide synthase, ATEG_08453 (gedR encodes a transcription factor responsible for activation of the geodin gene cluster and ATEG_08460 (gedL encodes a halogenase that catalyzes conversion of sulochrin to dihydrogeodin. We expect that our approach for transferring intact biosynthetic pathways to a fungus with a well developed genetic toolbox will be instrumental in characterizing the many exciting pathways for secondary metabolite production that are currently being uncovered by the fungal genome sequencing projects.

  16. The functional landscape of mouse gene expression

    Directory of Open Access Journals (Sweden)

    Zhang Wen

    2004-12-01

    Full Text Available Abstract Background Large-scale quantitative analysis of transcriptional co-expression has been used to dissect regulatory networks and to predict the functions of new genes discovered by genome sequencing in model organisms such as yeast. Although the idea that tissue-specific expression is indicative of gene function in mammals is widely accepted, it has not been objectively tested nor compared with the related but distinct strategy of correlating gene co-expression as a means to predict gene function. Results We generated microarray expression data for nearly 40,000 known and predicted mRNAs in 55 mouse tissues, using custom-built oligonucleotide arrays. We show that quantitative transcriptional co-expression is a powerful predictor of gene function. Hundreds of functional categories, as defined by Gene Ontology 'Biological Processes', are associated with characteristic expression patterns across all tissues, including categories that bear no overt relationship to the tissue of origin. In contrast, simple tissue-specific restriction of expression is a poor predictor of which genes are in which functional categories. As an example, the highly conserved mouse gene PWP1 is widely expressed across different tissues but is co-expressed with many RNA-processing genes; we show that the uncharacterized yeast homolog of PWP1 is required for rRNA biogenesis. Conclusions We conclude that 'functional genomics' strategies based on quantitative transcriptional co-expression will be as fruitful in mammals as they have been in simpler organisms, and that transcriptional control of mammalian physiology is more modular than is generally appreciated. Our data and analyses provide a public resource for mammalian functional genomics.

  17. Cocoa polyphenols and fiber modify colonic gene expression in rats.

    Science.gov (United States)

    Massot-Cladera, Malen; Franch, Àngels; Castell, Margarida; Pérez-Cano, Francisco J

    2017-08-01

    Cocoa intake has been associated with health benefits, improving cardiovascular function and metabolism, as well as modulating intestinal immune function. The aim of this study was to take an in-depth look into the mechanisms affected by the cocoa intake by evaluating the colonic gene expression after nutritional intervention, and to ascertain the role of the fiber of cocoa in these effects. To achieve this, Wistar rats were fed for 3 weeks with either a reference diet, a diet containing 10 % cocoa (C10), a diet based on cocoa fiber (CF) or a diet containing inulin (I). At the end of the study, colon was excised to obtain the RNA to evaluate the differential gene expression by microarray. Results were validated by RT-PCR. The C10 group was the group with most changes in colonic gene expression, most of them down-regulated but a few in common with the CF diet. The C10 diet significantly up-regulated the expression of Scgb1a1 and Scnn1 g and down-regulated Tac4, Mcpt2, Fcer1a and Fabp1 by twofold, most of them related to lipid metabolism and immune function. The CF and I diets down-regulated the expression of Serpina10 and Apoa4 by twofold. Similar patterns of expression were found by PCR. Most of the effects attributed to cocoa consumption on genes related to the immune system (B cell and mast cell functionality) and lipid metabolism in the colon tissue were due not only to its fiber content, but also to the possible contribution of polyphenols and other compounds.

  18. Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

    Science.gov (United States)

    Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

    2014-11-01

    The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

  19. Real-time gene expression analysis in carp (Cyprinus carpio) skin: inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauska, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  20. Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: Inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauskas, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  1. Functional features of gene expression profiles differentiating gastrointestinal stromal tumours according to KIT mutations and expression

    International Nuclear Information System (INIS)

    Ostrowski, Jerzy; Dobosz, Anna Jerzak Vel; Jarosz, Dorota; Ruka, Wlodzimierz; Wyrwicz, Lucjan S; Polkowski, Marcin; Paziewska, Agnieszka; Skrzypczak, Magdalena; Goryca, Krzysztof; Rubel, Tymon; Kokoszyñska, Katarzyna; Rutkowski, Piotr; Nowecki, Zbigniew I

    2009-01-01

    Gastrointestinal stromal tumours (GISTs) represent a heterogeneous group of tumours of mesenchymal origin characterized by gain-of-function mutations in KIT or PDGFRA of the type III receptor tyrosine kinase family. Although mutations in either receptor are thought to drive an early oncogenic event through similar pathways, two previous studies reported the mutation-specific gene expression profiles. However, their further conclusions were rather discordant. To clarify the molecular characteristics of differentially expressed genes according to GIST receptor mutations, we combined microarray-based analysis with detailed functional annotations. Total RNA was isolated from 29 frozen gastric GISTs and processed for hybridization on GENECHIP ® HG-U133 Plus 2.0 microarrays (Affymetrix). KIT and PDGFRA were analyzed by sequencing, while related mRNA levels were analyzed by quantitative RT-PCR. Fifteen and eleven tumours possessed mutations in KIT and PDGFRA, respectively; no mutation was found in three tumours. Gene expression analysis identified no discriminative profiles associated with clinical or pathological parameters, even though expression of hundreds of genes differentiated tumour receptor mutation and expression status. Functional features of genes differentially expressed between the two groups of GISTs suggested alterations in angiogenesis and G-protein-related and calcium signalling. Our study has identified novel molecular elements likely to be involved in receptor-dependent GIST development and allowed confirmation of previously published results. These elements may be potential therapeutic targets and novel markers of KIT mutation status

  2. Merkel cell polyomavirus detection in Merkel cell cancer tumors in Northern Germany using PCR and protein expression.

    Science.gov (United States)

    Leitz, Miriam; Stieler, Kristin; Grundhoff, Adam; Moll, Ingrid; Brandner, Johanna M; Fischer, Nicole

    2014-10-01

    Merkel cell carcinoma is a highly malignant skin cancer which predominantly occurs in elderly and immunocompromised persons. The identification of the Merkel cell polyomavirus (MCPyV) has inaugurated a new understanding of Merkel cell carcinoma pathogenesis. The frequent detection of the virus in Merkel cell carcinoma tissue (70-90%), its monoclonal integration in the tumor cells and the expression of viral oncogenes highly suggest that MCPyV is causally linked to the pathogenesis of the majority of Merkel cell cancer (MCC) cases. Using qualitative and quantitative PCR together with immunohistochemical staining this study aimed at characterizing the presence of MCPyV sequences and viral early gene expression in a cohort of MCC cases (n = 32) selected in Northern Germany. 40-57% of the cases were identified as MCPyV positive with 40.6% of the cases positive by immunohistochemical staining and 51.6-57.6% positive by PCR. Interestingly, in the majority (64%) of LT-Antigen positive tumors only 25-50% of tumor cells express LT-Antigen. These data are in accord with published studies describing heterogeneity in MCPyV viral loads and suggest that detection of MCPyV in Merkel cell carcinoma by PCR should be undertaken using multiple primer pairs. © 2013 Wiley Periodicals, Inc.

  3. A novel gene signature for molecular diagnosis of human prostate cancer by RT-qPCR.

    Directory of Open Access Journals (Sweden)

    Federica Rizzi

    Full Text Available Prostate cancer (CaP is one of the most relevant causes of cancer death in Western Countries. Although detection of CaP at early curable stage is highly desirable, actual screening methods present limitations and new molecular approaches are needed. Gene expression analysis increases our knowledge about the biology of CaP and may render novel molecular tools, but the identification of accurate biomarkers for reliable molecular diagnosis is a real challenge. We describe here the diagnostic power of a novel 8-genes signature: ornithine decarboxylase (ODC, ornithine decarboxylase antizyme (OAZ, adenosylmethionine decarboxylase (AdoMetDC, spermidine/spermine N(1-acetyltransferase (SSAT, histone H3 (H3, growth arrest specific gene (GAS1, glyceraldehyde 3-phosphate dehydrogenase (GAPDH and Clusterin (CLU in tumour detection/classification of human CaP.The 8-gene signature was detected by retrotranscription real-time quantitative PCR (RT-qPCR in frozen prostate surgical specimens obtained from 41 patients diagnosed with CaP and recommended to undergo radical prostatectomy (RP. No therapy was given to patients at any time before RP. The bio-bank used for the study consisted of 66 specimens: 44 were benign-CaP paired from the same patient. Thirty-five were classified as benign and 31 as CaP after final pathological examination. Only molecular data were used for classification of specimens. The Nearest Neighbour (NN classifier was used in order to discriminate CaP from benign tissue. Validation of final results was obtained with 10-fold cross-validation procedure. CaP versus benign specimens were discriminated with (80+/-5% accuracy, (81+/-6% sensitivity and (78+/-7% specificity. The method also correctly classified 71% of patients with Gleason score or =7, an important predictor of final outcome.The method showed high sensitivity in a collection of specimens in which a significant portion of the total (13/31, equal to 42% was considered CaP on the basis

  4. MALDI-TOF mass spectrometry for quantitative gene expression analysis of acid responses in Staphylococcus aureus.

    Science.gov (United States)

    Rode, Tone Mari; Berget, Ingunn; Langsrud, Solveig; Møretrø, Trond; Holck, Askild

    2009-07-01

    Microorganisms are constantly exposed to new and altered growth conditions, and respond by changing gene expression patterns. Several methods for studying gene expression exist. During the last decade, the analysis of microarrays has been one of the most common approaches applied for large scale gene expression studies. A relatively new method for gene expression analysis is MassARRAY, which combines real competitive-PCR and MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. In contrast to microarray methods, MassARRAY technology is suitable for analysing a larger number of samples, though for a smaller set of genes. In this study we compare the results from MassARRAY with microarrays on gene expression responses of Staphylococcus aureus exposed to acid stress at pH 4.5. RNA isolated from the same stress experiments was analysed using both the MassARRAY and the microarray methods. The MassARRAY and microarray methods showed good correlation. Both MassARRAY and microarray estimated somewhat lower fold changes compared with quantitative real-time PCR (qRT-PCR). The results confirmed the up-regulation of the urease genes in acidic environments, and also indicated the importance of metal ion regulation. This study shows that the MassARRAY technology is suitable for gene expression analysis in prokaryotes, and has advantages when a set of genes is being analysed for an organism exposed to many different environmental conditions.

  5. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  6. Temporal expression pattern of genes during the period of sex differentiation in human embryonic gonads

    DEFF Research Database (Denmark)

    Mamsen, Linn S; Ernst, Emil H; Borup, Rehannah

    2017-01-01

    The precise timing and sequence of changes in expression of key genes and proteins during human sex-differentiation and onset of steroidogenesis was evaluated by whole-genome expression in 67 first trimester human embryonic and fetal ovaries and testis and confirmed by qPCR and immunohistochemistry...... (IHC). SRY/SOX9 expression initiated in testis around day 40 pc, followed by initiation of AMH and steroidogenic genes required for androgen production at day 53 pc. In ovaries, gene expression of RSPO1, LIN28, FOXL2, WNT2B, and ETV5, were significantly higher than in testis, whereas GLI1...... was significantly higher in testis than ovaries. Gene expression was confirmed by IHC for GAGE, SOX9, AMH, CYP17A1, LIN28, WNT2B, ETV5 and GLI1. Gene expression was not associated with the maternal smoking habits. Collectively, a precise temporal determination of changes in expression of key genes involved in human...

  7. A comparative gene expression database for invertebrates

    Directory of Open Access Journals (Sweden)

    Ormestad Mattias

    2011-08-01

    Full Text Available Abstract Background As whole genome and transcriptome sequencing gets cheaper and faster, a great number of 'exotic' animal models are emerging, rapidly adding valuable data to the ever-expanding Evo-Devo field. All these new organisms serve as a fantastic resource for the research community, but the sheer amount of data, some published, some not, makes detailed comparison of gene expression patterns very difficult to summarize - a problem sometimes even noticeable within a single lab. The need to merge existing data with new information in an organized manner that is publicly available to the research community is now more necessary than ever. Description In order to offer a homogenous way of storing and handling gene expression patterns from a variety of organisms, we have developed the first web-based comparative gene expression database for invertebrates that allows species-specific as well as cross-species gene expression comparisons. The database can be queried by gene name, developmental stage and/or expression domains. Conclusions This database provides a unique tool for the Evo-Devo research community that allows the retrieval, analysis and comparison of gene expression patterns within or among species. In addition, this database enables a quick identification of putative syn-expression groups that can be used to initiate, among other things, gene regulatory network (GRN projects.

  8. Adaptive Evolution of Gene Expression in Drosophila.

    Science.gov (United States)

    Nourmohammad, Armita; Rambeau, Joachim; Held, Torsten; Kovacova, Viera; Berg, Johannes; Lässig, Michael

    2017-08-08

    Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Embryo quality predictive models based on cumulus cells gene expression

    Directory of Open Access Journals (Sweden)

    Devjak R

    2016-06-01

    Full Text Available Since the introduction of in vitro fertilization (IVF in clinical practice of infertility treatment, the indicators for high quality embryos were investigated. Cumulus cells (CC have a specific gene expression profile according to the developmental potential of the oocyte they are surrounding, and therefore, specific gene expression could be used as a biomarker. The aim of our study was to combine more than one biomarker to observe improvement in prediction value of embryo development. In this study, 58 CC samples from 17 IVF patients were analyzed. This study was approved by the Republic of Slovenia National Medical Ethics Committee. Gene expression analysis [quantitative real time polymerase chain reaction (qPCR] for five genes, analyzed according to embryo quality level, was performed. Two prediction models were tested for embryo quality prediction: a binary logistic and a decision tree model. As the main outcome, gene expression levels for five genes were taken and the area under the curve (AUC for two prediction models were calculated. Among tested genes, AMHR2 and LIF showed significant expression difference between high quality and low quality embryos. These two genes were used for the construction of two prediction models: the binary logistic model yielded an AUC of 0.72 ± 0.08 and the decision tree model yielded an AUC of 0.73 ± 0.03. Two different prediction models yielded similar predictive power to differentiate high and low quality embryos. In terms of eventual clinical decision making, the decision tree model resulted in easy-to-interpret rules that are highly applicable in clinical practice.

  10. Gene expression analysis in calcific tendinopathy of the rotator cuff

    Directory of Open Access Journals (Sweden)

    F Oliva

    2011-06-01

    Full Text Available We evaluated the expression of several genes involved in tissue remodelling and bone development in patients with calcific tendinopathy of the rotator cuff. Biopsies from calcified and non-calcified areas were obtained from 10 patients (8 women and 2 men; average age: 55 years; range: 40-68 with calcific tendinopathy of the rotator cuff. To evaluate the expression of selected genes, RNA extraction, cDNA synthesis and quantitative polymerase chain reaction (PCR were performed. A significantly increased expression of tissue transglutaminase (tTG2 and its substrate, osteopontin, was detected in the calcific areas compared to the levels observed in the normal tissue from the same subject with calcific tendinopathy, whereas a modest increase was observed for catepsin K. There was also a significant decrease in mRNA expression of Bone Morphogenetic Protein (BMP4 and BMP6 in the calcific area. BMP-2, collagen V and vascular endothelial growth factor (VEGF did not show significant differences. Collagen X and matrix metalloproteinase (MMP-9 were not detectable. A variation in expression of these genes could be characteristic of this form tendinopathy, since an increased level of these genes has not been detected in other forms of tendon lesions.

  11. Profiling helper T cell subset gene expression in deer mice

    Directory of Open Access Journals (Sweden)

    Hjelle Brian

    2006-08-01

    Full Text Available Abstract Background Deer mice (Peromyscus maniculatus are the most common mammals in North America and are reservoirs for several zoonotic agents, including Sin Nombre virus (SNV, the principal etiologic agent of hantavirus cardiopulmonary syndrome (HCPS in North America. Unlike human HCPS patients, SNV-infected deer mice show no overt pathological symptoms, despite the presence of virus in the lungs. A neutralizing IgG antibody response occurs, but the virus establishes a persistent infection. Limitations of detailed analysis of deer mouse immune responses to SNV are the lack of reagents and methods for evaluating such responses. Results We developed real-time PCR-based detection assays for several immune-related transcription factor and cytokine genes from deer mice that permit the profiling of CD4+ helper T cells, including markers of Th1 cells (T-bet, STAT4, IFNγ, TNF, LT, Th2 cells (GATA-3, STAT6, IL-4, IL-5 and regulatory T cells (Fox-p3, IL-10, TGFβ1. These assays compare the expression of in vitro antigen-stimulated and unstimulated T cells from individual deer mice. Conclusion We developed molecular methods for profiling immune gene expression in deer mice, including a multiplexed real-time PCR assay for assessing expression of several cytokine and transcription factor genes. These assays should be useful for characterizing the immune responses of experimentally- and naturally-infected deer mice.

  12. Analyzing Plasmodium falciparum erythrocyte membrane protein 1 gene expression by a next generation sequencing based method

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Petersen, Bent; Seguin-Orlando, Andaine

    2013-01-01

    at identifying PfEMP1 features associated with high virulence. Here we present the first effective method for sequence analysis of var genes expressed in field samples: a sequential PCR and next generation sequencing based technique applied on expressed var sequence tags and subsequently on long range PCR......, encoded by ~60 highly variable 'var' genes per haploid genome. PfEMP1 is exported to the surface of infected erythrocytes and is thought to be fundamental to immune evasion by adhesion to host and parasite factors. The highly variable nature has constituted a roadblock in var expression studies aimed...

  13. Over-expression of Eph and ephrin genes in advanced ovarian cancer: ephrin gene expression correlates with shortened survival

    Directory of Open Access Journals (Sweden)

    Lincoln Douglas

    2006-06-01

    Full Text Available Abstract Background Increased expression of Eph receptor tyrosine kinases and their ephrin ligands has been implicated in tumor progression in a number of malignancies. This report describes aberrant expression of these genes in ovarian cancer, the commonest cause of death amongst gynaecological malignancies. Methods Eph and ephrin expression was determined using quantitative real time RT-PCR. Correlation of gene expression was measured using Spearman's rho statistic. Survival was analysed using log-rank analysis and (was visualised by Kaplan-Meier survival curves. Results Greater than 10 fold over-expression of EphA1 and a more modest over-expression of EphA2 were observed in partially overlapping subsets of tumors. Over-expression of EphA1 strongly correlated (r = 0.801; p Conclusion These data imply that increased levels of ephrins A1 and A5 in the presence of high expression of Ephs A1 and A2 lead to a more aggressive tumor phenotype. The known functions of Eph/ephrin signalling in cell de-adhesion and movement may explain the observed correlation of ephrin expression with poor prognosis.

  14. Gene Expression Profiles of Main Olfactory Epithelium in Adenylyl Cyclase 3 Knockout Mice

    Directory of Open Access Journals (Sweden)

    Zhenshan Wang

    2015-11-01

    Full Text Available Adenylyl Cyclase 3 (AC3 plays an important role in the olfactory sensation-signaling pathway in mice. AC3 deficiency leads to defects in olfaction. However, it is still unknown whether AC3 deficiency affects gene expression or olfactory signal transduction pathways within the main olfactory epithelium (MOE. In this study, gene microarrays were used to screen differentially expressed genes in MOE from AC3 knockout (AC3−/− and wild-type (AC3+/+ mice. The differentially expressed genes identified were subjected to bioinformatic analysis and verified by qRT-PCR. Gene expression in the MOE from AC3−/− mice was significantly altered, compared to AC3+/+ mice. Of the 41266 gene probes, 3379 had greater than 2-fold fold change in expression levels between AC3−/− and AC3+/+ mice, accounting for 8% of the total gene probes. Of these genes, 1391 were up regulated, and 1988 were down regulated, including 425 olfactory receptor genes, 99 genes that are specifically expressed in the immature olfactory neurons, 305 genes that are specifically expressed in the mature olfactory neurons, and 155 genes that are involved in epigenetic regulation. Quantitative RT-PCR verification of the differentially expressed epigenetic regulation related genes, olfactory receptors, ion transporter related genes, neuron development and differentiation related genes, lipid metabolism and membrane protein transport etc. related genes showed that P75NTR, Hinfp, Gadd45b, and Tet3 were significantly up-regulated, while Olfr370, Olfr1414, Olfr1208, Golf, Faim2, Tsg101, Mapk10, Actl6b, H2BE, ATF5, Kirrrel2, OMP, Drd2 etc. were significantly down-regulated. In summary, AC3 may play a role in proximal olfactory signaling and play a role in the regulation of differentially expressed genes in mouse MOE.

  15. Stochastic gene expression in Arabidopsis thaliana.

    Science.gov (United States)

    Araújo, Ilka Schultheiß; Pietsch, Jessica Magdalena; Keizer, Emma Mathilde; Greese, Bettina; Balkunde, Rachappa; Fleck, Christian; Hülskamp, Martin

    2017-12-14

    Although plant development is highly reproducible, some stochasticity exists. This developmental stochasticity may be caused by noisy gene expression. Here we analyze the fluctuation of protein expression in Arabidopsis thaliana. Using the photoconvertible KikGR marker, we show that the protein expressions of individual cells fluctuate over time. A dual reporter system was used to study extrinsic and intrinsic noise of marker gene expression. We report that extrinsic noise is higher than intrinsic noise and that extrinsic noise in stomata is clearly lower in comparison to several other tissues/cell types. Finally, we show that cells are coupled with respect to stochastic protein expression in young leaves, hypocotyls and roots but not in mature leaves. Our data indicate that stochasticity of gene expression can vary between tissues/cell types and that it can be coupled in a non-cell-autonomous manner.

  16. Gene expression profiling demonstrates WNT/β-catenin pathway genes alteration in Mexican patients with colorectal cancer and diabetes mellitus.

    Science.gov (United States)

    Ivonne Wence-Chavez, Laura; Palomares-Chacon, Ulises; Pablo Flores-Gutierrez, Juan; Felipe Jave-Suarez, Luis; Del Carmen Aguilar-Lemarroy, Adriana; Barros-Nunez, Patricio; Esperanza Flores-Martinez, Silvia; Sanchez-Corona, Jose; Alejandra Rosales-Reynoso, Monica

    2017-01-01

    Several studies have shown a strong association between diabetes mellitus (DM) and increased risk of colorectal cancer (CRC). The fundamental mechanisms that support this association are not entirely understood; however, it is believed that hyperinsulinemia and hyperglycemia may be involved. Some proposed mechanisms include upregulation of mitogenic signaling pathways like MAPK, PI3K, mTOR, and WNT, which are involved in cell proliferation, growth, and cancer cell survival. The purpose of this study was to evaluate the gene expression profile and identify differently expressed genes involved in mitogenic pathways in CRC patients with and without DM. In this study, microarray analysis of gene expression followed by quantitative PCR (qPCR) was performed in cancer tissue from CRC patients with and without DM to identify the gene expression profiles and validate the differently expressed genes. Among the study groups, some differently expressed genes were identified. However, when bioinformatics clustering tools were used, a significant modulation of genes involved in the WNT pathway was evident. Therefore, we focused on genes participating in this pathway, such as WNT3A, LRP6, TCF7L2, and FRA-1. Validation of the expression levels of those genes by qPCR showed that CRC patients without type 2 diabetes mellitus (T2DM) expressed significantly more WNT3Ay LRP6, but less TCF7L2 and FRA-1 compared to controls, while in CRC patients with DM the expression levels of WNT3A, LRP6, TCF7L2, and FRA-1 were significantly higher compared to controls. Our results suggest that WNT/β-catenin pathway is upregulated in patients with CRC and DM, demonstrating its importance and involvement in both pathologies.

  17. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others

    1996-07-01

    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  18. Elicitor and fusarium-induced expression of NPR-1 like genes in banana

    CSIR Research Space (South Africa)

    Endah, R

    2008-11-01

    Full Text Available NPR1 is an essential positive regulator of salicylic acid-induced PR gene expression and systemic acquired resistance. Two novel full-length NPR1-like genes; MNPR1A and MNPR1B, were isolated by application of the PCR and RACE techniques. The two...

  19. Validation of RNAi by real time PCR

    DEFF Research Database (Denmark)

    Josefsen, Knud; Lee, Ying Chiu

    2011-01-01

    Real time PCR is the analytic tool of choice for quantification of gene expression, while RNAi is concerned with downregulation of gene expression. Together, they constitute a powerful approach in any loss of function studies of selective genes. We illustrate here the use of real time PCR to verify...

  20. Validation of reference genes for quantitative RT-PCR normalization in Suaeda aralocaspica, an annual halophyte with heteromorphism and C4 pathway without Kranz anatomy

    Directory of Open Access Journals (Sweden)

    Jing Cao

    2016-02-01

    Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (qRT-PCR is a powerful analytical technique for the measurement of gene expression, which depends on the stability of the reference gene used for data normalization. Suaeda aralocaspica, an annual halophyte with heteromorphic seeds and possessing C4 photosynthesis pathway without Kranz anatomy, is an ideal plant species to identify stress tolerance-related genes and compare relative expression at transcriptional level. So far, no molecular information is available for this species. In the present study, six traditionally used reference genes were selected and their expression stability in two types of seeds of S. aralocaspica under different experimental conditions was evaluated. Three analytical programs, geNorm, NormFinder and BestKeeper, were used to assess and rank the stability of reference gene expression. Results revealed that although some reference genes may display different transcriptional profiles between the two types of seeds, β-TUB and GAPDH appeared to be the most suitable references under different developmental stages and tissues. GAPDH was the appropriate reference gene under different germination time points and salt stress conditions, and ACTIN was suitable for various abiotic stress treatments for the two types of seeds. For all the sample pools, β-TUB served as the most stable reference gene, whereas 18S rRNA and 28S rRNA performed poorly and presented as the least stable genes in our study. UBQ seemed to be unsuitable as internal control under different salt treatments. In addition, the expression of a photosynthesis-related gene (PPDK of C4 pathway and a salt tolerance-related gene (SAT of S. aralocaspica were used to validate the best performance reference genes. This is the first systematic comparison of reference gene selection for qRT-PCR work in S. aralocaspica and these data will facilitate further studies on gene expression in this species

  1. Effects of Assisted Reproduction Technology on Placental Imprinted Gene Expression

    Science.gov (United States)

    Katagiri, Yukiko; Aoki, Chizu; Tamaki-Ishihara, Yuko; Fukuda, Yusuke; Kitamura, Mamoru; Matsue, Yoichi; So, Akiko; Morita, Mineto

    2010-01-01

    We used placental tissue to compare the imprinted gene expression of IGF2, H19, KCNQ1OT1, and CDKN1C of singletons conceived via assisted reproduction technology (ART) with that of spontaneously conceived (SC) singletons. Of 989 singletons examined (ART n = 65; SC n = 924), neonatal weight was significantly lower (P < .001) in the ART group than in the SC group, but placental weight showed no significant difference. Gene expression analyzed by real-time PCR was similar for both groups with appropriate-for-date (AFD) birth weight. H19 expression was suppressed in fetal growth retardation (FGR) cases in the ART and SC groups compared with AFD cases (P < .02 and P < .05, resp.). In contrast, CDKN1C expression was suppressed in FGR cases in the ART group (P < .01), while KCNQ1OT1 expression was hyperexpressed in FGR cases in the SC group (P < .05). As imprinted gene expression patterns differed between the ART and SC groups, we speculate that ART modifies epigenetic status even though the possibilities always exist. PMID:20706653

  2. Decorin gene expression and its regulation in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico); Kuri-Harcuch, Walid, E-mail: walidkuri@gmail.com [Department of Cell Biology, Centro de Investigacion y de Estudios Avanzados del IPN, Apdo. Postal 14-740, Mexico D.F. 07000 (Mexico)

    2011-07-22

    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  3. Detection of growth hormone doping by gene expression profiling of peripheral blood.

    Science.gov (United States)

    Mitchell, Christopher J; Nelson, Anne E; Cowley, Mark J; Kaplan, Warren; Stone, Glenn; Sutton, Selina K; Lau, Amie; Lee, Carol M Y; Ho, Ken K Y

    2009-12-01

    GH abuse is a significant problem in many sports, and there is currently no robust test that allows detection of doping beyond a short window after administration. Our objective was to evaluate gene expression profiling in peripheral blood leukocytes in-vivo as a test for GH doping in humans. Seven men and thirteen women were administered GH, 2 mg/d sc for 8 wk. Blood was collected at baseline and at 8 wk. RNA was extracted from the white cell fraction. Microarray analysis was undertaken using Agilent 44K G4112F arrays using a two-color design. Quantitative RT-PCR using TaqMan gene expression assays was performed for validation of selected differentially expressed genes. GH induced an approximately 2-fold increase in circulating IGF-I that was maintained throughout the 8 wk of the study. GH induced significant changes in gene expression with 353 in women and 41 in men detected with a false discovery rate of less than 5%. None of the differentially expressed genes were common between men and women. The maximal changes were a doubling for up-regulated or halving for down-regulated genes, similar in magnitude to the variation between individuals. Quantitative RT-PCR for seven target genes showed good concordance between microarray and quantitative PCR data in women but not in men. Gene expression analysis of peripheral blood leukocytes is unlikely to be a viable approach for the detection of GH doping.

  4. Widespread ectopic expression of olfactory receptor genes

    Directory of Open Access Journals (Sweden)

    Yanai Itai

    2006-05-01

    Full Text Available Abstract Background Olfactory receptors (ORs are the largest gene family in the human genome. Although they are expected to be expressed specifically in olfactory tissues, some ectopic expression has been reported, with special emphasis on sperm and testis. The present study systematically explores the expression patterns of OR genes in a large number of tissues and assesses the potential functional implication of such ectopic expression. Results We analyzed the expression of hundreds of human and mouse OR transcripts, via EST and microarray data, in several dozens of human and mouse tissues. Different tissues had specific, relatively small OR gene subsets which had particularly high expression levels. In testis, average expression was not particularly high, and very few highly expressed genes were found, none corresponding to ORs previously implicated in sperm chemotaxis. Higher expression levels were more common for genes with a non-OR genomic neighbor. Importantly, no correlation in expression levels was detected for human-mouse orthologous pairs. Also, no significant difference in expression levels was seen between intact and pseudogenized ORs, except for the pseudogenes of subfamily 7E which has undergone a human-specific expansion. Conclusion The OR superfamily as a whole, show widespread, locus-dependent and heterogeneous expression, in agreement with a neutral or near neutral evolutionary model for transcription control. These results cannot reject the possibility that small OR subsets might play functional roles in different tissues, however considerable care should be exerted when offering a functional interpretation for ectopic OR expression based only on transcription information.

  5. Regulation of Gene Expression in Protozoa Parasites

    Directory of Open Access Journals (Sweden)

    Consuelo Gomez

    2010-01-01

    Full Text Available Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  6. Regulation of gene expression in protozoa parasites.

    Science.gov (United States)

    Gomez, Consuelo; Esther Ramirez, M; Calixto-Galvez, Mercedes; Medel, Olivia; Rodríguez, Mario A

    2010-01-01

    Infections with protozoa parasites are associated with high burdens of morbidity and mortality across the developing world. Despite extensive efforts to control the transmission of these parasites, the spread of populations resistant to drugs and the lack of effective vaccines against them contribute to their persistence as major public health problems. Parasites should perform a strict control on the expression of genes involved in their pathogenicity, differentiation, immune evasion, or drug resistance, and the comprehension of the mechanisms implicated in that control could help to develop novel therapeutic strategies. However, until now these mechanisms are poorly understood in protozoa. Recent investigations into gene expression in protozoa parasites suggest that they possess many of the canonical machineries employed by higher eukaryotes for the control of gene expression at transcriptional, posttranscriptional, and epigenetic levels, but they also contain exclusive mechanisms. Here, we review the current understanding about the regulation of gene expression in Plasmodium sp., Trypanosomatids, Entamoeba histolytica and Trichomonas vaginalis.

  7. Inferring gene networks from discrete expression data

    KAUST Repository

    Zhang, L.; Mallick, B. K.

    2013-01-01

    graphical models applied to continuous data, which give a closedformmarginal likelihood. In this paper,we extend network modeling to discrete data, specifically data from serial analysis of gene expression, and RNA-sequencing experiments, both of which

  8. Gene Expression and Microarray Investigation of Dendrobium ...

    African Journals Online (AJOL)

    blood glucose > 16.7 mmol/L were used as the model group and treated with Dendrobium mixture. (DEN ... Keywords: Diabetes, Gene expression, Dendrobium mixture, Microarray testing ..... homeostasis in airway smooth muscle. Am J.

  9. Identification of genes showing differential expression profile ...

    Indian Academy of Sciences (India)

    3Department of Natural Sciences, International Christian University, Mitaka, Tokyo 181-8585, Japan ... the changes of expression predicted from gene function suggested association ... ate School of Science and Technology, Niigata University.

  10. Drosophila melanogaster gene expression changes after spaceflight.

    Data.gov (United States)

    National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

  11. Exertional Heat Illness and Human Gene Expression

    National Research Council Canada - National Science Library

    Sonna, L.A; Sawka, M. N; Lilly, C. M

    2007-01-01

    Microarray analysis of gene expression at the level of RNA has generated new insights into the relationship between cellular responses to acute heat shock in vitro, exercise, and exertional heat illness...

  12. Expression Profiling of Tyrosine Kinase Genes

    National Research Council Canada - National Science Library

    Weier, Heinz

    2000-01-01

    ... of these genes parallels the progression of tumors to a more malignant phenotype. We developed a DNA micro-array based screening system to monitor the level of expression of tyrosine kinase (tk...

  13. Regulation of meiotic gene expression in plants

    Directory of Open Access Journals (Sweden)

    Adele eZhou

    2014-08-01

    Full Text Available With the recent advances in genomics and sequencing technologies, databases of transcriptomes representing many cellular processes have been built. Meiotic transcriptomes in plants have been studied in Arabidopsis thaliana, rice (Oryza sativa, wheat (Triticum aestivum, petunia (Petunia hybrida, sunflower (Helianthus annuus, and maize (Zea mays. Studies in all organisms, but particularly in plants, indicate that a very large number of genes are expressed during meiosis, though relatively few of them seem to be required for the completion of meiosis. In this review, we focus on gene expression at the RNA level and analyze the meiotic transcriptome datasets and explore expression patterns of known meiotic genes to elucidate how gene expression could be regulated during meiosis. We also discuss mechanisms, such as chromatin organization and non-coding RNAs, that might be involved in the regulation of meiotic transcription patterns.

  14. Identification of genes preferentially expressed during

    African Journals Online (AJOL)

    雨林木风

    2012-08-16

    Aug 16, 2012 ... The suppression subtractive hybridization (SSH) method conducted to generate ... which showed the lack of genomic information currently available for lily. ..... characterization of genes expressed during somatic embryo.

  15. Mining gene expression data of multiple sclerosis.

    Directory of Open Access Journals (Sweden)

    Pi Guo

    Full Text Available Microarray produces a large amount of gene expression data, containing various biological implications. The challenge is to detect a panel of discriminative genes associated with disease. This study proposed a robust classification model for gene selection using gene expression data, and performed an analysis to identify disease-related genes using multiple sclerosis as an example.Gene expression profiles based on the transcriptome of peripheral blood mononuclear cells from a total of 44 samples from 26 multiple sclerosis patients and 18 individuals with other neurological diseases (control were analyzed. Feature selection algorithms including Support Vector Machine based on Recursive Feature Elimination, Receiver Operating Characteristic Curve, and Boruta algorithms were jointly performed to select candidate genes associating with multiple sclerosis. Multiple classification models categorized samples into two different groups based on the identified genes. Models' performance was evaluated using cross-validation methods, and an optimal classifier for gene selection was determined.An overlapping feature set was identified consisting of 8 genes that were differentially expressed between the two phenotype groups. The genes were significantly associated with the pathways of apoptosis and cytokine-cytokine receptor interaction. TNFSF10 was significantly associated with multiple sclerosis. A Support Vector Machine model was established based on the featured genes and gave a practical accuracy of ∼86%. This binary classification model also outperformed the other models in terms of Sensitivity, Specificity and F1 score.The combined analytical framework integrating feature ranking algorithms and Support Vector Machine model could be used for selecting genes for other diseases.

  16. Altered choroid plexus gene expression in major depressive disorder

    Directory of Open Access Journals (Sweden)

    Cortney Ann Turner

    2014-04-01

    Full Text Available Given the emergent interest in biomarkers for mood disorders, we assessed gene expression in the choroid plexus, the region that produces cerebrospinal fluid (CSF, in individuals with major depressive disorder (MDD. Genes that are expressed in the choroid plexus (CP can be secreted into the CSF and may be potential biomarker candidates. Given that we have previously shown that fibroblast growth factor family members are differentially expressed in post-mortem brain of subjects with MDD and the CP is a known source of growth factors in the brain, we posed the question whether growth factor dysregulation would be found in the CP of subjects with MDD. We performed laser capture microscopy of the choroid plexus at the level of the hippocampus in subjects with MDD and psychiatrically normal controls. We then extracted, amplified, labeled and hybridized the cRNA to Illumina BeadChips to assess gene expression. In controls, the most highly abundant known transcript was transthyretin. Moreover, half of the 14 most highly expressed transcripts in controls encode ribosomal proteins. Using BeadStudio software, we identified 169 transcripts differentially expressed (p< 0.05 between control and MDD samples. Using pathway analysis we noted that the top network altered in subjects with MDD included multiple members of the transforming growth factor-beta (TGFβ pathway. Quantitative real-time PCR (qRT-PCR confirmed downregulation of several transcripts that interact with the extracellular matrix in subjects with MDD. These results suggest that there may be an altered cytoskeleton in the choroid plexus in MDD subjects that may lead to a disrupted blood-CSF-brain barrier.

  17. Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

    Science.gov (United States)

    Yurong, Chai; Yumin, Lu; Tianyun, Wang; Weihong, Hou; Lexun, Xue

    2006-12-01

    Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

  18. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  19. Evidence based selection of commonly used RT-qPCR reference genes for the analysis of mouse skeletal muscle.

    Directory of Open Access Journals (Sweden)

    Kristen C Thomas

    Full Text Available The ability to obtain accurate and reproducible data using quantitative real-time Polymerase Chain Reaction (RT-qPCR is limited by the process of data normalization. The use of 'housekeeping' or 'reference' genes is the most common technique used to normalize RT-qPCR data. However, commonly used reference genes are often poorly validated and may change as a result of genetic background, environment and experimental intervention. Here we present an analysis of 10 reference genes in mouse skeletal muscle (Actb, Aldoa, Gapdh, Hprt1, Ppia, Rer1, Rn18s, Rpl27, Rpl41 and Rpl7L1, which were identified as stable either by microarray or in the literature. Using the MIQE guidelines we compared wild-type (WT mice across three genetic backgrounds (R129, C57BL/6j and C57BL/10 as well as analyzing the α-actinin-3 knockout (Actn3 KO mouse, which is a model of the common null polymorphism (R577X in human ACTN3. Comparing WT mice across three genetic backgrounds, we found that different genes were more tightly regulated in each strain. We have developed a ranked profile of the top performing reference genes in skeletal muscle across these common mouse strains. Interestingly the commonly used reference genes; Gapdh, Rn18s, Hprt1 and Actb were not the most stable. Analysis of our experimental variant (Actn3 KO also resulted in an altered ranking of reference gene suitability. Furthermore we demonstrate that a poor reference gene results in increased variability in the normalized expression of a gene of interest, and can result in loss of significance. Our data demonstrate that reference genes need to be validated prior to use. For the most accurate normalization, it is important to test several genes and use the geometric mean of at least three of the most stably expressed genes. In the analysis of mouse skeletal muscle, strain and intervention played an important role in selecting the most stable reference genes.

  20. The use of laser microdissection in the identification of suitable reference genes for normalization of quantitative real-time PCR in human FFPE epithelial ovarian tissue samples.

    Directory of Open Access Journals (Sweden)

    Jing Cai

    Full Text Available Quantitative real-time PCR (qPCR is a powerful and reproducible method of gene expression analysis in which expression levels are quantified by normalization against reference genes. Therefore, to investigate the potential biomarkers and therapeutic targets for epithelial ovarian cancer by qPCR, it is critical to identify stable reference genes. In this study, twelve housekeeping genes (ACTB, GAPDH, 18S rRNA, GUSB, PPIA, PBGD, PUM1, TBP, HRPT1, RPLP0, RPL13A, and B2M were analyzed in 50 ovarian samples from normal, benign, borderline, and malignant tissues. For reliable results, laser microdissection (LMD, an effective technique used to prepare homogeneous starting material, was utilized to precisely excise target tissues or cells. One-way analysis of variance (ANOVA and nonparametric (Kruskal-Wallis tests were used to compare the expression differences. NormFinder and geNorm software were employed to further validate the suitability and stability of the candidate genes. Results showed that epithelial cells occupied a small percentage of the normal ovary indeed. The expression of ACTB, PPIA, RPL13A, RPLP0, and TBP were stable independent of the disease progression. In addition, NormFinder and geNorm identified the most stable combination (ACTB, PPIA, RPLP0, and TBP and the relatively unstable reference gene GAPDH from the twelve commonly used housekeeping genes. Our results highlight the use of homogeneous ovarian tissues and multiple-reference normalization strategy, e.g. the combination of ACTB, PPIA, RPLP0, and TBP, for qPCR in epithelial ovarian tissues, whereas GAPDH, the most commonly used reference gene, is not recommended, especially as a single reference gene.

  1. The use of laser microdissection in the identification of suitable reference genes for normalization of quantitative real-time PCR in human FFPE epithelial ovarian tissue samples.

    Science.gov (United States)

    Cai, Jing; Li, Tao; Huang, Bangxing; Cheng, Henghui; Ding, Hui; Dong, Weihong; Xiao, Man; Liu, Ling; Wang, Zehua

    2014-01-01

    Quantitative real-time PCR (qPCR) is a powerful and reproducible method of gene expression analysis in which expression levels are quantified by normalization against reference genes. Therefore, to investigate the potential biomarkers and therapeutic targets for epithelial ovarian cancer by qPCR, it is critical to identify stable reference genes. In this study, twelve housekeeping genes (ACTB, GAPDH, 18S rRNA, GUSB, PPIA, PBGD, PUM1, TBP, HRPT1, RPLP0, RPL13A, and B2M) were analyzed in 50 ovarian samples from normal, benign, borderline, and malignant tissues. For reliable results, laser microdissection (LMD), an effective technique used to prepare homogeneous starting material, was utilized to precisely excise target tissues or cells. One-way analysis of variance (ANOVA) and nonparametric (Kruskal-Wallis) tests were used to compare the expression differences. NormFinder and geNorm software were employed to further validate the suitability and stability of the candidate genes. Results showed that epithelial cells occupied a small percentage of the normal ovary indeed. The expression of ACTB, PPIA, RPL13A, RPLP0, and TBP were stable independent of the disease progression. In addition, NormFinder and geNorm identified the most stable combination (ACTB, PPIA, RPLP0, and TBP) and the relatively unstable reference gene GAPDH from the twelve commonly used housekeeping genes. Our results highlight the use of homogeneous ovarian tissues and multiple-reference normalization strategy, e.g. the combination of ACTB, PPIA, RPLP0, and TBP, for qPCR in epithelial ovarian tissues, whereas GAPDH, the most commonly used reference gene, is not recommended, especially as a single reference gene.

  2. Selection and Validation of Reference Genes for Quantitative Real-Time PCR Normalization Under Ethanol Stress Conditions in Oenococcus oeni SD-2a

    Directory of Open Access Journals (Sweden)

    Shuai Peng

    2018-05-01

    Full Text Available The powerful Quantitative real-time PCR (RT-qPCR was widely used to assess gene expression levels, which requires the optimal reference genes used for normalization. Oenococcus oeni (O. oeni, as the one of most important microorganisms in wine industry and the most resistant lactic acid bacteria (LAB species to ethanol, has not been investigated regarding the selection of stable reference genes for RT-qPCR normalization under ethanol stress conditions. In this study, nine candidate reference genes (proC, dnaG, rpoA, ldhD, ddlA, rrs, gyrA, gyrB, and dpoIII were analyzed to determine the most stable reference genes for RT-qPCR in O. oeni SD-2a under different ethanol stress conditions (8, 12, and 16% (v/v ethanol. The transcript stabilities of these genes were evaluated using the algorithms geNorm, NormFinder, and BestKeeper. The results showed that dnaG and dpoIII were selected as the best reference genes across all experimental ethanol conditions. Considering single stress experimental modes, dpoIII and dnaG would be suitable to normalize expression level for 8% ethanol shock treatment, while the combination of gyrA, gyrB, and rrs would be suitable for 12% ethanol shock treatment. proC and gyrB revealed the most stable expression in 16% ethanol shock treatment. This study selected and validated for the first time the reference genes for RT-qPCR normalization in O. oeni SD-2a under ethanol stress conditions.

  3. Gene expression analysis uncovers novel Hedgehog interacting protein (HHIP) effects in human bronchial epithelial cells

    Science.gov (United States)

    Zhou, Xiaobo; Qiu, Weiliang; Sathirapongsasuti, J. Fah.; Cho, Michael H.; Mancini, John D.; Lao, Taotao; Thibault, Derek M.; Litonjua, Gus; Bakke, Per S.; Gulsvik, Amund; Lomas, David A.; Beaty, Terri H.; Hersh, Craig P.; Anderson, Christopher; Geigenmuller, Ute; Raby, Benjamin A.; Rennard, Stephen I.; Perrella, Mark A.; Choi, Augustine M.K.; Quackenbush, John; Silverman, Edwin K.

    2013-01-01

    Hedgehog Interacting Protein (HHIP) was implicated in chronic obstructive pulmonary disease (COPD) by genome-wide association studies (GWAS). However, it remains unclear how HHIP contributes to COPD pathogenesis. To identify genes regulated by HHIP, we performed gene expression microarray analysis in a human bronchial epithelial cell line (Beas-2B) stably infected with HHIP shRNAs. HHIP silencing led to differential expression of 296 genes; enrichment for variants nominally associated with COPD was found. Eighteen of the differentially expressed genes were validated by real-time PCR in Beas-2B cells. Seven of 11 validated genes tested in human COPD and control lung tissues demonstrated significant gene expression differences. Functional annotation indicated enrichment for extracellular matrix and cell growth genes. Network modeling demonstrated that the extracellular matrix and cell proliferation genes influenced by HHIP tended to be interconnected. Thus, we identified potential HHIP targets in human bronchial epithelial cells that may contribute to COPD pathogenesis. PMID:23459001

  4. Comparative gene expression between two yeast species

    Directory of Open Access Journals (Sweden)

    Guan Yuanfang

    2013-01-01

    Full Text Available Abstract Background Comparative genomics brings insight into sequence evolution, but even more may be learned by coupling sequence analyses with experimental tests of gene function and regulation. However, the reliability of such comparisons is often limited by biased sampling of expression conditions and incomplete knowledge of gene functions across species. To address these challenges, we previously systematically generated expression profiles in Saccharomyces bayanus to maximize functional coverage as compared to an existing Saccharomyces cerevisiae data repository. Results In this paper, we take advantage of these two data repositories to compare patterns of ortholog expression in a wide variety of conditions. First, we developed a scalable metric for expression divergence that enabled us to detect a significant correlation between sequence and expression conservation on the global level, which previous smaller-scale expression studies failed to detect. Despite this global conservation trend, between-species gene expression neighborhoods were less well-conserved than within-species comparisons across different environmental perturbations, and approximately 4% of orthologs exhibited a significant change in co-expression partners. Furthermore, our analysis of matched perturbations collected in both species (such as diauxic shift and cell cycle synchrony demonstrated that approximately a quarter of orthologs exhibit condition-specific expression pattern differences. Conclusions Taken together, these analyses provide a global view of gene expression patterns between two species, both in terms of the conditions and timing of a gene's expression as well as co-expression partners. Our results provide testable hypotheses that will direct future experiments to determine how these changes may be specified in the genome.

  5. Characterization and expression of the calpastatin gene in Cyprinus carpio.

    Science.gov (United States)

    Chen, W X; Ma, Y

    2015-07-03

    Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).

  6. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    Science.gov (United States)

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  7. Gene Expression by PBMC in Primary Sclerosing Cholangitis: Evidence for Dysregulation of Immune Mediated Genes

    Directory of Open Access Journals (Sweden)

    Christopher A. Aoki

    2006-01-01

    Full Text Available Primary sclerosing cholangitis (PSC is a chronic disease of the bile ducts characterized by an inflammatory infiltrate and obliterative fibrosis. The precise role of the immune system in the pathogenesis of PSC remains unknown. We used RNA microarray analysis to identify immune-related genes and pathways that are differentially expressed in PSC. Messenger RNA (mRNA from peripheral blood mononuclear cells (PBMC was isolated from both patients with PSC and age and sex matched healthy controls. Samples from 5 PSC patients and 5 controls were analyzed by microarray and based upon rigorous statistical analysis of the data, relevant genes were chosen for confirmation by RT-PCR in 10 PSC patients and 10 controls. Using unsupervised hierarchical clustering, gene expression in PSC was statistically different from our control population. Interestingly, genes within the IL-2 receptor beta, IL-6 and MAP Kinase pathways were found to be differently expressed in patients with PSC compared to controls. Further, individual genes, TNF-α induced protein 6 (TNFaip6 and membrane-spanning 4-domains, subfamily A (ms4a were found to be upregulated in PSC while similar to Mothers against decapentaplegic homolog 5 (SMAD 5 was downregulated. In conclusion, several immune-related pathways and genes were differentially expressed in PSC compared to control patients, giving further evidence that this disease is systemic and immune-mediated.

  8. Evaluation of Reference Genes for Real-Time Quantitative PCR Analysis in Larvae of Spodoptera litura Exposed to Azadirachtin Stress Conditions

    Directory of Open Access Journals (Sweden)

    Benshui Shu

    2018-04-01

    Full Text Available Azadirachtin is an efficient and broad-spectrum botanical insecticide against more than 150 kinds of agricultural pests with the effects of mortality, antifeedant and growth regulation. Real-time quantitative polymerase chain reaction (RT-qPCR could be one of the powerful tools to analyze the gene expression level and investigate the mechanism of azadirachtin at transcriptional level, however, the ideal reference genes are needed to normalize the expression profiling of target genes. In this present study, the fragments of eight candidate reference genes were cloned and identified from the pest Spodoptera litura. In addition, the expression stability of these genes in different samples from larvae of control and azadirachtin treatments were evaluated by the computational methods of NormFinder, BestKeeper, Delta CT, geNorm, and RefFinder. According to our results, two of the reference genes should be the optimal number for RT-qPCR analysis. Furthermore, the best reference genes for different samples were showed as followed: EF-1α and EF2 for cuticle, β-Tubulin and RPL7A for fat body, EF2 and Actin for midgut, EF2 and RPL13A for larva and RPL13A and RPL7A for all the samples. Our results established a reliable normalization for RT-qPCR experiments in S. litura and ensure the data more accurate for the mechanism analysis of azadirachtin.

  9. Evaluation of Reference Genes for Real-Time Quantitative PCR Analysis in Larvae of Spodoptera litura Exposed to Azadirachtin Stress Conditions.

    Science.gov (United States)

    Shu, Benshui; Zhang, Jingjing; Cui, Gaofeng; Sun, Ranran; Sethuraman, Veeran; Yi, Xin; Zhong, Guohua

    2018-01-01

    Azadirachtin is an efficient and broad-spectrum botanical insecticide against more than 150 kinds of agricultural pests with the effects of mortality, antifeedant and growth regulation. Real-time quantitative polymerase chain reaction (RT-qPCR) could be one of the powerful tools to analyze the gene expression level and investigate the mechanism of azadirachtin at transcriptional level, however, the ideal reference genes are needed to normalize the expression profiling of target genes. In this present study, the fragments of eight candidate reference genes were cloned and identified from the pest Spodoptera litura . In addition, the expression stability of these genes in different samples from larvae of control and azadirachtin treatments were evaluated by the computational methods of NormFinder, BestKeeper, Delta CT, geNorm, and RefFinder. According to our results, two of the reference genes should be the optimal number for RT-qPCR analysis. Furthermore, the best reference genes for different samples were showed as followed: EF-1α and EF2 for cuticle, β-Tubulin and RPL7A for fat body, EF2 and Actin for midgut, EF2 and RPL13A for larva and RPL13A and RPL7A for all the samples. Our results established a reliable normalization for RT-qPCR experiments in S. litura and ensure the data more accurate for the mechanism analysis of azadirachtin.

  10. DNA Methylation and Gene Expression Profiling of Ewing Sarcoma Primary Tumors Reveal Genes That Are Potential Targets of Epigenetic Inactivation

    Directory of Open Access Journals (Sweden)

    Nikul Patel

    2012-01-01

    Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.

  11. Gene expression profiling distinguishes between spontaneous and radiation-induced rat mammary carcinomas

    International Nuclear Information System (INIS)

    Imaoka, Tatsuhiko; Nishimura, Mayumi; Kakinuma, Shizuko; Shimada, Yoshiya; Yamashita, Satoshi; Ushijima, Toshikazu

    2008-01-01

    The ability to distinguish between spontaneous and radiation-induced cancers in humans is expected to improve the resolution of estimated risk from low dose radiation. Mammary carcinomas were obtained from Sprague-Dawley rats that were either untreated (n=45) or acutely γ-irradiated (1 Gy; n=20) at seven weeks of age. Gene expression profiles of three spontaneous and four radiation-induced carcinomas, as well as those of normal mammary glands, were analyzed by microarrays. Differential expression of identified genes of interest was then verified by quantitative polymerase chain reaction (qPCR). Cluster analysis of global gene expression suggested that spontaneous carcinomas were distinguished from a heterogeneous population of radiation-induced carcinomas, though most gene expressions were common. We identified 50 genes that had different expression levels between spontaneous and radiogenic carcinomas. We then selected 18 genes for confirmation of the microarray data by qPCR analysis and obtained the following results: high expression of Plg, Pgr and Wnt4 was characteristic to all spontaneous carcinomas; Tnfsf11, Fgf10, Agtr1a, S100A9 and Pou3f3 showed high expression in a subset of radiation-induced carcinomas; and incr