WorldWideScience

Sample records for pathogenic sivmac239 infection

  1. Parasites may exit immunocompromised northern pig-tailed macaques (Macaca leonina) infected with SIVmac239.

    Science.gov (United States)

    Song, Tian-Zhang; Zhang, Ming-Xu; Xia, Yu-Jie; Xiao, Yu; Pang, Wei; Zheng, Yong-Tang

    2018-01-18

    Parasites can increase infection rates and pathogenicity in immunocompromised human immunodeficiency virus (HIV) patients. However, in vitro studies and epidemiological investigations also suggest that parasites might escape immunocompromised hosts during HIV infection. Due to the lack of direct evidence from animal experiments, the effects of parasitic infections on immunocompromised hosts remain unclear. Here, we detected 14 different parasites in six northern pig-tailed macaques (NPMs) before or at the 50th week of simian immunodeficiency virus (SIV) infection by ELISA. The NPMs all carried parasites before viral injection. At the 50th week after viral injection, the individuals with negative results in parasitic detection (i.e., 08247 and 08287) were characterized as the Parasites Exit (PE) group, with the other individuals (i.e., 09203, 09211, 10205, and 10225) characterized as the Parasites Remain (PR) group. Compared with the PR group, the NPMs in the PE group showed higher viral loads, lower CD4 + T cells counts, and lower CD4/CD8 rates. Additionally, the PE group had higher immune activation and immune exhaustion of both CD4 + and CD8 + T cells. Pathological observation showed greater injury to the liver, cecum, colon, spleen, and mesenteric lymph nodes in the PE group. This study showed more seriously compromised immunity in the PE group, strongly indicating that parasites might exit an immunocompromised host.

  2. Parasites may exit immunocompromised northern pig-tailed macaques (Macaca leonina infected with SIVmac239

    Directory of Open Access Journals (Sweden)

    Tian-Zhang Song

    2018-01-01

    Full Text Available Parasites can increase infection rates andpathogenicity in immunocompromised humanimmunodeficiency virus (HIV patients. However, invitro studies and epidemiological investigationsalso suggest that parasites might escapeimmunocompromised hosts during HIV infection.Due to the lack of direct evidence from animalexperiments, the effects of parasitic infections onimmunocompromised hosts remain unclear. Here,we detected 14 different parasites in six northernpig-tailed macaques (NPMs before or during the50th week of post-simian immunodeficiency virus(SIV infection by ELISA. The NPMs all carriedparasites before viral injection. At the 50th week afterviral injection, the individuals with negative resultsin parasitic detection (i.e., 08247 and 08287 werecharacterized as the Parasites Exit (PE group, withthe other individuals (i.e., 09203, 09211, 10205, and10225 characterized as the Parasites Remain (PRgroup. Compared with the PR group, the NPMs in thePE group showed higher viral loads, lower CD4+ Tcells counts, and lower CD4/CD8 rates. Additionally,the PE group had higher immune activation andimmune exhaustion of both CD4+ and CD8+ T cells.Pathological observation showed greater injury tothe liver, cecum, colon, spleen, and mesentericlymph nodes in the PE group. This study showedmore seriously compromised immunity in the PEgroup, strongly indicating that parasites might exit animmunocompromised host.

  3. Effect of plasma viremia on apoptosis and immunophenotype of dendritic cells subsets in acute SIVmac239 infection of Chinese rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Hou-Jun Xia

    Full Text Available Non-human primates such as Chinese rhesus macaques (Ch Rhs provide good animal models for research on human infectious diseases. Similar to humans, there are two principal subsets of dendritic cells (DCs in the peripheral blood of Ch Rhs: myeloid DCs (mDCs and plasmacytoid DCs (pDCs. In this study, two-color fluorescence-activated cell sorting (FACS analyses were used to identify the main DC subsets, namely CD1c(+ mDCs and pDCs from Ch Rhs. Then, the apoptosis and immunophenotype changes of DCs subsets were first described during the acute phase of SIVmac239 infection. Both the DCs subsets showed decreased CD4 expression and enhanced CCR5 expression; in particular, those of pDCs significantly changed at most time points. Interestingly, the plasma viral loads were negatively correlated with CD4 expression, but were positively correlated with CCR5 expression of pDCs. During this period, both CD1c(+ mDCs and pDCs were activated by enhancing expressions of co-stimulatory molecules, accompanied with increase in CCR7. Either CD80 or CD86 expressed on CD1c(+ mDCs and pDCs was positively correlated with the plasma viral loads. Our analysis demonstrates that the pDCs were more prone to apoptosis after infection during the acute phase of SIVmac239 infection, which may be due to their high expressions of CD4 and CCR5. Both DCs subsets activated through elevating the expression of co-stimulatory molecules, which was beneficial in controlling the replication of SIV. However, a mere broad immune activation initiated by activated DCs may lead to tragic AIDS progression.

  4. A Multiplex Microsphere-Based Immunoassay Increases the Sensitivity of SIV-Specific Antibody Detection in Serum Samples and Mucosal Specimens Collected from Rhesus Macaques Infected with SIVmac239.

    Science.gov (United States)

    Powell, Rebecca L R; Ouellette, Ian; Lindsay, Ross W; Parks, Christopher L; King, C Richter; McDermott, Adrian B; Morrow, Gavin

    2013-06-01

    Results from recent HIV-1 vaccine studies have indicated that high serum antibody (Ab) titers may not be necessary for Ab-mediated protection, and that Abs localized to mucosal sites might be critical for preventing infection. Enzyme-linked immunosorbent assay (ELISA) has been used for decades as the gold standard for Ab measurement, though recently, highly sensitive microsphere-based assays have become available, with potential utility for improved detection of Abs. In this study, we assessed the Bio-Plex(®) Suspension Array System for the detection of simian immunodeficiency virus (SIV)-specific Abs in rhesus macaques (RMs) chronically infected with SIV, whose serum or mucosal SIV-specific Ab titers were negative by ELISA. We developed a SIVmac239-specific 4-plex bead array for the simultaneous detection of Abs binding to Env, Gag, Pol, and Nef. The 4-plex assay was used to quantify SIV-specific serum IgG and rectal swab IgA titers from control (SIV-naive) and SIVmac239-infected RMs. The Bio-Plex assay specifically detected anti-SIV Abs in specimens from SIV-infected animals for all four analytes when compared to SIV-naive control samples (p≤0.04). Furthermore, in 70% of Env and 79% of Gag ELISA-negative serum samples, specific Ab was detected using the Bio-Plex assay. Similarly, 71% of Env and 48% of Gag ELISA-negative rectal swab samples were identified as positive using the Bio-Plex assay. Importantly, assay specificity (i.e., probability of true positives) was comparable to ELISA (94%-100%). The results reported here indicate that microsphere-based methods provide a substantial improvement over ELISA for the detection of Ab responses, aid in detecting specific Abs when analyzing samples containing low levels of Abs, such as during the early stages of a vaccine trial, and may be valuable in attempts to link protective efficacy of vaccines with induced Ab responses.

  5. A novel SIV gag-specific CD4(+)T-cell clone suppresses SIVmac239 replication in CD4(+)T cells revealing the interplay between antiviral effector cells and their infected targets.

    Science.gov (United States)

    Ayala, Victor I; Trivett, Matthew T; Coren, Lori V; Jain, Sumiti; Bohn, Patrick S; Wiseman, Roger W; O'Connor, David H; Ohlen, Claes; Ott, David E

    2016-06-01

    To study CD4(+)T-cell suppression of AIDS virus replication, we isolated nine rhesus macaque SIVGag-specific CD4(+)T-cell clones. One responding clone, Gag68, produced a typical cytotoxic CD8(+)T-cell response: induction of intracellular IFN-γ, MIP-1α, MIP-1β, and CD107a degranulation. Gag68 effectively suppressed the spread of SIVmac239 in CD4(+)T cells with a corresponding reduction of infected Gag68 effector cells, suggesting that CD4(+)effectors need to suppress their own infection in addition to their targets to be effective. Gag68 TCR cloning and gene transfer into CD4(+)T cells enabled additional experiments with this unique specificity after the original clone senesced. Our data supports the idea that CD4(+)T cells can directly limit AIDS virus spread in T cells. Furthermore, Gag68 TCR transfer into CD4(+)T-cell clones with differing properties holds promise to better understand the suppressive effector mechanisms used by this important component of the antiviral response using the rhesus macaque model. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. A novel protective MHC-I haplotype not associated with dominant Gag-specific CD8+ T-cell responses in SIVmac239 infection of Burmese rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Naofumi Takahashi

    Full Text Available Several major histocompatibility complex class I (MHC-I alleles are associated with lower viral loads and slower disease progression in human immunodeficiency virus (HIV and simian immunodeficiency virus (SIV infections. Immune-correlates analyses in these MHC-I-related HIV/SIV controllers would lead to elucidation of the mechanism for viral control. Viral control associated with some protective MHC-I alleles is attributed to CD8+ T-cell responses targeting Gag epitopes. We have been trying to know the mechanism of SIV control in multiple groups of Burmese rhesus macaques sharing MHC-I genotypes at the haplotype level. Here, we found a protective MHC-I haplotype, 90-010-Id (D, which is not associated with dominant Gag-specific CD8+ T-cell responses. Viral loads in five D+ animals became significantly lower than those in our previous cohorts after 6 months. Most D+ animals showed predominant Nef-specific but not Gag-specific CD8+ T-cell responses after SIV challenge. Further analyses suggested two Nef-epitope-specific CD8+ T-cell responses exerting strong suppressive pressure on SIV replication. Another set of five D+ animals that received a prophylactic vaccine using a Gag-expressing Sendai virus vector showed significantly reduced viral loads compared to unvaccinated D+ animals at 3 months, suggesting rapid SIV control by Gag-specific CD8+ T-cell responses in addition to Nef-specific ones. These results present a pattern of SIV control with involvement of non-Gag antigen-specific CD8+ T-cell responses.

  7. A Multiplex Microsphere-Based Immunoassay Increases the Sensitivity of SIV-Specific Antibody Detection in Serum Samples and Mucosal Specimens Collected from Rhesus Macaques Infected with SIVmac239

    OpenAIRE

    Powell, Rebecca L.R.; Ouellette, Ian; Lindsay, Ross W.; Parks, Christopher L.; King, C. Richter; McDermott, Adrian B.; Morrow, Gavin

    2013-01-01

    Abstract Results from recent HIV-1 vaccine studies have indicated that high serum antibody (Ab) titers may not be necessary for Ab-mediated protection, and that Abs localized to mucosal sites might be critical for preventing infection. Enzyme-linked immunosorbent assay (ELISA) has been used for decades as the gold standard for Ab measurement, though recently, highly sensitive microsphere-based assays have become available, with potential utility for improved detection of Abs. In this study, w...

  8. Crystallization and preliminary X-ray crystallographic analysis of the rhesus macaque MHC class I molecule Mamu-B*17 complexed with an immunodominant SIVmac239 Env epitope

    International Nuclear Information System (INIS)

    Gao, Feng; Bao, Jinku

    2013-01-01

    A primitive monoclinic crystal of the rhesus macaque MHC class I molecule Mamu-B*17 complexed with an SIVmac239 Env peptide was obtained and belonged to space group P2, with unit-cell parameters a = 68.3, b = 45.0, c = 81.5 Å, β = 96.5°. The crystal diffracted to 2.55 Å resolution. Long-term nonprogression during simian immunodeficiency virus (SIV) infection has been strongly associated with the major histocompatibility complex (MHC) class I allele Mamu-B*17. Here, a complex of rhesus macaque Mamu-B*17 with rhesus macaque β 2 -microglobulin (β 2 m) and an immunodominant peptide (SIVmac239 Env241–251; LRCNDTNYSGF; Env LF11) derived from the SIV Env protein was crystallized by the hanging-drop method using PEG 3350 as a precipitating agent. The crystals belonged to the primitive monoclinic space group P2, with unit-cell parameters a = 68.3, b = 45.0, c = 81.5 Å, β = 96.5°. Assuming the presence of one molecule in the asymmetric unit, the Matthews coefficient and solvent content were calculated to be 2.96 Å 3 Da −1 and 58.5%, respectively

  9. Immunogenicity of seven new recombinant yellow fever viruses 17D expressing fragments of SIVmac239 Gag, Nef, and Vif in Indian rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Mauricio A Martins

    Full Text Available An effective vaccine remains the best solution to stop the spread of human immunodeficiency virus (HIV. Cellular immune responses have been repeatedly associated with control of viral replication and thus may be an important element of the immune response that must be evoked by an efficacious vaccine. Recombinant viral vectors can induce potent T-cell responses. Although several viral vectors have been developed to deliver HIV genes, only a few have been advanced for clinical trials. The live-attenuated yellow fever vaccine virus 17D (YF17D has many properties that make it an attractive vector for AIDS vaccine regimens. YF17D is well tolerated in humans and vaccination induces robust T-cell responses that persist for years. Additionally, methods to manipulate the YF17D genome have been established, enabling the generation of recombinant (rYF17D vectors carrying genes from unrelated pathogens. Here, we report the generation of seven new rYF17D viruses expressing fragments of simian immunodeficiency virus (SIVmac239 Gag, Nef, and Vif. Studies in Indian rhesus macaques demonstrated that these live-attenuated vectors replicated in vivo, but only elicited low levels of SIV-specific cellular responses. Boosting with recombinant Adenovirus type-5 (rAd5 vectors resulted in robust expansion of SIV-specific CD8(+ T-cell responses, particularly those targeting Vif. Priming with rYF17D also increased the frequency of CD4(+ cellular responses in rYF17D/rAd5-immunized macaques compared to animals that received rAd5 only. The effect of the rYF17D prime on the breadth of SIV-specific T-cell responses was limited and we also found evidence that some rYF17D vectors were more effective than others at priming SIV-specific T-cell responses. Together, our data suggest that YF17D - a clinically relevant vaccine vector - can be used to prime AIDS virus-specific T-cell responses in heterologous prime boost regimens. However, it will be important to optimize rYF17D

  10. Vaccination with Gag, Vif, and Nef gene fragments affords partial control of viral replication after mucosal challenge with SIVmac239.

    Science.gov (United States)

    Martins, Mauricio A; Wilson, Nancy A; Piaskowski, Shari M; Weisgrau, Kim L; Furlott, Jessica R; Bonaldo, Myrna C; Veloso de Santana, Marlon G; Rudersdorf, Richard A; Rakasz, Eva G; Keating, Karen D; Chiuchiolo, Maria J; Piatak, Michael; Allison, David B; Parks, Christopher L; Galler, Ricardo; Lifson, Jeffrey D; Watkins, David I

    2014-07-01

    Broadly targeted cellular immune responses are thought to be important for controlling replication of human and simian immunodeficiency viruses (HIV and SIV). However, eliciting such responses by vaccination is complicated by immunodominance, the preferential targeting of only a few of the many possible epitopes of a given antigen. This phenomenon may be due to the coexpression of dominant and subdominant epitopes by the same antigen-presenting cell and may be overcome by distributing these sequences among several different vaccine constructs. Accordingly, we tested whether vaccinating rhesus macaques with "minigenes" encoding fragments of Gag, Vif, and Nef resulted in broadened cellular responses capable of controlling SIV replication. We delivered these minigenes through combinations of recombinant Mycobacterium bovis BCG (rBCG), electroporated recombinant DNA (rDNA) along with an interleukin-12 (IL-12)-expressing plasmid (EP rDNA plus pIL-12), yellow fever vaccine virus 17D (rYF17D), and recombinant adenovirus serotype 5 (rAd5). Although priming with EP rDNA plus pIL-12 increased the breadth of vaccine-induced T-cell responses, this effect was likely due to the improved antigen delivery afforded by electroporation rather than modulation of immunodominance. Indeed, Mamu-A*01(+) vaccinees mounted CD8(+) T cells directed against only one subdominant epitope, regardless of the vaccination regimen. After challenge with SIVmac239, vaccine efficacy was limited to a modest reduction in set point in some of the groups and did not correlate with standard T-cell measurements. These findings suggest that broad T-cell responses elicited by conventional vectors may not be sufficient to substantially contain AIDS virus replication. Immunodominance poses a major obstacle to the generation of broadly targeted, HIV-specific cellular responses by vaccination. Here we attempted to circumvent this phenomenon and thereby broaden the repertoire of SIV-specific cellular responses by

  11. Rectal HSV-2 Infection May Increase Rectal SIV Acquisition Even in the Context of SIVΔnef Vaccination.

    Directory of Open Access Journals (Sweden)

    Natalia Guerra-Pérez

    Full Text Available Prevalent HSV-2 infection increases the risk of HIV acquisition both in men and women even in asymptomatic subjects. Understanding the impact of HSV-2 on the mucosal microenvironment may help to identify determinants of susceptibility to HIV. Vaginal HSV-2 infection increases the frequency of cells highly susceptible to HIV in the vaginal tissue of women and macaques and this correlates with increased susceptibility to vaginal SHIV infection in macaques. However, the effect of rectal HSV-2 infection on HIV acquisition remains understudied. We developed a model of rectal HSV-2 infection in macaques in combination with rectal SIVmac239Δnef (SIVΔnef vaccination and our results suggest that rectal HSV-2 infection may increase the susceptibility of macaques to rectal SIVmac239 wild-type (wt infection even in SIVΔnef-infected animals. Rectal SIVΔnef infection/vaccination protected 7 out of 7 SIVΔnef-infected macaques from SIVmac239wt rectal infection (vs 12 out of 16 SIVΔnef-negative macaques, while 1 out of 3 animals co-infected with SIVΔnef and HSV-2 acquired SIVmac239wt infection. HSV-2/SIVmac239wt co-infected animals had increased concentrations of inflammatory factors in their plasma and rectal fluids and a tendency toward higher acute SIVmac239wt plasma viral load. However, they had higher blood CD4 counts and reduced depletion of CCR5+ CD4+ T cells compared to SIVmac239wt-only infected animals. Thus, rectal HSV-2 infection generates a pro-inflammatory environment that may increase susceptibility to rectal SIV infection and may impact immunological and virological parameters during acute SIV infection. Studies with larger number of animals are needed to confirm these findings.

  12. Modification of a loop sequence between α-helices 6 and 7 of virus capsid (CA protein in a human immunodeficiency virus type 1 (HIV-1 derivative that has simian immunodeficiency virus (SIVmac239 vif and CA α-helices 4 and 5 loop improves replication in cynomolgus monkey cells

    Directory of Open Access Journals (Sweden)

    Adachi Akio

    2009-08-01

    Full Text Available Abstract Background Human immunodeficiency virus type 1 (HIV-1 productively infects only humans and chimpanzees but not cynomolgus or rhesus monkeys while simian immunodeficiency virus isolated from macaque (SIVmac readily establishes infection in those monkeys. Several HIV-1 and SIVmac chimeric viruses have been constructed in order to develop an animal model for HIV-1 infection. Construction of an HIV-1 derivative which contains sequences of a SIVmac239 loop between α-helices 4 and 5 (L4/5 of capsid protein (CA and the entire SIVmac239 vif gene was previously reported. Although this chimeric virus could grow in cynomolgus monkey cells, it did so much more slowly than did SIVmac. It was also reported that intrinsic TRIM5α restricts the post-entry step of HIV-1 replication in rhesus and cynomolgus monkey cells, and we previously demonstrated that a single amino acid in a loop between α-helices 6 and 7 (L6/7 of HIV type 2 (HIV-2 CA determines the susceptibility of HIV-2 to cynomolgus monkey TRIM5α. Results In the study presented here, we replaced L6/7 of HIV-1 CA in addition to L4/5 and vif with the corresponding segments of SIVmac. The resultant HIV-1 derivatives showed enhanced replication capability in established T cell lines as well as in CD8+ cell-depleted primary peripheral blood mononuclear cells from cynomolgus monkey. Compared with the wild type HIV-1 particles, the viral particles produced from a chimeric HIV-1 genome with those two SIVmac loops were less able to saturate the intrinsic restriction in rhesus monkey cells. Conclusion We have succeeded in making the replication of simian-tropic HIV-1 in cynomolgus monkey cells more efficient by introducing into HIV-1 the L6/7 CA loop from SIVmac. It would be of interest to determine whether HIV-1 derivatives with SIVmac CA L4/5 and L6/7 can establish infection of cynomolgus monkeys in vivo.

  13. Cytotoxic T-Lymphocyte Escape Does Not Always Explain the Transient Control of Simian Immunodeficiency Virus SIVmac239 Viremia in Adenovirus-Boosted and DNA-Primed Mamu-A*01-Positive Rhesus Macaques

    Science.gov (United States)

    McDermott, Adrian B.; O'Connor, David H.; Fuenger, Sarah; Piaskowski, Shari; Martin, Sarah; Loffredo, John; Reynolds, Matthew; Reed, Jason; Furlott, Jessica; Jacoby, Timothy; Riek, Cara; Dodds, Elizabeth; Krebs, Kendall; Davies, Mary-Ellen; Schleif, William A.; Casimiro, Danilo R.; Shiver, John W.; Watkins, D. I.

    2005-01-01

    Adenovirus 5 (Ad5) vectors show promise as human immunodeficiency virus vaccine candidates. Indian rhesus macaques vaccinated with Ad5-gag controlled simian-human immunodeficiency virus SHIV89.6P viral replication in the absence of Env immunogens that might elicit humoral immunity. Here we immunized 15 macaques using either a homologous Ad5-gag/Ad5-gag (Ad5/Ad5) or a heterologous DNA-gag/Ad5-gag (DNA/Ad5) prime-boost regimen and challenged them with a high dose of simian immunodeficiency virus SIVmac239. Macaques vaccinated with the DNA/Ad5 regimen experienced a brief viral load nadir of less than 10,000 viral copies per ml blood plasma that was not seen in Mamu-A*01-negative DNA/Ad5 vaccinees, Mamu-A*01-positive Ad5/Ad5 vaccinees, or vaccine-naive controls. Interestingly, most of these animals were not durably protected from disease progression when challenged with SIVmac239. To investigate the reasons underlying this short-lived vaccine effect, we investigated breadth of the T-cell response, immunogenetic background, and viral escape from CD8+ lymphocytes that recognize immunodominant T-cell epitopes. We show that these animals do not mount unusually broad cellular immune response, nor do they express unusual major histocompatibility complex class I alleles. Viral recrudescence occurred in four of the five Mamu-A*01-positive vaccinated macaques. However, only a single animal in this group demonstrated viral escape in the immunodominant Gag181-189CM9 response. These results suggest that viral “breakthrough” in vaccinated animals and viral escape are not inextricably linked and underscore the need for additional research into the mechanisms of vaccine failure. PMID:16306626

  14. Variability of bio-clinical parameters in Chinese-origin Rhesus macaques infected with simian immunodeficiency virus: a nonhuman primate AIDS model.

    Directory of Open Access Journals (Sweden)

    Song Chen

    Full Text Available BACKGROUND: Although Chinese-origin Rhesus macaques (Ch RhMs infected with simian immunodeficiency virus (SIV have been used for many years to evaluate the efficacy of AIDS vaccines and therapeutics, the bio-clinical variability of such a nonhuman primate AIDS model was so far not established. METHODOLOGY/PRINCIPAL FINDINGS: By randomizing 150 (78 male and 72 female Ch RhMs with diverse MHC class I alleles into 3 groups (50 animals per group challenged with intrarectal (i.r. SIVmac239, intravenous (i.v. SIVmac239, or i.v. SIVmac251, we evaluated variability in bio-clinical endpoints for 118 weeks. All SIV-challenged Ch RhMs became seropositive for SIV during 1-2 weeks. Plasma viral load (VL peaked at weeks 1-2 and then declined to set-point levels as from week 5. The set-point VL was 30 fold higher in SIVmac239 (i.r. or i.v.-infected than in SIVmac251 (i.v.-infected animals. This difference in plasma VL increased overtime (>100 fold as from week 68. The rates of progression to AIDS or death were more rapid in SIVmac239 (i.r. or i.v.-infected than in SIVmac251 (i.v.-infected animals. No significant difference in bio-clinical endpoints was observed in animals challenged with i.r. or i.v. SIVmac239. The variability (standard deviation in peak/set-point VL was nearly one-half lower in animals infected with SIVmac239 (i.r. or i.v. than in those infected with SIVmac251 (i.v., allowing that the same treatment-related difference can be detected with one-half fewer animals using SIVmac239 than using SIVmac251. CONCLUSION/SIGNIFICANCE: These results provide solid estimates of variability in bio-clinical endpoints needed when designing studies using the Ch RhM SIV model and contribute to the improving quality and standardization of preclinical studies.

  15. Viral CTL escape mutants are generated in lymph nodes and subsequently become fixed in plasma and rectal mucosa during acute SIV infection of macaques.

    Directory of Open Access Journals (Sweden)

    Thomas H Vanderford

    2011-05-01

    Full Text Available SIV(mac239 infection of rhesus macaques (RMs results in AIDS despite the generation of a strong antiviral cytotoxic T lymphocyte (CTL response, possibly due to the emergence of viral escape mutants that prevent recognition of infected cells by CTLs. To determine the anatomic origin of these SIV mutants, we longitudinally assessed the presence of CTL escape variants in two MamuA*01-restricted immunodominant epitopes (Tat-SL8 and Gag-CM9 in the plasma, PBMCs, lymph nodes (LN, and rectal biopsies (RB of fifteen SIV(mac239-infected RMs. As expected, Gag-CM9 did not exhibit signs of escape before day 84 post infection. In contrast, Tat-SL8 escape mutants were apparent in all tissues by day 14 post infection. Interestingly LNs and plasma exhibited the highest level of escape at day 14 and day 28 post infection, respectively, with the rate of escape in the RB remaining lower throughout the acute infection. The possibility that CTL escape occurs in LNs before RBs is confirmed by the observation that the specific mutants found at high frequency in LNs at day 14 post infection became dominant at day 28 post infection in plasma, PBMC, and RB. Finally, the frequency of escape mutants in plasma at day 28 post infection correlated strongly with the level Tat-SL8-specific CD8 T cells in the LN and PBMC at day 14 post infection. These results indicate that LNs represent the primary source of CTL escape mutants during the acute phase of SIV(mac239 infection, suggesting that LNs are the main anatomic sites of virus replication and/or the tissues in which CTL pressure is most effective in selecting SIV escape variants.

  16. Efferocytosis of Pathogen-Infected Cells

    Directory of Open Access Journals (Sweden)

    Niloofar Karaji

    2017-12-01

    Full Text Available The prompt and efficient clearance of unwanted and abnormal cells by phagocytes is termed efferocytosis and is crucial for organism development, maintenance of tissue homeostasis, and regulation of the immune system. Dying cells are recognized by phagocytes through pathways initiated via “find me” signals, recognition via “eat me” signals and down-modulation of regulatory “don’t eat me” signals. Pathogen infection may trigger cell death that drives phagocytic clearance in an immunologically silent, or pro-inflammatory manner, depending on the mode of cell death. In many cases, efferocytosis is a mechanism for eliminating pathogens and pathogen-infected cells; however, some pathogens have subverted this process and use efferocytic mechanisms to avoid innate immune detection and assist phagocyte infection. In parallel, phagocytes can integrate signals received from infected dying cells to elicit the most appropriate effector response against the infecting pathogen. This review focuses on pathogen-induced cell death signals that drive infected cell recognition and uptake by phagocytes, and the outcomes for the infected target cell, the phagocyte, the pathogen and the host.

  17. Childhood urinary tract infection in Benin City: pathogens and ...

    African Journals Online (AJOL)

    Childhood urinary tract infection in Benin City: pathogens and antimicrobial ... of bacterial isolates implicated in urinary tract infection (UTI) amongst children was ... There is also an emerging resistance of common pathogens to azithromycin ...

  18. Post-infection immunodeficiency virus control by neutralizing antibodies.

    Directory of Open Access Journals (Sweden)

    Hiroyuki Yamamoto

    Full Text Available BACKGROUND: Unlike most acute viral infections controlled with the appearance of virus-specific neutralizing antibodies (NAbs, primary HIV infections are not met with such potent and early antibody responses. This brings into question if or how the presence of potent antibodies can contribute to primary HIV control, but protective efficacies of antiviral antibodies in primary HIV infections have remained elusive; and, it has been speculated that even NAb induction could have only a limited suppressive effect on primary HIV replication once infection is established. Here, in an attempt to answer this question, we examined the effect of passive NAb immunization post-infection on primary viral replication in a macaque AIDS model. METHODS AND FINDINGS: The inoculums for passive immunization with simian immunodeficiency virus mac239 (SIVmac239-specific neutralizing activity were prepared by purifying polyclonal immunoglobulin G from pooled plasma of six SIVmac239-infected rhesus macaques with NAb induction in the chronic phase. Passive immunization of rhesus macaques with the NAbs at day 7 after SIVmac239 challenge resulted in significant reduction of set-point plasma viral loads and preservation of central memory CD4 T lymphocyte counts, despite the limited detection period of the administered NAb responses. Peripheral lymph node dendritic cell (DC-associated viral RNA loads showed a remarkable peak with the NAb administration, and DCs stimulated in vitro with NAb-preincubated SIV activated virus-specific CD4 T lymphocytes in an Fc-dependent manner, implying antibody-mediated virion uptake by DCs and enhanced T cell priming. CONCLUSIONS: Our results present evidence indicating that potent antibody induction post-infection can result in primary immunodeficiency virus control and suggest direct and indirect contribution of its absence to initial control failure in HIV infections. Although difficulty in achieving requisite neutralizing titers for

  19. Lentiviral Vpx accessory factor targets VprBP/DCAF1 substrate adaptor for cullin 4 E3 ubiquitin ligase to enable macrophage infection.

    Directory of Open Access Journals (Sweden)

    Smita Srivastava

    2008-05-01

    Full Text Available Vpx is a small virion-associated adaptor protein encoded by viruses of the HIV-2/SIVsm lineage of primate lentiviruses that enables these viruses to transduce monocyte-derived cells. This probably reflects the ability of Vpx to overcome an as yet uncharacterized block to an early event in the virus life cycle in these cells, but the underlying mechanism has remained elusive. Using biochemical and proteomic approaches, we have found that Vpx protein of the pathogenic SIVmac 239 strain associates with a ternary protein complex comprising DDB1 and VprBP subunits of Cullin 4-based E3 ubiquitin ligase, and DDA1, which has been implicated in the regulation of E3 catalytic activity, and that Vpx participates in the Cullin 4 E3 complex comprising VprBP. We further demonstrate that the ability of SIVmac as well as HIV-2 Vpx to interact with VprBP and its associated Cullin 4 complex is required for efficient reverse transcription of SIVmac RNA genome in primary macrophages. Strikingly, macrophages in which VprBP levels are depleted by RNA interference resist SIVmac infection. Thus, our observations reveal that Vpx interacts with both catalytic and regulatory components of the ubiquitin proteasome system and demonstrate that these interactions are critical for Vpx ability to enable efficient SIVmac replication in primary macrophages. Furthermore, they identify VprBP/DCAF1 substrate receptor for Cullin 4 E3 ubiquitin ligase and its associated protein complex as immediate downstream effector of Vpx for this function. Together, our findings suggest a model in which Vpx usurps VprBP-associated Cullin 4 ubiquitin ligase to enable efficient reverse transcription and thereby overcome a block to lentivirus replication in monocyte-derived cells, and thus provide novel insights into the underlying molecular mechanism.

  20. Evolution of nef variants in gut associated lymphoid tissue of rhesus macaques during primary simian immunodeficiency virus infection

    International Nuclear Information System (INIS)

    Ndolo, Thomas; Syvanen, Michael; Ellison, Thomas; Dandekar, Satya

    2005-01-01

    We utilized the simian immunodeficiency virus model of AIDS to examine evolution of nef gene in gut-associated lymphoid tissue (GALT) during primary and early asymptomatic stages of infection. Macaques were infected with a cloned virus, SIVmac239/nef-stop harboring a premature stop codon in the nef gene. Restoration of the nef open reading frame occurred in GALT early at 3 days post-infection. Analysis of nef sequences by phylogenetic tools showed that evolution of nef was neutral thereafter, as evidenced by the ratio of synonymous to nonsynonymous substitutions, a star pattern in unrooted trees and distribution of amino acid replacements fitting a simple Poisson process. Two regions encoding for a nuclear localization signal and a CTL epitope were conserved. Thus, GALT was a site for strong positive selection of functional nef during initial stages of infection. However, evolution of the nef gene thereafter was neutral during early asymptomatic stage of infection

  1. Simian Immunodeficiency Virus Targeting of CXCR3+ CD4+ T Cells in Secondary Lymphoid Organs Is Associated with Robust CXCL10 Expression in Monocyte/Macrophage Subsets.

    Science.gov (United States)

    Fujino, Masayuki; Sato, Hirotaka; Okamura, Tomotaka; Uda, Akihiko; Takeda, Satoshi; Ahmed, Nursarat; Shichino, Shigeyuki; Shiino, Teiichiro; Saito, Yohei; Watanabe, Satoru; Sugimoto, Chie; Kuroda, Marcelo J; Ato, Manabu; Nagai, Yoshiyuki; Izumo, Shuji; Matsushima, Kouji; Miyazawa, Masaaki; Ansari, Aftab A; Villinger, Francois; Mori, Kazuyasu

    2017-07-01

    Glycosylation of Env defines pathogenic properties of simian immunodeficiency virus (SIV). We previously demonstrated that pathogenic SIVmac239 and a live-attenuated, quintuple deglycosylated Env mutant (Δ5G) virus target CD4 + T cells residing in different tissues during acute infection. SIVmac239 and Δ5G preferentially infected distinct CD4 + T cells in secondary lymphoid organs (SLOs) and within the lamina propria of the small intestine, respectively (C. Sugimoto et al., J Virol 86:9323-9336, 2012, https://doi.org/10.1128/JVI.00948-12). Here, we studied the host responses relevant to SIV targeting of CXCR3 + CCR5 + CD4 + T cells in SLOs. Genome-wide transcriptome analyses revealed that Th1-polarized inflammatory responses, defined by expression of CXCR3 chemokines, were distinctly induced in the SIVmac239-infected animals. Consistent with robust expression of CXCL10, CXCR3 + T cells were depleted from blood in the SIVmac239-infected animals. We also discovered that elevation of CXCL10 expression in blood and SLOs was secondary to the induction of CD14 + CD16 + monocytes and MAC387 + macrophages, respectively. Since the significantly higher levels of SIV infection in SLOs occurred with a massive accumulation of infiltrated MAC387 + macrophages, T cells, dendritic cells (DCs), and residential macrophages near high endothelial venules, the results highlight critical roles of innate/inflammatory responses in SIVmac239 infection. Restricted infection in SLOs by Δ5G also suggests that glycosylation of Env modulates innate/inflammatory responses elicited by cells of monocyte/macrophage/DC lineages. IMPORTANCE We previously demonstrated that a pathogenic SIVmac239 virus and a live-attenuated, deglycosylated mutant Δ5G virus infected distinct CD4 + T cell subsets in SLOs and the small intestine, respectively (C. Sugimoto et al., J Virol 86:9323-9336, 2012, https://doi.org/10.1128/JVI.00948-12). Accordingly, infections with SIVmac239, but not with Δ5G, deplete CXCR3

  2. Environmental Persistence Influences Infection Dynamics for a Butterfly Pathogen.

    Directory of Open Access Journals (Sweden)

    Dara A Satterfield

    Full Text Available Many pathogens, including those infecting insects, are transmitted via dormant stages shed into the environment, where they must persist until encountering a susceptible host. Understanding how abiotic conditions influence environmental persistence and how these factors influence pathogen spread are crucial for predicting patterns of infection risk. Here, we explored the consequences of environmental transmission for infection dynamics of a debilitating protozoan parasite (Ophryocystis elektroscirrha that infects monarch butterflies (Danaus plexippus. We first conducted an experiment to observe the persistence of protozoan spores exposed to natural conditions. Experimental results showed that, contrary to our expectations, pathogen doses maintained high infectivity even after 16 days in the environment, although pathogens did yield infections with lower parasite loads after environmental exposure. Because pathogen longevity exceeded the time span of our experiment, we developed a mechanistic model to better explore environmental persistence for this host-pathogen system. Model analysis showed that, in general, longer spore persistence led to higher infection prevalence and slightly smaller monarch population sizes. The model indicated that typical parasite doses shed onto milkweed plants must remain viable for a minimum of 3 weeks for prevalence to increase during the summer-breeding season, and for 11 weeks or longer to match levels of infection commonly reported from the wild, assuming moderate values for parasite shedding rate. Our findings showed that transmission stages of this butterfly pathogen are long-lived and indicated that this is a necessary condition for the protozoan to persist in local monarch populations. This study provides a modeling framework for future work examining the dynamics of an ecologically important pathogen in an iconic insect.

  3. Sieve analysis using the number of infecting pathogens.

    Science.gov (United States)

    Follmann, Dean; Huang, Chiung-Yu

    2017-12-14

    Assessment of vaccine efficacy as a function of the similarity of the infecting pathogen to the vaccine is an important scientific goal. Characterization of pathogen strains for which vaccine efficacy is low can increase understanding of the vaccine's mechanism of action and offer targets for vaccine improvement. Traditional sieve analysis estimates differential vaccine efficacy using a single identifiable pathogen for each subject. The similarity between this single entity and the vaccine immunogen is quantified, for example, by exact match or number of mismatched amino acids. With new technology, we can now obtain the actual count of genetically distinct pathogens that infect an individual. Let F be the number of distinct features of a species of pathogen. We assume a log-linear model for the expected number of infecting pathogens with feature "f," f=1,…,F. The model can be used directly in studies with passive surveillance of infections where the count of each type of pathogen is recorded at the end of some interval, or active surveillance where the time of infection is known. For active surveillance, we additionally assume that a proportional intensity model applies to the time of potentially infectious exposures and derive product and weighted estimating equation (WEE) estimators for the regression parameters in the log-linear model. The WEE estimator explicitly allows for waning vaccine efficacy and time-varying distributions of pathogens. We give conditions where sieve parameters have a per-exposure interpretation under passive surveillance. We evaluate the methods by simulation and analyze a phase III trial of a malaria vaccine. © 2017, The International Biometric Society.

  4. Competition of pathogen strains leading to infection with variable infectivity and the effect of treatment

    NARCIS (Netherlands)

    Xiridou, Maria; Kretzschmar, Mirjam; Geskus, Ronald

    2005-01-01

    A model for the spread of two strains of a pathogen leading to an infection with variable infectivity is considered. The course of infection is described by two stages with different infectivity levels. The model is extended to account for treatment by including a third stage with different

  5. Multidrug-resistant opportunistic pathogens challenging veterinary infection control.

    Science.gov (United States)

    Walther, Birgit; Tedin, Karsten; Lübke-Becker, Antina

    2017-02-01

    Although the problems associated with healthcare-associated infections (HAI) and the emergence of zoonotic and multidrug-resistant pathogens in companion animal (dogs, cats and horses) medicine have been well-known for decades, current progress with respect to practical implementation of infection control programs in veterinary clinics has been limited. Clinical outbreak events reported for methicillin-resistant Staphylooccus aureus (MRSA) and Staphylococcus pseudintermedius (MRSP), extended spectrum beta-lactamase (ESBL)-producing Escherichia coli and multidrug-resistant (MDR) Salmonella Serovars indicate the necessity of infection control strategies for protecting animal patients at risk as well as veterinary personnel. The close bond between humans and their companion animals provides opportunities for exchange of microorganisms, including MDR pathogens. This particular aspect of the "One Health" idea requires more representative surveillance efforts and infection control strategies with respect to animal-species specific characters. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Cross inoculation of anthracnose pathogens infecting various tropical fruits

    Science.gov (United States)

    Suparman; Rahmiyah, M.; Pujiastuti, Y.; Gunawan, B.; Arsi

    2018-01-01

    Anthracnose disease is very important disease of tropical fruits causing significant yield losses. The disease is caused by Colletotrichum spp. and infects almost all tropical fruit species, especially the succulent ones. Various species of Colletotrichum infect various tropical fruits and there are possibilities for cross inoculation to occur among tropical fruits which might cause severe infection. An experimental research was conducted to examine the effect of cross inoculation of anthracnose pathogen among papaya, eggplant, chili and common bean on the infection development and severity of the disease on each inoculated fruit species. Colletotrichum spp. were isolated from naturally infected papaya, eggplant, chili and common bean. Each fungal isolate was purified and identified to determine the species name. The spores of each isolate were then used to separately inoculate healthy and sterilized papaya, eggplant, chili and common bean. The results showed that cross infection developed on chili, eggplant and papaya but not on bean. Chili showed the highest susceptibility to all Colletotrichum isolates and significantly different from eggplant and papaya. The anthracnose pathogen isolated from common bean showed no pathogenicity to other hosts and might be used as cross protection inoculant to the disease in the other hosts.

  7. Pathogenicity of Cryptosporidium parvum - evaluation of an animal infection model

    DEFF Research Database (Denmark)

    Enemark, Heidi L.; Bille-Hansen, Vivi; Lind, Peter

    2003-01-01

    and rectum. The unintended presence of rotavirus in some of the experimental animals revealed an additive or synergistic effect between rotavirus and C. parvum as indicated by prolonged diarrhoea, increased oocyst shedding, decreased weight gain and elevated levels of serum haptoglobin and serum amyloid...... A (SAA) in piglets infected simultaneously with both pathogens. The difference in daily weight gain between infected and control animals was significant only for piglets co-infected with rotavirus. The acute phase response of haptoglobin and SAA was characterised by a large individual variation....... In piglets, co-infected with rotavirus, the levels of serum haptoglobin were 3.5 and 4.6 times higher in the infected versus the controls 6 and 9 dpi, respectively (mean values: 2411 mug/ml +/- S.D. 2023 and 1840 mug/ml +/- S.D. 1697). In the controls infected with rotavirus, peak haptoglobin concentration...

  8. Screening for Sexually Transmitted Infection Pathogens in Semen Samples

    Directory of Open Access Journals (Sweden)

    RW Peeling

    2005-01-01

    Full Text Available The transmission of sexually transmitted infection (STI pathogens from an infected donor to the recipient of a semen donation in assisted conception may result not only in acute infection but also in long-term reproductive complications or adverse outcomes of pregnancy, including infection of the offspring. Screening for bacterial STI pathogens, Chlamydia trachomatis and Neisseria gonorrhoeae is strongly recommended because these pathogens can cause serious reproductive complications in the recipients of semen donations and infection in their offspring. Screening for these pathogens should be performed using the most sensitive methods, such as nucleic acid amplified tests. False-negative results due to inhibitory substances in the semen sample should be monitored using amplification controls. Where specimen transport is not a problem and culture facilities are available, N gonorrhoeae can also be detected by culture. Laboratories performing screening should subscribe to proficiency programs and have strict quality controls. Although Trichomonas vaginalis, group B streptococcus and genital mycoplasmas have been associated with adverse outcomes of pregnancy, the frequent finding of these organisms in healthy individuals brings into question the validity of mandatory inclusion of these organisms in the screening panel. Although viral STI pathogens and Treponema pallidum -- the causative agent of syphilis -- may be detected in semen, their presence may be more sensitively detected through antibody testing of the donor. Screening donors for HIV, hepatitis B and syphilis by serology is uniformly recommended in all of the guidelines, but the value of screening either donors or semen samples for cytomegalovirus, herpes simplex viruses and human papilloma viruses is less clear.

  9. Characteristic features of intracellular pathogenic Leptospira in infected murine macrophages.

    Science.gov (United States)

    Toma, Claudia; Okura, Nobuhiko; Takayama, Chitoshi; Suzuki, Toshihiko

    2011-11-01

    Leptospira interrogans is a spirochaete responsible for a zoonotic disease known as leptospirosis. Leptospires are able to penetrate the abraded skin and mucous membranes and rapidly disseminate to target organs such as the liver, lungs and kidneys. How this pathogen escape from innate immune cells and spread to target organs remains poorly understood. In this paper, the intracellular trafficking undertaken by non-pathogenic Leptospira biflexa and pathogenic L. interrogans in mouse bone marrow-derived macrophages was compared. The delayed in the clearance of L. interrogans was observed. Furthermore, the acquisition of lysosomal markers by L. interrogans-containing phagosomes lagged behind that of L. biflexa-containing phagosomes, and although bone marrow-derived macrophages could degrade L. biflexa as well as L. interrogans, a population of L. interrogans was able to survive and replicate. Intact leptospires were found within vacuoles at 24 h post infection, suggesting that bacterial replication occurs within a membrane-bound compartment. In contrast, L. biflexa were completely degraded at 24 h post infection. Furthermore, L. interrogans but not L. biflexa, were released to the extracellular milieu. These results suggest that pathogenic leptospires are able to survive, replicate and exit from mouse macrophages, enabling their eventual spread to target organs. © 2011 Blackwell Publishing Ltd.

  10. Microbial Community Composition Impacts Pathogen Iron Availability during Polymicrobial Infection.

    Directory of Open Access Journals (Sweden)

    Apollo Stacy

    2016-12-01

    Full Text Available Iron is an essential nutrient for bacterial pathogenesis, but in the host, iron is tightly sequestered, limiting its availability for bacterial growth. Although this is an important arm of host immunity, most studies examine how bacteria respond to iron restriction in laboratory rather than host settings, where the microbiome can potentially alter pathogen strategies for acquiring iron. One of the most important transcriptional regulators controlling bacterial iron homeostasis is Fur. Here we used a combination of RNA-seq and chromatin immunoprecipitation (ChIP-seq to characterize the iron-restricted and Fur regulons of the biofilm-forming opportunistic pathogen Aggregatibacter actinomycetemcomitans. We discovered that iron restriction and Fur regulate 4% and 3.5% of the genome, respectively. While most genes in these regulons were related to iron uptake and metabolism, we found that Fur also directly regulates the biofilm-dispersing enzyme Dispersin B, allowing A. actinomycetemcomitans to escape from iron-scarce environments. We then leveraged these datasets to assess the availability of iron to A. actinomycetemcomitans in its primary infection sites, abscesses and the oral cavity. We found that A. actinomycetemcomitans is not restricted for iron in a murine abscess mono-infection, but becomes restricted for iron upon co-infection with the oral commensal Streptococcus gordonii. Furthermore, in the transition from health to disease in human gum infection, A. actinomycetemcomitans also becomes restricted for iron. These results suggest that host iron availability is heterogeneous and dependent on the infecting bacterial community.

  11. Daphnia magna shows reduced infection upon secondary exposure to a pathogen.

    Science.gov (United States)

    McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

    2012-12-23

    Previous pathogen exposure is an important predictor of the probability of becoming infected. This is deeply understood for vertebrate hosts, and increasingly so for invertebrate hosts. Here, we test if an initial pathogen exposure changes the infection outcome to a secondary pathogen exposure in the natural host-pathogen system Daphnia magna and Pasteuria ramosa. Hosts were initially exposed to an infective pathogen strain, a non-infective pathogen strain or a control. The same hosts underwent a second exposure, this time to an infective pathogen strain, either immediately after the initial encounter or 48 h later. We observed that an initial encounter with a pathogen always conferred protection against infection compared with controls.

  12. Metagenomic approach for discovering new pathogens in infection disease outbreaks

    Directory of Open Access Journals (Sweden)

    Emanuela Giombini

    2011-09-01

    Full Text Available Viruses represent the most abundant biological components on earth.They can be found in every environment, from deep layers of oceans to animal bodies.Although several viruses have been isolated and sequenced, in each environment there are millions of different types of viruses that have not been identified yet.The advent of nextgeneration sequencing technologies with their high throughput capabilities make possible to study in a single experiment all the community of microorganisms present in a particular sample “microbioma”.They made more feasible the application of the metagenomic approach, by which it is also possible to discover and identify new pathogens, that may pose a threat to public health.This paper summarizes the most recent applications of nextgeneration sequencing to discover new viral pathogens during the occurrence of infection disease outbreaks.

  13. Multiple infections of rodents with zoonotic pathogens in Austria.

    Science.gov (United States)

    Schmidt, Sabrina; Essbauer, Sandra S; Mayer-Scholl, Anne; Poppert, Sven; Schmidt-Chanasit, Jonas; Klempa, Boris; Henning, Klaus; Schares, Gereon; Groschup, Martin H; Spitzenberger, Friederike; Richter, Dania; Heckel, Gerald; Ulrich, Rainer G

    2014-07-01

    Rodents are important reservoirs for a large number of zoonotic pathogens. We examined the occurrence of 11 viral, bacterial, and parasitic agents in rodent populations in Austria, including three different hantaviruses, lymphocytic choriomeningitis virus, orthopox virus, Leptospira spp., Borrelia spp., Rickettsia spp., Bartonella spp., Coxiella burnetii, and Toxoplasma gondii. In 2008, 110 rodents of four species (40 Clethrionomys glareolus, 29 Apodemus flavicollis, 26 Apodemus sylvaticus, and 15 Microtus arvalis) were trapped at two rural sites in Lower Austria. Chest cavity fluid and samples of lung, spleen, kidney, liver, brain, and ear pinna skin were collected. We screened selected tissue samples for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, Leptospira, Borrelia, Rickettsia, Bartonella spp., C. burnetii, and T. gondii by RT-PCR/PCR and detected nucleic acids of Tula hantavirus, Leptospira spp., Borrelia afzelii, Rickettsia spp., and different Bartonella species. Serological investigations were performed for hantaviruses, lymphocytic choriomeningitis virus, orthopox viruses, and Rickettsia spp. Here, Dobrava-Belgrade hantavirus-, Tula hantavirus-, lymphocytic choriomeningitis virus-, orthopox virus-, and rickettsia-specific antibodies were demonstrated. Puumala hantavirus, C. burnetii, and T. gondii were neither detected by RT-PCR/PCR nor by serological methods. In addition, multiple infections with up to three pathogens were shown in nine animals of three rodent species from different trapping sites. In conclusion, these results show that rodents in Austria may host multiple zoonotic pathogens. Our observation raises important questions regarding the interactions of different pathogens in the host, the countermeasures of the host's immune system, the impact of the host-pathogen interaction on the fitness of the host, and the spread of infectious agents among wild rodents and from those to other animals or humans.

  14. The race between infection and immunity - how do pathogens set the pace?

    Energy Technology Data Exchange (ETDEWEB)

    Ribiero, Ruy M [Los Alamos National Laboratory

    2009-01-01

    Infection is often referred to as a race between pathogen and immune response. This metaphor suggests that slower growing pathogens should be more easily controlled. However, a growing body ofevidence shows that many chronic infections are caused by failure to control slow growing pathogens. The slow growth of pathogens appears to directly affect the kinetics of the immune response. Compared with the response to fast growing pathogens, the T cell response to slow pathogens is delayed in its initiation, lymphocyte expansion is slow and the response often fails to clear the pathogen, leading to chronic infection. Understanding the 'rules ofthe race' for slow growing pathogens has important implications for vaccine design and immune control of many chronic infections.

  15. Differential lung NK cell responses in avian influenza virus infected chickens correlate with pathogenicity

    OpenAIRE

    Jansen, C.A.; de Geus, E.D.; van Haarlem, D.A.; van de Haar, P.M.; Löndt, B.Z; Graham, S.P.; Göbel, T.W.; van Eden, W.; Brookes, S.M.; Vervelde, L.

    2013-01-01

    Infection of chickens with low pathogenicity avian influenza (LPAI) virus results in mild clinical signs while infection with highly pathogenic avian influenza (HPAI) viruses causes death of the birds within 36–48 hours. Since natural killer (NK) cells have been shown to play an important role in influenza-specific immunity, we hypothesise that NK cells are involved in this difference in pathogenicity. To investigate this, the role of chicken NK-cells in LPAI virus infection was studied. Next...

  16. Haemophilus ducreyi: from sexually transmitted infection to skin ulcer pathogen.

    Science.gov (United States)

    Lewis, David A; Mitjà, Oriol

    2016-02-01

    This article provides an overview of the biology, epidemiology, clinical features, diagnostic tests, and treatment of Haemophilus ducreyi infection, with special reference to the decline of chancroid and the recent emergence of H. ducreyi as a pathogen responsible for chronic limb ulceration clinically similar to yaws. Chancroid has declined in importance as a sexually transmitted infection in most countries where it was previously endemic. Chancroid may be caused by either class I or class II H. ducreyi isolates; these two classes diverged from each other approximately 1.95 million years ago. H. ducreyi has recently emerged as a cause of chronic skin ulceration in the Pacific region and Africa. Based on sequencing of whole genomes and defined genetic loci, it appears that the cutaneous H. ducreyi strains diverged from the class I genital strains relatively recently. H. ducreyi should be considered as a major cause of chronic limb ulceration in both adults and children and appropriate molecular diagnostic assays are required to determine ulcer aetiology. The high prevalence of H. ducreyi-related cutaneous ulceration in yaws-endemic countries has challenged the validity of observational surveys to monitor the effectiveness of the WHO's yaws eradication campaign.

  17. Mixed infections reveal virulence differences between host-specific bee pathogens.

    Science.gov (United States)

    Klinger, Ellen G; Vojvodic, Svjetlana; DeGrandi-Hoffman, Gloria; Welker, Dennis L; James, Rosalind R

    2015-07-01

    Dynamics of host-pathogen interactions are complex, often influencing the ecology, evolution and behavior of both the host and pathogen. In the natural world, infections with multiple pathogens are common, yet due to their complexity, interactions can be difficult to predict and study. Mathematical models help facilitate our understanding of these evolutionary processes, but empirical data are needed to test model assumptions and predictions. We used two common theoretical models regarding mixed infections (superinfection and co-infection) to determine which model assumptions best described a group of fungal pathogens closely associated with bees. We tested three fungal species, Ascosphaera apis, Ascosphaera aggregata and Ascosphaera larvis, in two bee hosts (Apis mellifera and Megachile rotundata). Bee survival was not significantly different in mixed infections vs. solo infections with the most virulent pathogen for either host, but fungal growth within the host was significantly altered by mixed infections. In the host A. mellifera, only the most virulent pathogen was present in the host post-infection (indicating superinfective properties). In M. rotundata, the most virulent pathogen co-existed with the lesser-virulent one (indicating co-infective properties). We demonstrated that the competitive outcomes of mixed infections were host-specific, indicating strong host specificity among these fungal bee pathogens. Published by Elsevier Inc.

  18. Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

    Science.gov (United States)

    Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

    2012-07-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

  19. Role of complement and antibodies in controlling infection with pathogenic simian immunodeficiency virus (SIV in macaques vaccinated with replication-deficient viral vectors

    Directory of Open Access Journals (Sweden)

    Strasak Alexander

    2009-06-01

    Full Text Available Abstract Background We investigated the interplay between complement and antibodies upon priming with single-cycle replicating viral vectors (SCIV encoding SIV antigens combined with Adeno5-SIV or SCIV pseudotyped with murine leukemia virus envelope boosting strategies. The vaccine was applied via spray-immunization to the tonsils of rhesus macaques and compared with systemic regimens. Results Independent of the application regimen or route, viral loads were significantly reduced after challenge with SIVmac239 (p Conclusion The heterologous prime-boost strategy with replication-deficient viral vectors administered exclusively via the tonsils did not induce any neutralizing antibodies before challenge. However, after challenge, comparable SIV-specific humoral immune responses were observed in all vaccinated animals. Immunization with single cycle immunodeficiency viruses mounts humoral immune responses comparable to live-attenuated immunodeficiency virus vaccines.

  20. Models of Caenorhabditis elegans infection by bacterial and fungal pathogens.

    Science.gov (United States)

    Powell, Jennifer R; Ausubel, Frederick M

    2008-01-01

    The nematode Caenorhabditis elegans is a simple model host for studying the relationship between the animal innate immune system and a variety of bacterial and fungal pathogens. Extensive genetic and molecular tools are available in C. elegans, facilitating an in-depth analysis of host defense factors and pathogen virulence factors. Many of these factors are conserved in insects and mammals, indicating the relevance of the nematode model to the vertebrate innate immune response. Here, we describe pathogen assays for a selection of the most commonly studied bacterial and fungal pathogens using the C. elegans model system.

  1. Early depletion of proliferating B cells of germinal center in rapidly progressive simian immunodeficiency virus infection

    International Nuclear Information System (INIS)

    Zhang Zhiqiang; Casimiro, Danilo R.; Schleif, William A.; Chen, Minchun; Citron, Michael; Davies, Mary-Ellen; Burns, Janine; Liang, Xiaoping; Fu, Tong-Ming; Handt, Larry; Emini, Emilio A.; Shiver, John W.

    2007-01-01

    Lack of virus specific antibody response is commonly observed in both HIV-1-infected humans and SIV-infected monkeys with rapid disease progression. However, the mechanisms underlying this important observation still remain unclear. In a titration study of a SIVmac239 viral stock, three out of six animals with viral inoculation rapidly progressed to AIDS within 5 months. Unexpectedly, there was no obvious depletion of CD4 + T cells in both peripheral and lymph node (LN) compartments in these animals. Instead, progressive depletion of proliferating B cells and disruption of the follicular dendritic cell (FDC) network in germinal centers (GC) was evident in the samples collected at as early as 20 days after viral challenge. This coincided with undetectable, or weak and transient, virus-specific antibody responses over the course of infection. In situ hybridization of SIV RNA in the LN samples revealed a high frequency of SIV productively infected cells and large amounts of accumulated viral RNA in the GCs in these animals. Early severe depletion of GC proliferating B cells and disruption of the FDC network may thus result in an inability to mount a virus-specific antibody response in rapid progressors, which has been shown to contribute to accelerated disease progression of SIV infection

  2. Bioeconomic modeling of lactational antimicrobial treatment of new bovine subclinical intramammary infections caused by contagious pathogens

    NARCIS (Netherlands)

    Borne, van den B.H.P.; Halasa, T.; Schaik, van G.; Hogeveen, H.; Nielen, M.

    2010-01-01

    This study determined the direct and indirect epidemiologic and economic effects of lactational treatment of new bovine subclinical intramammary infections (IMI) caused by contagious pathogens using an existing bioeconomic model. The dynamic and stochastic model simulated the dynamics of

  3. Human infection with highly pathogenic H5N1 influenza virus

    NARCIS (Netherlands)

    Gambotto, Andrea; Barratt-Boyes, Simon M.; de Jong, Menno D.; Neumann, Gabriele; Kawaoka, Yoshihiro

    2008-01-01

    Highly pathogenic H5N1 influenza A viruses have spread relentlessly across the globe since 2003, and they are associated with widespread death in poultry, substantial economic loss to farmers, and reported infections of more than 300 people with a mortality rate of 60%. The high pathogenicity of

  4. Clinical data and CT findings of pulmonary infection caused by different pathogens after kidney transplantation

    International Nuclear Information System (INIS)

    Jiang Tao; Xue Feng; Zheng Xuan; Yu Hong; Tao Xiaofeng; Xiao Xiangsheng; Liu Shiyuan

    2012-01-01

    Purpose: The overall objective was to review clinical data and CT findings of pulmonary infection caused by different pathogens after kidney transplantation in an attempt to help early clinical qualitative diagnosis. Materials and methods: 446 cases of clinically confirmed pulmonary infection after kidney transplantation in recent 10 years were evaluated with respect to the time of occurrence and 89 cases with complete CT data and pathogenic diagnosis were further analyzed for pathogen types and CT manifestations. Statistical analysis was performed using Fisher's exact test. Results: Pulmonary infection reached the peak in 3 months after transplantation. Bacterial infection and mixed infection were predominant between 1 and 6 months. And most tuberculosis occurred after one year. Bacterial (38.2%) and mixed infections (38.2%) were the common types. The next was fungal infection, tuberculosis and viral infection (10.1%, 7.9% and 5.6%, respectively). CT manifestations of pulmonary infections after kidney transplantation were diverse and complex, lacking characteristic signs. Conclusion: More than 3/4 of pulmonary infections after kidney transplantation can be attributed to bacteria and mixed pathogens. The combination of time course, clinical data and CT manifestations plays an important role in the early clinical qualitative diagnosis.

  5. Transcriptomic analysis reveals the potential of highly pathogenic PRRS virus to modulate immune system activation related to host-pathogen and damage associated signaling in infected porcine monocytes

    Science.gov (United States)

    One of the largest risks to the continued stability of the swine industry is by pathogens like porcine reproductive and respiratory syndrome virus (PRRSV) that can decimate production as it spreads among individuals. These infections can be low or highly pathogenic, and because it infects monocytic ...

  6. A neonatal murine model for evaluation of enterovirus E HY12 virus infection and pathogenicity.

    Directory of Open Access Journals (Sweden)

    Xiaochun Gai

    Full Text Available HY12 viruses are enteroviruses recently isolated from cattle characterized by severe respiratory and digestive disease with high morbidity and mortality in China. While the viruses exhibit unique biological and molecular characters distinct from known enterovirus E, the pathogenicity and viral pathogenesis remains largely unknown.Neonatal mice of Balb/C, ICR, and Kunming strain are infected with HY12 to determine the susceptible mouse strain. The minimal infection dose, the virus infection routes, the pathogenicity and tissue tropism for HY12 were determined by infecting susceptible mice with HY12 viruses, and confirmed by different approaches including virus isolation and recovery, virus detection, histopathology, and immunohistochemistry.A murine model for HY12 infection was successfully established and employed to investigate the pathogenicity of HY12 viruses. ICR mouse strain is the most susceptible strain for HY12 infection with a minimal infective dose as 2×106TCID50/mouse. HY12 viruses have the capability of infecting ICR suckling mice via all infection routes including intranasal administration, oral administration, intraperitoneal injection, subcutaneous injection, and intramuscular injection, which are confirmed by the isolation and recovery of viruses from HY12-infected mice; detection of viruses by RT-PCR; observations of pathological lesions and inflammatory cell infiltrations in the intestine, lung, liver, and brain; uncovering of HY12 virus antigens in majority of tissues, especially in intestine, lung, and infected brain of mice by immunohistochemistry assay.A neonatal murine model for HY12 infection is successfully established for determining the susceptible mouse strain, the minimal infective dose, the infection route, the viral pathogenicity and the tropism of HY12, thus providing an invaluable model system for elucidating the pathogenesis of HY12 viruses and the elicited immunity.

  7. Severity of bovine tuberculosis is associated with co-infection with common pathogens in wild boar.

    Directory of Open Access Journals (Sweden)

    David Risco

    Full Text Available Co-infections with parasites or viruses drive tuberculosis dynamics in humans, but little is known about their effects in other non-human hosts. This work aims to investigate the relationship between Mycobacterium bovis infection and other pathogens in wild boar (Sus scrofa, a recognized reservoir of bovine tuberculosis (bTB in Mediterranean ecosystems. For this purpose, it has been assessed whether contacts with common concomitant pathogens are associated with the development of severe bTB lesions in 165 wild boar from mid-western Spain. The presence of bTB lesions affecting only one anatomic location (cervical lymph nodes, or more severe patterns affecting more than one location (mainly cervical lymph nodes and lungs, was assessed in infected animals. In addition, the existence of contacts with other pathogens such as porcine circovirus type 2 (PCV2, Aujeszky's disease virus (ADV, swine influenza virus, porcine reproductive and respiratory syndrome virus, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Haemophilus parasuis and Metastrongylus spp, was evaluated by means of serological, microbiological and parasitological techniques. The existence of contacts with a structured community of pathogens in wild boar infected by M. bovis was statistically investigated by null models. Association between this community of pathogens and bTB severity was examined using a Partial Least Squares regression approach. Results showed that adult wild boar infected by M. bovis had contacted with some specific, non-random pathogen combinations. Contact with PCV2, ADV and infection by Metastrongylus spp, was positively correlated to tuberculosis severity. Therefore, measures against these concomitant pathogens such as vaccination or deworming, might be useful in tuberculosis control programmes in the wild boar. However, given the unexpected consequences of altering any community of organisms, further research should evaluate the impact of such measures

  8. Severity of Bovine Tuberculosis Is Associated with Co-Infection with Common Pathogens in Wild Boar

    Science.gov (United States)

    Risco, David; Serrano, Emmanuel; Fernández-Llario, Pedro; Cuesta, Jesús M.; Gonçalves, Pilar; García-Jiménez, Waldo L.; Martínez, Remigio; Cerrato, Rosario; Velarde, Roser; Gómez, Luis; Segalés, Joaquím; Hermoso de Mendoza, Javier

    2014-01-01

    Co-infections with parasites or viruses drive tuberculosis dynamics in humans, but little is known about their effects in other non-human hosts. This work aims to investigate the relationship between Mycobacterium bovis infection and other pathogens in wild boar (Sus scrofa), a recognized reservoir of bovine tuberculosis (bTB) in Mediterranean ecosystems. For this purpose, it has been assessed whether contacts with common concomitant pathogens are associated with the development of severe bTB lesions in 165 wild boar from mid-western Spain. The presence of bTB lesions affecting only one anatomic location (cervical lymph nodes), or more severe patterns affecting more than one location (mainly cervical lymph nodes and lungs), was assessed in infected animals. In addition, the existence of contacts with other pathogens such as porcine circovirus type 2 (PCV2), Aujeszky's disease virus (ADV), swine influenza virus, porcine reproductive and respiratory syndrome virus, Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Haemophilus parasuis and Metastrongylus spp, was evaluated by means of serological, microbiological and parasitological techniques. The existence of contacts with a structured community of pathogens in wild boar infected by M. bovis was statistically investigated by null models. Association between this community of pathogens and bTB severity was examined using a Partial Least Squares regression approach. Results showed that adult wild boar infected by M. bovis had contacted with some specific, non-random pathogen combinations. Contact with PCV2, ADV and infection by Metastrongylus spp, was positively correlated to tuberculosis severity. Therefore, measures against these concomitant pathogens such as vaccination or deworming, might be useful in tuberculosis control programmes in the wild boar. However, given the unexpected consequences of altering any community of organisms, further research should evaluate the impact of such measures under

  9. Host-pathogen interactions in specific pathogen-free chickens following aerogenous infection with Chlamydia psittaci and Chlamydia abortus.

    Science.gov (United States)

    Kalmar, Isabelle; Berndt, Angela; Yin, Lizi; Chiers, Koen; Sachse, Konrad; Vanrompay, Daisy

    2015-03-15

    Although Chlamydia (C.) psittaci infections are recognized as an important factor causing economic losses and impairing animal welfare in poultry production, the specific mechanisms leading to severe clinical outcomes are poorly understood. In the present study, we comparatively investigated pathology and host immune response, as well as systemic dissemination and expression of essential chlamydial genes in the course of experimental aerogeneous infection with C. psittaci and the closely related C. abortus, respectively, in specific pathogen-free chicks. Clinical signs appeared sooner and were more severe in the C. psittaci-infected group. Compared to C. abortus infection, more intense systemic dissemination of C. psittaci correlated with higher and faster infiltration of immune cells, as well as more macroscopic lesions and epithelial pathology, such as hyperplasia and erosion. In thoracic air sac tissue, mRNA expression of immunologically relevant factors, such as IFN-γ, IL-1β, IL-6, IL-17, IL-22, LITAF and iNOS was significantly stronger up-regulated in C. psittaci- than in C. abortus-infected birds between 3 and 14 days post-infection. Likewise, transcription rates of the chlamydial genes groEL, cpaf and ftsW were consistently higher in C. psittaci during the acute phase. These findings illustrate that the stronger replication of C. psittaci in its natural host also evoked a more intense immune response than in the case of C. abortus infection. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Host-pathogen interactions mediating pain of urinary tract infection.

    Science.gov (United States)

    Rudick, Charles N; Billips, Benjamin K; Pavlov, Vladimir I; Yaggie, Ryan E; Schaeffer, Anthony J; Klumpp, David J

    2010-04-15

    Pelvic pain is a major component of the morbidity associated with urinary tract infection (UTI), yet the molecular mechanisms underlying UTI-induced pain remain unknown. UTI pain mechanisms probably contrast with the clinical condition of asymptomatic bacteriuria (ASB), characterized by significant bacterial loads without lack symptoms. A murine UTI model was used to compare pelvic pain behavior elicited by infection with uropathogenic Escherichia coli strain NU14 and ASB strain 83972. NU14-infected mice exhibited pelvic pain, whereas mice infected with 83972 did not exhibit pain, similar to patients infected with 83972. NU14-induced pain was not dependent on mast cells, not correlated with bacterial colonization or urinary neutrophils. UTI pain was not influenced by expression of type 1 pili, the bacterial adhesive appendages that induce urothelial apoptosis. However, purified NU14 lipopolysaccharide (LPS) induced Toll-like receptor 4 (TLR4)-dependent pain, whereas 83972 LPS induced no pain. Indeed, 83972 LPS attenuated the pain of NU14 infection, suggesting therapeutic potential. These data suggest a novel mechanism of infection-associated pain that is dependent on TLR4 yet independent of inflammation. Clinically, these findings also provide the rational for probiotic therapies that would minimize the symptoms of infection without reliance on empirical therapies that contribute to antimicrobial resistance.

  11. Cryptosporidium parvum: infectivity and pathogenicity of the 'porcine' genotype

    DEFF Research Database (Denmark)

    Enemark, Heidi L.; Ahrens, Peter; Bille-Hansen, Vivi

    2003-01-01

    mild clinical signs in piglets despite the excretion of high numbers of oocysts. Concomitant infection with rotavirus, however, caused a dramatic aggravation of the clinical signs, and 5 of 6 experimentally infected piglets died. CPP-13 appeared to be adapted to porcine hosts as illustrated by the lack...

  12. Pathogenic lower genital tract organisms in HIV-infected and ...

    African Journals Online (AJOL)

    Trichomonas vaginalis and group B streptococci were significantly associated with sepsis (p=0.023 and <0.001, respectively), whereas the presence of Candida species seemed to be protective (relative risk 0.69, p=0.014). Conclusion. The study shows that a high proportion of pregnant women have pathogenic organisms ...

  13. Biological characteristics and pathogenicity of a highly pathogenic Shewanella marisflavi infected sea cucumber (Apostichopus uaponicus)

    Science.gov (United States)

    Shewanella marisflavi isolate AP629 was characterized as a novel pathogen of sea cucumber. The LD50 values (14 days) in sea cucumber and swordtail fish were 3.89 × 106 and 4.85 × 104 CFU g-1 body weight, respectively. Studies on S. marisflavi had been conducted, including morphology, physiological a...

  14. Mycobacterium Szulgai Pulmonary Infection: Case Report of an Uncommon Pathogen in Korea

    International Nuclear Information System (INIS)

    Kim, Jeong Jae; Lee, Jae Chun; Jeong, Sun Young

    2014-01-01

    Mycobacterium szulgai (M. szulgai) is an unusual pathogen in a human non-tuberculous mycobacterial infection. Pulmonary infection due to M. szulgai may be clinically and radiologically confused with active pulmonary tuberculosis. In contrast to other non-tuberculous mycobacteria, M. szulgai infection is well controlled by combination antimycobacterial therapy. Most of the previously reported cases of M. szulgai pulmonary infection showed cavitary upper lobe infiltrates. We herein describe a case of pulmonary M. szulgai infection that shows clinical and radiological presentations similar to active pulmonary tuberculosis.

  15. Mycobacterium Szulgai Pulmonary Infection: Case Report of an Uncommon Pathogen in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jeong Jae; Lee, Jae Chun; Jeong, Sun Young [Jeju National University School of Medicine, Jeju (Korea, Republic of)

    2014-10-15

    Mycobacterium szulgai (M. szulgai) is an unusual pathogen in a human non-tuberculous mycobacterial infection. Pulmonary infection due to M. szulgai may be clinically and radiologically confused with active pulmonary tuberculosis. In contrast to other non-tuberculous mycobacteria, M. szulgai infection is well controlled by combination antimycobacterial therapy. Most of the previously reported cases of M. szulgai pulmonary infection showed cavitary upper lobe infiltrates. We herein describe a case of pulmonary M. szulgai infection that shows clinical and radiological presentations similar to active pulmonary tuberculosis.

  16. The membrane as the gatekeeper of infection: Cholesterol in host-pathogen interaction.

    Science.gov (United States)

    Kumar, G Aditya; Jafurulla, Md; Chattopadhyay, Amitabha

    2016-09-01

    The cellular plasma membrane serves as a portal for the entry of intracellular pathogens. An essential step for an intracellular pathogen to gain entry into a host cell therefore is to be able to cross the cell membrane. In this review, we highlight the role of host membrane cholesterol in regulating the entry of intracellular pathogens using insights obtained from work on the interaction of Leishmania and Mycobacterium with host cells. The entry of these pathogens is known to be dependent on host membrane cholesterol. Importantly, pathogen entry is inhibited either upon depletion (or complexation), or enrichment of membrane cholesterol. In other words, an optimum level of host membrane cholesterol is necessary for efficient infection by pathogens. In this overall context, we propose a general mechanism, based on cholesterol-induced conformational changes, involving cholesterol binding sites in host cell surface receptors that are implicated in this process. A therapeutic strategy targeting modulation of membrane cholesterol would have the advantage of avoiding the commonly encountered problem of drug resistance in tackling infection by intracellular pathogens. Insights into the role of host membrane cholesterol in pathogen entry would be instrumental in the development of novel therapeutic strategies to effectively tackle intracellular pathogenesis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Pathogenic characteristics of persistent feline enteric coronavirus infection in cats

    Science.gov (United States)

    Vogel, Liesbeth; Van der Lubben, Mariken; Te Lintelo, Eddie G.; Bekker, Cornelis P.J.; Geerts, Tamara; Schuijff, Leontine S.; Grinwis, Guy C.M.; Egberink, Herman F.; Rottier, Peter J.M.

    2010-01-01

    Feline coronaviruses (FCoV) comprise two biotypes: feline enteric coronaviruses (FECV) and feline infectious peritonitis viruses (FIPV). FECV is associated with asymptomatic persistent enteric infections, while FIPV causes feline infectious peritonitis (FIP), a usually fatal systemic disease in domestic cats and some wild Felidae. FIPV arises from FECV by mutation. FCoV also occur in two serotypes, I and II, of which the serotype I viruses are by far the most prevalent in the field. Yet, most of our knowledge about FCoV infections relates to serotype II viruses, particularly about the FIPV, mainly because type I viruses grow poorly in cell culture. Hence, the aim of the present work was the detailed study of the epidemiologically most relevant viruses, the avirulent serotype I viruses. Kittens were inoculated oronasally with different doses of two independent FECV field strains, UCD and RM. Persistent infection could be reproducibly established. The patterns of clinical symptoms, faecal virus shedding and seroconversion were monitored for up to 10 weeks revealing subtle but reproducible differences between the two viruses. Faecal virus, i.e. genomic RNA, was detected during persistent FECV infection only in the large intestine, downstream of the appendix, and could occasionally be observed also in the blood. The implications of our results, particularly our insights into the persistently infected state, are discussed. PMID:20663472

  18. Mining Host-Pathogen Protein Interactions to Characterize Burkholderia mallei Infectivity Mechanisms

    Science.gov (United States)

    2015-03-04

    the cytoskeleton, in lysosomes , and in the nuclear lumen. These results were consistent with the experimentally observed pathogen interference with...RESEARCH ARTICLE Mining Host- Pathogen Protein Interactions to Characterize Burkholderia mallei Infectivity Mechanisms Vesna Memišević1, Nela...Bacteriology Division, U.S. Army Medical Research Institute of Infectious Diseases , Fort Detrick, Maryland, United States of America * jaques.reifman.civ

  19. Assessing the Consequences of Microbial Infection in Field Trials: Seen, Unseen, Beneficial, Parasitic and Pathogenic

    Directory of Open Access Journals (Sweden)

    Mark E. Looseley

    2014-06-01

    Full Text Available Microbial infections of crop plants present an ongoing threat to agricultural production. However, in recent years, we have developed a more nuanced understanding of the ecological role of microbes and how they interact with plants. This includes an appreciation of the influence of crop physiology and environmental conditions on the expression of disease symptoms, the importance of non-pathogenic microbes on host plants and pathogens, and the capacity for plants to act as hosts for human pathogens. Alongside this we now have a variety of tools available for the identification and quantification of microbial infections on crops grown under field conditions. This review summarises some of the consequences of microbial infections in crop plants, and discusses how new and established assessment tools can be used to understand these processes. It challenges our current assumptions in yield loss relationships and offers understanding of the potential for more resilient crops.

  20. Orientia, rickettsia, and leptospira pathogens as causes of CNS infections in Laos

    DEFF Research Database (Denmark)

    Dittrich, Sabine; Rattanavong, Sayaphet; Lee, Sue J

    2015-01-01

    BACKGROUND: Scrub typhus (caused by Orientia tsutsugamushi), murine typhus (caused by Rickettsia typhi), and leptospirosis are common causes of febrile illness in Asia; meningitis and meningoencephalitis are severe complications. However, scarce data exist for the burden of these pathogens......, Neisseria meningitidis, Haemophilus influenzae, S suis) and O tsutsugamushi, Rickettsia typhi/Rickettsia spp, and Leptospira spp infections in blood or cerebrospinal fluid (CSF). We analysed and compared causes and clinical and CSF characteristics between patient groups. FINDINGS: 1051 (95%) of 1112...... patients who presented had CSF available for analysis, of whom 254 (24%) had a CNS infection attributable to a bacterial or fungal pathogen. 90 (35%) of these 254 infections were caused by O tsutsugamushi, R typhi/Rickettsia spp, or Leptospira spp. These pathogens were significantly more frequent than...

  1. Innate scavenger receptor-A regulates adaptive T helper cell responses to pathogen infection

    Science.gov (United States)

    Xu, Zhipeng; Xu, Lei; Li, Wei; Jin, Xin; Song, Xian; Chen, Xiaojun; Zhu, Jifeng; Zhou, Sha; Li, Yong; Zhang, Weiwei; Dong, Xiaoxiao; Yang, Xiaowei; Liu, Feng; Bai, Hui; Chen, Qi; Su, Chuan

    2017-01-01

    The pattern recognition receptor (PRR) scavenger receptor class A (SR-A) has an important function in the pathogenesis of non-infectious diseases and in innate immune responses to pathogen infections. However, little is known about the role of SR-A in the host adaptive immune responses to pathogen infection. Here we show with mouse models of helminth Schistosoma japonicum infection and heat-inactivated Mycobacterium tuberculosis stimulation that SR-A is regulated by pathogens and suppresses IRF5 nuclear translocation by direct interaction. Reduced abundance of nuclear IRF5 shifts macrophage polarization from M1 towards M2, which subsequently switches T-helper responses from type 1 to type 2. Our study identifies a role for SR-A as an innate PRR in regulating adaptive immune responses. PMID:28695899

  2. Additional risk factors for infection by multidrug-resistant pathogens in healthcare-associated infection: a large cohort study

    Directory of Open Access Journals (Sweden)

    Cardoso Teresa

    2012-12-01

    Full Text Available Abstract Background There is a lack of consensus regarding the definition of risk factors for healthcare-associated infection (HCAI. The purpose of this study was to identify additional risk factors for HCAI, which are not included in the current definition of HCAI, associated with infection by multidrug-resistant (MDR pathogens, in all hospitalized infected patients from the community. Methods This 1-year prospective cohort study included all patients with infection admitted to a large, tertiary care, university hospital. Risk factors not included in the HCAI definition, and independently associated with MDR pathogen infection, namely MDR Gram-negative (MDR-GN and ESKAPE microorganisms (vancomycin-resistant Enterococcus faecium, methicillin-resistant Staphylococcus aureus, extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella species, carbapenem-hydrolyzing Klebsiella pneumonia and MDR Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter species, were identified by logistic regression among patients admitted from the community (either with community-acquired or HCAI. Results There were 1035 patients with infection, 718 from the community. Of these, 439 (61% had microbiologic documentation; 123 were MDR (28%. Among MDR: 104 (85% had MDR-GN and 41 (33% had an ESKAPE infection. Independent risk factors associated with MDR and MDR-GN infection were: age (adjusted odds ratio (OR = 1.7 and 1.5, p = 0.001 and p = 0.009, respectively, and hospitalization in the previous year (between 4 and 12 months previously (adjusted OR = 2.0 and 1,7, p = 0.008 and p = 0.048, respectively. Infection by pathogens from the ESKAPE group was independently associated with previous antibiotic therapy (adjusted OR = 7.2, p p = 0.003. Patients with infection by MDR, MDR-GN and pathogens from the ESKAPE group had significantly higher rates of inadequate antibiotic therapy than those without (46% vs 7%, 44% vs 10%, 61% vs 15%, respectively, p

  3. Interferon production and immune response induction in pathogenic rabies virus-infected mice

    Energy Technology Data Exchange (ETDEWEB)

    Marcovistz, R; Leal, E C; De Souza Matos, D C [Departamento de Immunologia, Instituto Oswaldo Cruz, Caixa Postal 926, 21045 Rio de Janeiro (Brazil); Tsiang, H [Service Rage, Istitut Pasteur, Paris (France)

    1994-08-01

    Pathogenic parental rabies virus strain CVS (challenge virus standard) and its apathogenic variant RV194-2 were shown to differ in their ability to induce interferon (IFN) and immune response of the host. After intracerebral inoculation. IFN and antibody production was higher in the RV194-2 virus-infected mice than in the CVS infection. The enhancement of 2-5A synthetase activity, an IFN-mediated enzyme marker, showed biochemical evidence that IFN is active in both apathogenic and pathogenic infections. On the other hand, spontaneous proliferation in vitro of thymocytes and splenocytes from CVS virus-infected mice was strongly inhibited in contrast to the RV194-2 infection. In the CVS infection, the thymocyte proliferation However, in the RV194-2 infection, the thymocyte proliferation was higher than of the splenocytes. These results suggest a better performance of T-cell response to the RV194-2 infection. This fact can be critical for an enhancement of antibody production in the apathogenic infection and subsequent virus clearance from the brain of RV194-2 virus-infected mice. (author) 1 fig., 3 tabs., 32 refs.

  4. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal

    Science.gov (United States)

    Coy, Monique R.; Stelinski, Lukasz L.; Pelz-Stelinski, Kirsten S.

    2015-01-01

    The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas) affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama). CLas is the putative causal agent of huanglongbing (HLB), which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies. PMID:26083763

  5. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal.

    Directory of Open Access Journals (Sweden)

    Xavier Martini

    Full Text Available The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama. CLas is the putative causal agent of huanglongbing (HLB, which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies.

  6. Induced release of a plant-defense volatile 'deceptively' attracts insect vectors to plants infected with a bacterial pathogen.

    Directory of Open Access Journals (Sweden)

    Rajinder S Mann

    Full Text Available Transmission of plant pathogens by insect vectors is a complex biological process involving interactions between the plant, insect, and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites as well as major plant nutrients. Experiments were conducted to understand how a plant pathogenic bacterium, Candidatus Liberibacter asiaticus (Las, affects host preference behavior of its psyllid (Diaphorina citri Kuwayama vector. D. citri were attracted to volatiles from pathogen-infected plants more than to those from non-infected counterparts. Las-infected plants were more attractive to D. citri adults than non-infected plants initially; however after feeding, psyllids subsequently dispersed to non-infected rather than infected plants as their preferred settling point. Experiments with Las-infected and non-infected plants under complete darkness yielded similar results to those recorded under light. The behavior of psyllids in response to infected versus non-infected plants was not influenced by whether or not they were carriers of the pathogen. Quantification of volatile release from non-infected and infected plants supported the hypothesis that odorants mediate psyllid preference. Significantly more methyl salicylate, yet less methyl anthranilate and D-limonene, was released by infected than non-infected plants. Methyl salicylate was attractive to psyllids, while methyl anthranilate did not affect their behavior. Feeding on citrus by D. citri adults also induced release of methyl salicylate, suggesting that it may be a cue revealing location of conspecifics on host plants. Infected plants were characterized by lower levels of nitrogen, phosphorus, sulfur, zinc, and iron, as well as, higher levels of potassium and boron than non-infected plants. Collectively, our results suggest that host selection behavior of D. citri may be modified by bacterial infection of plants, which alters release of

  7. Determination of Pathogens in Postoperative Wound Infection After Surgically Reduced Calcaneal Fractures and Implications for Prophylaxis and Treatment

    NARCIS (Netherlands)

    Backes, Manouk; Spijkerman, Ingrid J.; de Muinck-Keizer, Robert-Jan O.; Goslings, J. Carel; Schepers, Tim

    2018-01-01

    High rates of postoperative wound infection (POWI) have been reported after surgery for calcaneal fractures. This is a retrospective cohort study to determine the causative pathogens of these infections and subsequent treatment strategies. In addition, microbacterial growth from superficial wound

  8. Highly pathogenic avian influenza virus (H5N1) in experimentally infected adult mute swans.

    Science.gov (United States)

    Kalthoff, Donata; Breithaupt, Angele; Teifke, Jens P; Globig, Anja; Harder, Timm; Mettenleiter, Thomas C; Beer, Martin

    2008-08-01

    Adult, healthy mute swans were experimentally infected with highly pathogenic avian influenza virus A/Cygnus cygnus/Germany/R65/2006 subtype H5N1. Immunologically naive birds died, whereas animals with preexisting, naturally acquired avian influenza virus-specific antibodies became infected asymptomatically and shed virus. Adult mute swans are highly susceptible, excrete virus, and can be clinically protected by preexposure immunity.

  9. Rapid qualitative urinary tract infection pathogen identification by SeptiFast real-time PCR.

    Directory of Open Access Journals (Sweden)

    Lutz E Lehmann

    2011-02-01

    Full Text Available Urinary tract infections (UTI are frequent in outpatients. Fast pathogen identification is mandatory for shortening the time of discomfort and preventing serious complications. Urine culture needs up to 48 hours until pathogen identification. Consequently, the initial antibiotic regimen is empirical.To evaluate the feasibility of qualitative urine pathogen identification by a commercially available real-time PCR blood pathogen test (SeptiFast® and to compare the results with dipslide and microbiological culture.Pilot study with prospectively collected urine samples.University hospital.82 prospectively collected urine samples from 81 patients with suspected UTI were included. Dipslide urine culture was followed by microbiological pathogen identification in dipslide positive samples. In parallel, qualitative DNA based pathogen identification (SeptiFast® was performed in all samples.61 samples were SeptiFast® positive, whereas 67 samples were dipslide culture positive. The inter-methodological concordance of positive and negative findings in the gram+, gram- and fungi sector was 371/410 (90%, 477/492 (97% and 238/246 (97%, respectively. Sensitivity and specificity of the SeptiFast® test for the detection of an infection was 0.82 and 0.60, respectively. SeptiFast® pathogen identifications were available at least 43 hours prior to culture results.The SeptiFast® platform identified bacterial DNA in urine specimens considerably faster compared to conventional culture. For UTI diagnosis sensitivity and specificity is limited by its present qualitative setup which does not allow pathogen quantification. Future quantitative assays may hold promise for PCR based UTI pathogen identification as a supplementation of conventional culture methods.

  10. Determinants of Infectivity of Pathogens in Vector Ticks

    Science.gov (United States)

    1990-11-15

    of group 1. Perhaps with i’,creased age , group 2 nymphs developed a systemic infection. We plan to follow group 1 as it ages , to see if this might be...may facilitate the formation of the unusual forms of Borrelia that we observed. The large swollen forms have been seen in spirochetes in aged cultures...Helminthol. 40:337-342. Lees, A.D. (1948). The sensory phisiology of the sheep Ixodes ricinus L. J. Exp. Biol. 25:145-207. Lemaux, P.G., Herendeen, S.L

  11. Evolution of Drosophila resistance against different pathogens and infection routes entails no detectable maintenance costs.

    Science.gov (United States)

    Faria, Vítor G; Martins, Nelson E; Paulo, Tânia; Teixeira, Luís; Sucena, Élio; Magalhães, Sara

    2015-11-01

    Pathogens exert a strong selective pressure on hosts, entailing host adaptation to infection. This adaptation often affects negatively other fitness-related traits. Such trade-offs may underlie the maintenance of genetic diversity for pathogen resistance. Trade-offs can be tested with experimental evolution of host populations adapting to parasites, using two approaches: (1) measuring changes in immunocompetence in relaxed-selection lines and (2) comparing life-history traits of evolved and control lines in pathogen-free environments. Here, we used both approaches to examine trade-offs in Drosophila melanogaster populations evolving for over 30 generations under infection with Drosophila C Virus or the bacterium Pseudomonas entomophila, the latter through different routes. We find that resistance is maintained after up to 30 generations of relaxed selection. Moreover, no differences in several classical life-history traits between control and evolved populations were found in pathogen-free environments, even under stresses such as desiccation, nutrient limitation, and high densities. Hence, we did not detect any maintenance costs associated with resistance to pathogens. We hypothesize that extremely high selection pressures commonly used lead to the disproportionate expression of costs relative to their actual occurrence in natural systems. Still, the maintenance of genetic variation for pathogen resistance calls for an explanation. © 2015 The Author(s). Evolution © 2015 The Society for the Study of Evolution.

  12. Utilizing Bacillus to inhibit the growth and infection by sheath blight pathogen, Rhizoctoniasolani in rice

    Science.gov (United States)

    Margani, R.; Hadiwiyono; Widadi, S.

    2018-03-01

    Rhizoctonia solani Kuhn is a common pathogen of rice. The pathogen causes sheath blight of rice. The pathogen can cause loss in the production of rice up to 45%. So far, the disease however is still poorly taken care of by the farmers and researchers, so the control measures is nearly never practiced by the farmers in the fields. It due to the unavailability of effective control method of the disease. Therefore, development to control the disease is important. Bacillus is one of popular bacteria which is effective as biological control agent of a lot of pathogens in plants, but it has not been used for control sheath blight in rice yet. The current researches were aimed to study the potential of Bacillus collected from healthy rice as candidates of biological control agent of the disease. The results showed that some isolates showed indications to inhibit significantly the growth and infection of the pathogen. We obtained at least five isolates of Bacillus collected from leaves, sheath, and stem of healthy rice fields. All of the isolates could effectively inhibit the growth of R. solani in vitro on potato dextrose medium at range 30.33-58.00%, whereas in vivo B05 isolate was the most effective in inhibiting the infection of pathogen at 30.43%. It was not significantly different (P≥0.05) to application of hexaconazol with dosage of 2 ml L-1.

  13. Pathogenicity of Highly Pathogenic Avian Influenza Virus H5N1 in Naturally Infected Poultry in Egypt.

    Directory of Open Access Journals (Sweden)

    Ibrahim Thabet Hagag

    Full Text Available Highly pathogenic avian influenza virus (HPAIV H5N1 has been endemic in Egypt since 2006, and there is increasing concern for its potential to become highly transmissible among humans. Infection by HPAIV H5N1 has been described in experimentally challenged birds. However, the pathogenicity of the H5N1 isolated in Egypt has never been reported in naturally infected chickens and ducks. Here we report a 2013 outbreak of HPAIV H5N1 in commercial poultry farms and backyards in Sharkia Province, Egypt. The main symptoms were ecchymosis on the shanks and feet, cyanosis of the comb and wattles, subcutaneous edema of the head and neck for chickens, and nervous signs (torticollis for ducks. Within 48-72 hrs of the onset of illness, the average mortality rates were 22.8-30% and 28.5-40% in vaccinated chickens and non-vaccinated ducks, respectively. Tissue samples of chickens and ducks were collected for analyses with cross-section immunohistochemistry and real-time RT-PCR for specific viral RNA transcripts. While viral RNA was detected in nearly all tissues and sera collected, viral nucleoprotein was detected almost ubiquitously in all tissues, including testis. Interestingly, viral antigen was also observed in endothelial cells of most organs in chickens, and clearly detected in the trachea and brain in particular. Viral nucleoprotein was also detected in mononuclear cells of various organs, especially pulmonary tissue. We performed phylogenetic analyses and compared the genomic sequences of the hemagglutinin (HA and nonstructural proteins (NS among the isolated viruses, the HPAIV circulated in Egypt in the past and currently, and some available vaccine strains. Further analysis of deduced amino acids of both HA and NS1 revealed that our isolates carried molecular determinants of HPAIV, including the multibasic amino acids (PQGERRRK/KR*GLF in the cleavage site in HA and glutamate at position 92 (D92E in NS1. This is the first report of the pathogenicity

  14. Infectivity, transmission and pathogenicity of avian influenza viruses for domestic and wild birds

    Science.gov (United States)

    Individual avian influenza (AI) virus strains vary in their ability to infect, transmit and cause disease and death in different bird species. Low pathogenicity AI (LPAI) viruses are maintained in wild birds, and must be adapted to pass to domestic poultry, where they replicate in respiratory and in...

  15. Infectivity and pathogenicity of Cryptosporidium andersoni to a novel host, southern multimammate mouse (Mastomys coucha)

    Czech Academy of Sciences Publication Activity Database

    Kváč, Martin; Ondráčková, Z.; Květoňová, Dana; Sak, Bohumil; Vítovec, J.

    2007-01-01

    Roč. 143, 3/4 (2007), s. 229-233 ISSN 0304-4017 R&D Projects: GA ČR GA524/05/0992 Institutional research plan: CEZ:AV0Z60220518 Keywords : Cryptosporidium andersoni * Mastomys coucha * infectivity * pathogenicity * 18S rRNA gene Subject RIV: EG - Zoology Impact factor: 2.016, year: 2007

  16. C. elegans germline-deficient mutants respond to pathogen infection using shared and distinct mechanisms.

    Directory of Open Access Journals (Sweden)

    Michael TeKippe

    2010-07-01

    Full Text Available Reproduction extracts a cost in resources that organisms are then unable to utilize to deal with a multitude of environmental stressors. In the nematode C. elegans, development of the germline shortens the lifespan of the animal and increases its susceptibility to microbial pathogens. Prior studies have demonstrated germline-deficient nematodes to have increased resistance to gram negative bacteria. We show that germline-deficient strains display increased resistance across a broad range of pathogens including gram positive and gram negative bacteria, and the fungal pathogen Cryptococcus neoformans. Furthermore, we show that the FOXO transcription factor DAF-16, which regulates longevity and immunity in C. elegans, appears to be crucial for maintaining longevity in both wild-type and germline-deficient backgrounds. Our studies indicate that germline-deficient mutants glp-1 and glp-4 respond to pathogen infection using common and different mechanisms that involve the activation of DAF-16.

  17. Dissemination of a highly virulent pathogen: tracking the early events that define infection.

    Directory of Open Access Journals (Sweden)

    Rodrigo J Gonzalez

    2015-01-01

    Full Text Available The series of events that occurs immediately after pathogen entrance into the body is largely speculative. Key aspects of these events are pathogen dissemination and pathogen interactions with the immune response as the invader moves into deeper tissues. We sought to define major events that occur early during infection of a highly virulent pathogen. To this end, we tracked early dissemination of Yersinia pestis, a highly pathogenic bacterium that causes bubonic plague in mammals. Specifically, we addressed two fundamental questions: (1 do the bacteria encounter barriers in disseminating to draining lymph nodes (LN, and (2 what mechanism does this nonmotile bacterium use to reach the LN compartment, as the prevailing model predicts trafficking in association with host cells. Infection was followed through microscopy imaging in addition to assessing bacterial population dynamics during dissemination from the skin. We found and characterized an unexpected bottleneck that severely restricts bacterial dissemination to LNs. The bacteria that do not pass through this bottleneck are confined to the skin, where large numbers of neutrophils arrive and efficiently control bacterial proliferation. Notably, bottleneck formation is route dependent, as it is abrogated after subcutaneous inoculation. Using a combination of approaches, including microscopy imaging, we tested the prevailing model of bacterial dissemination from the skin into LNs and found no evidence of involvement of migrating phagocytes in dissemination. Thus, early stages of infection are defined by a bottleneck that restricts bacterial dissemination and by neutrophil-dependent control of bacterial proliferation in the skin. Furthermore, and as opposed to current models, our data indicate an intracellular stage is not required by Y. pestis to disseminate from the skin to draining LNs. Because our findings address events that occur during early encounters of pathogen with the immune response

  18. Epidemiology of pathogen-specific respiratory infections among three US populations.

    Directory of Open Access Journals (Sweden)

    Jennifer M Radin

    Full Text Available Diagnostic tests for respiratory infections can be costly and time-consuming. Improved characterization of specific respiratory pathogens by identifying frequent signs, symptoms and demographic characteristics, along with improving our understanding of coinfection rates and seasonality, may improve treatment and prevention measures.Febrile respiratory illness (FRI and severe acute respiratory infection (SARI surveillance was conducted from October 2011 through March 2013 among three US populations: civilians near the US-Mexico border, Department of Defense (DoD beneficiaries, and military recruits. Clinical and demographic questionnaire data and respiratory swabs were collected from participants, tested by PCR for nine different respiratory pathogens and summarized. Age stratified characteristics of civilians positive for influenza and recruits positive for rhinovirus were compared to other and no/unknown pathogen. Seasonality and coinfection rates were also described.A total of 1444 patients met the FRI or SARI case definition and were enrolled in this study. Influenza signs and symptoms varied across age groups of civilians. Recruits with rhinovirus had higher percentages of pneumonia, cough, shortness of breath, congestion, cough, less fever and longer time to seeking care and were more likely to be male compared to those in the no/unknown pathogen group. Coinfections were found in 6% of all FRI/SARI cases tested and were most frequently seen among children and with rhinovirus infections. Clear seasonal trends were identified for influenza, rhinovirus, and respiratory syncytial virus.The age-stratified clinical characteristics associated with influenza suggest that age-specific case definitions may improve influenza surveillance and identification. Improving identification of rhinoviruses, the most frequent respiratory infection among recruits, may be useful for separating out contagious individuals, especially when larger outbreaks occur

  19. Infections and Coinfections of Questing Ixodes ricinus Ticks by Emerging Zoonotic Pathogens in Western Switzerland

    Science.gov (United States)

    Lommano, Elena; Bertaiola, Luce; Dupasquier, Christèle

    2012-01-01

    In Europe, Ixodes ricinus is the vector of many pathogens of medical and veterinary relevance, among them Borrelia burgdorferi sensu lato and tick-borne encephalitis virus, which have been the subject of numerous investigations. Less is known about the occurrence of emerging tick-borne pathogens like Rickettsia spp., Babesia spp., “Candidatus Neoehrlichia mikurensis,” and Anaplasma phagocytophilum in questing ticks. In this study, questing nymph and adult I. ricinus ticks were collected at 11 sites located in Western Switzerland. A total of 1,476 ticks were analyzed individually for the simultaneous presence of B. burgdorferi sensu lato, Rickettsia spp., Babesia spp., “Candidatus Neoehrlichia mikurensis,” and A. phagocytophilum. B. burgdorferi sensu lato, Rickettsia spp., and “Candidatus Neoehrlichia mikurensis” were detected in ticks at all sites with global prevalences of 22.5%, 10.2%, and 6.4%, respectively. Babesia- and A. phagocytophilum-infected ticks showed a more restricted geographic distribution, and their prevalences were lower (1.9% and 1.5%, respectively). Species rarely reported in Switzerland, like Borrelia spielmanii, Borrelia lusitaniae, and Rickettsia monacensis, were identified. Infections with more than one pathogenic species, involving mostly Borrelia spp. and Rickettsia helvetica, were detected in 19.6% of infected ticks. Globally, 34.2% of ticks were infected with at least one pathogen. The diversity of tick-borne pathogens detected in I. ricinus in this study and the frequency of coinfections underline the need to take them seriously into consideration when evaluating the risks of infection following a tick bite. PMID:22522688

  20. Infectious tenosynovitis with bloodstream infection caused by Erysipelothrix rhusiopathiae, a case report on an occupational pathogen.

    Science.gov (United States)

    Hofseth, Kristine; Dalen, Håvard; Kibsgaard, Leif; Nebb, Solrun; Kümmel, Angela; Mehl, Arne

    2017-01-05

    Erysipelothrix rhusiopathiae is an established animal pathogen, which may cause infections in humans. It is a gram-positive rod and found in the tonsils or the digestive tracts of animals. The bacterium is occupationally related, as usually only people with frequent animal contacts are infected. We report a case of a patient who was admitted with an infectious tenosynovitis with bloodstream infection due to E. rhusiopathiae, and to our knowledge, this is the first report of a tenosynovitis with systemic manifestation associated with this bacterium. A 52-year old Norwegian man, who worked with transportation of swine cadavers, was admitted to the local hospital with sepsis and unknown focus of infection. A few days earlier he had an injury to the skin of one of his fingers that later proved to be infected with E. rhusiopathiae. There were no other causes for his symptoms than the infectious tenosynovitis with systemic manifestation. The infection resolved on treatment with antibiotics and surgery. A transoesophageal echocardiogram was performed to exclude endocarditis, which may be associated with this pathogen. This case report highlights the importance of clinicians being aware of this bacterium, and we describe risk factors for infection, differences in the clinical manifestations of the disease, challenges with diagnosing the bacterium and adverse effects of immunosuppressive drugs. Recommended treatment is appropriate antibiotic therapy and adequate debridement and surgical drainage of the tendon sheath.

  1. A teleost CD46 is involved in the regulation of complement activation and pathogen infection.

    Science.gov (United States)

    Li, Mo-Fei; Sui, Zhi-Hai; Sun, Li

    2017-11-03

    In mammals, CD46 is involved in the inactivation of complement by factor I (FI). In teleost, study on the function of CD46 is very limited. In this study, we examined the immunological property of a CD46 molecule (CsCD46) from tongue sole, a teleost species with important economic value. We found that recombinant CsCD46 (rCsCD46) interacted with FI and inhibited complement activation in an FI-dependent manner. rCsCD46 also interacted with bacterial pathogens via a different mechanism to that responsible for the FI interaction, involving different rCsCD46 sites. Cellular study showed that CsCD46 was expressed on peripheral blood leukocytes (PBL) and protected the cells against the killing effect of complement. When the CsCD46 on PBL was blocked by antibody before incubation of the cells with bacterial pathogens, cellular infection was significantly reduced. Consistently, when tongue sole were infected with bacterial pathogens in the presence of rCsCD46, tissue dissemination and survival of the pathogens were significantly inhibited. These results provide the first evidence to indicate that CD46 in teleosts negatively regulates complement activation via FI and protects host cells from complement-induced damage, and that CD46 is required for optimal bacterial infection probably by serving as a receptor for the bacteria.

  2. Animals devoid of pulmonary system as infection models in the study of lung bacterial pathogens

    Science.gov (United States)

    López Hernández, Yamilé; Yero, Daniel; Pinos-Rodríguez, Juan M.; Gibert, Isidre

    2015-01-01

    Biological disease models can be difficult and costly to develop and use on a routine basis. Particularly, in vivo lung infection models performed to study lung pathologies use to be laborious, demand a great time and commonly are associated with ethical issues. When infections in experimental animals are used, they need to be refined, defined, and validated for their intended purpose. Therefore, alternative and easy to handle models of experimental infections are still needed to test the virulence of bacterial lung pathogens. Because non-mammalian models have less ethical and cost constraints as a subjects for experimentation, in some cases would be appropriated to include these models as valuable tools to explore host–pathogen interactions. Numerous scientific data have been argued to the more extensive use of several kinds of alternative models, such as, the vertebrate zebrafish (Danio rerio), and non-vertebrate insects and nematodes (e.g., Caenorhabditis elegans) in the study of diverse infectious agents that affect humans. Here, we review the use of these vertebrate and non-vertebrate models in the study of bacterial agents, which are considered the principal causes of lung injury. Curiously none of these animals have a respiratory system as in air-breathing vertebrates, where respiration takes place in lungs. Despite this fact, with the present review we sought to provide elements in favor of the use of these alternative animal models of infection to reveal the molecular signatures of host–pathogen interactions. PMID:25699030

  3. Evidence of an increased pathogenic footprint in the lingual microbiome of untreated HIV infected patients

    Directory of Open Access Journals (Sweden)

    Dang Angeline T

    2012-07-01

    Full Text Available Abstract Background Opportunistic oral infections can be found in over 80% of HIV + patients, often causing debilitating lesions that also contribute to deterioration in nutritional health. Although appreciation for the role that the microbiota is likely to play in the initiation and/or enhancement of oral infections has grown considerably in recent years, little is known about the impact of HIV infection on host-microbe interactions within the oral cavity. In the current study, we characterize modulations in the bacterial composition of the lingual microbiome in patients with treated and untreated HIV infection. Bacterial species profiles were elucidated by microarray assay and compared between untreated HIV infected patients, HIV infected patients receiving antiretroviral therapy, and healthy HIV negative controls. The relationship between clinical parameters (viral burden and CD4+ T cell depletion and the loss or gain of bacterial species was evaluated in each HIV patient group. Results In untreated HIV infection, elevated viremia was associated with significantly higher proportions of potentially pathogenic Veillonella, Prevotella, Megasphaera, and Campylobacter species in the lingual microbiome than observed in healthy controls. The upsurge in the prevalence of potential pathogens was juxtaposed by diminished representation of commensal Streptococcus and Veillonella species. Colonization of Neisseria flavescens was lower in the lingual microbiome of HIV infected patients receiving antiretroviral therapy than in uninfected controls. Conclusions Our findings provide novel insights into the potential impact of HIV infection and antiretroviral therapy on the community structure of the oral microbiome, and implicate potential mechanisms that may increase the capacity of non-commensal species to gain a stronger foothold.

  4. Multiplex identification of sepsis-causing Gram-negative pathogens from the plasma of infected blood.

    Science.gov (United States)

    Chung, Boram; Park, Chulmin; Cho, Sung-Yeon; Shin, Juyoun; Shin, Sun; Yim, Seon-Hee; Lee, Dong-Gun; Chung, Yeun-Jung

    2018-02-01

    Early and accurate detection of bacterial pathogens in the blood is the most crucial step for sepsis management. Gram-negative bacteria are the most common organisms causing severe sepsis and responsible for high morbidity and mortality. We aimed to develop a method for rapid multiplex identification of clinically important Gram-negative pathogens and also validated whether our system can identify Gram-negative pathogens with the cell-free plasm DNA from infected blood. We designed five MLPA probe sets targeting the genes specific to major Gram-negative pathogens (uidA and lacY for E. coli, ompA for A. baumannii, phoE for K. pneumoniae, and ecfX for P. aeruginosa) and one set targeting the CTX-M group 1 to identify the ESBL producing Gram-negative pathogens. All six target-specific peaks were clearly separated without any non-specific peaks in a multiplex reaction condition. The minimum detection limit was 100 fg of pathogen DNA. When we tested 28 Gram-negative clinical isolates, all of them were successfully identified without any non-specific peaks. To evaluate the clinical applicability, we tested seven blood samples from febrile patients. Three blood culture positive cases showed E. coli specific peaks, while no peak was detected in the other four culture negative samples. This technology can be useful for detection of major sepsis-causing, drug-resistant Gram-negative pathogens and also the major ESBL producing Gram-negatives from the blood of sepsis patients in a clinical setting. This system can help early initiation of effective antimicrobial treatment against Gram-negative pathogens for sepsis patients, which is very crucial for better treatment outcomes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Genes expressed in grapevine leaves reveal latent wood infection by the fungal pathogen Neofusicoccum parvum.

    Directory of Open Access Journals (Sweden)

    Stefan Czemmel

    Full Text Available Some pathogenic species of the Botryosphaeriaceae have a latent phase, colonizing woody tissues while perennial hosts show no apparent symptoms until conditions for disease development become favorable. Detection of these pathogens is often limited to the later pathogenic phase. The latent phase is poorly characterized, despite the need for non-destructive detection tools and effective quarantine strategies, which would benefit from identification of host-based markers in leaves. Neofusicoccum parvum infects the wood of grapevines and other horticultural crops, killing the fruit-bearing shoots. We used light microscopy and high-resolution computed tomography (HRCT to examine the spatio-temporal relationship between pathogen colonization and anatomical changes in stem sections. To identify differentially-expressed grape genes, leaves from inoculated and non-inoculated plants were examined using RNA-Seq. The latent phase occurred between 0 and 1.5 months post-inoculation (MPI, during which time the pathogen did not spread significantly beyond the inoculation site nor were there differences in lesion lengths between inoculated and non-inoculated plants. The pathogenic phase occurred between 1.5 and 2 MPI, when recovery beyond the inoculation site increased and lesion lengths of inoculated plants tripled. By 2 MPI, inoculated plants also had decreased starch content in xylem fibers and rays, and increased levels of gel-occluded xylem vessels, the latter of which HRCT revealed at a higher frequency than microscopy. RNA-Seq and screening of 21 grape expression datasets identified 20 candidate genes that were transcriptionally-activated by infection during the latent phase, and confirmed that the four best candidates (galactinol synthase, abscisic acid-induced wheat plasma membrane polypeptide-19 ortholog, embryonic cell protein 63, BURP domain-containing protein were not affected by a range of common foliar and wood pathogens or abiotic stresses

  6. Development of a chick bioassay for determination of infectivity of viral pathogens in poultry litter.

    Science.gov (United States)

    Islam, A F M F; Walkden-Brown, S W; Groves, P J; Wells, B

    2013-01-01

    To develop a chicken bioassay to detect infective viral pathogens in poultry litter and to determine the effects of type of chicken and age of exposure, as well as the effect of simulated litter transportation, on the level of viral infectivity detected. A 5 × 2 × 2 factorial design, plus negative controls. Five chicken litters, including two with deliberate contamination (one transported and one not), two chicken types (specific-pathogen-free (SPF) Leghorns and Cobb broilers) and two ages at initial exposure (days 1 and 8). Two replicates of each treatment combination. The 10 chickens in each of 22 isolators were either exposed (20 isolators) or not (2 isolators) to 8 L of previously used or deliberately contaminated poultry litter in two deep scratch trays. At day 35 post-exposure, sera were assayed for antibodies against chicken anaemia virus (CAV), infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV), Newcastle disease virus (NDV) and fowl adenovirus (FAV). Spleen samples were tested for Marek's disease virus (MDV) using real-time polymerase chain reaction. The bioassay detected CAV, IBDV and FAV, but not NDV, IBV or MDV, in chickens exposed to infected litters. Infection in SPF chickens was detected with greater sensitivity than in the broiler chickens. Sensitivity increased with age at exposure in broiler but not SPF chickens. Simulated transportation for 24 h had little effect on pathogen detection. A bioassay based on the exposure of day-old SPF chickens to poultry litter and measurement of seroconversion at day 35 post-exposure is a useful semi-quantitative assay for viral infectivity in poultry litter, with overnight transportation of litter having little effect on the level of viral infectivity detected. This bioassay has applications in research on litter treatment protocols. © 2013 The Authors. Australian Veterinary Journal © 2013 Australian Veterinary Association.

  7. Stress exacerbates infectivity and pathogenicity of Blastocystis hominis: in vitro and in vivo evidences.

    Directory of Open Access Journals (Sweden)

    Samudi Chandramathi

    Full Text Available BACKGROUND: Stress alters the oxidant-antioxidant state and immune cell responses which disrupts its function to combat infection. Blastocystis hominis, a common intestinal protozoan has been reported to be opportunistic in immunocompromised patients namely cancer. B. hominis infectivity in other altered immune system conditions especially stress is unknown. We aimed to demonstrate the stress effects towards the susceptibility and pathogenicity of B. hominis infection. METHODS/FINDINGS: Three-week-old Wistar rats were divided into four groups: (acontrol; (bstress-induced; (cB. hominis infected; (dstress-induced with B. hominis infection; (n = 20 respectively. Stress was induced for an hour daily (30 days using a Belly Dancer Shaker. Weight gain was monitored, stool samples were collected for B. hominis screening and blood for the determination of differential count, levels of immunoglobulin, oxidative damage, and peripheral blood mononuclear cell (PBMC proliferation upon induction with solubilized antigen of B. hominis (Blasto-Ag. Group (b exhibited the highest level of weight gain. Group (d had higher levels of parasite cyst count in stools, serum IgE, oxidized protein and lipid compared to the group (c. Levels of monocyte and antioxidant in group (d were decreased and their PBMCs showed highest inhibition of proliferation level when exposed to Blasto-Ag. Monocyte level in Group (b showed insignificant difference compared to group (a but was significantly lower compared to group (c. Antioxidant levels in group (c were generally lower compared to group (a and (b. Inhibition level exhibited by Blasto-Ag treated PBMCs of group (c was higher compared to group (a and (b. CONCLUSION: The pathogenicity and augmentation of B. hominis infection is enhanced when stress is present. Lifestyles today are becoming increasingly stressed and the present findings suggest that the parasite which has been reported to be one of the most common organisms seen in

  8. Three pathogens in sympatric populations of pumas, bobcats, and domestic cats: Implications for infections disease transmission

    Science.gov (United States)

    Bevins, Sarah N.; Carver, Scott; Boydston, Erin E.; Lyren, Lisa M.; Alldredge, Mat; Logan, Kenneth A.; Riley, Seth P.D.; Fisher, Robert N.; Vickers, T. Winston; Boyce, Walter; Salman, Mo; Lappin, Michael R.; Crooks, Kevin R.; VandeWoude, Sue

    2012-01-01

    Anthropogenic landscape change can lead to increased opportunities for pathogen transmission between domestic and non-domestic animals. Pumas, bobcats, and domestic cats are sympatric in many areas of North America and share many of the same pathogens, some of which are zoonotic. We analyzed bobcat, puma, and feral domestic cat samples collected from targeted geographic areas. We examined exposure to three pathogens that are taxonomically diverse (bacterial, protozoal, viral), that incorporate multiple transmission strategies (vector-borne, environmental exposure/ingestion, and direct contact), and that vary in species-specificity. Bartonella spp., Feline Immunodeficiency Virus (FIV), and Toxoplasma gondii IgG were detected in all three species with mean respective prevalence as follows: puma 16%, 41% and 75%; bobcat 31%, 22% and 43%; domestic cat 45%, 10% and 1%. Bartonella spp. were highly prevalent among domestic cats in Southern California compared to other cohort groups. Feline Immunodeficiency Virus exposure was primarily associated with species and age, and was not influenced by geographic location. Pumas were more likely to be infected with FIV than bobcats, with domestic cats having the lowest infection rate. Toxoplasma gondii seroprevalence was high in both pumas and bobcats across all sites; in contrast, few domestic cats were seropositive, despite the fact that feral, free ranging domestic cats were targeted in this study. Interestingly, a directly transmitted species-specific disease (FIV) was not associated with geographic location, while exposure to indirectly transmitted diseases – vector-borne for Bartonella spp. and ingestion of oocysts via infected prey or environmental exposure for T. gondii – varied significantly by site. Pathogens transmitted by direct contact may be more dependent upon individual behaviors and intra-specific encounters. Future studies will integrate host density, as well as landscape features, to better

  9. Hampered foraging and migratory performance in swans infected with low-pathogenic avian influenza A virus.

    Directory of Open Access Journals (Sweden)

    Jan A van Gils

    Full Text Available It is increasingly acknowledged that migratory birds, notably waterfowl, play a critical role in the maintenance and spread of influenza A viruses. In order to elucidate the epidemiology of influenza A viruses in their natural hosts, a better understanding of the pathological effects in these hosts is required. Here we report on the feeding and migratory performance of wild migratory Bewick's swans (Cygnus columbianus bewickii Yarrell naturally infected with low-pathogenic avian influenza (LPAI A viruses of subtypes H6N2 and H6N8. Using information on geolocation data collected from Global Positioning Systems fitted to neck-collars, we show that infected swans experienced delayed migration, leaving their wintering site more than a month after uninfected animals. This was correlated with infected birds travelling shorter distances and fuelling and feeding at reduced rates. The data suggest that LPAI virus infections in wild migratory birds may have higher clinical and ecological impacts than previously recognised.

  10. Zoonotic pathogens in Atlantic Forest wild rodents in Brazil: Bartonella and Coxiella infections.

    Science.gov (United States)

    Rozental, Tatiana; Ferreira, Michelle Santos; Guterres, Alexandro; Mares-Guia, Maria Angélica; Teixeira, Bernardo R; Gonçalves, Jonathan; Bonvicino, Cibele Rodrigues; D'Andrea, Paulo Sergio; de Lemos, Elba Regina Sampaio

    2017-04-01

    Zoonotic pathogens comprise a significant and increasing fraction of all emerging and re-emerging infectious diseases that plague humans. Identifying host species is one of the keys to controlling emerging infectious diseases. From March 2007 until April 2012, we collected a total of 131 wild rodents in eight municipalities of Rio de Janeiro, Brazil. We investigated these rodents for infection with Coxiella burnetii, Bartonella spp. and Rickettsia spp. In total, 22.1% (29/131) of the rodents were infected by at least one pathogen; co-infection was detected in 1.5% (2/131) of rodents. Coxiella burnetii was detected in 4.6% (6/131) of the wild animals, 17.6% of the rodents harbored Bartonella spp. No cases of Rickettsia were identified. Bartonella doshiae and Bartonella vinsonii were the species found on the wild mammals. This report is the first to note C. burnetii, B. doshiae and B. vinsonii natural infections in Atlantic Forest wild rodents in Brazil. Our work highlights the potential risk of transmission to humans, since most of the infected specimens belong to generalist species that live near human dwellings. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Senescence as a Factor in Latent Pathogen Infection in Eurasian Watermilfoil

    Science.gov (United States)

    2009-09-01

    organisms that colonize plant tissues at some time in their life without causing harm to their host (Petrini 1991). They include micro - organisms...declines including nutrient depletion, shading by phytoplankton and algae , attack by parasites and pathogens, long-term effects of harvesting and/or...Center (ERDC), Environmental Laboratory, Vicksburg, MS. Endophyte-infected plants were collected from a culture pond at the Lewisville Aquatic

  12. A Novel Prosthetic Joint Infection Pathogen, Mycoplasma salivarium, Identified by Metagenomic Shotgun Sequencing.

    Science.gov (United States)

    Thoendel, Matthew; Jeraldo, Patricio; Greenwood-Quaintance, Kerryl E; Chia, Nicholas; Abdel, Matthew P; Steckelberg, James M; Osmon, Douglas R; Patel, Robin

    2017-07-15

    Defining the microbial etiology of culture-negative prosthetic joint infection (PJI) can be challenging. Metagenomic shotgun sequencing is a new tool to identify organisms undetected by conventional methods. We present a case where metagenomics was used to identify Mycoplasma salivarium as a novel PJI pathogen in a patient with hypogammaglobulinemia. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  13. The Bacterial Pathogen Xylella fastidiosa Affects the Leaf Ionome of Plant Hosts during Infection

    Science.gov (United States)

    De La Fuente, Leonardo; Parker, Jennifer K.; Oliver, Jonathan E.; Granger, Shea; Brannen, Phillip M.; van Santen, Edzard; Cobine, Paul A.

    2013-01-01

    Xylella fastidiosa is a plant pathogenic bacterium that lives inside the host xylem vessels, where it forms biofilm believed to be responsible for disrupting the passage of water and nutrients. Here, Nicotiana tabacum was infected with X. fastidiosa, and the spatial and temporal changes in the whole-leaf ionome (i.e. the mineral and trace element composition) were measured as the host plant transitioned from healthy to diseased physiological status. The elemental composition of leaves was used as an indicator of the physiological changes in the host at a specific time and relative position during plant development. Bacterial infection was found to cause significant increases in concentrations of calcium prior to the appearance of symptoms and decreases in concentrations of phosphorous after symptoms appeared. Field-collected leaves from multiple varieties of grape, blueberry, and pecan plants grown in different locations over a four-year period in the Southeastern US showed the same alterations in Ca and P. This descriptive ionomics approach characterizes the existence of a mineral element-based response to X. fastidiosa using a model system suitable for further manipulation to uncover additional details of the role of mineral elements during plant-pathogen interactions. This is the first report on the dynamics of changes in the ionome of the host plant throughout the process of infection by a pathogen. PMID:23667547

  14. Increased TLR4 expression in murine placentas after oral infection with periodontal pathogens

    Science.gov (United States)

    Arce, R.M.; Barros, S.P.; Wacker, B.; Peters, B.; Moss, K.; Offenbacher, S.

    2009-01-01

    Maternal periodontitis has emerged as a putative risk factor for preterm births in humans. The periodontitis-associated dental biofilm is thought to serve as an important source of oral bacteria and related virulence factors that hematogenously disseminate and affect the fetoplacental unit; however the underlying biological mechanisms are yet to be fully elucidated. This study hypothesized that an oral infection with the human periodontal pathogens Campylobacter rectus and Porphyromonas gingivalis is able to induce fetal growth restriction, placental inflammation and enhance Toll-like receptors type 4 (TLR4) expression in a murine pregnancy model. Female Balb/C mice (n=40) were orally infected with C. rectus and/or P. gingivalis over a 16-week period and mated once per week. Pregnant mice were sacrificed at embryonic day (E) 16.5 and placentas were collected and analyzed for TLR4 mRNA levels and qualitative protein expression by real time PCR and immunofluorescence. TLR4 mRNA expression was found to be increased in C. rectus-infected group (1.98±0.886 fold difference, Pperiodontal pathogens. The TLR4 pathway has been implicated in the pathogenesis of preterm births; therefore the abnormal regulation of placental TLR4 may give new insights into how maternal periodontitis and periodontal pathogens might be linked to placental inflammation and preterm birth pathogenesis. PMID:19101032

  15. The bacterial pathogen Xylella fastidiosa affects the leaf ionome of plant hosts during infection.

    Directory of Open Access Journals (Sweden)

    Leonardo De La Fuente

    Full Text Available Xylella fastidiosa is a plant pathogenic bacterium that lives inside the host xylem vessels, where it forms biofilm believed to be responsible for disrupting the passage of water and nutrients. Here, Nicotiana tabacum was infected with X. fastidiosa, and the spatial and temporal changes in the whole-leaf ionome (i.e. the mineral and trace element composition were measured as the host plant transitioned from healthy to diseased physiological status. The elemental composition of leaves was used as an indicator of the physiological changes in the host at a specific time and relative position during plant development. Bacterial infection was found to cause significant increases in concentrations of calcium prior to the appearance of symptoms and decreases in concentrations of phosphorous after symptoms appeared. Field-collected leaves from multiple varieties of grape, blueberry, and pecan plants grown in different locations over a four-year period in the Southeastern US showed the same alterations in Ca and P. This descriptive ionomics approach characterizes the existence of a mineral element-based response to X. fastidiosa using a model system suitable for further manipulation to uncover additional details of the role of mineral elements during plant-pathogen interactions. This is the first report on the dynamics of changes in the ionome of the host plant throughout the process of infection by a pathogen.

  16. Recent insights into host-pathogen interaction in white spot syndrome virus infected penaeid shrimp.

    Science.gov (United States)

    Shekhar, M S; Ponniah, A G

    2015-07-01

    Viral disease outbreaks are a major concern impeding the development of the shrimp aquaculture industry. The viral disease due to white spot syndrome virus (WSSV) observed in early 1990s still continues unabated affecting the shrimp farms and cause huge economic loss to the shrimp aquaculture industry. In the absence of effective therapeutics to control WSSV, it is important to understand viral pathogenesis and shrimp response to WSSV at the molecular level. Identification and molecular characterization of WSSV proteins and receptors may facilitate in designing and development of novel therapeutics and antiviral drugs that may inhibit viral replication. Investigations into host-pathogen interactions might give new insights to viral infectivity, tissue tropism and defence mechanism elicited in response to WSSV infection. However, due to the limited information on WSSV gene function and host immune response, the signalling pathways which are associated in shrimp pathogen interaction have also not been elucidated completely. In the present review, the focus is on those shrimp proteins and receptors that are potentially involved in virus infection or in the defence mechanism against WSSV. In addition, the major signalling pathways involved in the innate immune response and the role of apoptosis in host-pathogen interaction is discussed. © 2014 John Wiley & Sons Ltd.

  17. Predictors of Antimicrobial Resistance among Pathogens Causing Urinary Tract Infection in Children.

    Science.gov (United States)

    Shaikh, Nader; Hoberman, Alejandro; Keren, Ron; Ivanova, Anastasia; Gotman, Nathan; Chesney, Russell W; Carpenter, Myra A; Moxey-Mims, Marva; Wald, Ellen R

    2016-04-01

    To determine which children with urinary tract infection are likely to have pathogens resistant to narrow-spectrum antimicrobials. Children, 2-71 months of age (n = 769) enrolled in the Randomized Intervention for Children with Vesicoureteral Reflux or Careful Urinary Tract Infection Evaluation studies were included. We used logistic regression models to test the associations between demographic and clinical characteristics and resistance to narrow-spectrum antimicrobials. Of the included patients, 91% were female and 76% had vesicoureteral reflux. The risk of resistance to narrow-spectrum antibiotics in uncircumcised males was approximately 3 times that of females (OR 3.1; 95% CI 1.4-6.7); in children with bladder bowel dysfunction, the risk was 2 times that of children with normal function (OR 2.2; 95% CI 1.2-4.1). Children who had received 1 course of antibiotics during the past 6 months also had higher odds of harboring resistant organisms (OR 1.6; 95% CI 1.1-2.3). Hispanic children had higher odds of harboring pathogens resistant to some narrow-spectrum antimicrobials. Uncircumcised males, Hispanic children, children with bladder bowel dysfunction, and children who received 1 course of antibiotics in the past 6 months were more likely to have a urinary tract infection caused by pathogens resistant to 1 or more narrow-spectrum antimicrobials. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Thymus transcriptome reveals novel pathways in response to avian pathogenic Escherichia coli infection.

    Science.gov (United States)

    Sun, H; Liu, P; Nolan, L K; Lamont, S J

    2016-12-01

    Avian pathogenic Escherichia coli (APEC) can cause significant morbidity in chickens. The thymus provides the essential environment for T cell development; however, the thymus transcriptome has not been examined for gene expression in response to APEC infection. An improved understanding of the host genomic response to APEC infection could inform future breeding programs for disease resistance and APEC control. We therefore analyzed the transcriptome of the thymus of birds challenged with APEC, contrasting susceptible and resistant phenotypes. Thousands of genes were differentially expressed in birds of the 5-day post infection (dpi) challenged-susceptible group vs. 5 dpi non-challenged, in 5 dpi challenged-susceptible vs. 5 dpi challenged-resistant birds, as well as in 5 dpi vs. one dpi challenged-susceptible birds. The Toll-like receptor signaling pathway was the major innate immune response for birds to respond to APEC infection. Moreover, lysosome and cell adhesion molecules pathways were common mechanisms for chicken response to APEC infection. The T-cell receptor signaling pathway, cell cycle, and p53 signaling pathways were significantly activated in resistant birds to resist APEC infection. These results provide a comprehensive assessment of global gene networks and biological functionalities of differentially expressed genes in the thymus under APEC infection. These findings provide novel insights into key molecular genetic mechanisms that differentiate host resistance from susceptibility in this primary lymphoid tissue, the thymus. © The Author 2016. Published by Oxford University Press on behalf of Poultry Science Association.

  19. Activation of type III interferon genes by pathogenic bacteria in infected epithelial cells and mouse placenta.

    Directory of Open Access Journals (Sweden)

    Hélène Bierne

    Full Text Available Bacterial infections trigger the expression of type I and II interferon genes but little is known about their effect on type III interferon (IFN-λ genes, whose products play important roles in epithelial innate immunity against viruses. Here, we studied the expression of IFN-λ genes in cultured human epithelial cells infected with different pathogenic bacteria and in the mouse placenta infected with Listeria monocytogenes. We first showed that in intestinal LoVo cells, induction of IFN-λ genes by L. monocytogenes required bacterial entry and increased further during the bacterial intracellular phase of infection. Other Gram-positive bacteria, Staphylococcus aureus, Staphylococcus epidermidis and Enterococcus faecalis, also induced IFN-λ genes when internalized by LoVo cells. In contrast, Gram-negative bacteria Salmonella enterica serovar Typhimurium, Shigella flexneri and Chlamydia trachomatis did not substantially induce IFN-λ. We also found that IFN-λ genes were up-regulated in A549 lung epithelial cells infected with Mycobacterium tuberculosis and in HepG2 hepatocytes and BeWo trophoblastic cells infected with L. monocytogenes. In a humanized mouse line permissive to fetoplacental listeriosis, IFN-λ2/λ3 mRNA levels were enhanced in placentas infected with L. monocytogenes. In addition, the feto-placental tissue was responsive to IFN-λ2. Together, these results suggest that IFN-λ may be an important modulator of the immune response to Gram-positive intracellular bacteria in epithelial tissues.

  20. Oral and dental infections with anaerobic bacteria: clinical features, predominant pathogens, and treatment.

    Science.gov (United States)

    Tanner, A; Stillman, N

    1993-06-01

    Microbial populations colonizing the teeth are a major source of pathogens responsible for oral and dental infections, including periodontal diseases, gingivitis, pericoronitis, endodontitis, peri-implantitis, and postextraction infections. Each entity has distinct clinical and microbial features. Bacterial species associated with oral infections include Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Bacteroides forsythus, Campylobacter rectus, Eubacterium species, Fusobacterium nucleatum, Eikenella corrodens, and Peptostreptococcus micros. Treponema pallidum-related spirochetes have been associated with acute necrotizing ulcerative gingivitis. Porphyromonas endodontalis appears to be specifically related to endodontic infections. Oral infections in medically compromised patients, including those with AIDS, are associated with similar species and are usually complicated by superinfection with enteric and Candida species. Isolation of species causing oral infections requires the collection of appropriate samples and the use of strictly anaerobic techniques. Rapid selective culture, immunofluorescence, and DNA probe methods have been developed for the identification of these oral species. The varied measures required in the management of oral and dental infections may include antimicrobial therapy. Accurate microbiological diagnosis, including antibiotic susceptibility testing, is indicated for cases that do not respond to therapy.

  1. Effect of low-pathogenicity influenza virus H3N8 infection on Mycoplasma gallisepticum infection of chickens.

    Science.gov (United States)

    Stipkovits, Laszlo; Egyed, Laszlo; Palfi, Vilmos; Beres, Andrea; Pitlik, Ervin; Somogyi, Maria; Szathmary, Susan; Denes, Bela

    2012-01-01

    Mycoplasma infection is still very common in chicken and turkey flocks. Several low-pathogenicity avian influenza (LPAI) viruses are circulating in wild birds that can be easily transmitted to poultry flocks. However, the effect of LPAI on mycoplasma infection is not well understood. The aim of the present study was to investigate the infection of LPAI virus H3N8 (A/mallard/Hungary/19616/07) in chickens challenged with Mycoplasma gallisepticum. Two groups of chickens were aerosol challenged with M. gallisepticum. Later one of these groups and one mycoplasma-free group were aerosol challenged with the LPAI H3N8 virus. The birds were observed for clinical signs for 8 days, then euthanized, and examined for the presence of M. gallisepticum in the trachea, lung, air sac, liver, spleen, kidney and heart, and for developing anti-mycoplasma and anti-viral antibodies. The LPAI H3N8 virus did not cause any clinical signs but M. gallisepticum infection caused clinical signs, reduction of body weight gain and colonization of the inner organs. These parameters were more severe in the birds co-infected with M. gallisepticum and LPAI H3N8 virus than in the group challenged with M. gallisepticum alone. In addition, in the birds infected with both M. gallisepticum and LPAI H3N8 virus, the anti-mycoplasma antibody response was reduced significantly when compared with the group challenged with M. gallisepticum alone. Co-infection with LPAI H3N8 virus thus enhanced pathogenesis of M. gallisepticum infection significantly.

  2. Chytrid fungus acts as a generalist pathogen infecting species-rich amphibian families in Brazilian rainforests.

    Science.gov (United States)

    Valencia-Aguilar, Anyelet; Ruano-Fajardo, Gustavo; Lambertini, Carolina; da Silva Leite, Domingos; Toledo, Luís Felipe; Mott, Tamí

    2015-05-11

    The fungus Batrachochytrium dendrobatidis (Bd) is among the main causes of declines in amphibian populations. This fungus is considered a generalist pathogen because it infects several species and spreads rapidly in the wild. To date, Bd has been detected in more than 100 anuran species in Brazil, mostly in the southern portion of the Atlantic forest. Here, we report survey data from some poorly explored regions; these data considerably extend current information on the distribution of Bd in the northern Atlantic forest region. In addition, we tested the hypothesis that Bd is a generalist pathogen in this biome. We also report the first positive record for Bd in an anuran caught in the wild in Amazonia. In total, we screened 90 individuals (from 27 species), of which 39 individuals (from 22 species) were Bd-positive. All samples collected in Bahia (2 individuals), Pernambuco (3 individuals), Pará (1 individual), and Minas Gerais (1 individual) showed positive results for Bd. We found a positive correlation between anuran richness per family and the number of infected species in the Atlantic forest, supporting previous observations that Bd lacks strong host specificity; of 38% of the anuran species in the Atlantic forest that were tested for Bd infection, 25% showed positive results. The results of our study exemplify the pandemic and widespread nature of Bd infection in amphibians.

  3. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens

    Directory of Open Access Journals (Sweden)

    Md. Zaherul Islam

    2016-08-01

    Full Text Available Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585, VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132 showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674 were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.

  4. Early immune response patterns to pathogenic bacteria are associated to increased risk of lower respiratory infections in children

    DEFF Research Database (Denmark)

    Vissing, N. H.; Larsen, Jeppe Madura; Rasmussen, Mette Annelie

    2014-01-01

    Neonatal colonisation of the airways with respiratory pathogens is associated with increased risk of lower respiratory infections (LRI) in early childhood (1). Therefore, we hypothesized that children developing LRI have an abnormal immune response to pathogenic bacteria in infancy. We aimed...... to characterise the systemic immune response to pathogenic bacteria at the age of 6 months and study the association with incidence of LRI during the first 3 years of life....

  5. Experimental infection of macaques with a wild water bird-derived highly pathogenic avian influenza virus (H5N1.

    Directory of Open Access Journals (Sweden)

    Tomoko Fujiyuki

    Full Text Available Highly pathogenic avian influenza virus (HPAIV continues to threaten human health. Non-human primate infection models of human influenza are desired. To establish an animal infection model with more natural transmission and to determine the pathogenicity of HPAIV isolated from a wild water bird in primates, we administered a Japanese isolate of HPAIV (A/whooper swan/Hokkaido/1/2008, H5N1 clade 2.3.2.1 to rhesus and cynomolgus monkeys, in droplet form, via the intratracheal route. Infection of the lower and upper respiratory tracts and viral shedding were observed in both macaques. Inoculation of rhesus monkeys with higher doses of the isolate resulted in stronger clinical symptoms of influenza. Our results demonstrate that HPAIV isolated from a water bird in Japan is pathogenic in monkeys by experimental inoculation, and provide a new method for HPAIV infection of non-human primate hosts, a good animal model for investigation of HPAIV pathogenicity.

  6. Brain transcriptomes of honey bees (Apis mellifera experimentally infected by two pathogens: Black queen cell virus and Nosema ceranae

    Directory of Open Access Journals (Sweden)

    Vincent Doublet

    2016-12-01

    Full Text Available Regulation of gene expression in the brain plays an important role in behavioral plasticity and decision making in response to external stimuli. However, both can be severely affected by environmental factors, such as parasites and pathogens. In honey bees, the emergence and re-emergence of pathogens and potential for pathogen co-infection and interaction have been suggested as major components that significantly impaired social behavior and survival. To understand how the honey bee is affected and responds to interacting pathogens, we co-infected workers with two prevalent pathogens of different nature, the positive single strand RNA virus Black queen cell virus (BQCV, and the Microsporidia Nosema ceranae, and explored gene expression changes in brains upon single infections and co-infections. Our data provide an important resource for research on honey bee diseases, and more generally on insect host-pathogen and pathogen-pathogen interactions. Raw and processed data are publicly available in the NCBI/GEO database: (http://www.ncbi.nlm.nih.gov/geo/ under accession number GSE81664.

  7. Pathogen group specific risk factors at herd, heifer and quarter levels for intramammary infections in early lactating dairy heifers

    NARCIS (Netherlands)

    Piepers, S.; Peeters, K.; Opsomer, G.; Barkema, H.W.; Frankena, K.; Vliegher, de S.

    2011-01-01

    Risk factors for intramammary infections caused by coagulase-negative staphylococci, contagious major pathogens and environmental major pathogens in early lactating heifers were evaluated at the herd, heifer and quarter levels. In total, 764 quarters of 191 dairy heifers in 20 randomly selected

  8. Panax ginseng has anti-infective activity against opportunistic pathogen Pseudomonas aeruginosa by inhibiting quorum sensing, a bacterial communication process critical for establishing infection

    DEFF Research Database (Denmark)

    Song, Z; Kong, K F; Wu, H

    2010-01-01

    Virulent factors produced by pathogens play an important role in the infectious process, which is regulated by a cell-to-cell communication mechanism called quorum sensing (QS). Pseudomonas aeruginosa is an important opportunistic human pathogen, which causes infections in patients with compromis...

  9. The nonstructural proteins of Nipah virus play a key role in pathogenicity in experimentally infected animals.

    Directory of Open Access Journals (Sweden)

    Misako Yoneda

    Full Text Available Nipah virus (NiV P gene encodes P protein and three accessory proteins (V, C and W. It has been reported that all four P gene products have IFN antagonist activity when the proteins were transiently expressed. However, the role of those accessory proteins in natural infection with NiV remains unknown. We generated recombinant NiVs lacking V, C or W protein, rNiV(V-, rNiV(C-, and rNiV(W-, respectively, to analyze the functions of these proteins in infected cells and the implications in in vivo pathogenicity. All the recombinants grew well in cell culture, although the maximum titers of rNiV(V- and rNiV(C- were lower than the other recombinants. The rNiV(V-, rNiV(C- and rNiV(W- suppressed the IFN response as well as the parental rNiV, thereby indicating that the lack of each accessory protein does not significantly affect the inhibition of IFN signaling in infected cells. In experimentally infected golden hamsters, rNiV(V- and rNiV(C- but not the rNiV(W- virus showed a significant reduction in virulence. These results suggest that V and C proteins play key roles in NiV pathogenicity, and the roles are independent of their IFN-antagonist activity. This is the first report that identifies the molecular determinants of NiV in pathogenicity in vivo.

  10. Metabolic investigation of host/pathogen interaction using MS2-infected Escherichia coli

    Directory of Open Access Journals (Sweden)

    Jain Rishi

    2009-12-01

    Full Text Available Abstract Background RNA viruses are responsible for a variety of illnesses among people, including but not limited to the common cold, the flu, HIV, and ebola. Developing new drugs and new strategies for treating diseases caused by these viruses can be an expensive and time-consuming process. Mathematical modeling may be used to elucidate host-pathogen interactions and highlight potential targets for drug development, as well providing the basis for optimizing patient treatment strategies. The purpose of this work was to determine whether a genome-scale modeling approach could be used to understand how metabolism is impacted by the host-pathogen interaction during a viral infection. Escherichia coli/MS2 was used as the host-pathogen model system as MS2 is easy to work with, harmless to humans, but shares many features with eukaryotic viruses. In addition, the genome-scale metabolic model of E. coli is the most comprehensive model at this time. Results Employing a metabolic modeling strategy known as "flux balance analysis" coupled with experimental studies, we were able to predict how viral infection would alter bacterial metabolism. Based on our simulations, we predicted that cell growth and biosynthesis of the cell wall would be halted. Furthermore, we predicted a substantial increase in metabolic activity of the pentose phosphate pathway as a means to enhance viral biosynthesis, while a break down in the citric acid cycle was predicted. Also, no changes were predicted in the glycolytic pathway. Conclusions Through our approach, we have developed a technique of modeling virus-infected host metabolism and have investigated the metabolic effects of viral infection. These studies may provide insight into how to design better drugs. They also illustrate the potential of extending such metabolic analysis to higher order organisms, including humans.

  11. Anaplasma phagocytophilum MSP4 and HSP70 Proteins Are Involved in Interactions with Host Cells during Pathogen Infection

    Directory of Open Access Journals (Sweden)

    Marinela Contreras

    2017-07-01

    Full Text Available Anaplasma phagocytophilum transmembrane and surface proteins play a role during infection and multiplication in host neutrophils and tick vector cells. Recently, A. phagocytophilum Major surface protein 4 (MSP4 and Heat shock protein 70 (HSP70 were shown to be localized on the bacterial membrane, with a possible role during pathogen infection in ticks. In this study, we hypothesized that A. phagocytophilum MSP4 and HSP70 have similar functions in tick-pathogen and host-pathogen interactions. To address this hypothesis, herein we characterized the role of these bacterial proteins in interaction and infection of vertebrate host cells. The results showed that A. phagocytophilum MSP4 and HSP70 are involved in host-pathogen interactions, with a role for HSP70 during pathogen infection. The analysis of the potential protective capacity of MSP4 and MSP4-HSP70 antigens in immunized sheep showed that MSP4-HSP70 was only partially protective against pathogen infection. This limited protection may be associated with several factors, including the recognition of non-protective epitopes by IgG in immunized lambs. Nevertheless, these antigens may be combined with other candidate protective antigens for the development of vaccines for the control of human and animal granulocytic anaplasmosis. Focusing on the characterization of host protective immune mechanisms and protein-protein interactions at the host-pathogen interface may lead to the discovery and design of new effective protective antigens.

  12. Experimental infection of highly pathogenic avian influenza virus H5N1 in black-headed gulls (Chroicocephalus ridibundus)

    OpenAIRE

    Ramis , Antonio; van Amerongen , Geert; van de Bildt , Marco; Leijten , Loneke; Vanderstichel , Raphael; Osterhaus , Albert; Kuiken , Thijs

    2014-01-01

    Historically, highly pathogenic avian influenza viruses (HPAIV) rarely resulted in infection or clinical disease in wild birds. However, since 2002, disease and mortality from natural HPAIV H5N1 infection have been observed in wild birds including gulls. We performed an experimental HPAIV H5N1 infection of black-headed gulls (Chroicocephalus ridibundus) to determine their susceptibility to infection and disease from this virus, pattern of viral shedding, clinical signs, pathological changes a...

  13. Immunomodulatory role for membrane vesicles released by THP-1 macrophages and respiratory pathogens during macrophage infection.

    Science.gov (United States)

    Volgers, Charlotte; Benedikter, Birke J; Grauls, Gert E; Savelkoul, Paul H M; Stassen, Frank R M

    2017-11-13

    During infection, inflammation is partially driven by the release of mediators which facilitate intercellular communication. Amongst these mediators are small membrane vesicles (MVs) that can be released by both host cells and Gram-negative and -positive bacteria. Bacterial membrane vesicles are known to exert immuno-modulatory and -stimulatory actions. Moreover, it has been proposed that host cell-derived vesicles, released during infection, also have immunostimulatory properties. In this study, we assessed the release and activity of host cell-derived and bacterial MVs during the first hours following infection of THP-1 macrophages with the common respiratory pathogens non-typeable Haemophilus influenzae, Moraxella catarrhalis, Streptococcus pneumoniae, and Pseudomonas aeruginosa. Using a combination of flow cytometry, tunable resistive pulse sensing (TRPS)-based analysis and electron microscopy, we demonstrated that the release of MVs occurs by both host cells and bacteria during infection. MVs released during infection and bacterial culture were found to induce a strong pro-inflammatory response by naive THP-1 macrophages. Yet, these MVs were also found to induce tolerance of host cells to secondary immunogenic stimuli and to enhance bacterial adherence and the number of intracellular bacteria. Bacterial MVs may play a dual role during infection, as they can both trigger and dampen immune responses thereby contributing to immune defence and bacterial survival.

  14. Spleen transcriptome response to infection with avian pathogenic Escherichia coli in broiler chickens.

    Science.gov (United States)

    Sandford, Erin E; Orr, Megan; Balfanz, Emma; Bowerman, Nate; Li, Xianyao; Zhou, Huaijun; Johnson, Timothy J; Kariyawasam, Subhashinie; Liu, Peng; Nolan, Lisa K; Lamont, Susan J

    2011-09-27

    Avian pathogenic Escherichia coli (APEC) is detrimental to poultry health and its zoonotic potential is a food safety concern. Regulation of antimicrobials in food-production animals has put greater focus on enhancing host resistance to bacterial infections through genetics. To better define effective mechanism of host resistance, global gene expression in the spleen of chickens, harvested at two times post-infection (PI) with APEC, was measured using microarray technology, in a design that will enable investigation of effects of vaccination, challenge, and pathology level. There were 1,101 genes significantly differentially expressed between severely infected and non-infected groups on day 1 PI and 1,723 on day 5 PI. Very little difference was seen between mildly infected and non-infected groups on either time point. Between birds exhibiting mild and severe pathology, there were 2 significantly differentially expressed genes on day 1 PI and 799 on day 5 PI. Groups with greater pathology had more genes with increased expression than decreased expression levels. Several predominate immune pathways, Toll-like receptor, Jak-STAT, and cytokine signaling, were represented between challenged and non-challenged groups. Vaccination had, surprisingly, no detectible effect on gene expression, although it significantly protected the birds from observable gross lesions. Functional characterization of significantly expressed genes revealed unique gene ontology classifications during each time point, with many unique to a particular treatment or class contrast. More severe pathology caused by APEC infection was associated with a high level of gene expression differences and increase in gene expression levels. Many of the significantly differentially expressed genes were unique to a particular treatment, pathology level or time point. The present study not only investigates the transcriptomic regulations of APEC infection, but also the degree of pathology associated with that

  15. Spleen transcriptome response to infection with avian pathogenic Escherichia coli in broiler chickens

    Directory of Open Access Journals (Sweden)

    Kariyawasam Subhashinie

    2011-09-01

    Full Text Available Abstract Background Avian pathogenic Escherichia coli (APEC is detrimental to poultry health and its zoonotic potential is a food safety concern. Regulation of antimicrobials in food-production animals has put greater focus on enhancing host resistance to bacterial infections through genetics. To better define effective mechanism of host resistance, global gene expression in the spleen of chickens, harvested at two times post-infection (PI with APEC, was measured using microarray technology, in a design that will enable investigation of effects of vaccination, challenge, and pathology level. Results There were 1,101 genes significantly differentially expressed between severely infected and non-infected groups on day 1 PI and 1,723 on day 5 PI. Very little difference was seen between mildly infected and non-infected groups on either time point. Between birds exhibiting mild and severe pathology, there were 2 significantly differentially expressed genes on day 1 PI and 799 on day 5 PI. Groups with greater pathology had more genes with increased expression than decreased expression levels. Several predominate immune pathways, Toll-like receptor, Jak-STAT, and cytokine signaling, were represented between challenged and non-challenged groups. Vaccination had, surprisingly, no detectible effect on gene expression, although it significantly protected the birds from observable gross lesions. Functional characterization of significantly expressed genes revealed unique gene ontology classifications during each time point, with many unique to a particular treatment or class contrast. Conclusions More severe pathology caused by APEC infection was associated with a high level of gene expression differences and increase in gene expression levels. Many of the significantly differentially expressed genes were unique to a particular treatment, pathology level or time point. The present study not only investigates the transcriptomic regulations of APEC infection

  16. Experimental infection of chicken embryos with recently described Brucella microti: Pathogenicity and pathological findings.

    Science.gov (United States)

    Wareth, Gamal; Böttcher, Denny; Melzer, Falk; Shehata, Awad Ali; Roesler, Uwe; Neubauer, Heinrich; Schoon, Heinz-Adolf

    2015-08-01

    Brucellae are facultative intracellular pathogens causing disease in a wide range of domestic and wild animals as well as in humans. Brucella (B.) microti is a recently recognized species and was isolated from common voles (Microtus arvalis), red foxes and soil in Austria and the Czech Republic. Its pathogenicity for livestock and its zoonotic potential has not been confirmed yet. In the present study 25 SPF chicken embryos were inoculated at day 11 of age with 1.6×10(3) and 1.6×10(5)B. microti by yolk sac and allantoic sac routes. Re-isolation of B. microti indicated rapid multiplication of bacteria (up to 1.7×10(12)CFU). B. microti provoked marked gross lesions, i.e. hemorrhages and necroses. All inoculated embryos were dead (100% mortality) in between 2nd and 4th day post inoculation. The predominant histopathological lesion was necroses in liver, kidneys, lungs, spleen, gastrointestinal tract, spinal meninges, yolk sac and chorioallantoic membrane. Immunohistochemical examination showed the presence of Brucella antigen in nearly all of these organs, with infection being mainly restricted to non-epithelial cells or tissues. This study provides the first results on the multiplication and pathogenicity of the mouse pathogenic B. microti in chicken embryos. These data suggest that, even though chicken are not mammals, they could provide a useful tool for understanding the pathogenesis of B. microti associated disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Pathogenic Events in a Nonhuman Primate Model of Oral Poliovirus Infection Leading to Paralytic Poliomyelitis.

    Science.gov (United States)

    Shen, Ling; Chen, Crystal Y; Huang, Dan; Wang, Richard; Zhang, Meihong; Qian, Lixia; Zhu, Yanfen; Zhang, Alvin Zhuoran; Yang, Enzhuo; Qaqish, Arwa; Chumakov, Konstantin; Kouiavskaia, Diana; Vignuzzi, Marco; Nathanson, Neal; Macadam, Andrew J; Andino, Raul; Kew, Olen; Xu, Junfa; Chen, Zheng W

    2017-07-15

    Despite a great deal of prior research, the early pathogenic events in natural oral poliovirus infection remain poorly defined. To establish a model for study, we infected 39 macaques by feeding them single high doses of the virulent Mahoney strain of wild type 1 poliovirus. Doses ranging from 10 7 to 10 9 50% tissue culture infective doses (TCID 50 ) consistently infected all the animals, and many monkeys receiving 10 8 or 10 9 TCID 50 developed paralysis. There was no apparent difference in the susceptibilities of the three macaque species (rhesus, cynomolgus, and bonnet) used. Virus excretion in stool and nasopharynges was consistently observed, with occasional viremia, and virus was isolated from tonsils, gut mucosa, and draining lymph nodes. Viral replication proteins were detected in both epithelial and lymphoid cell populations expressing CD155 in the tonsil and intestine, as well as in spinal cord neurons. Necrosis was observed in these three cell types, and viral replication in the tonsil/gut was associated with histopathologic destruction and inflammation. The sustained response of neutralizing antibody correlated temporally with resolution of viremia and termination of virus shedding in oropharynges and feces. For the first time, this model demonstrates that early in the infectious process, poliovirus replication occurs in both epithelial cells (explaining virus shedding in the gastrointestinal tract) and lymphoid/monocytic cells in tonsils and Peyer's patches (explaining viremia), extending previous studies of poliovirus pathogenesis in humans. Because the model recapitulates human poliovirus infection and poliomyelitis, it can be used to study polio pathogenesis and to assess the efficacy of candidate antiviral drugs and new vaccines. IMPORTANCE Early pathogenic events of poliovirus infection remain largely undefined, and there is a lack of animal models mimicking natural oral human infection leading to paralytic poliomyelitis. All 39 macaques fed with

  18. PCR-based identification of selected pathogens associated with endodontic infections in deciduous and permanent teeth.

    Science.gov (United States)

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Eronat, Cemal

    2008-09-01

    The aim of the present study was to evaluate the presence of the selected pathogens in samples from deciduous and permanent tooth root canals by using PCR method and to determine the association of these organisms with clinical symptoms. A total of 145 children, 5 to 13 years old, were involved in this study. The presence of selected pathogens (Actinomyces israelii, Candida albicans, Enterococcus faecalis, Fusobacterium nucleatum, Porphyromonas endodontalis, Porphyromonas gingivalis, Prevotella intermedia, Streptococcus intermedius, Treponema denticola, Parvimonas micra, Tannerella forsythensis, Enterococcus faecium, Prevotella melaninogenica) in infected root canals was studied using PCR. T. denticola (P = .012, .02) and E. faecalis (P = .012, .04) were highly associated with periapical radiolucency and previous pain, while P. gingivalis was associated with tenderness to percussion in both deciduous and permanent teeth (P = .01, .015). The results of the present study confirm that certain species of microorganisms are associated with clinical signs and symptoms of endodontic disease in both deciduous and permanent teeth.

  19. Diversity and relative abundance of the bacterial pathogen, Flavobacterium spp., infecting reproductive ecotypes of kokanee salmon.

    Science.gov (United States)

    Lemay, Matthew A; Russello, Michael A

    2014-11-04

    Understanding the distribution and abundance of pathogens can provide insight into the evolution and ecology of their host species. Previous research in kokanee, the freshwater form of sockeye salmon (Oncorhynchus nerka), found evidence that populations spawning in streams may experience a greater pathogen load compared with populations that spawn on beaches. In this study we tested for differences in the abundance and diversity of the gram-negative bacteria, Flavobacterium spp., infecting tissues of kokanee in both of these spawning habitats (streams and beaches). Molecular assays were carried out using primers designed to amplify a ~200 nucleotide region of the gene encoding the ATP synthase alpha subunit (AtpA) within the genus Flavobacterium. Using a combination of DNA sequencing and quantitative PCR (qPCR) we compared the diversity and relative abundance of Flavobacterium AtpA amplicons present in DNA extracted from tissue samples of kokanee collected from each spawning habitat. We identified 10 Flavobacterium AtpA haplotypes among the tissues of stream-spawning kokanee and seven haplotypes among the tissues of beach-spawning kokanee, with only two haplotypes shared between spawning habitats. Haplotypes occurring in the same clade as F. psychrophilum were the most prevalent (92% of all reads, 60% of all haplotypes), and occurred in kokanee from both spawning habitats (streams and beaches). Subsequent qPCR assays did not find any significant difference in the relative abundance of Flavobacterium AtpA amplicons between samples from the different spawning habitats. We confirmed the presence of Flavobacterium spp. in both spawning habitats and found weak evidence for increased Flavobacterium diversity in kokanee sampled from stream-spawning sites. However, the quantity of Flavobacterium DNA did not differ between spawning habitats. We recommend further study aimed at quantifying pathogen diversity and abundance in population-level samples of kokanee combined with

  20. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Directory of Open Access Journals (Sweden)

    Priyanka Surana

    2017-10-01

    Full Text Available Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh, causes powdery mildew disease in barley (Hordeum vulgare L.. Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa and H. vulgare cv. Algerian (Mla1, which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE complex with SYP121 (PEN1, which is engaged in pathogen associated molecular pattern (PAMP-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios.

  1. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy

    2010-06-01

    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  2. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Science.gov (United States)

    Surana, Priyanka; Xu, Ruo; Fuerst, Gregory; Chapman, Antony V. E.; Nettleton, Dan; Wise, Roger P.

    2017-01-01

    Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh), causes powdery mildew disease in barley (Hordeum vulgare L.). Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL) analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr) 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa) and H. vulgare cv. Algerian (Mla1), which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI) via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE) complex with SYP121 (PEN1), which is engaged in pathogen associated molecular pattern (PAMP)-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios. PMID:28790145

  3. Evaluation of biocontrol agents for grapevine pruning wound protection against trunk pathogen infection.

    Directory of Open Access Journals (Sweden)

    Charl KOTZE

    2011-12-01

    Full Text Available Trunk diseases of grapevine are caused by numerous pathogens, including Eutypa lata, Phaeomoniella chlamydospora, and species of Botryosphaeriaceae (incl. Botryosphaeria and aggregate genera, Phomopsis and Phaeoacremonium. Since infections occur mainly through pruning wounds, that have been shown by previous research to stay susceptible for up to 16 weeks after pruning, long-term pruning wound protection is required for prevention of infection. This study evaluated several biocontrol agents against a range of trunk disease pathogens in dual plate laboratory trials to determine macroscopic and microscopic interactions. The biocontrol agents had a substantial effect on all the pathogens, with a wide range of macroscopic and microscopic interactions observed. The best performing biocontrol agents were tested in two field trials. Fresh pruning wounds were treated with benomyl, Trichoderma products (Biotricho®, Vinevax® and ECO 77® and isolates (USPP-T1 and -T2, identified as T. atroviride and Bacillus subtilis. Seven days after treatment the pruning wounds were inoculated by spraying with spore suspensions of Neofusicoccum australe, N. parvum, Diplodia seriata, Lasiodiplodia theobromae, Eutypa lata, Phaeomoniella chlamydospora or Phomopsis viticola. Eight months after inoculation, the treatments were evaluated by isolation onto potato dextrose agar. The efficacy of the biocontrol agents was in most cases similar or superior to that observed for benomyl. Isolate USPP-T1, in particular, was very effective, reducing incidence of Ph. viticola, E. lata, Pa. chlamydospora, N. australe, N. parvum, D. seriata and L. theobromae by 69, 76, 77, 78, 80, 85 and 92%, respectively. This is the first report of biological protection of grapevine pruning wounds against this group of grapevine trunk disease pathogens.

  4. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Science.gov (United States)

    Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R

    2014-01-01

    MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  5. Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.

  6. Infectivity and pathogenicity of the oomycete Aphanomyces invadans in Atlantic menhaden Brevoortia tyrannus

    Science.gov (United States)

    Kiryu, Y.; Shields, J.D.; Vogelbein, W.K.; Kator, H.; Blazer, V.S.

    2003-01-01

    Atlantic menhaden Brevoortia tyrannus develop characteristic skin ulcers in response to infection by the oomycete Aphanomyces invadans. To investigate pathogenicity, we conducted a dose response study. Juvenile menhaden were inoculated subcutaneously with 0, 1, 5, 10, 100, and 500 secondary zoospores per fish and monitored for 37 d post-injection (p.i.). Survival rates declined with increasing zoospore dose, with significantly different survivorship curves for the different doses. Moribund and dead fish exhibited characteristic ulcerous lesions at the injection site starting at 13 d p.i. None of the sham-injected control fish (0 zoospore treatment) died. The LD50 (lethal dose killing 50% of exposed menhaden) for inoculated fish was estimated at 9.7 zoospores; however, some fish receiving an estimated single zoospore developed infections that resulted in death. Menhaden were also challenged by aqueous exposure and confirmed that A. invadans was highly pathogenic by this more environmentally realistic route. Fish that were acclimated to culture conditions for 30 d, and presumably free of skin damage, then aqueously exposed to 100 zoospores ml-1, exhibited 14% lesion prevalence with 11% mortality. Net-handled fish that were similarly infected had a significantly higher lesion prevalence (64%) and mortality (64%). Control fish developed no lesions and did not die. Scanning electron microscopy of fish skin indicated that zoospores adhered to intact epidermis, germinated and penetrated the epithelium with a germ tube. Our results indicate that A. invadans is a primary pathogen of menhaden and is able to cause disease at very low zoospore concentrations.

  7. Fighting infections due to multidrug-resistant Gram-positive pathogens.

    Science.gov (United States)

    Cornaglia, G

    2009-03-01

    Growing bacterial resistance in Gram-positive pathogens means that what were once effective and inexpensive treatments for infections caused by these bacteria are now being seriously questioned, including penicillin and macrolides for use against pneumococcal infections and-in hospitals-oxacillin for use against staphylococcal infections. As a whole, multidrug-resistant (MDR) Gram-positive pathogens are rapidly becoming an urgent and sometimes unmanageable clinical problem. Nevertheless, and despite decades of research into the effects of antibiotics, the actual risk posed to human health by antibiotic resistance has been poorly defined; the lack of reliable data concerning the outcomes resulting from antimicrobial resistance stems, in part, from problems with study designs and the methods used in resistence determination. Surprisingly little is known, too, about the actual effectiveness of the many types of intervention aimed at controlling antibiotic resistance. New antibiotics active against MDR Gram-positive pathogens have been recently introduced into clinical practice, and the antibiotic pipeline contains additional compounds at an advanced stage of development, including new glycopeptides, new anti-methicillin-resistant Staphylococcus aureus (MRSA) beta-lactams, and new diaminopyrimidines. Many novel antimicrobial agents are likely to be niche products, endowed with narrow antibacterial spectra and/or targeted at specific clinical problems. Therefore, an important educational goal will be to change the current, long-lasting attitudes of both physicians and customers towards broad-spectrum and multipurpose compounds. Scientific societies, such as the European Society of Clinical Microbiology and Infectious Diseases (ESCMID), must play a leading role in this process.

  8. Microbial Pathogens Implicated in Reproductive Health Infections in a Special Treatment Clinic in Ibadan, Nigeria

    Directory of Open Access Journals (Sweden)

    Adenike Ogunshe

    2009-03-01

    Full Text Available Objective: The lack of adequate recognition of health importance of non-HIV reproductive health infections (RHIs in Nigeria has led into this study, which was to determine clinical pathogens in non-HIV RHI in Nigeria using a tertiary health facility as case study.Materials and Methods: A nine-year investigation was carried out between 1997 and 2005 on 4047 (n = 1626 males; n = 2421 females patients presenting at Special Treatment Clinic (STC of University College Hospital (UCH Ibadan, Nigeria. Routine laboratory procedures using appropriate culture media, culture conditions, and current phenotypic taxonomic tools for classification of isolated pathogens were employed.Results: Age (p = 0.019 and gender (p<0.0001 were related to the recovery rates of pathogens Candida species (55.6 %, Neisseria gonorrhoae (11.1%, Gardenella vaginalis (10.3%, Escherichia coli (9.2 %, Klebsiella sp. (4.2%, streptococci (4.0%, Staphylococcus aureus (2.3%, Proteus sp., (1.8%, Haemophilus ducreyi (0.5%, Trichomonas vaginalis (0.44% and Pseudomonas aeruginosa (0.18%. Candida and Gardenella vaginalis species were mostly recovered from female patients, while N.gonorrhoeae were mostly isolated from male patients. Age brackets for the recovery of pathogens were Neisseria gonorrhoeae (16-30 years; Gardenella vaginalis (21-25 and 31-35 years and C.albicans (21-30 years.Conclusion: Candida, Neisseria gonorrhoea and Gadrenella vaginalis were the most recovered pathogens from patients presenting at Special Treatment Clinic of a tertiary health institution in Nigeria, and the relationship between age, gender and the aetiological agents was statistically significant.

  9. Sequence of pathogenic events in cynomolgus macaques infected with aerosolized monkeypox virus.

    Science.gov (United States)

    Tree, J A; Hall, G; Pearson, G; Rayner, E; Graham, V A; Steeds, K; Bewley, K R; Hatch, G J; Dennis, M; Taylor, I; Roberts, A D; Funnell, S G P; Vipond, J

    2015-04-01

    To evaluate new vaccines when human efficacy studies are not possible, the FDA's "Animal Rule" requires well-characterized models of infection. Thus, in the present study, the early pathogenic events of monkeypox infection in nonhuman primates, a surrogate for variola virus infection, were characterized. Cynomolgus macaques were exposed to aerosolized monkeypox virus (10(5) PFU). Clinical observations, viral loads, immune responses, and pathological changes were examined on days 2, 4, 6, 8, 10, and 12 postchallenge. Viral DNA (vDNA) was detected in the lungs on day 2 postchallenge, and viral antigen was detected, by immunostaining, in the epithelium of bronchi, bronchioles, and alveolar walls. Lesions comprised rare foci of dysplastic and sloughed cells in respiratory bronchioles. By day 4, vDNA was detected in the throat, tonsil, and spleen, and monkeypox antigen was detected in the lung, hilar and submandibular lymph nodes, spleen, and colon. Lung lesions comprised focal epithelial necrosis and inflammation. Body temperature peaked on day 6, pox lesions appeared on the skin, and lesions, with positive immunostaining, were present in the lung, tonsil, spleen, lymph nodes, and colon. By day 8, vDNA was present in 9/13 tissues. Blood concentrations of interleukin 1ra (IL-1ra), IL-6, and gamma interferon (IFN-γ) increased markedly. By day 10, circulating IgG antibody concentrations increased, and on day 12, animals showed early signs of recovery. These results define early events occurring in an inhalational macaque monkeypox infection model, supporting its use as a surrogate model for human smallpox. Bioterrorism poses a major threat to public health, as the deliberate release of infectious agents, such smallpox or a related virus, monkeypox, would have catastrophic consequences. The development and testing of new medical countermeasures, e.g., vaccines, are thus priorities; however, tests for efficacy in humans cannot be performed because it would be unethical and

  10. Pathogen infection distribution and drug resistance analysis of patients with severe liver disease

    Directory of Open Access Journals (Sweden)

    Xi CHEN

    2018-04-01

    Full Text Available Objective To explore the infection distribution and drug resistance of pathogens in patients with severe liver disease, and provide reference for clinical medication. Methods Retrospective analysis of the microbiological specimens from patients with severe liver disease in Department of Infection of our hospital from August 2014 to November 2016 and the drug susceptibility testing were carried out by means of K-B disc diffusion method after bacterial culturing, and the distribution and drug resistance of pathogens were analyzed. Results Totally 17 of 73 patients with severe liver disease developed hospital infection (23.3%. 104 strains of bacteria were isolated and 78 strains out of them were multidrug-resistant bacteria (75.0%. Among them, 28(26.9% strains were gram-positive coccus, mainly consisting of Staphylococcus aureus and Staphylococcus epidermidis, and 58(55.8% were gram-negative coccus, mainly composed of Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii, and 18(17.3% strains fungi. S.aureus and enterococci were resistant to penicillin, erythromycin and levofloxacin, the resistance rates were above 80.0%, but had low resistance rates to vancomycin, teicoplanin and tigecycline. The resistance rates of E.coli and K.pneumoniae to piperacillin, cefazolin and cefuroxime sodium were above 85.0%, but they had lower resistance rates to tigecycline and amikacin. Acinetobacter baumannii was 100% resistant to piperacillin and tazobactam, ceftazidime, imipenem and amikacin, but had low resistance to tigecycline and minocycline. Conclusions Multi-drug resistant bacteria are the main bacterial pathogens in patients with severe liver disease and have a high resistance rate to commonly used antibiotics, empirical treatment in the population at high risk of multidrug-resistant bacteria infections requires the use of broad-spectrum or high-grade antibiotics (e.g. carbapenems or tigecycline and drugs against specific pathogenic

  11. Examining the effect of intramammary infections with minor mastitis pathogens on the acquisition of new intramammary infections with major mastitis pathogens--a systematic review and meta-analysis.

    Science.gov (United States)

    Reyher, K K; Haine, D; Dohoo, I R; Revie, C W

    2012-11-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus agalactiae, Streptococcus uberis, Streptococcus dysgalactiae, and the coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium bovis and coagulase-negative staphylococci (CNS). The current literature contains several studies detailing analyses with conflicting results as to whether intramammary infection (IMI) with the minor pathogens decreases, increases, or has no effect on the risk of a quarter acquiring a new intramammary infection (NIMI) with a major pathogen. To investigate the available scientific evidence regarding the effect of IMI with minor pathogens on the acquisition of NIMI with major pathogens, a systematic review and meta-analysis were conducted. The total extant English- and French-language literature in electronic databases was searched and all publications cited by relevant papers were investigated. Results from 68 studies were extracted from 38 relevant papers. Random-effects models were used to investigate the effects of CNS and C. bovis on acquisition of new IMI with any of the major pathogens, as well as individually for the minor pathogens and Staph. aureus. Significant heterogeneity among studies exists, some of which could be accounted for by using meta-regression. Overall, observational studies showed no effect, whereas challenge studies showed strong and significant protective effects, specifically when major pathogens were introduced into the mammary gland via methods bypassing the teat end. Underlying risk can account for several unmeasured factors, and studies with higher underlying risk found more protective effects of minor pathogens. Larger doses of challenge organisms reduced the protective effect of minor pathogens, and studies with more stringent diagnostic criteria for pathogen IMI identified less protection. Smaller studies (those utilizing fewer than 40 cows) also showed a greater

  12. The onset of virus shedding and clinical signs in chickens infected with high-pathogenicity and low-pathogenicity avian influenza viruses.

    Science.gov (United States)

    Spickler, Anna R; Trampel, Darrell W; Roth, James A

    2008-12-01

    Some avian influenza viruses may be transmissible to mammals by ingestion. Cats and dogs have been infected by H5N1 avian influenza viruses when they ate raw poultry, and two human H5N1 infections were linked to the ingestion of uncooked duck blood. The possibility of zoonotic influenza from exposure to raw poultry products raises concerns about flocks with unrecognized infections. The present review examines the onset of virus shedding and the development of clinical signs for a variety of avian influenza viruses in chickens. In experimentally infected birds, some high-pathogenicity avian influenza (HPAI) and low-pathogenicity avian influenza (LPAI) viruses can occur in faeces and respiratory secretions as early as 1 to 2 days after inoculation. Some HPAI viruses have also been found in meat 1 day after inoculation and in eggs after 3 days. There is no evidence that LPAI viruses can be found in meat, and the risk of their occurrence in eggs is poorly understood. Studies in experimentally infected birds suggest that clinical signs usually develop within a few days of virus shedding; however, some models and outbreak descriptions suggest that clinical signs may not become evident for a week or more in some H5 or H7 HPAI-infected flocks. During this time, avian influenza viruses might be found in poultry products. LPAI viruses can be shed in asymptomatically infected or minimally affected flocks, but these viruses are unlikely to cause significant human disease.

  13. Experimental infection of highly pathogenic avian influenza virus H5N1 in black-headed gulls (Chroicocephalus ridibundus)

    NARCIS (Netherlands)

    A. Ramis (Antonio); G. van Amerongen (Geert); M.W.G. van de Bildt (Marco); L.M.E. Leijten (Lonneke); R. Vanderstichel (R.); A.D.M.E. Osterhaus (Albert); T. Kuiken (Thijs)

    2014-01-01

    textabstractHistorically, highly pathogenic avian influenza viruses (HPAIV) rarely resulted in infection or clinical disease in wild birds. However, since 2002, disease and mortality from natural HPAIV H5N1 infection have been observed in wild birds including gulls. We performed an experimental

  14. A model of the transmission of micro-organisms in a public setting and its correlation to pathogen infection risks.

    Science.gov (United States)

    Gerhardts, A; Hammer, T R; Balluff, C; Mucha, H; Hoefer, D

    2012-03-01

    Gastro-intestinal infections are widespread in the community and have considerable economic consequences. In this study, we followed chains of infection from a public toilet scenario, looking at infection risks by correlating the transmission of bacteria, fungi and viruses to our current knowledge of infectious doses. Transmission of Escherichia coli, Bacillus atrophaeus spores, Candida albicans and bacteriophage MS2 from hands to surfaces was examined in a transmission model, that is toilet brush, door handle to water tap. The load of viable pathogens was significantly reduced during transfer from hands to objects. Nevertheless, it was shown that pathogens were successfully transferred to other people in contagious doses by contact with contaminated surfaces. Our results suggest that infection risks are mainly dependent on current infectious doses of pathogens. For enteritic viruses or bacteria, for example Norovirus or EHEC, only a few particles or cells are sufficient for infection in public lavatories, thus bearing a high risk of infection for other persons. However, there seems to be only a low probability of becoming infected with pathogens that have a high infectious dose whilst sharing the same bathroom. The transmission model for micro-organisms enables a risk assessment of gastro-intestinal infections on the basis of a practical approach. © 2012 The Authors. Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  15. The risk of pathogenic intestinal parasite infections in Kisii Municipality, Kenya

    Directory of Open Access Journals (Sweden)

    Kabiru Ephantus W

    2008-07-01

    Full Text Available Abstract Background Intestinal parasitic infections are among the most common infections worldwide. Various epidemiological studies indicate that the prevalence of intestinal parasites is high especially in developing countries, although in many of these, the environmental risk factors have not been clearly elucidated. The objective of this study was to determine the risk of pathogenic intestinal parasites infections in Kisii Municipality. Methods Random sampling was used in the selection of the study samples. Stool parasitological profiles of food handlers were done by direct smear and formalin-ethyl acetate sedimentation method. Both vegetable and meat samples were examined for the presence of intestinal parasites. The storage and meat handling practices of the various butcheries were observed. Results Types of samples examined for occurrence of intestinal parasites includes, a total of 84 vegetable, 440 meat and 168 stool samples. Fifty five (65.5% vegetable, 334 (75.9% meat and 69 (41.1% of the stool samples were found positive for intestinal parasites indicating a high overall risk (66.18% for intestinal parasite infections. Of the parasites detected, the most common parasites infesting the foodstuffs and infecting the food handlers were Ascaris lumbricoides and Entamoeba histolytica. Parasites were significantly less likely to be present on meat that was refrigerated during display than meat that was displayed at ambient temperature. Conclusion There is a high risk of infection with intestinal parasites in the sampled Municipal markets. About half of the food handlers surveyed (41.1 % at the Municipal Hospital had one or more parasitic infections. Furthermore, meat (65.5% and vegetables (75.9% sold at the Municipal market were found to be contaminated with parasites hence the inhabitants requires a need for education on food safety, good distribution practices and improvement on sanitary conditions.

  16. Metabolic adaptation of a human pathogen during chronic infections - a systems biology approach

    DEFF Research Database (Denmark)

    Thøgersen, Juliane Charlotte

    modeling to uncover how human pathogens adapt to the human host. Pseudomonas aeruginosa infections in cystic fibrosis patients are used as a model system for under-­‐ standing these adaptation processes. The exploratory systems biology approach facilitates identification of important phenotypes...... by classical molecular biology approaches where genes and reactions typically are investigated in a one to one relationship. This thesis is an example of how mathematical approaches and modeling can facilitate new biologi-­‐ cal understanding and provide new surprising ideas to important biological processes....... and metabolic pathways that are necessary or related to establishment of chronic infections. Archetypal analysis showed to be successful in extracting relevant phenotypes from global gene expression da-­‐ ta. Furthermore, genome-­‐scale metabolic modeling showed to be useful in connecting the genotype...

  17. CLINICAL CHARACTERISTICS AND ANTIBIOTIC RESISTANCE PATTERN OF PATHOGENS IN PEDIATRIC URINARY TRACT INFECTION.

    Science.gov (United States)

    Amornchaicharoensuk, Yupaporn

    2016-09-01

    Medical records of children less than 15-years of age admitted to hospital for urinary tract infection (UTI) from January 2010 to December 2014 were reviewed. Among 100 children (59% males and 41% females) with upper UTI, the most common pathogen (88%) was Escherichia coli, of which 69% were nonextended spectrum beta-lactamase (ESBL) and 19 % ESBL producers. Resistance to ampicillin and trimethoprim/sulfamethoxazole was 90% and 60%, respectively. All ESBL-producing E. coli were resistant to ampicillin and third generation cephalosporins (cefotaxime and ceftriaxone), while 87% and 1.5% of non ESBL-producing E. coli were resistant to ampicillin and the two third generation cephalosporins, respectively. These data highlight the high prevalence of ESBL-producing E. coli in pediatric UTI and the potential problem in treating such infections.

  18. Bioeconomic modeling of lactational antimicrobial treatment of new bovine subclinical intramammary infections caused by contagious pathogens

    DEFF Research Database (Denmark)

    Van den Borne, B. H. P.; Hisham Beshara Halasa, Tariq; Van Schaik, G.

    2010-01-01

    This study determined the direct and indirect epidemiologic and economic effects of lactational treatment of new bovine subclinical intramammary infections (IMI) caused by contagious pathogens using an existing bioeconomic model. The dynamic and stochastic model simulated the dynamics...... of uncured cows after 2 mo of infection. Model behavior was observed for variation in parameter input values. Compared with no lactational intervention, lactational intervention of new subclinical IMI resulted in fewer clinical flare ups, less transmission within the herd, and much lower combined total....... Changing the probability of cure resulted in a nonlinear change in the cumulative incidence of IMI cases and associated costs. Lactational treatment was able to prevent IMI epidemics in dairy herds at high transmission rates of Strep. uberis, Strep. dysgalactiae, and E. coli. Lactational treatment did...

  19. Low pathogenicity avian influenza viruses infect chicken layers by different routes of inoculation.

    Science.gov (United States)

    Pantin-Jackwood, Mary J; Smith, Diane M; Wasilenko, Jamie L; Spackman, Erica

    2012-06-01

    In order to develop better control measures against avian influenza, it is necessary to understand how the virus transmits in poultry. In a previous study in which the infectivity and transmissibility of the pandemic H1N1 influenza virus was examined in different poultry species, we found that no or minimal infection occurred in chicken and turkeys intranasally (IN) inoculated with the virus. However, we demonstrated that the virus can infect laying turkey hens by the intracloacal (IC) and intraoviduct (IO) routes, possibly explaining the drops in egg production observed in turkey breeder farms affected by the virus. Such novel routes of exposure have not been previously examined in chickens and could also explain outbreaks of low pathogenicity avian influenza (LPAI) that cause a decrease in egg production in chicken layers and breeders. In the present study, 46-wk-old specific-pathogen-free chicken layers were infected by the IN, IC, or IO routes with one of two LPAI viruses: a poultry origin virus, A/chicken/CA/1255/02 (H6N2), and a live bird market isolate, A/chicken/NJ/12220/97 (H9N2). Only hens IN inoculated with the H6N2 virus presented mild clinical signs consisting of depression and anorexia. However, a decrease in number of eggs laid was observed in all virus-inoculated groups when compared to control hens. Evidence of infection was found in all chickens inoculated with the H6N2 virus by any of the three routes and the virus transmitted to contact hens. On the other hand, only one or two hens from each of the groups inoculated with the H9N2 virus shed detectable levels of virus, or seroconverted and did not transmit the virus to contacts, regardless of the route of inoculation. In conclusion, LPAI viruses can also infect chickens through other routes besides the IN route, which is considered the natural route of exposure. However, as seen with the H9N2 virus, the infectivity of the virus did not increase when given by these alternate routes.

  20. Induction of gentisic acid 5-O-beta-D-xylopyranoside in tomato and cucumber plants infected by different pathogens.

    Science.gov (United States)

    Fayos, Joaquín; Bellés, José María; López-Gresa, M Pilar; Primo, Jaime; Conejero, Vicente

    2006-01-01

    Tomato plants infected with the citrus exocortis viroid exhibited strongly elevated levels of a compound identified as 2,5-dihydroxybenzoic acid (gentisic acid, GA) 5-O-beta-D-xylopyranoside. The compound accumulated early in leaves expressing mild symptoms from both citrus exocortis viroid-infected tomato, and prunus necrotic ringspot virus-infected cucumber plants, and progressively accumulated concomitant with symptom development. The work presented here demonstrates that GA, mainly associated with systemic infections in compatible plant-pathogen interactions [Bellés, J.M., Garro, R., Fayos, J., Navarro, P., Primo, J., Conejero, V., 1999. Gentisic acid as a pathogen-inducible signal, additional to salicylic acid for activation of plant defenses in tomato. Mol. Plant-Microbe Interact. 12, 227-235], is conjugated to xylose. Notably, this result contrasts with those previously found in other plant-pathogen interactions in which phenolics analogues of GA as benzoic or salicylic acids, are conjugated to glucose.

  1. Human Infection with Highly Pathogenic Avian Influenza A(H7N9) Virus, China.

    Science.gov (United States)

    Ke, Changwen; Mok, Chris Ka Pun; Zhu, Wenfei; Zhou, Haibo; He, Jianfeng; Guan, Wenda; Wu, Jie; Song, Wenjun; Wang, Dayan; Liu, Jiexiong; Lin, Qinhan; Chu, Daniel Ka Wing; Yang, Lei; Zhong, Nanshan; Yang, Zifeng; Shu, Yuelong; Peiris, Joseph Sriyal Malik

    2017-07-01

    The recent increase in zoonotic avian influenza A(H7N9) disease in China is a cause of public health concern. Most of the A(H7N9) viruses previously reported have been of low pathogenicity. We report the fatal case of a patient in China who was infected with an A(H7N9) virus having a polybasic amino acid sequence at its hemagglutinin cleavage site (PEVPKRKRTAR/GL), a sequence suggestive of high pathogenicity in birds. Its neuraminidase also had R292K, an amino acid change known to be associated with neuraminidase inhibitor resistance. Both of these molecular features might have contributed to the patient's adverse clinical outcome. The patient had a history of exposure to sick and dying poultry, and his close contacts had no evidence of A(H7N9) disease, suggesting human-to-human transmission did not occur. Enhanced surveillance is needed to determine whether this highly pathogenic avian influenza A(H7N9) virus will continue to spread.

  2. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood

    OpenAIRE

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I.; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L.; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H.; Didar, Tohid; Dimitrakakis, Nikolaos

    2016-01-01

    Background: Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. Methods: An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, contai...

  3. Bacteriophages: the possible solution to treat infections caused by pathogenic bacteria.

    Science.gov (United States)

    El-Shibiny, Ayman; El-Sahhar, Salma

    2017-11-01

    Since their discovery in 1915, bacteriophages have been used to treat bacterial infections in animals and humans because of their unique ability to infect their specific bacterial hosts without affecting other bacterial populations. The research carried out in this field throughout the 20th century, largely in Georgia, part of USSR and Poland, led to the establishment of phage therapy protocols. However, the discovery of penicillin and sulfonamide antibiotics in the Western World during the 1930s was a setback in the advancement of phage therapy. The misuse of antibiotics has reduced their efficacy in controlling pathogens and has led to an increase in the number of antibiotic-resistant bacteria. As an alternative to antibiotics, bacteriophages have become a topic of interest with the emergence of multidrug-resistant bacteria, which are a threat to public health. Recent studies have indicated that bacteriophages can be used indirectly to detect pathogenic bacteria or directly as biocontrol agents. Moreover, they can be used to develop new molecules for clinical applications, vaccine production, drug design, and in the nanomedicine field via phage display.

  4. HIV Infection Disrupts the Sympatric Host–Pathogen Relationship in Human Tuberculosis

    Science.gov (United States)

    Fenner, Lukas; Egger, Matthias; Bodmer, Thomas; Furrer, Hansjakob; Ballif, Marie; Battegay, Manuel; Helbling, Peter; Fehr, Jan; Gsponer, Thomas; Rieder, Hans L.; Zwahlen, Marcel; Hoffmann, Matthias; Bernasconi, Enos; Cavassini, Matthias; Calmy, Alexandra; Dolina, Marisa; Frei, Reno; Janssens, Jean-Paul; Borrell, Sonia; Stucki, David; Schrenzel, Jacques; Böttger, Erik C.; Gagneux, Sebastien

    2013-01-01

    The phylogeographic population structure of Mycobacterium tuberculosis suggests local adaptation to sympatric human populations. We hypothesized that HIV infection, which induces immunodeficiency, will alter the sympatric relationship between M. tuberculosis and its human host. To test this hypothesis, we performed a nine-year nation-wide molecular-epidemiological study of HIV–infected and HIV–negative patients with tuberculosis (TB) between 2000 and 2008 in Switzerland. We analyzed 518 TB patients of whom 112 (21.6%) were HIV–infected and 233 (45.0%) were born in Europe. We found that among European-born TB patients, recent transmission was more likely to occur in sympatric compared to allopatric host–pathogen combinations (adjusted odds ratio [OR] 7.5, 95% confidence interval [95% CI] 1.21–infinity, p = 0.03). HIV infection was significantly associated with TB caused by an allopatric (as opposed to sympatric) M. tuberculosis lineage (OR 7.0, 95% CI 2.5–19.1, p<0.0001). This association remained when adjusting for frequent travelling, contact with foreigners, age, sex, and country of birth (adjusted OR 5.6, 95% CI 1.5–20.8, p = 0.01). Moreover, it became stronger with greater immunosuppression as defined by CD4 T-cell depletion and was not the result of increased social mixing in HIV–infected patients. Our observation was replicated in a second independent panel of 440 M. tuberculosis strains collected during a population-based study in the Canton of Bern between 1991 and 2011. In summary, these findings support a model for TB in which the stable relationship between the human host and its locally adapted M. tuberculosis is disrupted by HIV infection. PMID:23505379

  5. The infection biology of Sphaerulina musiva: clues to understanding a forest pathogen.

    Directory of Open Access Journals (Sweden)

    Ruqian Qin

    Full Text Available Trees in the genus Populus and their interspecific hybrids are used across North America for fiber production and as a potential source of biofuel. Plantations of these species are severely impacted by a fungal pathogen, Sphaerulina musiva, the cause of leaf spot and stem canker. An inoculation protocol that does not rely on stem wounding to achieve infection was recently developed. Using this protocol two experiments were conducted to examine infection biology and disease development in the S. musiva-Populus interaction. In the first experiment non-wounded stems of one moderately resistant clone (NM6 and one susceptible clone (NC11505 were inoculated and examined by scanning electron microscopy at six different times (6 h, 12 h, 24 h, 72 h, 1 week, and 3 weeks post-inoculation. The images indicate that the pathogen appears to enter host tissue through small openings and lenticels and that there are no significant differences in the penetration rate between the moderately resistant (NM6 and susceptible (NC11505 clones at 12 h post-inoculation. In a second experiment a histological comparison of stem cankers for resistant clone DN74 and susceptible clone NC11505 were conducted at three time points (3 weeks, 5 weeks, and 7 weeks post-inoculation. Distinct differences in disease development were apparent between the resistant and susceptible clones at each time point, with the susceptible clone exhibiting a weak and delayed defense response. These results suggest, that following penetration, the pathogen may be able to interfere with the defense response in the susceptible host.

  6. Outbreaks where food workers have been implicated in the spread of foodborne disease. Part 4. Infective doses and pathogen carriage.

    Science.gov (United States)

    Todd, Ewen C D; Greig, Judy D; Bartleson, Charles A; Michaels, Barry S

    2008-11-01

    In this article, the fourth in a series reviewing the role of food workers in foodborne outbreaks, background information on the presence of enteric pathogens in the community, the numbers of organisms required to initiate an infection, and the length of carriage are presented. Although workers have been implicated in outbreaks, they were not always aware of their infections, either because they were in the prodromic phase before symptoms began or because they were asymptomatic carriers. Pathogens of fecal, nose or throat, and skin origin are most likely to be transmitted by the hands, highlighting the need for effective hand hygiene and other barriers to pathogen contamination, such as no bare hand contact with ready-to-eat food. The pathogens most likely to be transmitted by food workers are norovirus, hepatitis A virus, Salmonella, Shigella, and Staphylococcus aureus. However, other pathogens have been implicated in worker-associated outbreaks or have the potential to be implicated. In this study, the likelihood of pathogen involvement in foodborne outbreaks where infected workers have been implicated was examined, based on infectious dose, carriage rate in the community, duration of illness, and length of pathogen excretion. Infectious dose estimates are based on volunteer studies (mostly early experiments) or data from outbreaks. Although there is considerable uncertainty associated with these data, some pathogens appear to be able to infect at doses as low as 1 to 100 units, including viruses, parasites, and some bacteria. Lengthy postsymptomatic shedding periods and excretion by asymptomatic individuals of many enteric pathogens is an important issue for the hygienic management of food workers.

  7. Intrinsic and extrinsic factors related to pathogen infection in wild small mammals in intensive milk cattle and swine production systems.

    Science.gov (United States)

    Lovera, Rosario; Fernández, María Soledad; Jacob, Jens; Lucero, Nidia; Morici, Gabriel; Brihuega, Bibiana; Farace, María Isabel; Caracostantogolo, Jorge; Cavia, Regino

    2017-06-01

    Understanding the ecological processes that are involved in the transmission of zoonotic pathogens by small mammals may aid adequate and effective management measures. Few attempts have been made to analyze the ecological aspects that influence pathogen infection in small mammals in livestock production systems. We describe the infection of small mammals with Leptospira spp., Brucella spp., Trichinella spp. and Cysticercus fasciolaris and assess the related intrinsic and extrinsic factors in livestock production systems in central Argentina at the small mammal community, population and individual levels. Ten pig farms and eight dairy farms were studied by removal trapping of small mammals from 2008 to 2011. Each farm was sampled seasonally over the course of one year with cage and Sherman live traps. The 505 small mammals captured (14,359 trap-nights) included three introduced murine rodents, four native rodents and two opossums. Leptospira spp., anti-Brucella spp. antibodies and Trichinella spp. were found in the three murine rodents and both opossums. Rattus norvegicus was also infected with C. fasciolaris; Akodon azarae and Oligoryzomys flavescens with Leptospira spp.; anti-Brucella spp. antibodies were found in A. azarae. Two or more pathogens occurred simultaneously on 89% of the farms, and each pathogen was found on at least 50% of the farms. Pathogen infections increased with host abundance. Infection by Leptospira spp. also increased with precipitation and during warm seasons. The occurrence of anti-Brucella spp. antibodies was higher on dairy farms and during the winter and summer. The host abundances limit values, from which farms are expected to be free of the studied pathogens, are reported. Murine rodents maintain pathogens within farms, whereas other native species are likely dispersing pathogens among farms. Hence, we recommend preventing and controlling murines in farm dwellings and isolating farms from their surroundings to avoid contact with other

  8. Intrinsic and extrinsic factors related to pathogen infection in wild small mammals in intensive milk cattle and swine production systems.

    Directory of Open Access Journals (Sweden)

    Rosario Lovera

    2017-06-01

    Full Text Available Understanding the ecological processes that are involved in the transmission of zoonotic pathogens by small mammals may aid adequate and effective management measures. Few attempts have been made to analyze the ecological aspects that influence pathogen infection in small mammals in livestock production systems. We describe the infection of small mammals with Leptospira spp., Brucella spp., Trichinella spp. and Cysticercus fasciolaris and assess the related intrinsic and extrinsic factors in livestock production systems in central Argentina at the small mammal community, population and individual levels.Ten pig farms and eight dairy farms were studied by removal trapping of small mammals from 2008 to 2011. Each farm was sampled seasonally over the course of one year with cage and Sherman live traps. The 505 small mammals captured (14,359 trap-nights included three introduced murine rodents, four native rodents and two opossums. Leptospira spp., anti-Brucella spp. antibodies and Trichinella spp. were found in the three murine rodents and both opossums. Rattus norvegicus was also infected with C. fasciolaris; Akodon azarae and Oligoryzomys flavescens with Leptospira spp.; anti-Brucella spp. antibodies were found in A. azarae. Two or more pathogens occurred simultaneously on 89% of the farms, and each pathogen was found on at least 50% of the farms. Pathogen infections increased with host abundance. Infection by Leptospira spp. also increased with precipitation and during warm seasons. The occurrence of anti-Brucella spp. antibodies was higher on dairy farms and during the winter and summer. The host abundances limit values, from which farms are expected to be free of the studied pathogens, are reported.Murine rodents maintain pathogens within farms, whereas other native species are likely dispersing pathogens among farms. Hence, we recommend preventing and controlling murines in farm dwellings and isolating farms from their surroundings to avoid

  9. New Epidemiological and Clinical Signatures of 18 Pathogens from Respiratory Tract Infections Based on a 5-Year Study.

    Directory of Open Access Journals (Sweden)

    Xiaohong Liao

    Full Text Available Respiratory tract infections (RTIs are a heavy burden on society. However, due to the complex etiology of RTIs, the clinical diagnosis, treatment, and prevention of these infections remain challenging, especially in developing countries.To determine the epidemiological and clinical characteristics of 18 respiratory pathogens, we analyzed 12,502 patients with acute respiratory infections (ARIs by performing polymerase chain reaction (PCR on patient pharyngeal swabs.Samples positive for at least 1 pathogen were obtained from 48.42% of the total patients. Of these pathogen-positive patients, 17.99% were infected with more than 1 pathogen. Of the 18 pathogens analyzed, four were detected with a positive detection rate (PDR > 5%: influenza A virus (IAV > respiratory syncytial virus (RSV >Mycoplasma pneumoniae (MP > human coronavirus (HCoV. The pathogens with the 4 highest co-infection rates (CIRs were as follows: HCoV > human bocavirus (HBoV > enterovirus (EV > parainfluenza virus (PIV. The overall positive detection rate (PDR varied significantly according to patient age, the season and year of detection, and the disease subgroup, but not according to patient sex. The individual PDRs of the pathogens followed 3 types of distributions for patient sex, 4 types of distributions for patient age, 4 types of seasonal distributions, 2 types of seasonal epidemic trends, 4 types of yearly epidemic trends, and different susceptibility distributions in the disease subgroups. Additionally, the overall CIR showed significantly different distributions according to patient sex, patient age, and the disease subgroup, whereas the CIRs of individual pathogens suggested significant preference characteristics.IAV remains the most common pathogen among the pathogens analyzed. More effort should be directed toward the prevention and control of pathogens that show a trend of increasing incidence such as HCoV, human adenovirus (ADV, and RSV. Although clinically

  10. Emergence and Adaptation of a Novel Highly Pathogenic H7N9 Influenza Virus in Birds and Humans from a 2013 Human-Infecting Low-Pathogenic Ancestor.

    Science.gov (United States)

    Qi, Wenbao; Jia, Weixin; Liu, Di; Li, Jing; Bi, Yuhai; Xie, Shumin; Li, Bo; Hu, Tao; Du, Yingying; Xing, Li; Zhang, Jiahao; Zhang, Fuchun; Wei, Xiaoman; Eden, John-Sebastian; Li, Huanan; Tian, Huaiyu; Li, Wei; Su, Guanming; Lao, Guangjie; Xu, Chenggang; Xu, Bing; Liu, Wenjun; Zhang, Guihong; Ren, Tao; Holmes, Edward C; Cui, Jie; Shi, Weifeng; Gao, George F; Liao, Ming

    2018-01-15

    Since its emergence in 2013, the H7N9 low-pathogenic avian influenza virus (LPAIV) has been circulating in domestic poultry in China, causing five waves of human infections. A novel H7N9 highly pathogenic avian influenza virus (HPAIV) variant possessing multiple basic amino acids at the cleavage site of the hemagglutinin (HA) protein was first reported in two cases of human infection in January 2017. More seriously, those novel H7N9 HPAIV variants have been transmitted and caused outbreaks on poultry farms in eight provinces in China. Herein, we demonstrate the presence of three different amino acid motifs at the cleavage sites of these HPAIV variants which were isolated from chickens and humans and likely evolved from the preexisting LPAIVs. Animal experiments showed that these novel H7N9 HPAIV variants are both highly pathogenic in chickens and lethal to mice. Notably, human-origin viruses were more pathogenic in mice than avian viruses, and the mutations in the PB2 gene associated with adaptation to mammals (E627K, A588V, and D701N) were identified by next-generation sequencing (NGS) and Sanger sequencing of the isolates from infected mice. No polymorphisms in the key amino acid substitutions of PB2 and HA in isolates from infected chicken lungs were detected by NGS. In sum, these results highlight the high degree of pathogenicity and the valid transmissibility of this new H7N9 variant in chickens and the quick adaptation of this new H7N9 variant to mammals, so the risk should be evaluated and more attention should be paid to this variant. IMPORTANCE Due to the recent increased numbers of zoonotic infections in poultry and persistent human infections in China, influenza A(H7N9) virus has remained a public health threat. Most of the influenza A(H7N9) viruses reported previously have been of low pathogenicity. Now, these novel H7N9 HPAIV variants have caused human infections in three provinces and outbreaks on poultry farms in eight provinces in China. We analyzed

  11. Preliminary Epidemiology of Human Infections with Highly Pathogenic Avian Influenza A(H7N9) Virus, China, 2017.

    Science.gov (United States)

    Zhou, Lei; Tan, Yi; Kang, Min; Liu, Fuqiang; Ren, Ruiqi; Wang, Yali; Chen, Tao; Yang, Yiping; Li, Chao; Wu, Jie; Zhang, Hengjiao; Li, Dan; Greene, Carolyn M; Zhou, Suizan; Iuliano, A Danielle; Havers, Fiona; Ni, Daxin; Wang, Dayan; Feng, Zijian; Uyeki, Timothy M; Li, Qun

    2017-08-01

    We compared the characteristics of cases of highly pathogenic avian influenza (HPAI) and low pathogenic avian influenza (LPAI) A(H7N9) virus infections in China. HPAI A(H7N9) case-patients were more likely to have had exposure to sick and dead poultry in rural areas and were hospitalized earlier than were LPAI A(H7N9) case-patients.

  12. The innate immunity of guinea pigs against highly pathogenic avian influenza virus infection.

    Science.gov (United States)

    Zhang, Kun; Xu, Wei Wei; Zhang, Zhaowei; Liu, Jing; Li, Jing; Sun, Lijuan; Sun, Weiyang; Jiao, Peirong; Sang, Xiaoyu; Ren, Zhiguang; Yu, Zhijun; Li, Yuanguo; Feng, Na; Wang, Tiecheng; Wang, Hualei; Yang, Songtao; Zhao, Yongkun; Zhang, Xuemei; Wilker, Peter R; Liu, WenJun; Liao, Ming; Chen, Hualan; Gao, Yuwei; Xia, Xianzhu

    2017-05-02

    H5N1 avian influenza viruses are a major pandemic concern. In contrast to the highly virulent phenotype of H5N1 in humans and many animal models, guinea pigs do not typically display signs of severe disease in response to H5N1 virus infection. Here, proteomic and transcriptional profiling were applied to identify host factors that account for the observed attenuation of A/Tiger/Harbin/01/2002 (H5N1) virulence in guinea pigs. RIG-I and numerous interferon stimulated genes were among host proteins with altered expression in guinea pig lungs during H5N1 infection. Overexpression of RIG-I or the RIG-I adaptor protein MAVS in guinea pig cell lines inhibited H5N1 replication. Endogenous GBP-1 expression was required for RIG-I mediated inhibition of viral replication upstream of the activity of MAVS. Furthermore, we show that guinea pig complement is involved in viral clearance, the regulation of inflammation, and cellular apoptosis during influenza virus infection of guinea pigs. This work uncovers features of the guinea pig innate immune response to influenza that may render guinea pigs resistant to highly pathogenic influenza viruses.

  13. The Immune Response against Acinetobacter baumannii, an Emerging Pathogen in Nosocomial Infections

    Science.gov (United States)

    García-Patiño, María Guadalupe; García-Contreras, Rodolfo; Licona-Limón, Paula

    2017-01-01

    Acinetobacter baumannii is the etiologic agent of a wide range of nosocomial infections, including pneumonia, bacteremia, and skin infections. Over the last 45 years, an alarming increase in the antibiotic resistance of this opportunistic microorganism has been reported, a situation that hinders effective treatments. In order to develop effective therapies against A. baumannii it is crucial to understand the basis of host–bacterium interactions, especially those concerning the immune response of the host. Different innate immune cells such as monocytes, macrophages, dendritic cells, and natural killer cells have been identified as important effectors in the defense against A. baumannii; among them, neutrophils represent a key immune cell indispensable for the control of the infection. Several immune strategies to combat A. baumannii have been identified such as recognition of the bacteria by immune cells through pattern recognition receptors, specifically toll-like receptors, which trigger bactericidal mechanisms including oxidative burst and cytokine and chemokine production to amplify the immune response against the pathogen. However, a complete picture of the protective immune strategies activated by this bacteria and its potential therapeutic use remains to be determined and explored. PMID:28446911

  14. Discrete time Markov chains (DTMC) susceptible infected susceptible (SIS) epidemic model with two pathogens in two patches

    Science.gov (United States)

    Lismawati, Eka; Respatiwulan; Widyaningsih, Purnami

    2017-06-01

    The SIS epidemic model describes the pattern of disease spread with characteristics that recovered individuals can be infected more than once. The number of susceptible and infected individuals every time follows the discrete time Markov process. It can be represented by the discrete time Markov chains (DTMC) SIS. The DTMC SIS epidemic model can be developed for two pathogens in two patches. The aims of this paper are to reconstruct and to apply the DTMC SIS epidemic model with two pathogens in two patches. The model was presented as transition probabilities. The application of the model obtain that the number of susceptible individuals decreases while the number of infected individuals increases for each pathogen in each patch.

  15. Convergent evolution of SIV env after independent inoculation of rhesus macaques with infectious proviral DNA

    International Nuclear Information System (INIS)

    Buckley, Kathleen A.; Li Peilin; Khimani, Anis H.; Hofmann-Lehmann, Regina; Liska, Vladimir; Anderson, Daniel C.; McClure, Harold M.; Ruprecht, Ruth M.

    2003-01-01

    The env gene of three simian immunodeficiency virus (SIV) variants developed convergent mutations during disease progression in six rhesus macaques. The monkeys had been inoculated with supercoiled plasmids encoding infectious proviruses of SIVmac239 (a pathogenic, wild-type strain), SIVΔ3 (the live attenuated vaccine strain derived from SIVmac239), or SIVΔ3+ (a pathogenic progeny virus that had evolved from SIVΔ3). All six monkeys developed immunodeficiency and progressed to fatal disease. Although many divergent mutations arose in env among the different hosts, three regions consistently mutated in all monkeys studied; these similar mutations developed independently even though the animals had received only a single infectious molecular clone rather than standard viral inocula that contain viral quasispecies. Together, these data indicate that the env genes of SIVmac239, SIVΔ3, and SIVΔ3+, in the context of different proviral backbones, evolve similarly in different hosts during disease progression

  16. Infections by pathogens with different transmission modes in feral cats from urban and rural areas of Korea.

    Science.gov (United States)

    Hwang, Jusun; Gottdenker, Nicole; Oh, Dae-Hyun; Lee, Hang; Chun, Myung-Sun

    2017-12-31

    In this study, we examine prevalences of three infectious pathogens with different transmission modes ( Bartonella henselae , hemoplasma, and Toxoplasma gondii ) in feral cats from urban and rural habitats. Infection status of the three pathogens in blood samples (n = 117) was determined through molecular or serological diagnostic methods. Overall prevalence of hemoplasma, Toxoplasma gondii , and Bartonella henselae was 47.9%, 50%, and 35.7%, respectively. Comparing the two habitats, only seroprevalence of Bartonella henselae was significantly higher in urban cats. Based on the results, we discuss how pathogens with distinct transmission modes may show different prevalence between urban and rural habitat types.

  17. Removal of waterborne pathogens from liver transplant unit water taps in prevention of healthcare-associated infections: a proposal for a cost-effective, proactive infection control strategy.

    Science.gov (United States)

    Zhou, Z Y; Hu, B J; Qin, L; Lin, Y E; Watanabe, H; Zhou, Q; Gao, X D

    2014-04-01

    Hospital water supplies often contain waterborne pathogens, which can become a reservoir for healthcare-associated infections (HAIs). We surveyed the extent of waterborne pathogen contamination in the water supply of a Liver Transplant Unit. The efficacy of point-of-use (POU) water filters was evaluated by comparative analysis in routine clinical use. Our baseline environmental surveillance showed that Legionella spp. (28%, 38/136), Pseudomonas aeruginosa (8%, 11/136), Mycobacterium spp. (87%, 118/136) and filamentous fungi (50%, 68/136) were isolated from the tap water of the Liver Transplant Unit. 28.9% of Legionella spp.-positive water samples (n = 38) showed high-level Legionella contamination (≥10(3) CFU/L). After installation of the POU water filter, none of these pathogens were found in the POU filtered water samples. Furthermore, colonizations/infections with Gram-negative bacteria determined from patient specimens were reduced by 47% during this period, even if only 27% (3/11) of the distal sites were installed with POU water filters. In conclusion, the presence of waterborne pathogens was common in the water supply of our Liver Transplant Unit. POU water filters effectively eradicated these pathogens from the water supply. Concomitantly, healthcare-associated colonization/infections declined after the POU filters were installed, indicating their potential benefit in reducing waterborne HAIs. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  18. Co-infection with arthropod-borne pathogens in domestic cats.

    Science.gov (United States)

    André, Marcos Rogério; Filgueira, Kilder Dantas; Calchi, Ana Cláudia; Sousa, Keyla Carstens Marques de; Gonçalves, Luiz Ricardo; Medeiros, Vitor Brasil; Ximenes, Poliana Araújo; Lelis, Ivana Cristina Nunes Gadelha; Meireles, Maria Vanuza Nunes de; Machado, Rosangela Zacarias

    2017-01-01

    The role of several feline vector-borne pathogens (FVBP) as a cause of disease in cats has not been clearly determined. In fact, with the exception of Bartonella spp. and hemoplasmas, FVBP in cats has not been clearly determined in Brazil yet. The present study aimed at identifying, by using molecular methods, the presence of FVBP in three cats showing non-specific clinical signs and inclusions suggestive of hemoparasites in blood smears. Cytauxzoon felis, 'Candidatus Mycoplasma haemominutum', Ehrlichia sp. closely related to Ehrlichia canis, and Anaplasma sp. closely related to Anaplasma phagocytophilum were detected in blood samples from two out of three sampled cats. Both cats positive for multiple FVBP did not show hematological and biochemical abnormalities. The present work emphasizes the need for molecular confirmation of co-infection by multiple FVBP in cats presenting non-specific clinical signs and inclusions resembling hemoparasites in blood smears.

  19. Co-infection with arthropod-borne pathogens in domestic cats

    Directory of Open Access Journals (Sweden)

    Marcos Rogério André

    2017-11-01

    Full Text Available Abstract The role of several feline vector-borne pathogens (FVBP as a cause of disease in cats has not been clearly determined. In fact, with the exception of Bartonella spp. and hemoplasmas, FVBP in cats has not been clearly determined in Brazil yet. The present study aimed at identifying, by using molecular methods, the presence of FVBP in three cats showing non-specific clinical signs and inclusions suggestive of hemoparasites in blood smears. Cytauxzoon felis, ‘Candidatus Mycoplasma haemominutum’, Ehrlichia sp. closely related to Ehrlichia canis, and Anaplasma sp. closely related to Anaplasma phagocytophilum were detected in blood samples from two out of three sampled cats. Both cats positive for multiple FVBP did not show hematological and biochemical abnormalities. The present work emphasizes the need for molecular confirmation of co-infection by multiple FVBP in cats presenting non-specific clinical signs and inclusions resembling hemoparasites in blood smears.

  20. Features of pathology in mice experimentally infected with highly pathogenic H5N1 influenza virus

    International Nuclear Information System (INIS)

    Ryabchikova, E. I.; Taranov, O. S.; Malkova, E. M.; Gritsyk, O. B.; Demina, O. K.

    2009-01-01

    Avian influenza became a new threat and has set people thinking about possibility of new influenza pandemic which may be caused by highly pathogenic H5N1 influenza virus. The virus could acquire ability of fast spreading between the humans and new pandemics could kill millions. Influenza virus H5N1 exhibited its deadly essence by taking out many millions of birds in nature and aviculture; other millions of chicks and ducks were killed to prevent spread of the epizootic. The strains isolated in Russia belong to Qinghai group of H5N1 influenza virus, and were imported to Russia by migratory birds. We examined time-course changes in mice blood and lungs after intranasal infection with strains A /Chicken/ Kurgan/ 05/2005, A/ Duck/ Kurgan/08/ 2005 and A/ Chicken/ Suzdalka/ Nov-11/2005 differing in virulence for this animal species. Development of leucopenia and severe damage of hemopoiesis were found in mice infected with all H5N1 influenza virus strains. Pathological changes in mice lungs during the infection with above mentioned strains, and strain-specific features have been examined. Main characteristics of lung pathology in all mice were focal nature of the alterations, severe damage of bronchial epithelium and pronounced alteration of lung vasculature. Strain A/Chicken/Suzdalka/Nov-11/2005 induced massive apoptosis of infected bronchial cells which may be a part of mechanism responsible for avirulent properties of this strain. The most interesting finding was absence of serious direct virus damage of the lung evidencing for principal role of the host humoral mechanisms in pathogenesis of H5N1 influenza in mice.(author)

  1. Transcriptome analysis of Pseudostellaria heterophylla in response to the infection of pathogenic Fusarium oxysporum.

    Science.gov (United States)

    Qin, Xianjin; Wu, Hongmiao; Chen, Jun; Wu, Linkun; Lin, Sheng; Khan, Muhammad Umar; Boorboori, Mohammad Reza; Lin, Wenxiong

    2017-09-18

    Pseudostellaria heterophylla (P. heterophylla), a herbaceous perennial, belongs to Caryophyllaceae family and is one of the Chinese herbal medicine with high pharmacodynamic value. It can be used to treat the spleen deficiency, anorexia, weakness after illness and spontaneous perspiration symptoms. Our previous study found that consecutive monoculture of Pseudostellaria heterophylla could lead to the deterioration of the rhizosphere microenvironment. The specialized forms of pathogenic fungus Fusarium oxysporum f.Sp. heterophylla (F. oxysporum) in rhizosphere soils of P. heterophylla plays an important role in the consecutive monoculture of P. heterophylla. In this study, F. oxysporum was used to infect the tissue culture plantlets of P. heterophylla to study the responding process at three different infection stages by using RNA-sequencing. We obtained 127,725 transcripts and 47,655 distinct unigenes by de novo assembly and obtained annotated information in details for 25,882 unigenes. The Kyoto Encyclopedia of Genes and Genomes pathway analysis and the real-time quantitative PCR results suggest that the calcium signal system and WRKY transcription factor in the plant-pathogen interaction pathway may play an important role in the response process, and all of the WRKY transcription factor genes were divided into three different types. Moreover, we also found that the stimulation of F. oxysporum may result in the accumulation of some phenolics in the plantlets and the programmed cell death of the plantlets. This study has partly revealed the possible molecular mechanism of the population explosion of F. oxysporum in rhizosphere soils and signal response process, which can be helpful in unraveling the role of F. oxysporum in consecutive monoculture problems of P. heterophylla.

  2. Neuropathogenesis of a highly pathogenic avian influenza virus (H7N1 in experimentally infected chickens

    Directory of Open Access Journals (Sweden)

    Chaves Aida J

    2011-10-01

    Full Text Available Abstract In order to understand the mechanism of neuroinvasion of a highly pathogenic avian influenza virus (HPAIV into the central nervous system (CNS of chickens, specific pathogen free chickens were inoculated with a H7N1 HPAIV. Blood, cerebrospinal fluid (CSF, nasal cavity and brain tissue samples were obtained from 1 to 4 days post-inoculation (dpi of infected and control chickens. Viral antigen topographical distribution, presence of influenza A virus receptors in the brain, as well as, the role of the olfactory route in virus CNS invasion were studied using different immunohistochemistry techniques. Besides, viral RNA load in CSF and blood was quantified by means of a quantitative real-time reverse transcription-polymerase chain reaction. Viral antigen was observed widely distributed in the CNS, showing bilateral and symmetrical distribution in the nuclei of the diencephalon, mesencephalon and rhombencephalon. Viral RNA was detected in blood and CSF at one dpi, indicating that the virus crosses the blood-CSF-barrier early during infection. This early dissemination is possibly favoured by the presence of Siaα2,3 Gal and Siaα2,6 Gal receptors in brain vascular endothelial cells, and Siaα2,3 Gal receptors in ependymal and choroid plexus cells. No viral antigen was observed in olfactory sensory neurons, while the olfactory bulb showed only weak staining, suggesting that the virus did not use this pathway to enter into the brain. The sequence of virus appearance and the topographical distribution of this H7N1 HPAIV indicate that the viral entry occurs via the haematogenous route, with early and generalized spreading through the CSF.

  3. Neuropathogenesis of a highly pathogenic avian influenza virus (H7N1) in experimentally infected chickens.

    Science.gov (United States)

    Chaves, Aida J; Busquets, Núria; Valle, Rosa; Rivas, Raquel; Vergara-Alert, Júlia; Dolz, Roser; Ramis, Antonio; Darji, Ayub; Majó, Natàlia

    2011-10-07

    In order to understand the mechanism of neuroinvasion of a highly pathogenic avian influenza virus (HPAIV) into the central nervous system (CNS) of chickens, specific pathogen free chickens were inoculated with a H7N1 HPAIV. Blood, cerebrospinal fluid (CSF), nasal cavity and brain tissue samples were obtained from 1 to 4 days post-inoculation (dpi) of infected and control chickens. Viral antigen topographical distribution, presence of influenza A virus receptors in the brain, as well as, the role of the olfactory route in virus CNS invasion were studied using different immunohistochemistry techniques. Besides, viral RNA load in CSF and blood was quantified by means of a quantitative real-time reverse transcription-polymerase chain reaction. Viral antigen was observed widely distributed in the CNS, showing bilateral and symmetrical distribution in the nuclei of the diencephalon, mesencephalon and rhombencephalon. Viral RNA was detected in blood and CSF at one dpi, indicating that the virus crosses the blood-CSF-barrier early during infection. This early dissemination is possibly favoured by the presence of Siaα2,3 Gal and Siaα2,6 Gal receptors in brain vascular endothelial cells, and Siaα2,3 Gal receptors in ependymal and choroid plexus cells. No viral antigen was observed in olfactory sensory neurons, while the olfactory bulb showed only weak staining, suggesting that the virus did not use this pathway to enter into the brain. The sequence of virus appearance and the topographical distribution of this H7N1 HPAIV indicate that the viral entry occurs via the haematogenous route, with early and generalized spreading through the CSF.

  4. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Science.gov (United States)

    Comin, Arianna; Stegeman, Arjan; Marangon, Stefano; Klinkenberg, Don

    2012-01-01

    In recent years, the early detection of low pathogenicity avian influenza (LPAI) viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms) was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h)). The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h) reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control). Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier), whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus introduction

  5. Evaluating surveillance strategies for the early detection of low pathogenicity avian influenza infections.

    Directory of Open Access Journals (Sweden)

    Arianna Comin

    Full Text Available In recent years, the early detection of low pathogenicity avian influenza (LPAI viruses in poultry has become increasingly important, given their potential to mutate into highly pathogenic viruses. However, evaluations of LPAI surveillance have mainly focused on prevalence and not on the ability to act as an early warning system. We used a simulation model based on data from Italian LPAI epidemics in turkeys to evaluate different surveillance strategies in terms of their performance as early warning systems. The strategies differed in terms of sample size, sampling frequency, diagnostic tests, and whether or not active surveillance (i.e., routine laboratory testing of farms was performed, and were also tested under different epidemiological scenarios. We compared surveillance strategies by simulating within-farm outbreaks. The output measures were the proportion of infected farms that are detected and the farm reproduction number (R(h. The first one provides an indication of the sensitivity of the surveillance system to detect within-farm infections, whereas R(h reflects the effectiveness of outbreak detection (i.e., if detection occurs soon enough to bring an epidemic under control. Increasing the sampling frequency was the most effective means of improving the timeliness of detection (i.e., it occurs earlier, whereas increasing the sample size increased the likelihood of detection. Surveillance was only effective in preventing an epidemic if actions were taken within two days of sampling. The strategies were not affected by the quality of the diagnostic test, although performing both serological and virological assays increased the sensitivity of active surveillance. Early detection of LPAI outbreaks in turkeys can be achieved by increasing the sampling frequency for active surveillance, though very frequent sampling may not be sustainable in the long term. We suggest that, when no LPAI virus is circulating yet and there is a low risk of virus

  6. Genotyping of TRIM5 locus in northern pig-tailed macaques (Macaca leonina, a primate species susceptible to Human Immunodeficiency Virus type 1 infection

    Directory of Open Access Journals (Sweden)

    Jiang Xue-Long

    2009-06-01

    Full Text Available Abstract Background The pig-tailed macaques are the only Old World monkeys known to be susceptible to human immunodeficiency virus type 1 (HIV-1 infection. We have previously reported that the TRIM5-Cyclophilin A (TRIMCyp fusion in pig-tailed macaques (Macaca nemestrina is dysfunctional in restricting HIV-1, which may explain why pig-tailed macaques are susceptible to HIV-1 infection. Similar results have also been reported by other groups. However, according to the current primate taxonomy, the previously reported M. nemestrina are further classified into three species, which all belong to the Macaca spp. This calls for the need to look into the previous studies in more details. Results The local species Northern pig-tailed macaque (M. leonina was analyzed for the correlation of TRIM5 structure and HIV-1 infection. Eleven M. leonina animals were analyzed, and all of them were found to possess TRIM5-CypA fusion at the TRIM5 locus. The transcripts encoding the dysfunctional TRIM5-CypA should result from the G-to-T mutation in the 3'-splicing site of intron 6. Polymorphism in the putative TRIMCyp recognition domain was observed. The peripheral blood mononuclear cells (PBMCs of M. leonina were susceptible to HIV-1 infection. Consistent with the previous results, expression of the M. leonina TRIMCyp in HeLa-T4 cells rendered the cells resistant to HIV-2ROD but not to SIVmac239 infection. Conclusion The susceptibility of M. leonina to HIV-1 infection is due to the dysfunctional TRIM5-CypA fusion in the TRIM5 locus. This finding should broaden our perspective in developing better HIV/AIDS non-human primate animal models.

  7. Induced Release of a Plant-Defense Volatile ‘Deceptively’ Attracts Insect Vectors to Plants Infected with a Bacterial Pathogen

    Science.gov (United States)

    Mann, Rajinder S.; Ali, Jared G.; Hermann, Sara L.; Tiwari, Siddharth; Pelz-Stelinski, Kirsten S.; Alborn, Hans T.; Stelinski, Lukasz L.

    2012-01-01

    Transmission of plant pathogens by insect vectors is a complex biological process involving interactions between the plant, insect, and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites as well as major plant nutrients. Experiments were conducted to understand how a plant pathogenic bacterium, Candidatus Liberibacter asiaticus (Las), affects host preference behavior of its psyllid (Diaphorina citri Kuwayama) vector. D. citri were attracted to volatiles from pathogen-infected plants more than to those from non-infected counterparts. Las-infected plants were more attractive to D. citri adults than non-infected plants initially; however after feeding, psyllids subsequently dispersed to non-infected rather than infected plants as their preferred settling point. Experiments with Las-infected and non-infected plants under complete darkness yielded similar results to those recorded under light. The behavior of psyllids in response to infected versus non-infected plants was not influenced by whether or not they were carriers of the pathogen. Quantification of volatile release from non-infected and infected plants supported the hypothesis that odorants mediate psyllid preference. Significantly more methyl salicylate, yet less methyl anthranilate and D-limonene, was released by infected than non-infected plants. Methyl salicylate was attractive to psyllids, while methyl anthranilate did not affect their behavior. Feeding on citrus by D. citri adults also induced release of methyl salicylate, suggesting that it may be a cue revealing location of conspecifics on host plants. Infected plants were characterized by lower levels of nitrogen, phosphorus, sulfur, zinc, and iron, as well as, higher levels of potassium and boron than non-infected plants. Collectively, our results suggest that host selection behavior of D. citri may be modified by bacterial infection of plants, which alters release of specific headspace

  8. Gastrointestinal and urinary tract pathogenic infections among HIV seropositive patients at the Komfo Anokye Teaching Hospital in Ghana.

    Science.gov (United States)

    Boaitey, Yaw Agyekum; Nkrumah, Bernard; Idriss, Ali; Tay, Samuel Crowther Kofi

    2012-08-21

    Gastrointestinal and urinary tract pathogenic infections are aggravating the incidence and progression of the Human Immunodeficiency Virus (HIV) infection into Acquired Immune Deficiency Syndrome (AIDS) more especially in the developing countries. This study was conducted to assess the common gastrointestinal and urinary infections among HIV/AIDS patients at the Komfo Anokye Teaching Hospital (KATH) in Ghana between April and December 2008. This work reports on gastrointestinal and urinary tract pathogenic infections among 500 HIV seropositive and 300 HIV seronegative patients. There was a 35% (175/500) prevalence of intestinal parasites among HIV seropositive patients compared to 4.3% (13/300) in HIV seronegative patients. Giardia lamblia and Cryptosporidium accounted for 19% (95/500) and 14% (70/500) respectively, while Schistosoma mansoni, Strongyloides stercoralis and hookworm together accounted for 2% (10/500) of intestinal parasitic infections among the HIV seropositive patients. There was no significant difference (p > 0.05) in urinary parasitic infection between HIV seropositive 1% (2/500) and seronegative patients 0.7% (2/300). Most, 60 (86%) out of 70, of the urinary tract infection among the HIV seropositive patients was due to bacteria with E. coli being the most predominant isolate, 28 (47%) out of 60. There was no significant difference in infections based on age and gender. G. lamblia and Cryptosporidium were the most common gastrointestinal parasites detected while bacteria accounted for majority of the urinary tract infections among the HIV seropositive patients at the hospital.

  9. Viral Small-RNA Analysis of Bombyx mori Larval Midgut during Persistent and Pathogenic Cytoplasmic Polyhedrosis Virus Infection

    OpenAIRE

    Zografidis, Aris; Van Nieuwerburgh, Filip; Kolliopoulou, Anna; Apostolou-Karampelis, Konstantinos; Head, Steven R.; Deforce, Dieter; Smagghe, Guy; Swevers, Luc

    2015-01-01

    The lepidopteran innate immune response against RNA viruses remains poorly understood, while in other insects several studies have highlighted an essential role for the exo-RNAi pathway in combating viral infection. Here, by using deep-sequencing technology for viral small-RNA (vsRNA) assessment, we provide evidence that exo-RNAi is operative in the silkworm Bombyx mori against both persistent and pathogenic infection of B. mori cytoplasmic polyhedrosis virus (BmCPV) which is characterized by...

  10. THE “CHALLENGING” MULTIDRUG-RESISTANT PATHOGENS OF NOSOCOMIAL INFECTIONS IN CRITICALLY ILL PATIENTS (A LITERATURE REVIEW

    Directory of Open Access Journals (Sweden)

    T. V. Chernenkaya

    2015-01-01

    Full Text Available ABSTRACT. Changes in the structure of the main causative agents of nosocomial infections and significant spread of multidrug­resistant strains of bacteria are a natural biological response for antibiotics that selectively inhibit pathogens and contribute to selection, survival and growth of drug resistant strains of bacteria. In this literature review we present the change of structure of the major causative microorganisms of nosocomial septic infections and theirs resistance to antibiotics for the last 70 years. 

  11. Priming by Rhizobacterium Protects Tomato Plants from Biotrophic and Necrotrophic Pathogen Infections through Multiple Defense Mechanisms

    Science.gov (United States)

    Ahn, Il-Pyung; Lee, Sang-Woo; Kim, Min Gab; Park, Sang-Ryeol; Hwang, Duk-Ju; Bae, Shin-Chul

    2011-01-01

    A selected strain of rhizobacterium, Pseudomonas putida strain LSW17S (LSW17S), protects tomato plants (Lycopersicon esculentum L. cv. Seokwang) from bacterial speck by biotrophic Pseudomonas syringae pv. tomato strain DC3000 (DC3000) and bacterial wilt by necrotrophic Ralstonia solanacearum KACC 10703 (Rs10703). To investigate defense mechanisms induced by LSW17S in tomato plants, transcription patterns of pathogenesis-related (PR) genes and H2O2 production were analyzed in plants treated with LSW17S and subsequent pathogen inoculation. LSW17S alone did not induce transcriptions of employed PR genes in leaves and roots. DC3000 challenge following LSW17S triggered rapid transcriptions of PR genes and H2O2 production in leaves and roots. Catalase infiltration with DC3000 attenuated defense-related responses and resistance against DC3000 infection. Despite depriving H2O2 production and PR1b transcription by the same treatment, resistance against Rs10703 infection was not deterred significantly. H2O2 is indispensable for defense signaling and/or mechanisms primed by LSW17S and inhibition of bacterial speck, however, it is not involved in resistance against bacterial wilt. PMID:21710203

  12. Immunological Control of Viral Infections in Bats and the Emergence of Viruses Highly Pathogenic to Humans

    Directory of Open Access Journals (Sweden)

    Tony Schountz

    2017-09-01

    Full Text Available Bats are reservoir hosts of many important viruses that cause substantial disease in humans, including coronaviruses, filoviruses, lyssaviruses, and henipaviruses. Other than the lyssaviruses, they do not appear to cause disease in the reservoir bats, thus an explanation for the dichotomous outcomes of infections of humans and bat reservoirs remains to be determined. Bats appear to have a few unusual features that may account for these differences, including evidence of constitutive interferon (IFN activation and greater combinatorial diversity in immunoglobulin genes that do not undergo substantial affinity maturation. We propose these features may, in part, account for why bats can host these viruses without disease and how they may contribute to the highly pathogenic nature of bat-borne viruses after spillover into humans. Because of the constitutive IFN activity, bat-borne viruses may be shed at low levels from bat cells. With large naive antibody repertoires, bats may control the limited virus replication without the need for rapid affinity maturation, and this may explain why bats typically have low antibody titers to viruses. However, because bat viruses have evolved in high IFN environments, they have enhanced countermeasures against the IFN response. Thus, upon infection of human cells, where the IFN response is not constitutive, the viruses overwhelm the IFN response, leading to abundant virus replication and pathology.

  13. Microfluidic system for the identification of bacterial pathogens causing urinary tract infections

    Science.gov (United States)

    Becker, Holger; Hlawatsch, Nadine; Haraldsson, Tommy; van der Wijngaart, Wouter; Lind, Anders; Malhotra-Kumar, Surbi; Turlej-Rogacka, Agata; Goossens, Herman

    2015-03-01

    Urinary tract infections (UTIs) are among the most common bacterial infections and pose a significant healthcare burden. The growing trend in antibiotic resistance makes it mandatory to develop diagnostic kits which allow not only the determination of a pathogen but also the antibiotic resistances. We have developed a microfluidic cartridge which takes a direct urine sample, extracts the DNA, performs an amplification using batch-PCR and flows the sample over a microarray which is printed into a microchannel for fluorescence detection. The cartridge is injection-molded out of COP and contains a set of two-component injection-molded rotary valves to switch between input and to isolate the PCR chamber during thermocycling. The hybridization probes were spotted directly onto a functionalized section of the outlet microchannel. We have been able to successfully perform PCR of E.coli in urine in this chip and perform a fluorescence detection of PCR products. An upgraded design of the cartridge contains the buffers and reagents in blisters stored on the chip.

  14. Hyperglycemia Impairs Neutrophil-Mediated Bacterial Clearance in Mice Infected with the Lyme Disease Pathogen.

    Directory of Open Access Journals (Sweden)

    Ashkan Javid

    Full Text Available Insulin-insufficient type 1 diabetes is associated with attenuated bactericidal function of neutrophils, which are key mediators of innate immune responses to microbes as well as pathological inflammatory processes. Neutrophils are central to immune responses to the Lyme pathogen Borrelia burgdorferi. The effect of hyperglycemia on host susceptibility to and outcomes of B. burgdorferi infection has not been examined. The present study investigated the impact of sustained obesity-independent hyperglycemia in mice on bacterial clearance, inflammatory pathology and neutrophil responses to B. burgdorferi. Hyperglycemia was associated with reduced arthritis incidence but more widespread tissue colonization and reduced clearance of bacterial DNA in multiple tissues including brain, heart, liver, lung and knee joint. B. burgdorferi uptake and killing were impaired in neutrophils isolated from hyperglycemic mice. Thus, attenuated neutrophil function in insulin-insufficient hyperglycemia was associated with reduced B. burgdorferi clearance in target organs. These data suggest that investigating the effects of comorbid conditions such as diabetes on outcomes of B. burgdorferi infections in humans may be warranted.

  15. Sugarcane Elongin C is involved in infection by sugarcane mosaic disease pathogens.

    Science.gov (United States)

    Zhai, Yushan; Deng, Yuqing; Cheng, Guangyuan; Peng, Lei; Zheng, Yanru; Yang, Yongqing; Xu, Jingsheng

    2015-10-23

    Sugarcane (Saccharum sp. hybrid) provides the main source of sugar for humans. Sugarcane mosaic disease (SMD) is a major threat to sugarcane production. Currently, control of SMD is mainly dependent on breeding resistant cultivars through hybridization, which is time-consuming. Understanding the mechanism of viral infection may facilitate novel strategies to breed cultivars resistant to SMD and to control the disease. In this study, a wide interaction was detected between the viral VPg protein and host proteins. Several genes were screened from sugarcane cDNA library that could interact with Sugarcane streak mosaic virus VPg, including SceIF4E1 and ScELC. ScELC was predicted to be a cytoplasmic protein, but subcellular localization analysis showed it was distributed both in cytoplasmic and nuclear, and interactions were also detected between ScELC and VPg of SCMV or SrMV that reveal ScELC was widely used in the SMD pathogen infection process. ScELC and VPgs interacted in the nucleus, and may function to enhance the viral transcription rate. ScELC also interacted with SceIF4E2 both in the cytoplasm and nucleus, but not with SceIF4E1 and SceIF4E3. These results suggest that ScELC may be essential for the function of SceIF4E2, an isomer of eIF4E. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae).

    Science.gov (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina

    2018-01-23

    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Unlikely remedy: fungicide clears infection from pathogenic fungus in larval southern leopard frogs (Lithobates sphenocephalus.

    Directory of Open Access Journals (Sweden)

    Shane M Hanlon

    Full Text Available Amphibians are often exposed to a wide variety of perturbations. Two of these, pesticides and pathogens, are linked to declines in both amphibian health and population viability. Many studies have examined the separate effects of such perturbations; however, few have examined the effects of simultaneous exposure of both to amphibians. In this study, we exposed larval southern leopard frog tadpoles (Lithobates sphenocephalus to the chytrid fungus Batrachochytrium dendrobatidis and the fungicide thiophanate-methyl (TM at 0.6 mg/L under laboratory conditions. The experiment was continued until all larvae completed metamorphosis or died. Overall, TM facilitated increases in tadpole mass and length. Additionally, individuals exposed to both TM and Bd were heavier and larger, compared to all other treatments. TM also cleared Bd in infected larvae. We conclude that TM affects larval anurans to facilitate growth and development while clearing Bd infection. Our findings highlight the need for more research into multiple perturbations, specifically pesticides and disease, to further promote amphibian heath.

  18. Unexpected infection outcomes of China-origin H7N9 low pathogenicity avian influenza virus in turkeys.

    Science.gov (United States)

    Slomka, Marek J; Seekings, Amanda H; Mahmood, Sahar; Thomas, Saumya; Puranik, Anita; Watson, Samantha; Byrne, Alexander M P; Hicks, Daniel; Nunez, Alejandro; Brown, Ian H; Brookes, Sharon M

    2018-05-09

    The China-origin H7N9 low pathogenicity avian influenza virus (LPAIV) emerged as a zoonotic threat in 2013 where it continues to circulate in live poultry markets. Absence of overt clinical signs in poultry is a typical LPAIV infection outcome, and has contributed to its insidious maintenance in China. This study is the first description of H7N9 LPAIV (A/Anhui/1/13) infection in turkeys, with efficient transmission to two additional rounds of introduced contact turkeys which all became infected during cohousing. Surprisingly, mortality was observed in six of eight (75%) second-round contact turkeys which is unusual for LPAIV infection, with unexpected systemic dissemination to many organs beyond the respiratory and enteric tracts, but interestingly no accompanying mutation to highly pathogenic AIV. The intravenous pathogenicity index score for a turkey-derived isolate (0.39) affirmed the LPAIV phenotype. However, the amino acid change L235Q in the haemagglutinin gene occurred in directly-infected turkeys and transmitted to the contacts, including those that died and the two which resolved infection to survive to the end of the study. This polymorphism was indicative of a reversion from mammalian to avian adaptation for the H7N9 virus. This study underlined a new risk to poultry in the event of H7N9 spread beyond China.

  19. Genetically-barcoded SIV facilitates enumeration of rebound variants and estimation of reactivation rates in nonhuman primates following interruption of suppressive antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Christine M Fennessey

    2017-05-01

    Full Text Available HIV and SIV infection dynamics are commonly investigated by measuring plasma viral loads. However, this total viral load value represents the sum of many individual infection events, which are difficult to independently track using conventional sequencing approaches. To overcome this challenge, we generated a genetically tagged virus stock (SIVmac239M with a 34-base genetic barcode inserted between the vpx and vpr accessory genes of the infectious molecular clone SIVmac239. Next-generation sequencing of the virus stock identified at least 9,336 individual barcodes, or clonotypes, with an average genetic distance of 7 bases between any two barcodes. In vitro infection of rhesus CD4+ T cells and in vivo infection of rhesus macaques revealed levels of viral replication of SIVmac239M comparable to parental SIVmac239. After intravenous inoculation of 2.2x105 infectious units of SIVmac239M, an average of 1,247 barcodes were identified during acute infection in 26 infected rhesus macaques. Of the barcodes identified in the stock, at least 85.6% actively replicated in at least one animal, and on average each barcode was found in 5 monkeys. Four infected animals were treated with combination antiretroviral therapy (cART for 82 days starting on day 6 post-infection (study 1. Plasma viremia was reduced from >106 to <15 vRNA copies/mL by the time treatment was interrupted. Virus rapidly rebounded following treatment interruption and between 87 and 136 distinct clonotypes were detected in plasma at peak rebound viremia. This study confirmed that SIVmac239M viremia could be successfully curtailed with cART, and that upon cART discontinuation, rebounding viral variants could be identified and quantified. An additional 6 animals infected with SIVmac239M were treated with cART beginning on day 4 post-infection for 305, 374, or 482 days (study 2. Upon treatment interruption, between 4 and 8 distinct viral clonotypes were detected in each animal at peak rebound

  20. Host and Pathogen Copper-Transporting P-Type ATPases Function Antagonistically during Salmonella Infection.

    Science.gov (United States)

    Ladomersky, Erik; Khan, Aslam; Shanbhag, Vinit; Cavet, Jennifer S; Chan, Jefferson; Weisman, Gary A; Petris, Michael J

    2017-09-01

    Copper is an essential yet potentially toxic trace element that is required by all aerobic organisms. A key regulator of copper homeostasis in mammalian cells is the copper-transporting P-type ATPase ATP7A, which mediates copper transport from the cytoplasm into the secretory pathway, as well as copper export across the plasma membrane. Previous studies have shown that ATP7A-dependent copper transport is required for killing phagocytosed Escherichia coli in a cultured macrophage cell line. In this investigation, we expanded on these studies by generating Atp7a LysMcre mice, in which the Atp7a gene was specifically deleted in cells of the myeloid lineage, including macrophages. Primary macrophages isolated from Atp7a LysMcre mice exhibit decreased copper transport into phagosomal compartments and a reduced ability to kill Salmonella enterica serovar Typhimurium compared to that of macrophages isolated from wild-type mice. The Atp7a LysMcre mice were also more susceptible to systemic infection by S Typhimurium than wild-type mice. Deletion of the S Typhimurium copper exporters, CopA and GolT, was found to decrease infection in wild-type mice but not in the Atp7a LysMcre mice. These studies suggest that ATP7A-dependent copper transport into the phagosome mediates host defense against S Typhimurium, which is counteracted by copper export from the bacteria via CopA and GolT. These findings reveal unique and opposing functions for copper transporters of the host and pathogen during infection. Copyright © 2017 American Society for Microbiology.

  1. Immunomodulation of Host Chitinase 3-Like 1 During a Mammary Pathogenic Escherichia coli Infection

    Directory of Open Access Journals (Sweden)

    Koen Breyne

    2018-05-01

    Full Text Available Chitin is a N-acetyl-d-glucosamine biopolymer that can be recognized by chitin-binding proteins. Although mammals lack chitin synthase, they induce proteins responsible for detecting chitin in response to bacterial infections. Our aim was to investigate whether chitinase 3-like 1 (CHI3L1 has a potential role in the innate immunity of the Escherichia coli (E. coli infected mammary gland. CHI3L1 protein was found to be secreted in whey of naturally coliform-affected quarters compared to whey samples isolated from healthy udders. In addition, gene expression of CHI3L1 was confirmed in udder tissue of cows experimentally infected with a mammary pathogenic E. coli (MPEC strain. Despite the known anatomical differences, the bovine udders’ innate immune response was mimicked by applying an experimental mouse model using MPEC or non-MPEC isolates. The effect of CHI3L1 expression in the murine mammary gland in response to coliform bacteria was investigated through the use of CHI3L1−/− mice as well as through treatment with either a pan-caspase inhibitor or chitin particles in wild-type mice. The local induction of CHI3L1 postinfection with different E. coli strains was demonstrated to be independent of both bacterial growth and mammary interleukin (IL-8 levels. Indeed, CHI3L1 emerged as a regulator impacting on the transcytosis of Ly6G-positive cells from the interstitial space into the alveolar lumen of the mammary tissue. Furthermore, CHI3L1 was found to be upstream regulated by caspase activity and had a major downstream effect on the local pro-inflammatory cytokine profile, including IL-1beta, IL-6, and RANTES/CCL5. In conclusion, CHI3L1 was demonstrated to play a key role in the cytokine and caspase signaling during E. coli triggered inflammation of the mammary gland.

  2. Modulation of Quorum Sensing in a Gram Positive Pathogen by Linear Imprinted Copolymers with anti-Infective Properties

    NARCIS (Netherlands)

    Motib, Anfal; Guerreiro, Antonio; Al-Bayati, Firas; Piletska, Elena; Manzoor, Irfan; Shafeeq, Sulman; Kadam, Anagha; Kuipers, Oscar; Hiller, Luisa; Cowen, Todd; Piletsky, Sergey; Andrew, Peter; Yesilkaya, Hasan

    2017-01-01

    Here we describe the development, characterization and biological testing of a new type of linear molecularly imprinted polymer (LMIP) designed to act as anti-infective by blocking the quorum sensing (QS) mechanism and so preventing virulence of the pathogen Streptococcus pneumoniae. The LMIP is

  3. Urethritis/cervicitis pathogen prevalence and associated risk factors among asymptomatic HIV-infected patients in South Africa.

    Science.gov (United States)

    Lewis, David A; Chirwa, Tobias F; Msimang, Veerle M Y; Radebe, Frans M; Kamb, Mary L; Firnhaber, Cynthia S

    2012-07-01

    To determine sexually transmitted infection (STI) prevalence, and patient characteristics associated with detection of urethritis/cervicitis pathogens, among HIV-infected individuals offered voluntary STI screening at a South African HIV treatment center. Individuals, asymptomatic for genital discharge, were screened for Neisseria gonorrhoeae (NG), Chlamydia trachomatis, Trichomonas vaginalis (TV), Mycoplasma genitalium (MG) infections (real-time polymerase chain reaction assay), for syphilis and herpes simplex type 2 (serologically), and for bacterial vaginosis and Candida (microscopy, women only). Patients' most recent CD4 and viral load results were recorded. Demographic, clinical, and behavioral data were collected by nurse-administered questionnaire. Compared with men (n = 551), women (n = 558) were younger (mean age, 35.0 vs. 37.9 years; P urethritis/cervicitis pathogens detected (21.3% vs.16.4%, P = 0.035), and were less aware of their partner's HIV status (53.1% vs. 62.3%; P = 0.007). The overall prevalence of individual urethritis/cervicitis pathogens was TV (7.6%), MG (6.1%), NG (5.4%), and C. trachomatis (2.1%). Multivariate analysis highlighted 4 significant factors associated with the detection of specific urethritis/cervicitis pathogens, namely female gender (TV, adjusted odds ratio [aOR] 2.53, 95% confidence interval [CI]: 1.47-4.37), having a regular sexual partner in the past 3 months (NG, aOR 2.26, 95% CI: 1.01-5.08), suboptimal condom use with regular partners (TV, aOR 2.07, 95% CI: 1.25-3.42), and a history of genital warts in the past year (NG, 2.25, 95% CI: 1.26-4.03). Asymptomatic urethritis/cervicitis pathogens were highly prevalent in this population. Few urethritis/cervicitis pathogen-associated patient characteristics were identified, emphasizing the need for affordable STI diagnostics to screen HIV-infected patients.

  4. Incidence of Cercopithifilaria bainae in dogs and probability of co-infection with other tick-borne pathogens.

    Directory of Open Access Journals (Sweden)

    Rafael Antonio Nascimento Ramos

    Full Text Available BACKGROUND: Cercopithifilaria bainae is a filarioid parasite that infects dogs, being transmitted by Rhipicephalus sanguineus group ticks in many countries of the Mediterranean basin. This study assessed the incidence density rate (IDR of infection by C. bainae in dogs and the probability of co-infection with other tick-borne pathogens (i.e., Anaplasma platys, Babesia vogeli and Hepatozoon canis, in an area of high endemicity in southern Italy. METHODOLOGY/PRINCIPAL FINDINGS: From March 2011 to October 2012, a field study involving 58 young dogs naturally exposed to tick infestation was conducted. Skin and blood samples obtained from each dog six times during an 18-month period were tested for C. bainae by parasite detection within skin snip sediments, with subsequent confirmation through PCR and DNA sequencing. Dogs examined monthly for ticks and A. platys, B. vogeli and H. canis were microscopically and/or molecularly diagnosed and after the first and the second summer seasons, the IDR for positive animal-month at risk was 3.8% and 1.7% in November 2011 and October 2012, respectively. All 58 C. bainae-infected dogs were simultaneously infected with at least one other tick-borne pathogen. After the first summer season (assessment in November 2011, a C. bainae-infected dog had a 33% probability of being infected with H. canis or A. platys, whereas after the second tick season (assessment in October 2012 the probability of co-infection was 78%, 22% and 11% for H. canis, A. platys and B. vogeli, respectively. CONCLUSIONS: Our data indicate that tick-infested dogs are at risk of acquiring infection by C. bainae. In addition, the detection of C. bainae microfilariae indicates a prior tick exposure and, should stimulate testing for other tick-borne disease causing pathogens.

  5. A Broad-Spectrum Infection Diagnostic that Detects Pathogen-Associated Molecular Patterns (PAMPs) in Whole Blood.

    Science.gov (United States)

    Cartwright, Mark; Rottman, Martin; Shapiro, Nathan I; Seiler, Benjamin; Lombardo, Patrick; Gamini, Nazita; Tomolonis, Julie; Watters, Alexander L; Waterhouse, Anna; Leslie, Dan; Bolgen, Dana; Graveline, Amanda; Kang, Joo H; Didar, Tohid; Dimitrakakis, Nikolaos; Cartwright, David; Super, Michael; Ingber, Donald E

    2016-07-01

    Blood cultures, and molecular diagnostic tests that directly detect pathogen DNA in blood, fail to detect bloodstream infections in most infected patients. Thus, there is a need for a rapid test that can diagnose the presence of infection to triage patients, guide therapy, and decrease the incidence of sepsis. An Enzyme-Linked Lectin-Sorbent Assay (ELLecSA) that uses magnetic microbeads coated with an engineered version of the human opsonin, Mannose Binding Lectin, containing the Fc immunoglobulin domain linked to its carbohydrate recognition domain (FcMBL) was developed to quantify pathogen-associated molecular patterns (PAMPs) in whole blood. This assay was tested in rats and pigs to explore whether it can detect infections and monitor disease progression, and in prospectively enrolled, emergency room patients with suspected sepsis. These results were also compared with data obtained from non-infected patients with or without traumatic injuries. The FcMBL ELLecSA was able to detect PAMPS present on, or released by, 85% of clinical isolates representing 47 of 55 different pathogen species, including the most common causes of sepsis. The PAMP assay rapidly (animals, even when blood cultures were negative and bacteriocidal antibiotics were administered. In patients with suspected sepsis, the FcMBL ELLecSA detected infection in 55 of 67 patients with high sensitivity (>81%), specificity (>89%), and diagnostic accuracy of 0·87. It also distinguished infection from trauma-related inflammation in the same patient cohorts with a higher specificity than the clinical sepsis biomarker, C-reactive Protein. The FcMBL ELLecSA-based PAMP assay offers a rapid, simple, sensitive and specific method for diagnosing infections, even when blood cultures are negative and antibiotic therapy has been initiated. It may help to triage patients with suspected systemic infections, and serve as a companion diagnostic to guide administration of emerging dialysis-like sepsis therapies

  6. Antimicrobial resistance in pathogens causing urinary tract infections in a rural community of Odisha, India

    Directory of Open Access Journals (Sweden)

    Muktikesh Dash

    2013-01-01

    Full Text Available Background: Antimicrobial resistance of urinary tract pathogens has increased worldwide. Empiric treatment of community-acquired urinary tract infection (CA-UTI is determined by antimicrobial resistance patterns of uropathogens in a population of specific geographical location. Objectives: This study was conducted to determine the prevalence of CA-UTI in rural Odisha, India, and the effect of gender and age on its prevalence as well as etiologic agents and the resistance profile of the bacterial isolates. Materials and Methods: Consecutive clean-catch mid-stream urine samples were collected from 1670 adult patients. The urine samples were processed and microbial isolates were identified by conventional methods. Antimicrobial susceptibility testing was performed on all bacterial isolates by Kirby Bauer′s disc diffusion method. Results: The prevalence of UTI was significantly higher in females compared with males (females 45.2%, males 18.4%, OR = 2.041, 95% CI = 1.64-2.52, P ≤ 0.0001. Young females within the age group of 18-37 years and elderly males (≥68 years showed high prevalence of UTI. Escherichia coli (68.8% was the most prevalent isolate followed by Enterococcus spp. (9.7%. Amikacin and nitrofurantoin were the most active antimicrobial agents which showed low resistance rate of 5.8% and 9.8%, respectively. Conclusion: Our study revealed E. coli as the pre-dominant bacterial pathogen. Nitrofurantoin should be used as empirical therapy for uncomplicated CA-UTIs. In the Indian setting, routine urine cultures may be advisable, since treatment failure is likely to occur with commonly used antimicrobials. Therefore, development of regional surveillance programs is necessary for implementation of national CA-UTI guidelines.

  7. Genome-Wide Host-Pathogen Interaction Unveiled by Transcriptomic Response of Diamondback Moth to Fungal Infection.

    Directory of Open Access Journals (Sweden)

    Zhen-Jian Chu

    Full Text Available Genome-wide insight into insect pest response to the infection of Beauveria bassiana (fungal insect pathogen is critical for genetic improvement of fungal insecticides but has been poorly explored. We constructed three pairs of transcriptomes of Plutella xylostella larvae at 24, 36 and 48 hours post treatment of infection (hptI and of control (hptC for insight into the host-pathogen interaction at genomic level. There were 2143, 3200 and 2967 host genes differentially expressed at 24, 36 and 48 hptI/hptC respectively. These infection-responsive genes (~15% of the host genome were enriched in various immune processes, such as complement and coagulation cascades, protein digestion and absorption, and drug metabolism-cytochrome P450. Fungal penetration into cuticle and host defense reaction began at 24 hptI, followed by most intensive host immune response at 36 hptI and attenuated immunity at 48 hptI. Contrastingly, 44% of fungal genes were differentially expressed in the infection course and enriched in several biological processes, such as antioxidant activity, peroxidase activity and proteolysis. There were 1636 fungal genes co-expressed during 24-48 hptI, including 116 encoding putative secretion proteins. Our results provide novel insights into the insect-pathogen interaction and help to probe molecular mechanisms involved in the fungal infection to the global pest.

  8. Evaluation of the significance of cell wall polymers in flax infected with a pathogenic strain of Fusarium oxysporum.

    Science.gov (United States)

    Wojtasik, Wioleta; Kulma, Anna; Dymińska, Lucyna; Hanuza, Jerzy; Czemplik, Magdalena; Szopa, Jan

    2016-03-22

    Fusarium oxysporum infection leads to Fusarium-derived wilt, which is responsible for the greatest losses in flax (Linum usitatissimum) crop yield. Plants infected by Fusarium oxysporum show severe symptoms of dehydration due to the growth of the fungus in vascular tissues. As the disease develops, vascular browning and leaf yellowing can be observed. In the case of more virulent strains, plants die. The pathogen's attack starts with secretion of enzymes degrading the host cell wall. The main aim of the study was to evaluate the role of the cell wall polymers in the flax plant response to the infection in order to better understand the process of resistance and develop new ways to protect plants against infection. For this purpose, the expression of genes involved in cell wall polymer metabolism and corresponding polymer levels were investigated in flax seedlings after incubation with Fusarium oxysporum. This analysis was facilitated by selecting two groups of genes responding differently to the infection. The first group comprised genes strongly affected by the infection and activated later (phenylalanine ammonia lyase and glucosyltransferase). The second group comprised genes which are slightly affected (up to five times) and their expression vary as the infection progresses. Fusarium oxysporum infection did not affect the contents of cell wall polymers, but changed their structure. The results suggest that the role of the cell wall polymers in the plant response to Fusarium oxysporum infection is manifested through changes in expression of their genes and rearrangement of the cell wall polymers. Our studies provided new information about the role of cellulose and hemicelluloses in the infection process, the change of their structure and the expression of genes participating in their metabolism during the pathogen infection. We also confirmed the role of pectin and lignin in this process, indicating the major changes at the mRNA level of lignin metabolism genes

  9. Influence of Novel Highly Pathogenic Avian Influenza A (H5N1 Virus Infection on Migrating Whooper Swans Fecal Microbiota

    Directory of Open Access Journals (Sweden)

    Na Zhao

    2018-02-01

    Full Text Available The migration of wild birds plays an important role in the transmission and spread of H5 highly pathogenic avian influenza (HPAI virus, posing a severe risk to animal and human health. Substantial evidence suggests that altered gut microbial community is implicated in the infection of respiratory influenza virus. However, the influence of H5N1 infection in gut microbiota of migratory birds remains unknown. In January 2015, a novel recombinant H5N1 virus emerged and killed about 100 migratory birds, mainly including whooper swans in Sanmenxia Reservoir Area of China. Here, we describe the first fecal microbiome diversity study of H5N1-infected migratory birds. By investigating the influence of H5N1 infection on fecal bacterial communities in infected and uninfected individuals, we found that H5N1 infection shaped the gut microbiota composition by a difference in the dominance of some genera, such as Aeromonas and Lactobacillus. We also found a decreased α diversity and increased β diversity in infectious individuals. Our results highlight that increases in changes in pathogen-containing gut communities occur when individuals become infected with H5N1. Our study may provide the first evidence that there are statistical association among H5N1 presence and fecal microbiota compositional shifts, and properties of the fecal microbiota may serve as the risk of gut-linked disease in migrates with H5N1 and further aggravate the disease transmission.

  10. Influence of Novel Highly Pathogenic Avian Influenza A (H5N1) Virus Infection on Migrating Whooper Swans Fecal Microbiota.

    Science.gov (United States)

    Zhao, Na; Wang, Supen; Li, Hongyi; Liu, Shelan; Li, Meng; Luo, Jing; Su, Wen; He, Hongxuan

    2018-01-01

    The migration of wild birds plays an important role in the transmission and spread of H5 highly pathogenic avian influenza (HPAI) virus, posing a severe risk to animal and human health. Substantial evidence suggests that altered gut microbial community is implicated in the infection of respiratory influenza virus. However, the influence of H5N1 infection in gut microbiota of migratory birds remains unknown. In January 2015, a novel recombinant H5N1 virus emerged and killed about 100 migratory birds, mainly including whooper swans in Sanmenxia Reservoir Area of China. Here, we describe the first fecal microbiome diversity study of H5N1-infected migratory birds. By investigating the influence of H5N1 infection on fecal bacterial communities in infected and uninfected individuals, we found that H5N1 infection shaped the gut microbiota composition by a difference in the dominance of some genera, such as Aeromonas and Lactobacillus . We also found a decreased α diversity and increased β diversity in infectious individuals. Our results highlight that increases in changes in pathogen-containing gut communities occur when individuals become infected with H5N1. Our study may provide the first evidence that there are statistical association among H5N1 presence and fecal microbiota compositional shifts, and properties of the fecal microbiota may serve as the risk of gut-linked disease in migrates with H5N1 and further aggravate the disease transmission.

  11. Variations of immune parameters in the lined seahorse Hippocampus erectus after infection with enteritis pathogen of Vibrio parahaemolyticus.

    Science.gov (United States)

    Lin, Tingting; Zhang, Dong; Liu, Xin; Xiao, Dongxue

    2016-03-01

    Enteritis has been increasingly recognized as one of the major obstacles for the lined seahorse Hippocampus erectus mass culture success. In the present study, the intestinal bacteria strains of the lined seahorses H. erectus suffered from enteritis were isolated, then their pathogenicities were confirmed by artificial infection, and one pathogenic bacteria strain named DS3 was obtained. The median lethal dose (LD50) of strain DS3 for 10 days was determined. The seahorses with different infection levels of uninfected (control), early stage of infection (ESI) and late stage of infection (LSI) were respectively sampled at 0, 3, 6 and 9 days post infection, and 12 immune parameters in the plasma were analyzed. The strain DS3 identified with a biochemical test combined with a molecular method was Vibrio parahaemolyticus, and its LD50 for 10 days was 1.3 × 10(3) cfu/fish. Six parameters including monocytes/leucocytes, leucocytes phagocytic rate, interleukin-2, interferon-α, lysozyme and immunoglobulin M exhibited a generally similar variation trend: highest in the control, second in the ESI and lowest in the LSI throughout the entire experiment. In view of the infection level of V. parahaemolyticus to H. erectus is largely decided by the seahorse's own immune capacity, therefore, these immune parameters were high in the non- or slightly infected seahorses, and low in the severely infected individuals may be an indicator for immune level. These immune parameters may be reliable indicators for the juvenile and broodstock quality assessment. Moreover, clarification of the enteritis pathogen also provides guidances for targeted medicine choice for the lined seahorse. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. An Alteration of Lymphocytes Subpopulations and Immunoglobulins Levels in Patients with Diabetic Foot Ulcers Infected Particularly by Resistant Pathogens

    Directory of Open Access Journals (Sweden)

    Vladimíra Fejfarová

    2016-01-01

    Full Text Available The aim of our study was to analyse immune abnormalities in patients with chronic infected diabetic foot ulcers (DFUs especially those infected by resistant microorganisms. Methods. 68 patients treated in our foot clinic for infected chronic DFUs with 34 matched diabetic controls were studied. Patients with infected DFUs were subdivided into two subgroups according to the antibiotic sensitivity of causal pathogen: subgroup S infected by sensitive (n=50 and subgroup R by resistant pathogens (n=18. Selected immunological markers were compared between the study groups and subgroups. Results. Patients with infected chronic DFUs had, in comparison with diabetic controls, significantly reduced percentages (p<0.01 and total numbers of lymphocytes (p<0.001 involving B lymphocytes (p<0.01, CD4+ (p<0.01, and CD8+ T cells (p<0.01 and their naive and memory effector cells. Higher levels of IgG (p<0.05 including IgG1 (p<0.001 and IgG3 (p<0.05 were found in patients with DFUs compared to diabetic controls. Serum levels of immunoglobulin subclasses IgG2 and IgG3 correlated negatively with metabolic control (p<0.05. A trend towards an increased frequency of IgG2 deficiency was found in patients with DFUs compared to diabetic controls (22% versus 15%; NS. Subgroup R revealed lower levels of immunoglobulins, especially of IgG4 (p<0.01 in contrast to patients infected by sensitive bacteria. The innate immunity did not differ significantly between the study groups. Conclusion. Our study showed changes mainly in the adaptive immune system represented by low levels of lymphocyte subpopulations and their memory effector cells, and also changes in humoral immunity in patients with DFUs, even those infected by resistant pathogens, in comparison with diabetic controls.

  13. In vitro studies on medicinal plants used against bacterial diabetic foot ulcer (BDFU) and urinary tract infected (UTI) causing pathogens.

    Science.gov (United States)

    Subbu Lakshmi, S; Chelladurai, G; Suresh, B

    2016-09-01

    The pus samples from diabetic foot ulcer patients and urine samples from urinary tract infected patients were collected and inoculated in nutrient agar plates. The colonies showing different morphologies were streaked on selective agar plates. The antibacterial assay of selected commercial antibiotics was tested against the foot ulcer and urinary tract isolates. The result revealed that most of the organisms were found to be resistant against the antibiotics. Screening of antibacterial activity of selected plants, methanol extracts of plants were prepared and tested against foot ulcer pathogens. Among the plants used, the methanolic extract Tragia involucrata was very effective against the foot ulcer pathogens and to separate the compounds present in the methanolic extract of T. involucrata, when it was subjected to column chromatography. The fractions obtained were further checked for their antibacterial property and fraction 1 which inhibited the pathogens, were subjected to thin layer chromatography and the structure of the particular phytochemical compound was elucidated by NMR study. The spices were tested for their antibacterial property against the urinary tract pathogens. Among the spices tested; Allium sativum inhibited the growth of the pathogens isolated from urinary tract infection. It can be concluded that the plants extract can be used to discover natural products that may serve as lead for the development of new pharmaceuticals addressing the major therapeutic needs.

  14. Pathogens Causing Blood Stream Infections and their Drug Susceptibility Profile in Immunocompromised Patients

    International Nuclear Information System (INIS)

    Fayyaz, M.; Mirza, I.A.; Ikram, A.; Hussain, A.; Ghafoor, T.; Shujat, U.

    2013-01-01

    Objective: To determine the types of pathogens causing blood stream infections and their drug susceptibility profile in immunocompromised patients. Study Design: Cross-sectional, observational study. Place and Duration of Study: Department of Microbiology, Armed Forces Institute of Pathology, Rawalpindi, from January to September 2012. Methodology: Blood culture bottles received from immunocompromised patients were dealt by two methods, brain heart infusion (BHI) broth based manual method and automated BACTEC system. The samples yielding positive growth from either of two methods were further analyzed. The identification of isolates was done with the help of biochemical reactions and rapid tests. Antimicrobial susceptibility of the isolates was carried out as per recommendations of Clinical and Laboratory Standards Institute (CLSI). Results: Out of the 938 blood culture specimens received from immunocompromised patients, 188 (20%) yielded positive growth. Out of these, 89 (47.3%) isolates were Gram positive and Gram negative each, while 10 (5.3%) isolates were fungi (Candida spp.). In case of Gram positive isolates, 75 (84.3%) were Staphylococcus spp. and 51 (67%) were Methicillin resistant. Amongst Gram negative group 49 (55.1%) isolates were of enterobacteriaceae family, while 40 (44.9%) were non-lactose fermenters (NLF). In vitro antimicrobial susceptibility of Staphylococci revealed 100% susceptibility to vancomycin and linezolid. The enterobacteriaceae isolates had better susceptibility against amikacin 85.7% compared to tigecycline 61.2% and imipenem 59.2%. For NLF, the in vitro efficacy of aminoglycosides was 72.5%. Conclusion: The frequency of Gram positive and Gram negative organisms causing blood stream infections in immunocompromised patients was equal. Vancomycin in case of Gram positive and amikacin for Gram negative organisms revealed better in vitro efficacy as compared to other antibiotics. (author)

  15. Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and New Antifungal Therapies

    Directory of Open Access Journals (Sweden)

    Maria N. Gamaletsou

    2018-02-01

    Full Text Available Invasive fungal infections caused by drug-resistant organisms are an emerging threat to heavily immunosuppressed patients with hematological malignancies. Modern early antifungal treatment strategies, such as prophylaxis and empirical and preemptive therapy, result in long-term exposure to antifungal agents, which is a major driving force for the development of resistance. The extended use of central venous catheters, the nonlinear pharmacokinetics of certain antifungal agents, neutropenia, other forms of intense immunosuppression, and drug toxicities are other contributing factors. The widespread use of agricultural and industrial fungicides with similar chemical structures and mechanisms of action has resulted in the development of environmental reservoirs for some drug-resistant fungi, especially azole-resistant Aspergillus species, which have been reported from four continents. The majority of resistant strains have the mutation TR34/L98H, a finding suggesting that the source of resistance is the environment. The global emergence of new fungal pathogens with inherent resistance, such as Candida auris, is a new public health threat. The most common mechanism of antifungal drug resistance is the induction of efflux pumps, which decrease intracellular drug concentrations. Overexpression, depletion, and alteration of the drug target are other mechanisms of resistance. Mutations in the ERG11 gene alter the protein structure of C-demethylase, reducing the efficacy of antifungal triazoles. Candida species become echinocandin-resistant by mutations in FKS genes. A shift in the epidemiology of Candida towards resistant non-albicans Candida spp. has emerged among patients with hematological malignancies. There is no definite association between antifungal resistance, as defined by elevated minimum inhibitory concentrations, and clinical outcomes in this population. Detection of genes or mutations conferring resistance with the use of molecular methods

  16. Pathogens causing blood stream infections and their drug susceptibility profile in immunocompromised patients.

    Science.gov (United States)

    Fayyaz, Muhammad; Mirza, Irfan Ali; Ikram, Aamer; Hussain, Aamir; Ghafoor, Tahir; Shujat, Umer

    2013-12-01

    To determine the types of pathogens causing blood stream infections and their drug susceptibility profile in immunocompromised patients. Cross-sectional, observational study. Department of Microbiology, Armed Forces Institute of Pathology, Rawalpindi, from January to September 2012. Blood culture bottles received from immunocompromised patients were dealt by two methods, brain heart infusion (BHI) broth based manual method and automated BACTEC system. The samples yielding positive growth from either of two methods were further analyzed. The identification of isolates was done with the help of biochemical reactions and rapid tests. Antimicrobial susceptibility of the isolates was carried out as per recommendations of Clinical and Laboratory Standards Institute (CLSI). Out of the 938 blood culture specimens received from immunocompromised patients, 188 (20%) yielded positive growth. Out of these, 89 (47.3%) isolates were Gram positive and Gram negative each, while 10 (5.3%) isolates were fungi (Candida spp.). In case of Gram positive isolates, 75 (84.3%) were Staphylococcus spp. and 51 (67%) were Methicillin resistant. Amongst Gram negative group 49 (55.1%) isolates were of enterobacteriaceae family, while 40 (44.9%) were non-lactose fermenters (NLF). In vitro antimicrobial susceptibility of Staphylococci revealed 100% susceptibility to vancomycin and linezolid. The enterobacteriaceae isolates had better susceptibility against amikacin 85.7% compared to tigecycline 61.2% and imipenem 59.2%. For NLF, the in vitro efficacy of aminoglycosides was 72.5%. The frequency of Gram positive and Gram negative organisms causing blood stream infections in immunocompromised patients was equal. Vancomycin in case of Gram positive and amikacin for Gram negative organisms revealed better in vitro efficacy as compared to other antibiotics.

  17. Modelling fungal sink competitiveness with grains for assimilates in wheat infected by a biotrophic pathogen

    Science.gov (United States)

    Bancal, Marie-Odile; Hansart, Amandine; Sache, Ivan; Bancal, Pierre

    2012-01-01

    Background and Aims Experiments have shown that biotrophic fungi divert assimilates for their growth. However, no attempt has been made either to account for this additional sink or to predict to what extent it competes with both grain filling and plant reserve metabolism for carbon. Fungal sink competitiveness with grains was quantified by a mixed experimental–modelling approach based on winter wheat infected by Puccinia triticina. Methods One week after anthesis, plants grown under controlled conditions were inoculated with varying loads. Sporulation was recorded while plants underwent varying degrees of shading, ensuring a range of both fungal sink and host source levels. Inoculation load significantly increased both sporulating area and rate. Shading significantly affected net assimilation, reserve mobilization and sporulating area, but not grain filling or sporulation rates. An existing carbon partitioning (source–sink) model for wheat during the grain filling period was then enhanced, in which two parameters characterize every sink: carriage capacity and substrate affinity. Fungal sink competitiveness with host sources and sinks was modelled by representing spore production as another sink in diseased wheat during grain filling. Key Results Data from the experiment were fitted to the model to provide the fungal sink parameters. Fungal carriage capacity was 0·56 ± 0·01 µg dry matter °Cd−1 per lesion, much less than grain filling capacity, even in highly infected plants; however, fungal sporulation had a competitive priority for assimilates over grain filling. Simulation with virtual crops accounted for the importance of the relative contribution of photosynthesis loss, anticipated reserve depletion and spore production when light level and disease severity vary. The grain filling rate was less reduced than photosynthesis; however, over the long term, yield loss could double because the earlier reserve depletion observed here would shorten the

  18. [Uncommon non-fermenting Gram-negative rods as pathogens of lower respiratory tract infection].

    Science.gov (United States)

    Juhász, Emese; Iván, Miklós; Pongrácz, Júlia; Kristóf, Katalin

    2018-01-01

    Glucose non-fermenting Gram-negative bacteria are ubiquitous environmental organisms. Most of them are identified as opportunistic, nosocomial pathogens in patients. Uncommon species are identified accurately, mainly due to the introduction of matrix-assisted laser desorption-ionization time of flight mass spectrometry (MALDI-TOF MS) in clinical microbiology practice. Most of these uncommon non-fermenting rods are isolated from lower respiratory tract samples. Their significance in lower respiratory tract infections, such as rules of their testing are not clarified yet. The aim of this study was to review the clinical microbiological features of these bacteria, especially their roles in lower respiratory tract infections and antibiotic treatment options. Lower respiratory tract samples of 3589 patients collected in a four-year period (2013-2016) were analyzed retrospectively at Semmelweis University (Budapest, Hungary). Identification of bacteria was performed by MALDI-TOF MS, the antibiotic susceptibility was tested by disk diffusion method. Stenotrophomonas maltophilia was revealed to be the second, whereas Acinetobacter baumannii the third most common non-fermenting rod in lower respiratory tract samples, behind the most common Pseudomonas aeruginosa. The total number of uncommon non-fermenting Gram-negative isolates was 742. Twenty-three percent of isolates were Achromobacter xylosoxidans. Beside Chryseobacterium, Rhizobium, Delftia, Elizabethkingia, Ralstonia and Ochrobactrum species, and few other uncommon species were identified among our isolates. The accurate identification of this species is obligatory, while most of them show intrinsic resistance to aminoglycosides. Resistance to ceftazidime, cefepime, piperacillin-tazobactam and carbapenems was frequently observed also. Ciprofloxacin, levofloxacin and trimethoprim-sulfamethoxazole were found to be the most effective antibiotic agents. Orv Hetil. 2018; 159(1): 23-30.

  19. The Pathogenic Potential of Proteus mirabilis Is Enhanced by Other Uropathogens during Polymicrobial Urinary Tract Infection.

    Science.gov (United States)

    Armbruster, Chelsie E; Smith, Sara N; Johnson, Alexandra O; DeOrnellas, Valerie; Eaton, Kathryn A; Yep, Alejandra; Mody, Lona; Wu, Weisheng; Mobley, Harry L T

    2017-02-01

    Urinary catheter use is prevalent in health care settings, and polymicrobial colonization by urease-positive organisms, such as Proteus mirabilis and Providencia stuartii, commonly occurs with long-term catheterization. We previously demonstrated that coinfection with P. mirabilis and P. stuartii increased overall urease activity in vitro and disease severity in a model of urinary tract infection (UTI). In this study, we expanded these findings to a murine model of catheter-associated UTI (CAUTI), delineated the contribution of enhanced urease activity to coinfection pathogenesis, and screened for enhanced urease activity with other common CAUTI pathogens. In the UTI model, mice coinfected with the two species exhibited higher urine pH values, urolithiasis, bacteremia, and more pronounced tissue damage and inflammation compared to the findings for mice infected with a single species, despite having a similar bacterial burden within the urinary tract. The presence of P. stuartii, regardless of urease production by this organism, was sufficient to enhance P. mirabilis urease activity and increase disease severity, and enhanced urease activity was the predominant factor driving tissue damage and the dissemination of both organisms to the bloodstream during coinfection. These findings were largely recapitulated in the CAUTI model. Other uropathogens also enhanced P. mirabilis urease activity in vitro, including recent clinical isolates of Escherichia coli, Enterococcus faecalis, Klebsiella pneumoniae, and Pseudomonas aeruginosa We therefore conclude that the underlying mechanism of enhanced urease activity may represent a widespread target for limiting the detrimental consequences of polymicrobial catheter colonization, particularly by P. mirabilis and other urease-positive bacteria. Copyright © 2017 American Society for Microbiology.

  20. Disclosing respiratory co-infections: a broad-range panel assay for avian respiratory pathogens on a nanofluidic PCR platform.

    Science.gov (United States)

    Croville, Guillaume; Foret, Charlotte; Heuillard, Pauline; Senet, Alexis; Delpont, Mattias; Mouahid, Mohammed; Ducatez, Mariette F; Kichou, Faouzi; Guerin, Jean-Luc

    2018-06-01

    Respiratory syndromes (RS) are among the most significant pathological conditions in edible birds and are caused by complex coactions of pathogens and environmental factors. In poultry, low pathogenic avian influenza A viruses, metapneumoviruses, infectious bronchitis virus, infectious laryngotracheitis virus, Mycoplasma spp. Escherichia coli and/or Ornithobacterium rhinotracheale in turkeys are considered as key co-infectious agents of RS. Aspergillus sp., Pasteurella multocida, Avibacterium paragallinarum or Chlamydia psittaci may also be involved in respiratory outbreaks. An innovative quantitative PCR method, based on a nanofluidic technology, has the ability to screen up to 96 samples with 96 pathogen-specific PCR primers, at the same time, in one run of real-time quantitative PCR. This platform was used for the screening of avian respiratory pathogens: 15 respiratory agents, including viruses, bacteria and fungi potentially associated with respiratory infections of poultry, were targeted. Primers were designed and validated for SYBR green real-time quantitative PCR and subsequently validated on the Biomark high throughput PCR nanofluidic platform (Fluidigm©, San Francisco, CA, USA). As a clinical assessment, tracheal swabs were sampled from turkeys showing RS and submitted to this panel assay. Beside systematic detection of E. coli, avian metapneumovirus, Mycoplasma gallisepticum and Mycoplasma synoviae were frequently detected, with distinctive co-infection patterns between French and Moroccan flocks. This proof-of-concept study illustrates the potential of such panel assays for unveiling respiratory co-infection profiles in poultry.

  1. Pathobiology of highly pathogenic avian influenza virus (H5N1) infection in mute swans (Cygnus olor).

    Science.gov (United States)

    Pálmai, Nimród; Erdélyi, Károly; Bálint, Adám; Márton, Lázár; Dán, Adám; Deim, Zoltán; Ursu, Krisztina; Löndt, Brandon Z; Brown, Ian H; Glávits, Róbert

    2007-06-01

    The results of pathological, virological and polymerase chain reaction examinations carried out on 35 mute swans (Cygnus olor) that succumbed to a highly pathogenic avian influenza virus (H5N1) infection during an outbreak in Southern Hungary are reported. The most frequently observed macroscopic lesions included: haemorrhages under the epicardium, in the proventricular and duodenal mucosa and pancreas; focal necrosis in the pancreas; myocardial degeneration; acute mucous enteritis; congestion of the spleen and lung, and the accumulation of sero-mucinous exudate in the body cavity. Histopathological lesions comprised: lymphocytic meningo-encephalomyelitis accompanied by gliosis and occasional perivascular haemorrhages; multi-focal myocardial necrosis with lympho-histiocytic infiltration; pancreatitis with focal necrosis; acute desquamative mucous enteritis; lung congestion and oedema; oedema of the tracheal mucosa and, in young birds, the atrophy of the bursa of Fabricius as a result of lymphocyte depletion and apoptosis. The observed lesions and the moderate to good body conditions were compatible with findings in acute highly pathogenic avian influenza infections of other bird species reported in the literature. Skin lesions and lesions typical for infections caused by strains of lower pathogenicity (low pathogenic avian influenza virus) such as emaciation or fibrinous changes in the reproductive and respiratory organs, sinuses and airsacs were not observed. The H5N1 subtype avian influenza virus was isolated in embryonated fowl eggs from all cases and it was identified by classical and molecular virological methods.

  2. Cytokine expression in three chicken host systems infected with H9N2 influenza viruses with different pathogenicities.

    Science.gov (United States)

    Wang, Jianlin; Cao, Zhiwei; Guo, Xuejin; Zhang, Yi; Wang, Dongdong; Xu, Shouzheng; Yin, Yanbo

    2016-12-01

    SD/818 and SD/196 are H9N2 influenza virus strains isolated from chickens from the same farm at different times that exhibited similar genetic evolution. However, strain SD/818 exhibited higher pathogenicity in chickens than strain SD/196 and other H9N2 influenza virus epidemic strains from China. The expression of cytokines is an important host defence mechanism following viral infection and their intensity is a major determinant of viral pathogenicity. To elucidate the mechanism underlying the increased pathogenicity of strain SD/818 from the host's perspective, viral replication and cytokine expression were dynamically studied using real-time quantitative reverse transcription PCR in chickens infected with strain SD/818 compared with chickens infected with strain SD/196 in this study. The results showed that the replication of strain SD/818 and the expressions of IL-1β, IL-6, TNF-α, IFN-α and IFN-β induced by strain SD/818 were higher than those induced by strain SD/196 in the chicken host system. Expression of these cytokines in chickens coincided with or followed virus replication. These results suggested that high-level viral replication and pro-inflammatory cytokine expression (but not decreased type I IFN expression) were associated with the higher pathogenicity of strain SD/818 in chickens.

  3. Infection capacity of the pathogens Penicillium italicum and P. Expansum in orange during storage

    Directory of Open Access Journals (Sweden)

    Veljović Sonja P.

    2017-01-01

    Full Text Available Penicillium italicum and P. expansum are important pathogens causing decay in most fruits and vegetables. In this study, orange fruits were inoculated with these two species of fungus and stored 14 days with or without bagging, in a cold room for 11 days and 3 days at room temperature to determine the effect of bagging and infection capacities of both molds on oranges during storage. The results indicated that P. expansum can grow on orange peel with smaller colony diameter than P. italicum in bagged and unbagged fruits. Total soluble solids (TSS and firmness were not affected by bag. Gas composition of the bags showed low oxygen and high carbon dioxide concentration after fourteen days of storage. Bagged fruits decreased decay caused by P. italicum and weight loss, and delayed changes in firmness, TSS and acidity compared with control fruits. The study suggests that bagging may be a promising option for controlling decay, maintaining fruit quality and extending shelf-life of oranges.

  4. Effect of a lytic bacteriophage on rabbits experimentally infected with pathogenic Escherichia coli

    Directory of Open Access Journals (Sweden)

    J. Zhao

    2017-09-01

    Full Text Available Pathogenic Escherichia coli (E. coli is severely threatening the rabbit industry in China, and the concern over antibiotic-resistant bacteria has given rise to an urgent need for antibiotic alternatives. In this study, a member (ZRP1 of the Myoviridae family was isolated from rabbit faeces using a strain of rabbit atypical enteropathogenic E. coli (ZR1 as host. The one-step growth curve indicated that the latent period was around 25 to 30 min and the burst size was 144±31 plaque-forming unit/cell. The rate of phage-resistant mutation was 7×10–5±4×10–5. When the bacteriophage input at the multiplicity of infection (MOI was 0.1, 1 or 10, the growth of host E. coli in broth was inhibited for 5 h. A single intravenous injection of ZRP1 at MOI 0.1, 1 or 10 significantly prolonged the survival time of rabbits which simultaneously received a lethal dose of ZR1.

  5. Increasing resistance to quinolones: A four-year prospective study of urinary tract infection pathogens

    Directory of Open Access Journals (Sweden)

    Orhiosefe Omigie

    2009-08-01

    Full Text Available Orhiosefe Omigie, Lawrence Okoror, Patience Umolu, Gladys IkuuhDepartment of Microbiology, Ambrose Alli University, Ekpoma, NigeriaAbstract: A four-year prospective study was carried out to determine the incidence and rate of development of resistance by common urinary tract infection (UTI pathogens to quinolone antimicrobial agents. Results show that there is high intrinsic resistance to the quinolones among strains of Pseudomonas aeruginosa (43.4%, Escherichia coli (26.3%, and Proteus spp. (17.1%. Over four years, rising rates of resistance were observed in P. aeruginosa (14.6% increase, Staphylococcus aureus (9.8%, and E. coli (9.7%. The highest potency was exhibited by ciprofloxacin (91.2%, levofloxacin (89.2%, and moxifloxacin (85.1%, while there were high rates of resistance to nalidixic acid (51.7% and pefloxacin (29.0%. Coliforms, particularly E. coli (>45%, remain the most prevalent causative agents of UTI while females within the age range of 20–50 years were most vulnerable to UTI.Keywords: UTI, microorganisms, antibiotics, resistance

  6. Cellulose gum and copper nanoparticles based hydrogel as antimicrobial agents against urinary tract infection (UTI) pathogens.

    Science.gov (United States)

    Al-Enizi, Abdullah M; Ahamad, Tansir; Al-Hajji, Abdullah Baker; Ahmed, Jahangeer; Chaudhary, Anis Ahmad; Alshehri, Saad M

    2018-04-01

    In the present study, stable copper nanoparticles (CuNPs) were successfully prepared in the hydrogel matrix. The prepared nanocomposite (HCuNPs) was characterized via x-ray diffraction (XRD), electron microscopy (TEM), and energy-dispersive (EDX) and x-ray photoelectron spectroscopic (XPS) studies. The wide scan XPS spectra support the presence of C, N and O in neat hydrogel; while, the XPS spectra of HCuNPs demonstrate the presence of Cu along with C, N, and O elements. TEM studies show the formation of spherical shaped CuNPs in the size range from 7 to 12nm. The rheology results reveal that the storage modulus (G') of the HCuNPs was found to be higher than the loss modulus (G"). Additionally, the antibacterial activities and cytotoxic were carried out against urinary tract infection (UTI) microbes and HeLa (cervical) cells respectively. The antibacterial results reveal that HCuNPs composites show higher zone of inhibition against these pathogens then that of corresponding hydrogel matrix. The cytotoxic effects suggest that the prepared nanocomposite could be used as promising candidates for biomedical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Clinical predictors of the leading pathogens in human immunodeficiency virus-infected adults with community-onset bacteremia in the emergency department: The importance of transmission routes

    Directory of Open Access Journals (Sweden)

    Ching-Chi Lee

    2018-06-01

    Conclusion: Focusing on the two key pathogens in HIV-infected adults with community-onset bacteremia, IDU was one of independent predictors associated with S. aureus infection, whereas MSM was the leading risk factor of S. enterica infection. Although the proposed predictive model of these pathogens has been not established, a scoring system involving the transmission risk of HIV may be of use for the early identification of these patients for clinicians.

  8. Highly (H5N1 and low (H7N2 pathogenic avian influenza virus infection in falcons via nasochoanal route and ingestion of experimentally infected prey.

    Directory of Open Access Journals (Sweden)

    Kateri Bertran

    Full Text Available An experimental infection with highly pathogenic avian influenza (HPAI and low pathogenic avian influenza (LPAI viruses was carried out on falcons in order to examine the effects of these viruses in terms of pathogenesis, viral distribution in tissues and viral shedding. The distribution pattern of influenza virus receptors was also assessed. Captive-reared gyr-saker (Falco rusticolus x Falco cherrug hybrid falcons were challenged with a HPAI H5N1 virus (A/Great crested grebe/Basque Country/06.03249/2006 or a LPAI H7N2 virus (A/Anas plathyrhynchos/Spain/1877/2009, both via the nasochoanal route and by ingestion of previously infected specific pathogen free chicks. Infected falcons exhibited similar infection dynamics despite the different routes of exposure, demonstrating the effectiveness of in vivo feeding route. H5N1 infected falcons died, or were euthanized, between 5-7 days post-infection (dpi after showing acute severe neurological signs. Presence of viral antigen in several tissues was confirmed by immunohistochemistry and real time RT-PCR (RRT-PCR, which were generally associated with significant microscopical lesions, mostly in the brain. Neither clinical signs, nor histopathological findings were observed in any of the H7N2 LPAI infected falcons, although all of them had seroconverted by 11 dpi. Avian receptors were strongly present in the upper respiratory tract of the falcons, in accordance with the consistent oral viral shedding detected by RRT-PCR in both H5N1 HPAI and H7N2 LPAI infected falcons. The present study demonstrates that gyr-saker hybrid falcons are highly susceptible to H5N1 HPAI virus infection, as previously observed, and that they may play a major role in the spreading of both HPAI and LPAI viruses. For the first time in raptors, natural infection by feeding on infected prey was successfully reproduced. The use of avian prey species in falconry husbandry and wildlife rehabilitation facilities could put valuable birds

  9. Highly (H5N1) and low (H7N2) pathogenic avian influenza virus infection in falcons via nasochoanal route and ingestion of experimentally infected prey.

    Science.gov (United States)

    Bertran, Kateri; Busquets, Núria; Abad, Francesc Xavier; García de la Fuente, Jorge; Solanes, David; Cordón, Iván; Costa, Taiana; Dolz, Roser; Majó, Natàlia

    2012-01-01

    An experimental infection with highly pathogenic avian influenza (HPAI) and low pathogenic avian influenza (LPAI) viruses was carried out on falcons in order to examine the effects of these viruses in terms of pathogenesis, viral distribution in tissues and viral shedding. The distribution pattern of influenza virus receptors was also assessed. Captive-reared gyr-saker (Falco rusticolus x Falco cherrug) hybrid falcons were challenged with a HPAI H5N1 virus (A/Great crested grebe/Basque Country/06.03249/2006) or a LPAI H7N2 virus (A/Anas plathyrhynchos/Spain/1877/2009), both via the nasochoanal route and by ingestion of previously infected specific pathogen free chicks. Infected falcons exhibited similar infection dynamics despite the different routes of exposure, demonstrating the effectiveness of in vivo feeding route. H5N1 infected falcons died, or were euthanized, between 5-7 days post-infection (dpi) after showing acute severe neurological signs. Presence of viral antigen in several tissues was confirmed by immunohistochemistry and real time RT-PCR (RRT-PCR), which were generally associated with significant microscopical lesions, mostly in the brain. Neither clinical signs, nor histopathological findings were observed in any of the H7N2 LPAI infected falcons, although all of them had seroconverted by 11 dpi. Avian receptors were strongly present in the upper respiratory tract of the falcons, in accordance with the consistent oral viral shedding detected by RRT-PCR in both H5N1 HPAI and H7N2 LPAI infected falcons. The present study demonstrates that gyr-saker hybrid falcons are highly susceptible to H5N1 HPAI virus infection, as previously observed, and that they may play a major role in the spreading of both HPAI and LPAI viruses. For the first time in raptors, natural infection by feeding on infected prey was successfully reproduced. The use of avian prey species in falconry husbandry and wildlife rehabilitation facilities could put valuable birds of prey and

  10. Transmission dynamics of Bacillus thuringiensis infecting Plodia interpunctella: a test of the mass action assumption with an insect pathogen.

    Science.gov (United States)

    Knell, R J; Begon, M; Thompson, D J

    1996-01-22

    Central to theoretical studies of host-pathogen population dynamics is a term describing transmission of the pathogen. This usually assumes that transmission is proportional to the density of infectious hosts or particles and of susceptible individuals. We tested this assumption with the bacterial pathogen Bacillus thuringiensis infecting larvae of Plodia interpunctella, the Indian meal moth. Transmission was found to increase in a more than linear way with host density in fourth and fifth instar P. interpunctella, and to decrease with the density of infectious cadavers in the case of fifth instar larvae. Food availability was shown to play an important part in this process. Therefore, on a number of counts, the usual assumption was found not to apply in our experimental system.

  11. Evidence for the importance of hydrogen peroxide in wheat infected by the hemibiotrophic pathogen Septoria triciti

    DEFF Research Database (Denmark)

    Shetty, Nandini Prasad; Jensen, Jens Due; Mehrabi, Rahim

    infection is the oxidative burst, which leads to the production of reactive oxygen species (ROS). ROS have been found to inhibit biotrophic pathogens whereas necrotrophic pathogens are generally believed to benefit or even stimulate ROS production. We studied the role of hydrogen peroxide (H2O2) in defence...... in the susceptible cv. Sevin. In Sevin, very little H2O2 accumulated, except during sporulation, where tissue degradation occurred. This accumulation probably represents a stress response coinciding with tissue collapse. This pattern of H2O2 accumulation supports the dogma that pathogens with a necrotrophic phase...... plant material infiltrated with catalase or H2O2 and by the use of catalase knock-out mutants of S. tritici. Likewise, we are studying the sources and regulation of both the early and the late . Likewise, we are studying the sources and regulation of both the early and the late accumulation of H2O2...

  12. A genome-wide survey for host response of silkworm, Bombyx mori during pathogen Bacillus bombyseptieus infection.

    Directory of Open Access Journals (Sweden)

    Lulin Huang

    Full Text Available Host-pathogen interactions are complex relationships, and a central challenge is to reveal the interactions between pathogens and their hosts. Bacillus bombysepticus (Bb which can produces spores and parasporal crystals was firstly separated from the corpses of the infected silkworms (Bombyx mori. Bb naturally infects the silkworm can cause an acute fuliginosa septicaemia and kill the silkworm larvae generally within one day in the hot and humid season. Bb pathogen of the silkworm can be used for investigating the host responses after the infection. Gene expression profiling during four time-points of silkworm whole larvae after Bb infection was performed to gain insight into the mechanism of Bb-associated host whole body effect. Genome-wide survey of the host genes demonstrated many genes and pathways modulated after the infection. GO analysis of the induced genes indicated that their functions could be divided into 14 categories. KEGG pathway analysis identified that six types of basal metabolic pathway were regulated, including genetic information processing and transcription, carbohydrate metabolism, amino acid and nitrogen metabolism, nucleotide metabolism, metabolism of cofactors and vitamins, and xenobiotic biodegradation and metabolism. Similar to Bacillus thuringiensis (Bt, Bb can also induce a silkworm poisoning-related response. In this process, genes encoding midgut peritrophic membrane proteins, aminopeptidase N receptors and sodium/calcium exchange protein showed modulation. For the first time, we found that Bb induced a lot of genes involved in juvenile hormone synthesis and metabolism pathway upregulated. Bb also triggered the host immune responses, including cellular immune response and serine protease cascade melanization response. Real time PCR analysis showed that Bb can induce the silkworm systemic immune response, mainly by the Toll pathway. Anti-microorganism peptides (AMPs, including of Attacin, Lebocin, Enbocin, Gloverin

  13. Accumulation of gentisic acid as associated with systemic infections but not with the hypersensitive response in plant-pathogen interactions.

    Science.gov (United States)

    Bellés, José M; Garro, Rafael; Pallás, Vicente; Fayos, Joaquín; Rodrigo, Ismael; Conejero, Vicente

    2006-02-01

    In the present work we have studied the accumulation of gentisic acid (2,5-dihydroxybenzoic acid, a metabolic derivative of salicylic acid, SA) in the plant-pathogen systems, Cucumis sativus and Gynura aurantiaca, infected with either prunus necrotic ringspot virus (PNRSV) or the exocortis viroid (CEVd), respectively. Both pathogens produced systemic infections and accumulated large amounts of the intermediary signal molecule gentisic acid as ascertained by electrospray ionization mass spectrometry (ESI-MS) coupled on line with high performance liquid chromatography (HPLC). The compound was found mostly in a conjugated (beta-glucoside) form. Gentisic acid has also been found to accumulate (although at lower levels) in cucumber inoculated with low doses of Pseudomonas syringae pv. tomato, producing a nonnecrotic reaction. In contrast, when cucumber was inoculated with high doses of this pathogen, a hypersensitive reaction occurred, but no gentisic-acid signal was induced. This is consistent with our results supporting the idea that gentisic-acid signaling may be restricted to nonnecrotizing reactions of the host plant (Bellés et al. in Mol Plant-Microbe Interact 12:227-235, 1999). In cucumber and Gynura plants, the activity of gentisic acid as inducing signal was different to that of SA, thus confirming the data found for tomato. Exogenously supplied gentisic acid was able to induce peroxidase activity in both Gynura and cucumber plants in a similar way as SA or pathogens. However, gentisic-acid treatments strongly induced polyphenol oxidase activity in cucumber, whereas pathogen infection or SA treatment resulted in a lower induction of this enzyme. Nevertheless, gentisic acid did not induce other defensive proteins which are induced by SA in these plants. This indicates that gentisic acid could act as an additional signal to SA for the activation of plant defenses in cucumber and Gynura plants.

  14. Novel experimental Pseudomonas aeruginosa lung infection model mimicking long-term host-pathogen interactions in cystic fibrosis

    DEFF Research Database (Denmark)

    Moser, Claus; van Gennip, Maria; Bjarnsholt, Thomas

    2009-01-01

    Moser C, van Gennip M, Bjarnsholt T, Jensen PO, Lee B, Hougen HP, Calum H, Ciofu O, Givskov M, Molin S, Hoiby N. Novel experimental Pseudomonas aeruginosa lung infection model mimicking long-term host-pathogen interactions in cystic fibrosis. APMIS 2009; 117: 95-107. The dominant cause of premature...... death in patients suffering from cystic fibrosis (CF) is chronic lung infection with Pseudomonas aeruginosa. The chronic lung infection often lasts for decades with just one clone. However, as a result of inflammation, antibiotic treatment and different niches in the lungs, the clone undergoes...... and 2003) of the chronic lung infection of one CF patient using the seaweed alginate embedment model. The results showed that the non-mucoid clones reduced their virulence over time, resulting in faster clearing of the bacteria from the lungs, improved pathology and reduced pulmonary production...

  15. Idiopathic urethritis in young men in the United States: prevalence and comparison to infections with known sexually transmitted pathogens.

    Science.gov (United States)

    Wetmore, Catherine M; Manhart, Lisa E; Golden, Matthew R

    2009-11-01

    Urethritis is the most common male reproductive tract disease syndrome; yet 20-50% of diagnosed cases have no defined etiology, and few population-level data exist on the prevalence or etiology of the syndrome. We estimated the prevalence of urethritis among young men in the United States and compared correlates of idiopathic cases to correlates of detected infections with sexually transmitted pathogens. Questionnaire data and urine specimens from 5,447 men aged 18-27 years participating in Wave III of the National Longitudinal Study of Adolescent Health were analyzed. Symptomatic urethritis was defined as self-reported dysuria or urethral discharge in the past 24hours. Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis, and Mycoplasma genitalium were identified using nucleic acid amplification tests. Idiopathic urethritis (IU) was defined as urethral symptoms in the absence of these four pathogens. Stratified weighted analyses generated population-based estimates. Urethritis was reported by 1.2% (95% CI=.8-1.6%) of men, of whom 82.4% (61.1-93.3%) had IU. Men with previous STD diagnoses (aOR=9.3 [95% CI=3.0-28.7]), or fewer (1-4) or no lifetime vaginal sex partners (aOR=7.5 [2.9-19.3] and aOR=7.2 [1.9-27.4]), were more likely to have IU compared with men without urethral symptoms or identified pathogens, whereas men of Native American or Asian/Pacific Islander descent (aOR=.04 [.01-.2]) and heavy drinkers (aOR=.08 [.03-.2]) were less likely to have IU. Unlike infection with known pathogens, IU was not associated with black race, Hispanic ethnicity, or age at sexual debut. Urethral symptoms were rarely associated with known pathogens. IU and known pathogens were associated with distinct characteristics.

  16. InvA protein is a Nudix hydrolase required for infection by pathogenic Leptospira in cell lines and animals.

    Science.gov (United States)

    Luo, Yihui; Liu, Yan; Sun, Dexter; Ojcius, David M; Zhao, Jinfang; Lin, Xuai; Wu, Dong; Zhang, Rongguang; Chen, Ming; Li, Lanjuan; Yan, Jie

    2011-10-21

    Leptospirosis caused by pathogenic species of the genus Leptospira is a re-emerging zoonotic disease, which affects a wide variety of host species and is transmitted by contaminated water. The genomes of several pathogenic Leptospira species contain a gene named invA, which contains a Nudix domain. However, the function of this gene has never been characterized. Here, we demonstrated that the invA gene was highly conserved in protein sequence and present in all tested pathogenic Leptospira species. The recombinant InvA protein of pathogenic L. interrogans strain Lai hydrolyzed several specific dinucleoside oligophosphate substrates, reflecting the enzymatic activity of Nudix in Leptospira species. Pathogenic leptospires did not express this protein in media but temporarily expressed it at early stages (within 60 min) of infection of macrophages and nephric epithelial cells. Comparing with the wild type, the invA-deficient mutant displayed much lower infectivity and a significantly reduced survival rate in macrophages and nephric epithelial cells. Moreover, the invA-deficient leptospires presented an attenuated virulence in hamsters, caused mild histopathological damage, and were transmitted in lower numbers in the urine, compared with the wild-type strain. The invA revertant, made by complementing the invA-deficient mutant with the invA gene, reacquired virulence similar to the wild type in vitro and in vivo. The LD(50) in hamsters was 1000-fold higher for the invA-deficient mutant than for the invA revertant and wild type. These results demonstrate that the InvA protein is a Nudix hydrolase, and the invA gene is essential for virulence in pathogenic Leptospira species.

  17. Blood stream infection by an emerging pathogen Oligella ureolytica in a cancer patient: Case report and review of literature

    Directory of Open Access Journals (Sweden)

    Frincy K Baruah

    2014-01-01

    Full Text Available Oligella ureolytica is an emerging bacteria rarely implicated as a human pathogen. It is infrequently recovered from clinical specimens probably because of inadequate processing of non-fermenting oxidase positive Gram negative bacilli. We present here a case of a 30 year old male suffering from right lung adenocarcinoma (moderately differentiated with multiple abdominal lymph node metastasis with Syringohydromyelia whose blood culture yielded Oligella ureolytica in pure culture. Oligella ureolytica isolation in pure culture and the patient′s response to targeted treatment supported that Oligella ureolytica was the true causative agent of the blood stream infection. Early suspicion, diagnosis and treatment with potent antibiotics are needed to prevent further complications resulting from infection with this emerging pathogen.

  18. Prior DNA immunization enhances immune response to dominant and subdominant viral epitopes induced by a fowlpox-based SIVmac vaccine in long-term slow-progressor macaques infected with SIVmac251

    International Nuclear Information System (INIS)

    Radaelli, Antonia; Nacsa, Janos; Tsai, W.-P.; Edghill-Smith, Yvette; Zanotto, Carlo; Elli, Veronica; Venzon, David; Tryniszewska, Elzbieta; Markham, Phil; Mazzara, Gail P.; Panicali, Dennis; Morghen, Carlo De Giuli; Franchini, Genoveffa

    2003-01-01

    A therapeutic vaccine for individuals infected with HIV-1 and treated with antiretroviral therapy (ART) should be able to replenish virus-specific CD4+ T-cells and broaden the virus-specific CD8+ T-cell response in order to maintain CD8+ T-cell function and minimize viral immune escape after ART cessation. Because a combination of DNA and recombinant poxvirus vaccine modalities induces high levels of virus-specific CD4+ T-cell response and broadens the cytolytic activity in naive macaques, we investigated whether the same results could be obtained in SIVmac251-infected macaques. The macaques studied here were long-term nonprogressors that naturally contained viremia but were nevertheless treated with a combination of antiviral drugs to assess more carefully the effect of vaccination in the context of ART. The combination of a DNA expressing the gag and pol genes (DNA-SIV-gp) of SIVmac239 followed by a recombinant fowlpox expressing the same SIVmac genes (FP-SIV-gp) was significantly more immunogenic than two immunizations of FP-SIV-gp in SIVmac251-infected macaques treated with ART. The DNA/FP combination significantly expanded and broadened Gag-specific T-cell responses measured by tetramer staining, ELISPOT, and intracellular cytokine staining and measurement of ex vivo cytolytic function. Importantly, the combination of these vaccine modalities also induced a sizeable expansion in most macaques of Gag-specific CD8-(CD4+) T-cells able to produce TNF-α. Hopefully, this modality of vaccine combination may be useful in the clinical management of HIV-1-infected individuals

  19. Resting spore formation of aphid-pathogenic fungus Pandora nouryi depends on the concentration of infective inoculum.

    Science.gov (United States)

    Huang, Zhi-Hong; Feng, Ming-Guang

    2008-07-01

    Resting spore formation of some aphid-pathogenic Entomophthorales is important for the seasonal pattern of their prevalence and survival but this process is poorly understood. To explore the possible mechanism involved in the process, Pandora nouryi (obligate aphid pathogen) interacted with green peach aphid Myzus persicae on cabbage leaves under favourable conditions. Host nymphs showered with primary conidia of an isolate (LC(50): 0.9-6.7 conidia mm(-2) 4-7 days post shower) from air captures in the low-latitude plateau of China produced resting spores (azygospores), primary conidia or both spore types. Surprisingly, the proportion of mycosed cadavers forming resting spores (P(CFRS)) increased sharply within the concentrations (C) of 28-240 conidia mm(-2), retained high levels at 240-1760, but was zero or extremely low at 0.3-16. The P(CFRS)-C relationship fit well the logistic equation P(CFRS) = 0.6774/[1 + exp(3.1229-0.0270C)] (r(2) = 0.975). This clarified for the first time the dependence of in vivo resting spore formation of P. nouryi upon the concentration of infective inoculum. A hypothesis is thus proposed that some sort of biochemical signals may exist in the host-pathogen interaction so that the fungal pathogen perceives the signals for prompt response to forthcoming host-density changes by either producing conidia for infecting available hosts or forming resting spores for surviving host absence in situ.

  20. Analysis of pathogenic factors of Proteus mirabilis isolated from urinary tract infection

    OpenAIRE

    室谷,勝久

    1991-01-01

    Proteus mirabilis has several pathogenic factors such as adherent ability to urinary tract epitherial cells, urease, motility and resistance to urine. The pathogenic activities of clinically isolated P. mirabilis were analyzed. Higher pathogenic strains (No. 25 and No. 30) which had morphologically different pili but had a higher density of pili showed strong adherent activity to bladder epithelial cells of mouse and rat. These strains also showed a clear chemotaxis to urinary tract tissue ex...

  1. [Experimental study of the effects of impulse-electric discharge on chemotaxis and cytoadhesion of urinary infection pathogens].

    Science.gov (United States)

    Kuderinov, S K; Azizov, I S; Turgunov, E M; Shambilova, N A

    2006-01-01

    The aim of the experimental study was to evaluate effects of impulse-electric discharge in liquid on chemotaxis and cytoadhesion of urinary infection pathogens. Chemotaxis was determined in respect to the lung, liver, spleen, kidney, ureter, urinary bladder, urethra of white mice by S. Likholetov's modified method. Cytoadhesion was assessed by V. Brilis. The experiments show that the impulse-electric discharge holds promise for urological practice.

  2. Sugarcane Elongin C is involved in infection by sugarcane mosaic disease pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Zhai, Yushan; Deng, Yuqing; Cheng, Guangyuan; Peng, Lei; Zheng, Yanru; Yang, Yongqing, E-mail: yyq287346@163.com; Xu, Jingsheng, E-mail: xujingsheng@126.com

    2015-10-23

    Sugarcane (Saccharum sp. hybrid) provides the main source of sugar for humans. Sugarcane mosaic disease (SMD) is a major threat to sugarcane production. Currently, control of SMD is mainly dependent on breeding resistant cultivars through hybridization, which is time-consuming. Understanding the mechanism of viral infection may facilitate novel strategies to breed cultivars resistant to SMD and to control the disease. In this study, a wide interaction was detected between the viral VPg protein and host proteins. Several genes were screened from sugarcane cDNA library that could interact with Sugarcane streak mosaic virus VPg, including SceIF4E1 and ScELC. ScELC was predicted to be a cytoplasmic protein, but subcellular localization analysis showed it was distributed both in cytoplasmic and nuclear, and interactions were also detected between ScELC and VPg of SCMV or SrMV that reveal ScELC was widely used in the SMD pathogen infection process. ScELC and VPgs interacted in the nucleus, and may function to enhance the viral transcription rate. ScELC also interacted with SceIF4E2 both in the cytoplasm and nucleus, but not with SceIF4E1 and SceIF4E3. These results suggest that ScELC may be essential for the function of SceIF4E2, an isomer of eIF4E. - Highlights: • We cloned ScELC, SceIF4E1, SceIF4E2 and SceIF4E3 from sugarcane accession Badila. • We examined interactions among VPg, ScELC, SceIF4E1, SceIF4E2 and SceIF4E3. • We proofed that ScELC interacted with VPgs of SCMV, SrMV and SCSMV. • We proofed that ScELC interacted with SceIF4E2 but not SceIF4E1 or SceIF4E3.

  3. Sugarcane Elongin C is involved in infection by sugarcane mosaic disease pathogens

    International Nuclear Information System (INIS)

    Zhai, Yushan; Deng, Yuqing; Cheng, Guangyuan; Peng, Lei; Zheng, Yanru; Yang, Yongqing; Xu, Jingsheng

    2015-01-01

    Sugarcane (Saccharum sp. hybrid) provides the main source of sugar for humans. Sugarcane mosaic disease (SMD) is a major threat to sugarcane production. Currently, control of SMD is mainly dependent on breeding resistant cultivars through hybridization, which is time-consuming. Understanding the mechanism of viral infection may facilitate novel strategies to breed cultivars resistant to SMD and to control the disease. In this study, a wide interaction was detected between the viral VPg protein and host proteins. Several genes were screened from sugarcane cDNA library that could interact with Sugarcane streak mosaic virus VPg, including SceIF4E1 and ScELC. ScELC was predicted to be a cytoplasmic protein, but subcellular localization analysis showed it was distributed both in cytoplasmic and nuclear, and interactions were also detected between ScELC and VPg of SCMV or SrMV that reveal ScELC was widely used in the SMD pathogen infection process. ScELC and VPgs interacted in the nucleus, and may function to enhance the viral transcription rate. ScELC also interacted with SceIF4E2 both in the cytoplasm and nucleus, but not with SceIF4E1 and SceIF4E3. These results suggest that ScELC may be essential for the function of SceIF4E2, an isomer of eIF4E. - Highlights: • We cloned ScELC, SceIF4E1, SceIF4E2 and SceIF4E3 from sugarcane accession Badila. • We examined interactions among VPg, ScELC, SceIF4E1, SceIF4E2 and SceIF4E3. • We proofed that ScELC interacted with VPgs of SCMV, SrMV and SCSMV. • We proofed that ScELC interacted with SceIF4E2 but not SceIF4E1 or SceIF4E3.

  4. Proline utilization system is required for infection by the pathogenic α-proteobacterium Brucella abortus.

    Science.gov (United States)

    Caudill, Mitchell T; Budnick, James A; Sheehan, Lauren M; Lehman, Christian R; Purwantini, Endang; Mukhopadhyay, Biswarup; Caswell, Clayton C

    2017-07-01

    Proline utilization (Put) systems have been described in a number of bacteria; however, the importance and functionality of the Put system in the intracellular pathogen Brucellaabortus has not been explored. Generally, bacterial Put systems are composed of the bifunctional enzyme proline dehydrogenase PutA and its transcriptional activator PutR. Here, we demonstrate that the genes putA (bab2_0518) and putR (bab2_0517) are critical for the chronic infection of mice by B. abortus, but putA and putR are not required for the survival and replication of the bacteria in naive macrophages. Additionally, in vitro experiments revealed that putR is necessary for the ability of the bacteria to withstand oxidative stress, as a ΔputR deletion strain is hypersensitive to hydrogen peroxide exposure. Quantitative reverse transcription-PCR and putA-lacZ transcriptional reporter studies revealed that PutR acts as a transcriptional activator of putA in Brucella, and electrophoretic mobility shift assays confirmed that PutR binds directly to the putA promoter region. Biochemical analyses demonstrated that a purified recombinant B. abortus PutA protein possesses quintessential proline dehydrogenase activity, as PutA is capable of catalysing the conversion of proline to glutamate. Altogether, these data are the first to reveal that the Put system plays a significant role in the ability of B. abortus to replicate and survive within its host, as well as to describe the genetic regulation and biochemical activity of the Put system in Brucella.

  5. Third wave of African swine fever infection in Armenia: Virus demonstrates the reduction of pathogenicity

    Science.gov (United States)

    Sargsyan, M. A.; Voskanyan, H. E.; Karalova, E. M.; Hakobyan, L. H.; Karalyan, Z. A.

    2018-01-01

    Aim: First cases of clinically uncommon African swine fever (ASF), caused by virus genotype II are described in this article. These cases occurred in Armenia, Tavush region, Dilijan municipality in 2011. The aim of this study was to identify and describe the new pathogenic forms of ASF in Armenia. Materials and Methods: The isolation and identification of ASF virus (ASFV) were carried out using conventional techniques. Clinical signs of infection were recorded daily. Gross anatomical pathology characteristics were observed during routine postmortem examinations. Blood and serum were obtained by puncture of the jugular vein using a vacutainer system. Results: The presence of ASFV DNA in the spleens was confirmed by polymerase chain reaction. Sequenced sections of p72 showed phylogenetic identity to genotype 2. The pathology exhibits unusual manifestations of the main disease. The unusual form of ASF demonstrates characteristics of a subacute form of the disease, with the possibility of conversion to a chronic form. Decreased lethality, low level of hemorrhages, and absence of severe pancytopenia in smears from spleen, lymph nodes, and blood are common features of the new form of ASF. Unlike severe thrombocytopenia in the typical ASF, the unusual form exhibited moderate or minor decrease of this feature. Despite a moderate decrease in hemadsorption titers, the unusual pattern of the disease was characterized by viremia and the presence of the virus in the visceral organs, including the brain. Conclusion: Our data allow assuming that new nosological form of ASF (genotype II) may present as a transitional form of the disease with the possibility of chronization. PMID:29479149

  6. Third wave of African swine fever infection in Armenia: Virus demonstrates the reduction of pathogenicity

    Directory of Open Access Journals (Sweden)

    M. A. Sargsyan

    2018-01-01

    Full Text Available Aim: First cases of clinically uncommon African swine fever (ASF, caused by virus genotype II are described in this article. These cases occurred in Armenia, Tavush region, Dilijan municipality in 2011. The aim of this study was to identify and describe the new pathogenic forms of ASF in Armenia. Materials and Methods: The isolation and identification of ASF virus (ASFV were carried out using conventional techniques. Clinical signs of infection were recorded daily. Gross anatomical pathology characteristics were observed during routine postmortem examinations. Blood and serum were obtained by puncture of the jugular vein using a vacutainer system. Results: The presence of ASFV DNA in the spleens was confirmed by polymerase chain reaction. Sequenced sections of p72 showed phylogenetic identity to genotype 2. The pathology exhibits unusual manifestations of the main disease. The unusual form of ASF demonstrates characteristics of a subacute form of the disease, with the possibility of conversion to a chronic form. Decreased lethality, low level of hemorrhages, and absence of severe pancytopenia in smears from spleen, lymph nodes, and blood are common features of the new form of ASF. Unlike severe thrombocytopenia in the typical ASF, the unusual form exhibited moderate or minor decrease of this feature. Despite a moderate decrease in hemadsorption titers, the unusual pattern of the disease was characterized by viremia and the presence of the virus in the visceral organs, including the brain. Conclusion: Our data allow assuming that new nosological form of ASF (genotype II may present as a transitional form of the disease with the possibility of chronization.

  7. Lipoteichoic Acid (LTA) and Lipopolysaccharides (LPS) from Periodontal Pathogenic Bacteria Facilitate Oncogenic Herpesvirus Infection within Primary Oral Cells

    Science.gov (United States)

    Dai, Lu; DeFee, Michael R.; Cao, Yueyu; Wen, Jiling; Wen, Xiaofei; Noverr, Mairi C.; Qin, Zhiqiang

    2014-01-01

    Kaposi’s sarcoma (KS) remains the most common tumor arising in patients with HIV/AIDS, and involvement of the oral cavity represents one of the most common clinical manifestations of this tumor. HIV infection incurs an increased risk for periodontal diseases and oral carriage of a variety of bacteria. Whether interactions involving pathogenic bacteria and oncogenic viruses in the local environment facilitate replication or maintenance of these viruses in the oral cavity remains unknown. In the current study, our data indicate that pretreatment of primary human oral fibroblasts with two prototypical pathogen-associated molecular patterns (PAMPs) produced by oral pathogenic bacteria–lipoteichoic acid (LTA) and lipopolysaccharide (LPS), increase KSHV entry and subsequent viral latent gene expression during de novo infection. Further experiments demonstrate that the underlying mechanisms induced by LTA and/or LPS include upregulation of cellular receptor, increasing production of reactive oxygen species (ROS), and activating intracellular signaling pathways such as MAPK and NF-κB, and all of which are closely associated with KSHV entry or gene expression within oral cells. Based on these findings, we hope to provide the framework of developing novel targeted approaches for treatment and prevention of oral KSHV infection and KS development in high-risk HIV-positive patients. PMID:24971655

  8. A Multi-Omic View of Host-Pathogen-Commensal Interplay in Salmonella-Mediated Intestinal Infection

    Energy Technology Data Exchange (ETDEWEB)

    Kaiser, Brooke LD; Li, Jie; Sanford, James A.; Kim, Young-Mo; Kronewitter, Scott R.; Jones, Marcus B.; Peterson, Christine; Peterson, Scott N.; Frank, Bryan C.; Purvine, Samuel O.; Brown, Joseph N.; Metz, Thomas O.; Smith, Richard D.; Heffron, Fred; Adkins, Joshua N.

    2013-06-26

    The potential for commensal microorganisms indigenous to a host (the ‘microbiome’ or ‘microbiota’) to alter infection outcome by influencing host-pathogen interplay is largely unknown. We used a multi-omics “systems” approach, incorporating proteomics, metabolomics, glycomics, and metagenomics, to explore the molecular interplay between the murine host, the pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium), and commensal gut microorganisms during intestinal infection with S. Typhimurium. We find proteomic evidence that S. Typhimurium thrives within the infected 129/SvJ mouse gut without antibiotic pre-treatment, inducing inflammation and disrupting the intestinal microbiome (e.g., suppressing Bacteroidetes and Firmicutes while promoting growth of Salmonella and Enterococcus). Alteration of the host microbiome population structure was highly correlated with gut environmental changes, including the accumulation of metabolites normally consumed by commensal microbiota. Finally, the less characterized phase of S. Typhimurium’s lifecycle was investigated, and both proteomic and glycomic evidence suggests S. Typhimurium may take advantage of increased fucose moieties to metabolize fucose while growing in the gut. The application of multiple omics measurements to Salmonella-induced intestinal inflammation provides insights into complex molecular strategies employed during pathogenesis between host, pathogen, and the microbiome.

  9. All Yersinia enterocolitica are pathogenic: virulence of phylogroup 1 Y. enterocolitica in a Galleria mellonella infection model.

    Science.gov (United States)

    Alenizi, Dhahi; Ringwood, Tamara; Redhwan, Alya; Bouraha, Bouchra; Wren, Brendan W; Prentice, Michael; McNally, Alan

    2016-08-01

    Yersinia enterocolitica is a zoonotic pathogen and a common cause of gastroenteritis in humans. The species is composed of six diverse phylogroups, of which strains of phylogroup 1 are considered non-pathogenic to mammals due to the lack of the major virulence plasmid pYV, and their lack of virulence in a mouse infection model. In the present report we present data examining the pathogenicity of strains of Y. enterocolitica across all six phylogroups in a Galleria mellonellla model. We have demonstrated that in this model strains of phylogroup 1 exhibit severe pathogenesis with a lethal dose of as low as 10 c.f.u., that this virulence is an active process and that flagella play a major role in the virulence phenotype. We have also demonstrated that the complete lack of virulence in Galleria of the mammalian pathogenic phylogroups is not due to carriage of the pYV virulence plasmid. Our data suggest that all Y. enterocolitica can be pathogenic, which may be a reflection of the true natural habitat of the species, and that we may need to reconsider the eco-evo perspective of this important bacterial species.

  10. Detection of HPV and co-infecting pathogens in healthy Italian women by multiplex real-time PCR.

    Science.gov (United States)

    Camporiondo, Maria Pia; Farchi, Francesca; Ciccozzi, Massimo; Denaro, Aurelia; Gallone, Domenica; Maracchioni, Fabio; Favalli, Cartesio; Ciotti, Marco

    2016-01-01

    Several pathogens can be transmitted sexually and are an important cause of morbidity among sexually active women. The aim of the study was to detect the presence of human papillomavirus (HPV), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Mycoplasma genitalium (MG), Ureaplasma urealyticum (UU), and Ureaplasma parvum (UP) in a group of 309 healthy women enrolled at the San Camillo - Forlanini hospital of Rome by using two multiplex real-time PCR assays based on TOCE® technology. The women's ages ranged from 34 to 60 years, median 49 [IQR 45-54]. Of the 309 women tested, HPV DNA was detected in 77/309 (24.9%) patients. Of these, 44 (14.2%) harboured a single infection while 33 (10.7%) were infected by multiple genotypes. Prevalence of HPV infection was highest among females aged 40-50 years (15.2%). Of the other pathogens sought, CT, MG and NG were not detected while positive results were found for MH (12/309, 3.9%), TV (4/309, 1.3%), UP (89/309, 28.8%) and UU (14/309, 4.5%). Co-infections were as follows: 5 MH/HPV, 4 TV/HPV, 34 UP/HPV and 9 UU/HPV. In HPV-positive women, the probability of being infected by UP and UU was 2.5 (p=0.00045) and 6 fold higher (p=0.0016) than in HPV-negative women. The study supports the use of multiplex real-time PCR assays in a routine diagnostic setting. The high sensitivity and specificity of these assays along with the simultaneous detection of the most common sexually transmitted pathogens confers an advantage with respect to more obsolete methods reducing costs and time to diagnosis.

  11. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Elsen, S.; Collin-Faure, V.; Gidrol, X.; Lemercier, C.

    2013-01-01

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  12. Secretome of fungus-infected aphids documents high pathogen activity and weak host response

    DEFF Research Database (Denmark)

    Grell, Morten Nedergaard; Jensen, Annette Bruun; Olsen, Peter B.

    2011-01-01

    Discovery of novel secretome proteins contributes to the understanding of host-pathogen interactions. Here we report a rich diversity of secreted proteins from the interaction between grain aphids (host, insect order Hemiptera) and fungi of the order Entomophthorales (insect pathogens), made...

  13. In vitro and in vivo infectivity and pathogenicity of the lymphoid cell-derived woodchuck hepatitis virus.

    Science.gov (United States)

    Lew, Y Y; Michalak, T I

    2001-02-01

    Woodchuck hepatitis virus (WHV) and human hepatitis B virus are closely related, highly hepatotropic mammalian DNA viruses that also replicate in the lymphatic system. The infectivity and pathogenicity of hepadnaviruses propagating in lymphoid cells are under debate. In this study, hepato- and lymphotropism of WHV produced by naturally infected lymphoid cells was examined in specifically established woodchuck hepatocyte and lymphoid cell cultures and coculture systems, and virus pathogenicity was tested in susceptible animals. Applying PCR-based assays discriminating between the total pool of WHV genomes and covalently closed circular DNA (cccDNA), combined with enzymatic elimination of extracellular viral sequences potentially associated with the cell surface, our study documents that virus replicating in woodchuck lymphoid cells is infectious to homologous hepatocytes and lymphoid cells in vitro. The productive replication of WHV from lymphoid cells in cultured hepatocytes was evidenced by the appearance of virus-specific DNA, cccDNA, and antigens, transmissibility of the virus through multiple passages in hepatocyte cultures, and the ability of the passaged virus to infect virus-naive animals. The data also revealed that WHV from lymphoid cells can initiate classical acute viral hepatitis in susceptible animals, albeit small quantities (approximately 10(3) virions) caused immunovirologically undetectable (occult) WHV infection that engaged the lymphatic system but not the liver. Our results provide direct in vitro and in vivo evidence that lymphoid cells in the infected host support propagation of infectious hepadnavirus that has the potential to induce hepatitis. They also emphasize a principal role of the lymphatic system in the maintenance and dissemination of hepadnavirus infection, particularly when infection is induced by low virus doses.

  14. Cross-species infection of specific-pathogen-free pigs by a genotype 4 strain of human hepatitis E virus

    Science.gov (United States)

    Feagins, A. R.; Opriessnig, T.; Huang, Y. W.; Halbur, P. G.; Meng, X. J.

    2010-01-01

    SUMMARY Hepatitis E virus (HEV) is an important pathogen. The animal strain of HEV, swine HEV, is related to human HEV. The genotype 3 swine HEV infected humans and genotype 3 human HEV infected pigs. The genotype 4 swine and human HEV strains are genetically related, but it is unknown whether genotype 4 human HEV can infect pigs. A swine bioassay was utilized in this study to determine whether genotype 4 human HEV can infect pigs. Fifteen, 4-week-old, specific-pathogen-free pigs were divided into 3 groups of 5 each. Group 1 pigs were each inoculated intravenously with PBS buffer as negative controls, group 2 pigs similarly with genotype 3 human HEV (strain US-2), and group 3 pigs similarly with genotype 4 human HEV (strain TW6196E). Serum and fecal samples were collected at 0, 7, 14, 21, 28, 35, 42, 49, and 56 days postinoculation (dpi) and tested for evidence of HEV infection. All pigs were necropsied at 56 dpi. As expected, the negative control pigs remained negative. The positive control pigs inoculated with genotype 3 human HEV all became infected as evidenced by detection of HEV antibodies, viremia and fecal virus shedding. All five pigs in group 3 inoculated with genotype 4 human HEV also became infected: fecal virus shedding and viremia were detected variably from 7 to 56 dpi, and seroconversion occurred by 28 dpi. The data indicated that genotype 4 human HEV has an expanded host range, and the results have important implications for understanding the natural history and zoonosis of HEV. PMID:18551597

  15. In vivo fluorescence imaging of bacteriogenic cyanide in the lungs of live mice infected with cystic fibrosis pathogens.

    Directory of Open Access Journals (Sweden)

    Seong-Won Nam

    Full Text Available BACKGROUND: Pseudomonas aeruginosa (PA and Burkholderia cepacia complex (Bcc, commonly found in the lungs of cystic fibrosis (CF patients, often produce cyanide (CN, which inhibits cellular respiration. CN in sputa is a potential biomarker for lung infection by CF pathogens. However, its actual concentration in the infected lungs is unknown. METHODS AND FINDINGS: This work reports observation of CN in the lungs of mice infected with cyanogenic PA or Bcc strains using a CN fluorescent chemosensor (4',5'-fluorescein dicarboxaldehyde with a whole animal imaging system. When the CN chemosensor was injected into the lungs of mice intratracheally infected with either PA or B. cepacia strains embedded in agar beads, CN was detected in the millimolar range (1.8 to 4 mM in the infected lungs. CN concentration in PA-infected lungs rapidly increased within 24 hours but gradually decreased over the following days, while CN concentration in B. cepacia-infected lungs slowly increased, reaching a maximum at 5 days. CN concentrations correlated with the bacterial loads in the lungs. In vivo efficacy of antimicrobial treatments was tested in live mice by monitoring bacteriogenic CN in the lungs. CONCLUSIONS: The in vivo imaging method was also found suitable for minimally invasive testing the efficacy of antibiotic compounds as well as for aiding the understanding of bacterial cyanogenesis in CF lungs.

  16. Risk of Human Infections With Highly Pathogenic H5N2 and Low Pathogenic H7N1 Avian Influenza Strains During Outbreaks in Ostriches in South Africa.

    Science.gov (United States)

    Venter, Marietjie; Treurnicht, Florette K; Buys, Amelia; Tempia, Stefano; Samudzi, Rudo; McAnerney, Johanna; Jacobs, Charlene A; Thomas, Juno; Blumberg, Lucille

    2017-09-15

    Risk factors for human infection with highly pathogenic (HP) and low-pathogenic (LP) avian influenza (AI) H5N2 and H7N1 were investigated during outbreaks in ostriches in the Western Cape province, South Africa. Serum surveys were conducted for veterinarians, farmworkers, and laboratory and abattoir workers involved in 2 AI outbreaks in the Western Cape province: (1) controlling and culling of 42000 ostriches during (HPAI)H5N2 outbreaks in ostriches (2011) (n = 207); (2) movement control during (LPAI)H7N1 outbreaks in 2012 (n = 66). A third serosurvey was conducted on state veterinarians from across the country in 2012 tasked with disease control in general (n = 37). Antibodies to H5 and H7 were measured by means of hemagglutination inhibition and microneutralization assays, with microneutralization assay titers >40 considered positive. Two of 207 (1%) participants were seropositive for H5 and 4 of 207 (2%) for H7 in 2011, compared with 1 of 66 (1.5%) and 8 of 66 (13%) in 2012. Although individuals in all professions tested seropositive, abattoir workers (10 of 97; 10.3%) were significantly more at risk of influenza A(H7N1) infection (P = .001) than those in other professions (2 of 171;1.2%). Among state veterinarians, 4 of 37(11%) were seropositive for H7 and 1 of 37 (2.7%) for H5. Investigations of (LP)H7N1-associated fatalities in wild birds and quarantined exotic birds in Gauteng, AI outbreaks in poultry in KwaZulu-Natal, and ostriches in Western Cape province provide possible exposure events. (LPAI)H7N1 strains pose a greater infection-risk than (HPAI)H5N2 strains to persons involved in control of outbreaks in infected birds, with ostrich abattoir workers at highest risk. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  17. Experimental infection of swans and geese with highly pathogenic avian influenza virus (H5N1) of Asian lineage.

    Science.gov (United States)

    Brown, Justin D; Stallknecht, David E; Swayne, David E

    2008-01-01

    The role of wild birds in the epidemiology of the Asian lineage highly pathogenic avian influenza (HPAI) virus subtype H5N1 epizootic and their contribution to the spread of the responsible viruses in Eurasia and Africa are unclear. To better understand the potential role of swans and geese in the epidemiology of this virus, we infected 4 species of swans and 2 species of geese with an HPAI virus of Asian lineage recovered from a whooper swan in Mongolia in 2005, A/whooper swan/Mongolia/244/2005 (H5N1). The highest mortality rates were observed in swans, and species-related differences in clinical illness and viral shedding were evident. These results suggest that the potential for HPAI (H5N1) viral shedding and the movement of infected birds may be species-dependent and can help explain observed deaths associated with HPAI (H5N1) infection in anseriforms in Eurasia.

  18. A cross-sectional serological survey of the Dutch commercial poultry population for the presence of Low Pathogenic Avian Influenza virus infection

    NARCIS (Netherlands)

    Wit, de J.J.; Koch, G.; Fabri, T.H.F.; Elbers, A.R.W.

    2004-01-01

    After the discovery of poultry infected with highly pathogenic avian influenza (HPAI) virus of subtype H7N7 in the central area of the Netherlands on 28 February 2003, the hypothesis was put forward that an outbreak of the low pathogenic (LP) variant of H7N7 had preceded, unnoticed, the occurrence

  19. Infection of Drosophila suzukii with the obligate insect-pathogenic fungus Entomophthora muscae

    DEFF Research Database (Denmark)

    Becher, Paul G.; Jensen, Rasmus E.; Natsopoulou, Myrsini E.

    2018-01-01

    Physiological constraints restrict specialist pathogens from infecting new hosts. From an applied perspective, a narrow host range makes specialist pathogens interesting for targeting specific pest insects since they have minimal direct effects on non-target species. Entomopathogenic fungi of the...

  20. Meta-analysis of the Effects of Insect Vector Saliva on Host Immune Responses and Infection of Vector-Transmitted Pathogens: A Focus on Leishmaniasis

    OpenAIRE

    Ockenfels, Brittany; Michael, Edwin; McDowell, Mary Ann

    2014-01-01

    A meta-analysis of the effects of vector saliva on the immune response and progression of vector-transmitted disease, specifically with regard to pathology, infection level, and host cytokine levels was conducted. Infection in the absence or presence of saliva in naïve mice was compared. In addition, infection in mice pre-exposed to uninfected vector saliva was compared to infection in unexposed mice. To control for differences in vector and pathogen species, mouse strain, and experimental de...

  1. Elimination of root-infecting pathogens in recirculation water from closed cultivation systems by ultra-violet radiation

    International Nuclear Information System (INIS)

    Runia, W.T.

    1994-01-01

    The development from growing in border soil to soilless cultures has not resulted in the disappearance of soil-borne diseases. Most root-infecting pathogens also occur in these new cultivation systems. Some pathogens such as Pythium, Phytophthora, cucumber green mottle mosaic virus and tomato mosaic virus are easily transmitted in recirculation water as is Olpidium, the vector of several viruses. To exclude any risk of dispersal of plant pathogens the water has to be sterilised before re-use. Rainwater collected from the glasshouse roof can also be contaminated with pathogens. When this rainwater is used for irrigation water it should be disinfected first. Currently water disinfection by heating or ozonisation is applied on some 450 nurseries. Initially ultra-violet(UV) radiation was not effective against plant pathogens. Only at a low capacity of 18 l h -1 and a high UV-dose of 430 mJ cm -2 could fungal spores be eliminated in nutrient solution. A low capacity however implies a poor turbulence in the water, resulting in varying UV-doses in the different water layers. Two new UV-installations with high capacities were tested for their efficacy against fungal and viral plant pathogens. One installation was equipped with a high-pressure and the other with a low-pressure mercury vapour lamp. In both installations a sandfilter first removed organic particles from the water. A UV-dose from the high-pressure lamp of 28 mJ cm -2 reduced the infectivity of conidia of Fusarium oxysporum f.sp lycopersici by 90 % resulting in a 99.9 % reduction at 84 mJ cm -2 . The low-pressure lamp completely eliminated conidia of Fusarium at a UV-dose of 70 mJ cm -2 . Tomato mosaic virus was reduced by 99 % using a UV-dose of 100 mJ cm -2 in both installations. Ultra-violet radiation can be effective against plant pathogens providing the dose under controlled conditions is sufficient. Numerous growers use UV-radiation for the disinfection of water in closed cultivation systems. (author)

  2. Antibacterial and antioxidant activities of Musa sp. leaf extracts against multidrug resistant clinical pathogens causing nosocomial infection.

    Science.gov (United States)

    Karuppiah, Ponmurugan; Mustaffa, Muhammed

    2013-09-01

    To investigate different Musa sp. leave extracts of hexane, ethyl acetate and methanol were evaluated for antibacterial activity against multi-drug resistant pathogens causing nosocomial infection by agar well diffusion method and also antioxidant activities. The four different Musa species leaves were extracted with hexane, ethyl acetate and methanol. Antibacterial susceptibility test, minimum inhibitory concentration and minimum inhibitory bacterial concentration were determined by agar well diffusion method. Total phenolic content and in vitro antioxidant activity was determined. All the Musa sp. extracts showed moderate antibacterial activities expect Musa paradisiaca with the inhibition zone ranging from 8.0 to 18.6 mm. Among four species ethyl acetate extracts of Musa paradisiaca showed highest activity against tested pathogens particularly E. coli, P. aeruginosa and Citrobacter sp. The minimum inhibitory concentrations were within the value of 15.63- 250 µg/mL and minimum bactericidal concentrations were ranging from 31.25- 250 µg/mL. Antioxidant activity of Musa acuminate exhibited maximum activity among other three Musa species. The present study concluded that among the different Musa species, Musa paradisiaca displayed efficient antibacterial activity followed by Musa acuminata against multi-drug resistant nosocomial infection causing pathogens. Further, an extensive study is needed to identify the bioactive compounds, mode of action and toxic effect in vivo of Musa sp.

  3. The defense-responsive genes showing enhanced and repressed expression after pathogen infection in rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)

    2002-01-01

    Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.

  4. Discoloration and tyrosinase activity in Agaricus bisporus fruit bodies infected with various pathogens

    NARCIS (Netherlands)

    Soler-Rivas, C.; Arpin, N.; Olivier, J.M.; Wichers, H.J.

    2000-01-01

    The discoloration of A. bisporus after infection by Pseudomonas tolaasii, P. gingeri, P. agarici, P. reactans, Verticillium fungicola and Trichoderma harzianum can be distinguished by chromametric measurements. Infection with P. tolaasii caused a specific colour change, independent of the bacterial

  5. Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference

    KAUST Repository

    Mahfouz, Magdy Mahmoud

    2016-11-24

    A genetically modified tobacco plant or tomato plant resistant to at least one pathogenic geminiviridae virus species is provided. The plant comprises a heterologous CRISPR/Cas9 system and at least one heterologous nucleotide sequence that is capable of hybridizing to a nucleotide sequence of the pathogenic virus and that directs inactivation of the pathogenic virus species or plurality of viral species by the CRISPR/Cas9 system. The heterologous nucleotide sequence can be complementary to, but not limited to an Intergenic Region (IR) of the Tomato Yellow Leaf Curl Virus (TYLCV), Further provided are methods of generating a genetically modified plant that is resistant to a virus pathogen by a heterologous CRISPR/Cas9 system and expression of a gRNA specifically targeting the virus.

  6. Method of inhibiting plant virus pathogen infections by crispr/cas9-mediated interference

    KAUST Repository

    Mahfouz, Magdy M.; Ali, Zahir

    2016-01-01

    A genetically modified tobacco plant or tomato plant resistant to at least one pathogenic geminiviridae virus species is provided. The plant comprises a heterologous CRISPR/Cas9 system and at least one heterologous nucleotide sequence

  7. Direct and indirect effects of climate change on the risk of infection by water-transmitted pathogens.

    Science.gov (United States)

    Sterk, Ankie; Schijven, Jack; de Nijs, Ton; de Roda Husman, Ana Maria

    2013-11-19

    Climate change is likely to affect the infectious disease burden from exposure to pathogens in water used for drinking and recreation. Effective intervention measures require quantification of impacts of climate change on the distribution of pathogens in the environment and their potential effects on human health. Objectives of this systematic review were to summarize current knowledge available to estimate how climate change may directly and indirectly affect infection risks due to Campylobacter, Cryptosporidium, norovirus, and Vibrio. Secondary objectives were to prioritize natural processes and interactions that are susceptible to climate change and to identify knowledge gaps. Search strategies were determined based on a conceptual model and scenarios with the main emphasis on The Netherlands. The literature search resulted in a large quantity of publications on climate variables affecting pathogen input and behavior in aquatic environments. However, not all processes and pathogens are evenly covered by the literature, and in many cases, the direction of change is still unclear. To make useful predictions of climate change, it is necessary to combine both negative and positive effects. This review provides an overview of the most important effects of climate change on human health and shows the importance of QMRA to quantify the net effects.

  8. Vector-borne pathogens in dogs from Costa Rica: first molecular description of Babesia vogeli and Hepatozoon canis infections with a high prevalence of monocytic ehrlichiosis and the manifestations of co-infection.

    Science.gov (United States)

    Rojas, Alicia; Rojas, Diana; Montenegro, Víctor; Gutiérrez, Ricardo; Yasur-Landau, Daniel; Baneth, Gad

    2014-01-31

    Infection with canine vector-borne pathogens was evaluated in dogs from four different regions of Costa Rica by PCR. Demographic data, clinical signs, packed cell volume values, and the presence of tick infestation were recorded for each dog. Forty seven percent (69/146) of the dogs were infected with at least one pathogen and 12% were co-infected with two pathogens. Ehrlichia canis was detected in 34%, Anaplasma platys in 10%, Babesia vogeli in 8%, and Hepatozoon canis in 7.5% of the blood samples. No infection was detected with Leishmania spp. in blood, skin scrapings or conjunctival swabs. Thirty percent of the dogs presented at least one clinical sign compatible with vector-borne disease, and of those, 66% were infected with a pathogen. Subclinical infections were determined in 58% of the infected dogs including 82% (9/11), 58% (29/50), 42% (5/12) and 36% (5/14) of the dogs with H. canis, E. canis, B. vogeli and A. platys infections, respectively. A distinct relationship was found between infection and anemia. The mean PCV values were 34.4% in dogs with no infection, 31.5% in those who had a single infection and 23% in those with co-infection. Co-infected dogs had significantly lower PCV values compared to non-infected and single-infected dogs (pcanis were significantly associated with R. sanguineus s.l. infestation (pcanis in Costa Rica as well as in Central America. The results of this study indicate that multiple vector-borne pathogens responsible for severe diseases infect dogs in Costa Rica and therefore, increased owner and veterinarian awareness are needed. Moreover, prevention of tick infestation is recommended to decrease the threat of these diseases to the canine population. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Nosocomial infections after aneurysmal subarachnoid hemorrhage : time course and causative pathogens

    NARCIS (Netherlands)

    Laban, Kamil G.; Rinkel, Gabriel J. E.; Vergouwen, Mervyn D. I.

    BackgroundNosocomial infections after aneurysmal subarachnoid hemorrhage (aSAH) are associated with prolonged length of stay and poor functional outcome. It remains unclear if infections result in prolonged length of stay or, vice versa, if prolonged length of stay results in more infections. Before

  10. Airborne Transmission of Highly Pathogenic Influenza Virus during Processing of Infected Poultry.

    Science.gov (United States)

    Bertran, Kateri; Balzli, Charles; Kwon, Yong-Kuk; Tumpey, Terrence M; Clark, Andrew; Swayne, David E

    2017-11-01

    Exposure to infected poultry is a suspected cause of avian influenza (H5N1) virus infections in humans. We detected infectious droplets and aerosols during laboratory-simulated processing of asymptomatic chickens infected with human- (clades 1 and 2.2.1) and avian- (clades 1.1, 2.2, and 2.1) origin H5N1 viruses. We detected fewer airborne infectious particles in simulated processing of infected ducks. Influenza virus-naive chickens and ferrets exposed to the air space in which virus-infected chickens were processed became infected and died, suggesting that the slaughter of infected chickens is an efficient source of airborne virus that can infect birds and mammals. We did not detect consistent infections in ducks and ferrets exposed to the air space in which virus-infected ducks were processed. Our results support the hypothesis that airborne transmission of HPAI viruses can occur among poultry and from poultry to humans during home or live-poultry market slaughter of infected poultry.

  11. Implementing hospital-based surveillance for severe acute respiratory infections caused by influenza and other respiratory pathogens in New Zealand

    Directory of Open Access Journals (Sweden)

    Q Sue Huang

    2014-05-01

    Full Text Available Background: Recent experience with pandemic influenza A(H1N1pdm09 highlighted the importance of global surveillance for severe respiratory disease to support pandemic preparedness and seasonal influenza control. Improved surveillance in the southern hemisphere is needed to provide critical data on influenza epidemiology, disease burden, circulating strains and effectiveness of influenza prevention and control measures. Hospital-based surveillance for severe acute respiratory infection (SARI cases was established in New Zealand on 30 April 2012. The aims were to measure incidence, prevalence, risk factors, clinical spectrum and outcomes for SARI and associated influenza and other respiratory pathogen cases as well as to understand influenza contribution to patients not meeting SARI case definition. Methods/Design: All inpatients with suspected respiratory infections who were admitted overnight to the study hospitals were screened daily. If a patient met the World Health Organization’s SARI case definition, a respiratory specimen was tested for influenza and other respiratory pathogens. A case report form captured demographics, history of presenting illness, co-morbidities, disease course and outcome and risk factors. These data were supplemented from electronic clinical records and other linked data sources. Discussion: Hospital-based SARI surveillance has been implemented and is fully functioning in New Zealand. Active, prospective, continuous, hospital-based SARI surveillance is useful in supporting pandemic preparedness for emerging influenza A(H7N9 virus infections and seasonal influenza prevention and control.

  12. Pattern of Bacterial Pathogens and Their Susceptibility Isolated from Surgical Site Infections at Selected Referral Hospitals, Addis Ababa, Ethiopia

    Directory of Open Access Journals (Sweden)

    Walelign Dessie

    2016-01-01

    Full Text Available Background. The emergence of multidrug resistant bacterial pathogens in hospitals is becoming a challenge for surgeons to treat hospital acquired infections. Objective. To determine bacterial pathogens and drug susceptibility isolated from surgical site infections at St. Paul Specialized Hospital Millennium Medical College and Yekatit 12 Referral Hospital Medical College, Addis Ababa, Ethiopia. Methods. A cross-sectional study was conducted between October 2013 and March 2014 on 107 surgical site infected patients. Wound specimens were collected using sterile cotton swab and processed as per standard operative procedures in appropriate culture media; and susceptibility testing was done using Kirby-Bauer disc diffusion technique. The data were analyzed by using SPSS version 20. Result. From a total of 107 swabs collected, 90 (84.1% were culture positive and 104 organisms were isolated. E. coli (24 (23.1% was the most common organism isolated followed by multidrug resistant Acinetobacter species (23 (22.1%. More than 58 (75% of the Gram negative isolates showed multiple antibiotic resistance (resistance ≥ 5 drugs. Pan-antibiotic resistance was noted among 8 (34.8% Acinetobacter species and 3 (12.5% E. coli. This calls for abstinence from antibiotic abuse. Conclusion. Gram negative bacteria were the most important isolates accounting for 76 (73.1%. Ampicillin, amoxicillin, penicillin, cephazoline, and tetracycline showed resistance while gentamicin and ciprofloxacin were relatively effective antimicrobials.

  13. Penicillium expansum (compatible) and Penicillium digitatum (non-host) pathogen infection differentially alter ethylene biosynthesis in apple fruit.

    Science.gov (United States)

    Vilanova, Laura; Vall-Llaura, Núria; Torres, Rosario; Usall, Josep; Teixidó, Neus; Larrigaudière, Christian; Giné-Bordonaba, Jordi

    2017-11-01

    The role of ethylene on inducing plant resistance or susceptibility to certain fungal pathogens clearly depends on the plant pathogen interaction with little or no-information available focused on the apple-Penicillium interaction. Taken advantage that Penicillium expansum is the compatible pathogen and P. digitatum is the non-host of apples, the present study aimed at deciphering how each Penicillium spp. could interfere in the fruit ethylene biosynthesis at the biochemical and molecular level. The infection capacity and different aspects related to the ethylene biosynthesis were conducted at different times post-inoculation. The results show that the fruit ethylene biosynthesis was differently altered during the P. expansum infection than in response to other biotic (non-host pathogen P. digitatum) or abiotic stresses (wounding). The first symptoms of the disease due to P. expansum were visible before the initiation of the fruit ethylene climacteric burst. Indeed, the ethylene climacteric burst was reduced in response to P. expansum concomitant to an important induction of MdACO3 gene expression and an inhibition (ca. 3-fold) and overexpression (ca. 2-fold) of ACO (1-Aminocyclopropane-1-carboxylic acid oxidase) and ACS (1-Aminocyclopropane-1-carboxylic acid synthase) enzyme activities, indicating a putative role of MdACO3 in the P. expansum-apple interaction which may, in turn, be related to System-1 ethylene biosynthesis. System-1 is auto-inhibited by ethylene and is characteristic of non-climateric or pre-climacteric fruit. Accordingly, we hypothesise that P. expansum may 'manipulate' the endogenous ethylene biosynthesis in apples, leading to the circumvention or suppression of effective defences hence facilitating its colonization. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. Insertion of an esterase gene into a specific locust pathogen (Metarhizium acridum enables it to infect caterpillars.

    Directory of Open Access Journals (Sweden)

    Sibao Wang

    2011-06-01

    Full Text Available An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta cuticle, M. robertsii up-regulates a gene (Mest1 that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta, while virulence to grasshoppers (Melanoplus femurrubrum was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.

  15. Pattern of pathogens and their sensitivity isolated from superficial surgical site infections in a tertiary care hospital

    International Nuclear Information System (INIS)

    Ali, S.A.; Tahir, S.M.; Shaikh, N.A.

    2009-01-01

    Infection is an important cause of morbidity and mortality in surgical patients. Rapidly emerging nosocomial pathogens and the problem of multi-drug resistance necessitates periodic review of isolation patterns and sensitivity in surgical practice. Surgical site infections (SSI) are defined as an infections that occurs at the incision site within thirty days after surgery. Objectives of the study were to determine the pattern of pathogens involved and their antibiotic sensitivity isolated from superficial surgical site infections in a teaching hospital. This observational study was conducted for 1 year from January 2008 to December 2008 in all 4 surgical units of Liaquat University Hospital Hyderabad which caters to patients from low socioeconomic status. Pus culture and sensitivity reports were collected prospectively from hospitalised patients who developed postoperative wound infection. The patients who developed fecal/biliary/urinary fistula or operated for malignancies, and with negative cultures were excluded from the study. Analysis was carried out using SPSS 10. During the study period 112 pus culture and sensitivity reports were analyzed. E. coli 68 (60.7%) was the most common organism isolated followed by Klebsiella 23 (20.5%). The least frequent organism was staph. Epidermidis 1 (0.9%). All isolates were sensitive to penicillin derivatives and carbapenem. Quinolones, Aminoglycosides and Monobactum were also showing some promise in our study. However, Cephalosporins were ineffective against most of the important isolates in our study. E. coli and klebsiella were the most important isolates form SSI in our study, and penicillin derivatives and carbapenem were showing 100% antibiotic sensitivity to all of the isolates. (author)

  16. Immunogenicity in pig-tailed macaques of poliovirus replicons expressing HIV-1 and SIV antigens and protection against SHIV-89.6P disease

    International Nuclear Information System (INIS)

    Fultz, Patricia N.; Stallworth, Jackie; Porter, Donna; Novak, Miroslav; Anderson, Marie J.; Morrow, Casey D.

    2003-01-01

    In the search for an effective vaccine against the human immunodeficiency virus (HIV), novel ways to deliver viral antigens are being evaluated. One such approach is the use of nonreplicating viral vectors encoding HIV and/or SIV genes that are expressed after infection of host cells. Nonreplicating poliovirus vectors, termed replicons, that expressed HIV-1/HXB2 and SIVmac239 gag and various HIV-1 env genes from different clades were tested for immunogenicity and protective efficacy against intravenous challenge of pig-tailed macaques with SHIV-89.6P. To maximize both cellular and humoral immune responses, a prime-boost regimen was used. Initially, macaques were immunized four times over 35 weeks by either the intranasal and intrarectal or the intramuscular (im) route with mixtures of poliovirus replicons expressing HIV-1 gag and multiple env genes. Immunization with replicons alone induced both serum antibodies and lymphocyte proliferative responses. After boosting with purified Env protein, neutralizing antibodies to SHIV-89.6P were induced in four of five immunized animals. In a second experiment, four macaques were immunized im three times over 27 weeks with replicons expressing the SIVmac239 gag and HIV-1/HXB2 env genes. All immunized animals were then boosted twice with purified HIV-1-89.6 rgp140-Env and SIVmac239 p55-Gag proteins. Four control animals received only the two protein inoculations. Immunized and control animals were then challenged intravenously with the pathogenic SHIV-89.6P. After challenge the animals were monitored for virus isolation from peripheral blood mononuclear cells and plasma viremia and for changes in virus-specific antibody titers. Naieve pig-tailed macaques experienced rapid loss of CD4 + T cells and died between 38 and 62 weeks after infection. In contrast, macaques immunized with replicons and proteins rapidly cleared plasma virus and did not experience sustained loss of CD4 + lymphocytes. Furthermore, two of the four macaques

  17. Characterization and genome analysis of novel bacteriophages infecting the opportunistic human pathogens Klebsiella oxytoca and K. pneumoniae.

    Science.gov (United States)

    Park, Eun-Ah; Kim, You-Tae; Cho, Jae-Hyun; Ryu, Sangryeol; Lee, Ju-Hoon

    2017-04-01

    Klebsiella is a genus of well-known opportunistic human pathogens that are associated with diabetes mellitus and chronic pulmonary obstruction; however, this pathogen is often resistant to multiple drugs. To control this pathogen, two Klebsiella-infecting phages, K. oxytoca phage PKO111 and K. pneumoniae phage PKP126, were isolated from a sewage sample. Analysis of their host range revealed that they infect K. pneumoniae and K. oxytoca, suggesting host specificity for members of the genus Klebsiella. Stability tests confirmed that the phages are stable under various temperature (4 to 60 °C) and pH (3 to 11) conditions. A challenge assay showed that PKO111 and PKP126 inhibit growth of their host strains by 2 log and 4 log, respectively. Complete genome sequencing of the phages revealed that their genome sizes are quite different (168,758 bp for PKO111 and 50,934 bp for PKP126). Their genome annotation results showed that they have no human virulence-related genes, an important safety consideration. In addition, no lysogen-formation gene cluster was detected in either phage genome, suggesting that they are both virulent phages in their bacterial hosts. Based on these results, PKO111 and PKP126 may be good candidates for development of biocontrol agents against members of the genus Klebsiella for therapeutic purposes. A comparative analysis of tail-associated gene clusters of PKO111 and PKP126 revealed relatively low homology, suggesting that they might differ in the way they recognize and infect their specific hosts.

  18. [The role of natural environment in spreading of hantavirus--model of the correlation between host, pathogen and human infections].

    Science.gov (United States)

    Baumann, Anna; Dudek, Dorota; Sadkowska-Todys, Małgorzata

    2007-01-01

    The environmental changes caused by humans influence ecosystem and thus have significant impact on occurrence of emerging and re-emerging diseases. The hantavirus infection belong to the one of them. The aim of this paper was to present current knowledge about relationship between hantavirus, their natural host and the spread of the infection to people. Rodents constitute both the natural host of the hantaviruses and the reservoir of hantavirus for environment. Circulation of the virus in the rodent population is crucial to maintain the virus in the environment. The individual characteristics of rodents influence on risk of infection with hantavirus. However, this relationship is still unexplained. Risk of pathogen exposure often increases with age and behavioral differences associated with the sex of the susceptible individual. Mating behaviors seem to play an important role in the spread of the virus among rodents. Human incidence of hantavirus infection has in general been found to correlate to the population size of rodent host especially in the model of nephropathia epidemica (NE; a mild form of HFRS), Puumala virus (PUU) and bank voles. The occurrence of hantavirus infections in humans is assumed to rise as a secondary effect from altered population sizes of rodents in a changing environment due to e.g. mast years, forest fragmentation, global warming.

  19. Infection processes of xylem-colonizing pathogenic bacteria: possible explanations for the scarcity of qualitative disease resistance genes against them in crops.

    Science.gov (United States)

    Bae, Chungyun; Han, Sang Wook; Song, Yu-Rim; Kim, Bo-Young; Lee, Hyung-Jin; Lee, Je-Min; Yeam, Inhwa; Heu, Sunggi; Oh, Chang-Sik

    2015-07-01

    Disease resistance against xylem-colonizing pathogenic bacteria in crops. Plant pathogenic bacteria cause destructive diseases in many commercially important crops. Among these bacteria, eight pathogens, Ralstonia solanacearum, Xanthomonas oryzae pv. oryzae, X. campestris pv. campestris, Erwinia amylovora, Pantoea stewartii subsp. stewartii, Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. actinidiae, and Xylella fastidiosa, infect their host plants through different infection sites and paths and eventually colonize the xylem tissues of their host plants, resulting in wilting symptoms by blocking water flow or necrosis of xylem tissues. Noticeably, only a relatively small number of resistant cultivars in major crops against these vascular bacterial pathogens except X. oryzae pv. oryzae have been found or generated so far, although these pathogens threaten productivity of major crops. In this review, we summarize the lifestyles of major xylem-colonizing bacterial pathogens and then discuss the progress of current research on disease resistance controlled by qualitative disease resistance genes or quantitative trait loci against them. Finally, we propose infection processes of xylem-colonizing bacterial pathogens as one of possible reasons for why so few qualitative disease resistance genes against these pathogens have been developed or identified so far in crops.

  20. The ability to cause infection in a pathogenic fungus uncovers a new biological feature of honey bee viruses.

    Science.gov (United States)

    Li, Zhiguo; Su, Songkun; Hamilton, Michele; Yan, Limin; Chen, Yanping

    2014-07-01

    We demonstrated that honey bee viruses including Deformed wing virus (DWV), Black queen cell virus (BQCV) and Israeli acute paralysis virus (IAPV) could infect and replicate in the fungal pathogen Ascosphaera apis that causes honey bee chalkbrood disease, revealing a novel biological feature of honey bee viruses. The phylogenetic analysis show that viruses of fungal and honey bee origins form two clusters in the phylogenetic trees distinctly and that host range of honey bee viruses is dynamic. Further studies are warranted to investigate the impact of the viruses on the fitness of their fungal host and phenotypic effects the virus-fungus combination has on honey bee hosts. Published by Elsevier Inc.

  1. Prevention of pathogenic Escherichia coli infection in mice and stimulation of macrophage activation in rats by an oral administration of probiotic Lactobacillus casei I-5.

    Science.gov (United States)

    Ishida-Fujii, Keiko; Sato, Rieko; Goto, Shingo; Yang, Xiao-Ping; Kuboki, Hiroshi; Hirano, Shin-Ichi; Sato, Michikatsu

    2007-04-01

    Lactobacillus casei I-5 isolated from an alcohol fermentation broth enhanced immunity and prevented pathogenic infection as a probiotic. Mice fed with I-5 cells for 11 days prior to an intraperitoneal challenge with pathogenic Escherichia coli Juhl exhibited a high survival rate compared with the control group. Rats fed with I-5 cells for 10 days significantly increased the phagocytosis of peritoneal macrophages. In a cell culture system employing peritoneal macrophages from rats, the I-5 administration activated NF-kappaB stimulated by LPS. It also enhanced LPS-stimulated IL-12 and TNF-alpha production, but not IL-6 production. These results show that L. casei I-5 effectively prevented infection by pathogenic E. coli possibly through the activation of peritoneal macrophages. The strain would be useful to prevent pathogenic microbial infections in humans and farm animals.

  2. The cereal pathogen Fusarium pseudograminearum produces a new class of active cytokinins during infection

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Benfield, Aurelie H.; Wollenberg, Rasmus Dam

    2018-01-01

    -senescence activities and the production of a cytokinin mimic by what was once considered a necrotrophic pathogen that promotes cell death and senescence challenges the simple view that this pathogen invades its hosts by employing a barrage of lytic enzymes and toxins. Through genome mining, a gene cluster in the F....... pseudograminearum genome for the production of Fusarium cytokinins was identified and the biosynthetic pathway established using gene knockouts. The Fusarium cytokinins could activate plant cytokinin signalling, demonstrating their genuine hormone mimicry. In planta analysis of the transcriptional response to one...

  3. Transcription factor regulation and cytokine expression following in vitro infection of primary chicken cell culture with low pathogenic avian influenza virus

    Science.gov (United States)

    Avian influenza virus (AIV) induced proinflammatory cytokine expression is believed to contribute to the disease pathogenesis following infection. However, there is limited information on the avian immune response to infection with low pathogenic avian influenza virus (LPAIV). To gain a better under...

  4. Immune responses of mature chicken bone-marrow-derived dendritic cells infected with Newcastle disease virus strains with differing pathogenicity.

    Science.gov (United States)

    Xiang, Bin; Zhu, Wenxian; Li, Yaling; Gao, Pei; Liang, Jianpeng; Liu, Di; Ding, Chan; Liao, Ming; Kang, Yinfeng; Ren, Tao

    2018-06-01

    Infection of chickens with virulent Newcastle disease virus (NDV) is associated with severe pathology and increased morbidity and mortality. The innate immune response contributes to the pathogenicity of NDV. As professional antigen-presenting cells, dendritic cells (DCs) play a unique role in innate immunity. However, the contribution of DCs to NDV infection has not been investigated in chickens. In this study, we selected two representative NDV strains, i.e., the velogenic NDV strain Chicken/Guangdong/GM/2014 (GM) and the lentogenic NDV strain La Sota, to investigate whether NDVs could infect LPS-activated chicken bone-derived marrow DCs (mature chicken BM-DCs). We compared the viral titres and innate immune responses in mature chicken BM-DCs following infection with those strains. Both NDV strains could infect mature chicken BM-DC, but the GM strain showed stronger replication capacity than the La Sota strain in mature chicken BM-DCs. Gene expression profiling showed that MDA5, LGP2, TLR3, TLR7, IFN-α, IFN-β, IFN-γ, IL-1β, IL-6, IL-18, IL-8, CCL5, IL-10, IL-12, MHC-I, and MHC-II levels were altered in mature DCs after infection with NDVs at all evaluated times postinfection. Notably, the GM strain triggered stronger innate immune responses than the La Sota strain in chicken BM-DCs. However, both strains were able to suppress the expression of some cytokines, such as IL-6 and IFN-α, in mature chicken DCs at 24 hpi. These data provide a foundation for further investigation of the role of chicken DCs in NDV infection.

  5. Pharmacodynamics of nitrofurantoin at different pH levels against pathogens involved in urinary tract infections

    NARCIS (Netherlands)

    Fransen, F.; Melchers, M.J.B.; Lagarde, C.M.C.; Meletiadis, J.; Mouton, J.W.

    2017-01-01

    Background: Urinary tract infections are among the most common human infections. Due to the progressive increase in ESBL-producing bacteria and the unavailability of new antibiotics, re-evaluation of 'old' antibiotics is needed. However, the pharmacodynamics of nitrofurantoin under variable pH

  6. Inter-chromosomal transfer of immune regulation during infection of barley with the powdery mildew pathogen

    Science.gov (United States)

    Powdery mildews infect over 9,500 plant species, causing critical yield loss. Powdery mildew disease of barley is caused by the Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh) and has become a model for the interactions among obligate biotrophs and their cereal hosts. Successful infection r...

  7. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  8. Pathogen burden, co-infection and major histocompatibility complex variability in the European badger (Meles meles)

    NARCIS (Netherlands)

    Sin, Yung Wa; Annavi, Geetha; Dugdale, Hannah L.; Newman, Chris; Burke, Terry; MacDonald, David W.

    2014-01-01

    Pathogen-mediated selection is thought to maintain the extreme diversity in the major histocompatibility complex (MHC) genes, operating through the heterozygote advantage, rare-allele advantage and fluctuating selection mechanisms. Heterozygote advantage (i.e. recognizing and binding a wider range

  9. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

    Science.gov (United States)

    Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

    2016-07-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.

  10. Pathogenesis of highly pathogenic avian influenza A virus (H7N1) infection in chickens inoculated with three different doses.

    Science.gov (United States)

    Chaves, Aida J; Busquets, Nuria; Campos, Naiana; Ramis, Antonio; Dolz, Roser; Rivas, Raquel; Valle, Rosa; Abad, F Xavier; Darji, Ayub; Majo, Natalia

    2011-04-01

    To study the pathogenesis of a H7N1 highly pathogenic avian influenza virus strain, specific pathogen free chickens were inoculated with decreasing concentrations of virus: 10(5.5) median embryo lethal dose (ELD(50)) (G1), 10(3.5) ELD(50) (G2) and 10(1.5) ELD(50) (G3). Disease progression was monitored over a period of 16 days and sequential necropsies and tissue samples were collected for histological and immunohistochemical examination. Viral RNA loads were also quantified in different tissues, blood, oropharyngeal swabs, and cloacal swabs using quantitative real-time reverse transcriptase-polymerase chain reaction (RT-qPCR). Clinical signs of depression, apathy, listlessness, huddling and ruffled feathers were recorded in G1 and a few G2 birds, whilst neurological signs were only observed in chickens inoculated with the highest dose. Gross lesions of haemorrhages were observed in the unfeathered skin of the comb and legs, and skeletal muscle, lung, pancreas and kidneys of birds inoculated with 10(5.5) ELD(50) and 10(3.5) ELD(50) doses. Microscopic lesions and viral antigen were demonstrated in cells of the nasal cavity, lung, heart, skeletal muscle, brain, spinal cord, gastrointestinal tract, pancreas, liver, bone marrow, thymus, bursa of Fabricius, spleen, kidney, adrenal gland and skin. Viral RNA was detected by RT-qPCR in kidney, lung, intestine, and brain samples of G1 and G2 birds. However, in birds infected with the lowest dose, viral RNA was detected only in brain and lung samples in low amounts at 5 and 7 days post infection. Interestingly, viral shedding was observed in oropharyngeal and cloacal swabs with proportionate decrease with the inoculation dose. We conclude that although an adequate infectious dose is critical in reproducing the clinical infection, chickens exposed to lower doses can be infected and shed virus representing a risk for the dissemination of the viral agent.

  11. Phage inhibit pathogen dissemination by targeting bacterial migrants in a chronic infection model

    DEFF Research Database (Denmark)

    Darch, Sophie E.; Kragh, Kasper N.; Abbott, Evelyn A.

    2017-01-01

    The microbial communities inhabiting chronic infections are often composed of spatially organized micrometer-sized, highly dense aggregates. It has recently been hypothesized that aggregates are responsible for the high tolerance of chronic infections to host immune functions and antimicrobial...... production; however, seeding of new aggregates by dispersed migrants was inhibited. We propose a model in which aggregates provide a mechanism that allows P. aeruginosa to tolerate phage therapy during chronic infection without the need for genetic mutation. IMPORTANCE Bacteria in chronic infections often...... reside in communities composed of micrometer-sized, highly dense aggregates. A primary challenge for studying aggregates has been the lack of laboratory systems that promote natural aggregate formation in relevant environments. Here, we developed a growth medium that mimics chronic lung infection...

  12. Synovial fluid multiplex PCR is superior to culture for detection of low-virulent pathogens causing periprosthetic joint infection.

    Science.gov (United States)

    Morgenstern, Christian; Cabric, Sabrina; Perka, Carsten; Trampuz, Andrej; Renz, Nora

    2018-02-01

    Analysis of joint aspirate is the standard preoperative investigation for diagnosis of periprosthetic joint infection (PJI). We compared the diagnostic performance of culture and multiplex polymerase chain reaction (PCR) of synovial fluid for diagnosis of PJI. Patients in whom aspiration of the prosthetic hip or knee joint was performed before revision arthroplasty were prospectively included. The performance of synovial fluid culture and multiplex PCR was compared by McNemar's chi-squared test. A total of 142 patients were included, 82 with knee and 60 with hip prosthesis. PJI was diagnosed in 77 patients (54%) and aseptic failure in 65 patients (46%). The sensitivity of synovial fluid culture and PCR was 52% and 60%, respectively, showing concordant results in 116 patients (82%). In patients with PJI, PCR missed 6 high-virulent pathogens (S. aureus, streptococci, E. faecalis, E. coli) which grew in synovial fluid culture, whereas synovial fluid culture missed 12 pathogens detected by multiplex PCR, predominantly low-virulent pathogens (Cutibacterium acnes and coagulase-negative staphylococci). In patients with aseptic failure, PCR detected 6 low-virulent organisms (predominantly C. acnes). While the overall performance of synovial fluid PCR was comparable to culture, PCR was superior for detection of low-virulent bacteria such as Cutibacterium spp. and coagulase-negative staphylococci. In addition, synovial fluid culture required several days for growth, whereas multiplex PCR provided results within 5hours in an automated manner. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. No Observed Effect of Landscape Fragmentation on Pathogen Infection Prevalence in Blacklegged Ticks (Ixodes scapularis in the Northeastern United States.

    Directory of Open Access Journals (Sweden)

    Christine P Zolnik

    Full Text Available Pathogen prevalence within blacklegged ticks (Ixodes scapularis Say, 1821 tends to vary across sites and geographic regions, but the underlying causes of this variation are not well understood. Efforts to understand the ecology of Lyme disease have led to the proposition that sites with higher host diversity will result in lower disease risk due to an increase in the abundance of inefficient reservoir species relative to the abundance of species that are highly competent reservoirs. Although the Lyme disease transmission cycle is often cited as a model for this "dilution effect hypothesis", little empirical evidence exists to support that claim. Here we tested the dilution effect hypothesis for two pathogens transmitted by the blacklegged tick along an urban-to-rural gradient in the northeastern United States using landscape fragmentation as a proxy for host biodiversity. Percent impervious surface and habitat fragment size around each site were determined to assess the effect of landscape fragmentation on nymphal blacklegged tick infection with Borrelia burgdorferi and Anaplasma phagocytophilum. Our results do not support the dilution effect hypothesis for either pathogen and are in agreement with the few studies to date that have tested this idea using either a landscape proxy or direct measures of host biodiversity.

  14. Comparative study of CXC chemokines modulation in brown trout (Salmo trutta) following infection with a bacterial or viral pathogen.

    Science.gov (United States)

    Gorgoglione, Bartolomeo; Zahran, Eman; Taylor, Nick G H; Feist, Stephen W; Zou, Jun; Secombes, Christopher J

    2016-03-01

    Chemokine modulation in response to pathogens still needs to be fully characterised in fish, in view of the recently described novel chemokines present. This paper reports the first comparative study of CXC chemokine genes transcription in salmonids (brown trout), with a particular focus on the fish specific CXC chemokines (CXCL_F). Adopting new primer sets, optimised to specifically target mRNA, a RT-qPCR gene screening was carried out. Constitutive gene expression was assessed first in six tissues from SPF brown trout. Transcription modulation was next investigated in kidney and spleen during septicaemic infection induced by a RNA virus (Viral Haemorrhagic Septicaemia virus, genotype Ia) or by a Gram negative bacterium (Yersinia ruckeri, ser. O1/biot. 2). From each target organ specific pathogen burden, measured detecting VHSV-glycoprotein or Y. ruckeri 16S rRNA, and IFN-γ gene expression were analysed for their correlation to chemokine transcription. Both pathogens modulated CXC chemokine gene transcript levels, with marked up-regulation seen in some cases, and with both temporal and tissue specific effects apparent. For example, Y. ruckeri strongly induced chemokine transcription in spleen within 24h, whilst VHS generally induced the largest increases at 3d.p.i. in both tissues. This study gives clues to the role of the novel CXC chemokines, in comparison to the other known CXC chemokines in salmonids. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Corneal Opacity in Domestic Ducks Experimentally Infected With H5N1 Highly Pathogenic Avian Influenza Virus.

    Science.gov (United States)

    Yamamoto, Y; Nakamura, K; Yamada, M; Mase, M

    2016-01-01

    Domestic ducks can be a key factor in the regional spread of H5N1 highly pathogenic avian influenza (HPAI) virus in Asia. The authors performed experimental infections to examine the relationship between corneal opacity and H5N1 HPAI virus infection in domestic ducks (Anas platyrhyncha var domestica). A total of 99 domestic ducks, including 3 control birds, were used in the study. In experiment 1, when domestic ducks were inoculated intranasally with 2 H5N1 HPAI viruses, corneal opacity appeared more frequently than neurologic signs and mortality. Corneal ulceration and exophthalmos were rare findings. Histopathologic examinations of the eyes of domestic ducks in experiment 2 revealed that corneal opacity was due to the loss of corneal endothelial cells and subsequent keratitis with edema. Influenza viral antigen was detected in corneal endothelial cells and some other ocular cells by immunohistochemistry. Results suggest that corneal opacity is a characteristic and frequent finding in domestic ducks infected with the H5N1 HPAI virus. Confirming this ocular change may improve the detection rate of infected domestic ducks in the field. © The Author(s) 2015.

  16. The co-transcriptome of uropathogenic Escherichia coli-infected mouse macrophages reveals new insights into host-pathogen interactions

    KAUST Repository

    Mavromatis, Charalampos Harris; Bokil, Nilesh J.; Totsika, Makrina; Kakkanat, Asha; Schaale, Kolja; Cannistraci, Carlo V.; Ryu, Tae Woo; Beatson, Scott A.; Ulett, Glen C.; Schembri, Mark A.; Sweet, Matthew J.; Ravasi, Timothy

    2015-01-01

    Urinary tract infections (UTI) are among the most common infections in humans. Uropathogenic Escherichia coli (UPEC) can invade and replicate within bladder epithelial cells, and some UPEC strains can also survive within macrophages. To understand the UPEC transcriptional programme associated with intramacrophage survival, we performed host–pathogen co-transcriptome analyses using RNA sequencing. Mouse bone marrow-derived macrophages (BMMs) were challenged over a 24 h time course with two UPEC reference strains that possess contrasting intramacrophage phenotypes: UTI89, which survives in BMMs, and 83972, which is killed by BMMs. Neither of these strains caused significant BMM cell death at the low multiplicity of infection that was used in this study. We developed an effective computational framework that simultaneously separated, annotated and quantified the mammalian and bacterial transcriptomes. Bone marrow-derived macrophages responded to the two UPEC strains with a broadly similar gene expression programme. In contrast, the transcriptional responses of the UPEC strains diverged markedly from each other. We identified UTI89 genes up-regulated at 24 h post-infection, and hypothesized that some may contribute to intramacrophage survival. Indeed, we showed that deletion of one such gene (pspA) significantly reduced UTI89 survival within BMMs. Our study provides a technological framework for simultaneously capturing global changes at the transcriptional level in co-cultures, and has generated new insights into the mechanisms that UPEC use to persist within the intramacrophage environment.

  17. The co-transcriptome of uropathogenic Escherichia coli-infected mouse macrophages reveals new insights into host-pathogen interactions

    KAUST Repository

    Mavromatis, Charalampos Harris

    2015-01-24

    Urinary tract infections (UTI) are among the most common infections in humans. Uropathogenic Escherichia coli (UPEC) can invade and replicate within bladder epithelial cells, and some UPEC strains can also survive within macrophages. To understand the UPEC transcriptional programme associated with intramacrophage survival, we performed host–pathogen co-transcriptome analyses using RNA sequencing. Mouse bone marrow-derived macrophages (BMMs) were challenged over a 24 h time course with two UPEC reference strains that possess contrasting intramacrophage phenotypes: UTI89, which survives in BMMs, and 83972, which is killed by BMMs. Neither of these strains caused significant BMM cell death at the low multiplicity of infection that was used in this study. We developed an effective computational framework that simultaneously separated, annotated and quantified the mammalian and bacterial transcriptomes. Bone marrow-derived macrophages responded to the two UPEC strains with a broadly similar gene expression programme. In contrast, the transcriptional responses of the UPEC strains diverged markedly from each other. We identified UTI89 genes up-regulated at 24 h post-infection, and hypothesized that some may contribute to intramacrophage survival. Indeed, we showed that deletion of one such gene (pspA) significantly reduced UTI89 survival within BMMs. Our study provides a technological framework for simultaneously capturing global changes at the transcriptional level in co-cultures, and has generated new insights into the mechanisms that UPEC use to persist within the intramacrophage environment.

  18. Genome-wide analysis of gene expression and protein secretion of Babesia canis during virulent infection identifies potential pathogenicity factors.

    Science.gov (United States)

    Eichenberger, Ramon M; Ramakrishnan, Chandra; Russo, Giancarlo; Deplazes, Peter; Hehl, Adrian B

    2017-06-13

    Infections of dogs with virulent strains of Babesia canis are characterized by rapid onset and high mortality, comparable to complicated human malaria. As in other apicomplexan parasites, most Babesia virulence factors responsible for survival and pathogenicity are secreted to the host cell surface and beyond where they remodel and biochemically modify the infected cell interacting with host proteins in a very specific manner. Here, we investigated factors secreted by B. canis during acute infections in dogs and report on in silico predictions and experimental analysis of the parasite's exportome. As a backdrop, we generated a fully annotated B. canis genome sequence of a virulent Hungarian field isolate (strain BcH-CHIPZ) underpinned by extensive genome-wide RNA-seq analysis. We find evidence for conserved factors in apicomplexan hemoparasites involved in immune-evasion (e.g. VESA-protein family), proteins secreted across the iRBC membrane into the host bloodstream (e.g. SA- and Bc28 protein families), potential moonlighting proteins (e.g. profilin and histones), and uncharacterized antigens present during acute crisis in dogs. The combined data provides a first predicted and partially validated set of potential virulence factors exported during fatal infections, which can be exploited for urgently needed innovative intervention strategies aimed at facilitating diagnosis and management of canine babesiosis.

  19. Alendronate augments interleukin-1β release from macrophages infected with periodontal pathogenic bacteria through activation of caspase-1

    International Nuclear Information System (INIS)

    Deng Xue; Tamai, Riyoko; Endo, Yasuo; Kiyoura, Yusuke

    2009-01-01

    Nitrogen-containing bisphosphonates (NBPs) are anti-bone-resorptive drugs with inflammatory side effects that include osteomyelitis and osteonecrosis of the jaw. Oral bacteria have been considered to be a trigger for these NBP-associated jaw bone diseases. The present study examined the effects of alendronate (a typical NBP) and clodronate (a non-NBP) on the production of proinflammatory cytokines by macrophages infected with Porphyromonas gingivalis and Tannerella forsythia, which are important pathogens of periodontal diseases. Pretreatment with alendronate augmented IL-1β, but not TNFα, production by macrophages infected with P. gingivalis or T. forsythia. This augmentation of IL-1β production was inhibited by clodronate. Furthermore, caspase-1, a promoter of IL-1β production, was activated by treatment with alendronate, and caspase-1 inhibitor reduced the production of IL-1β induced by alendronate and P. gingivalis. These results suggest that NBPs augment periodontal pathogenic bacteria-induced IL-1β release via caspase-1 activation, and this phenomenon may contribute to the development of NBP-associated inflammatory side effects including jaw osteomyelitis. Co-treatment with clodronate may prevent and/or reduce these inflammatory effects induced by NBPs

  20. Alendronate augments interleukin-1{beta} release from macrophages infected with periodontal pathogenic bacteria through activation of caspase-1

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Deng; Tamai, Riyoko [Division of Oral Bacteriology, Department of Oral Medical Science, Ohu University School of Dentistry, 31-1 Misumido, Tomitamachi, Koriyama, Fukushima 963-8611 (Japan); Endo, Yasuo [Department of Molecular Regulation, Graduate School of Dentistry, Tohoku University, 4-1 Seiryo-machi, Aoba-ku, Sendai 980-8575 (Japan); Kiyoura, Yusuke [Division of Oral Bacteriology, Department of Oral Medical Science, Ohu University School of Dentistry, 31-1 Misumido, Tomitamachi, Koriyama, Fukushima 963-8611 (Japan)

    2009-02-15

    Nitrogen-containing bisphosphonates (NBPs) are anti-bone-resorptive drugs with inflammatory side effects that include osteomyelitis and osteonecrosis of the jaw. Oral bacteria have been considered to be a trigger for these NBP-associated jaw bone diseases. The present study examined the effects of alendronate (a typical NBP) and clodronate (a non-NBP) on the production of proinflammatory cytokines by macrophages infected with Porphyromonas gingivalis and Tannerella forsythia, which are important pathogens of periodontal diseases. Pretreatment with alendronate augmented IL-1{beta}, but not TNF{alpha}, production by macrophages infected with P. gingivalis or T. forsythia. This augmentation of IL-1{beta} production was inhibited by clodronate. Furthermore, caspase-1, a promoter of IL-1{beta} production, was activated by treatment with alendronate, and caspase-1 inhibitor reduced the production of IL-1{beta} induced by alendronate and P. gingivalis. These results suggest that NBPs augment periodontal pathogenic bacteria-induced IL-1{beta} release via caspase-1 activation, and this phenomenon may contribute to the development of NBP-associated inflammatory side effects including jaw osteomyelitis. Co-treatment with clodronate may prevent and/or reduce these inflammatory effects induced by NBPs.

  1. Molecular characterization of the sweet potato peroxidase SWPA4 promoter which responds to abiotic stresses and pathogen infection.

    Science.gov (United States)

    Ryu, Sun-Hwa; Kim, Yun-Hee; Kim, Cha Young; Park, Soo-Young; Kwon, Suk-Yoon; Lee, Haeng-Soon; Kwak, Sang-Soo

    2009-04-01

    Previously, the swpa4 peroxidase gene has been shown to be inducible by a variety of abiotic stresses and pathogenic infections in sweet potato (Ipomoea batatas). To elucidate its regulatory mechanism at the transcriptional level under various stress conditions, we isolated and characterized the promoter region (2374 bp) of swpa4 (referred to as SWPA4). We performed a transient expression assay in tobacco protoplasts with deletions from the 5'-end of SWPA4 promoter fused to the beta-glucuronidase (GUS) reporter gene. The -1408 and -374 bp deletions relative to the transcription start site (+1) showed 8 and 4.5 times higher GUS expression than the cauliflower mosaic virus 35S promoter, respectively. In addition, transgenic tobacco plants expressing GUS under the control of -2374, -1408 or -374 bp region of SWPA4 promoter were generated and studied in various tissues under abiotic stresses and pathogen infection. Gel mobility shift assays revealed that nuclear proteins from sweet potato cultured cells specifically interacted with 60-bp fragment (-178/-118) in -374 bp promoter region. In silico analysis indicated that four kinds of cis-acting regulatory sequences, reactive oxygen species-related element activator protein 1 (AP1), CCAAT/enhancer-binding protein alpha element, ethylene-responsive element (ERE) and heat-shock element, are present in the -60 bp region (-178/-118), suggesting that the -60 bp region might be associated with stress inducibility of the SWPA4 promoter.

  2. Culture-dependent approaches to explore the prevalence of root canal pathogens from endodontic infections

    Directory of Open Access Journals (Sweden)

    Maryam Pourhajibagher

    2017-12-01

    Full Text Available Abstract: Endodontic infections are considered to be caused by the presence of various microorganisms within the root canal system. Recognition of this microbiota contributes to the successful treatment of infected root canals. This study investigated the microorganisms associated with primary and secondary endodontic infections via culture methods, biochemical tests, and molecular approaches in an Iranian population. Microbial specimens were collected from 36 patients with primary endodontic infection and 14 patients with a history of root canal therapy. Advanced microbiological culture techniques were used to isolate microbiota; subsequently, biochemical tests and 16S ribosomal RNA gene sequencing were performed to identify the microorganisms. Within the total 218 cultivable isolates, Veillonella parvula (20.6% was found to occur with the highest frequency in primary endodontic infection, followed by Porphyromonas gingivalis (14.1%, and Aggregatibacter actinomycetemcomitans (9.2%. Enterococcus faecalis (36.6% was the most predominant microorganism in secondary endodontic infections, followed by Candida albicans, Propionibacterium acnes, and V. parvula with frequencies of 20%, 2%, and 2%, respectively. It was concluded that V. parvula and E. faecalis was most frequently found in primary and secondary endodontic infections, respectively.

  3. Foreign Body Infection Models to Study Host-Pathogen Response and Antimicrobial Tolerance of Bacterial Biofilm

    Directory of Open Access Journals (Sweden)

    Justyna Nowakowska

    2014-08-01

    Full Text Available The number of implanted medical devices is steadily increasing and has become an effective intervention improving life quality, but still carries the risk of infection. These infections are mainly caused by biofilm-forming staphylococci that are difficult to treat due to the decreased susceptibility to both antibiotics and host defense mechanisms. To understand the particular pathogenesis and treatment tolerance of implant-associated infection (IAI animal models that closely resemble human disease are needed. Applications of the tissue cage and catheter abscess foreign body infection models in the mouse will be discussed herein. Both models allow the investigation of biofilm and virulence of various bacterial species and a comprehensive insight into the host response at the same time. They have also been proven to serve as very suitable tools to study the anti-adhesive and anti-infective efficacy of different biomaterial coatings. The tissue cage model can additionally be used to determine pharmacokinetics, efficacy and cytotoxicity of antimicrobial compounds as the tissue cage fluid can be aspirated repeatedly without the need to sacrifice the animal. Moreover, with the advance in innovative imaging systems in rodents, these models may offer new diagnostic measures of infection. In summary, animal foreign body infection models are important tools in the development of new antimicrobials against IAI and can help to elucidate the complex interactions between bacteria, the host immune system, and prosthetic materials.

  4. Pathogenicity, serological responses, and diagnosis of experimental and natural malarial infections in native Hawaiian thrushes

    Science.gov (United States)

    Atkinson, C.T.; Lease, J.K.; Drake, B.M.; Shema, N.P.

    2001-01-01

    Omao (Myadestes obscurus) from the Hawaiian Islands typically have very low prevalences of infection with avian malaria (Plasmodium relictum) and it is not clear whether they share the same high susceptibility to this parasite that has been documented in native Hawaiian honeycreepers. We exposed four captive Omao to single infective mosquito bites and measured parasitemia, serological responses, and mortality over time. All four birds experienced transient infections with low parasitemias and were immune when rechallenged with multiple infective mosquito bites. By contrast, three of four honeycreepers (Maui Alauahio, Paroreomyza montana) that were exposed to the same dose and parasite isolate succumbed to infection. All four Omao developed antibodies to a common suite of malarial antigens that were detectable on immunoblots of a crude red blood cell extract of P. relictum. We used this technique to screen plasma samples from wild Omao and endangered Puaiohi (Myadestes palmeri) that were captured at elevations between 900 and 1300 m on the islands of Hawaii and Kauai. We found that the true prevalence of infection at elevations where active malaria transmission occurs is much higher than estimates based on blood smears alone. Hawaiian thrushes appear to have a high tolerance for malaria, with most individuals developing chronic, low-level infections after exposure that cannot be diagnosed accurately by blood smears.

  5. Secondary infection with Streptococcus suis serotype 7 increases the virulence of highly pathogenic porcine reproductive and respiratory syndrome virus in pigs.

    Science.gov (United States)

    Xu, Min; Wang, Shujie; Li, Linxi; Lei, Liancheng; Liu, Yonggang; Shi, Wenda; Wu, Jiabin; Li, Liqin; Rong, Fulong; Xu, Mingming; Sun, Guangli; Xiang, Hua; Cai, Xuehui

    2010-08-09

    Porcine reproductive and respiratory syndrome virus (PRRSV) and Streptococcus suis are common pathogens in pigs. In samples collected during the porcine high fever syndrome (PHFS) outbreak in many parts of China, PRRSV and S. suis serotype 7 (SS7) have always been isolated together. To determine whether PRRSV-SS7 coinfection was the cause of the PHFS outbreak, we evaluated the pathogenicity of PRRSV and/or SS7 in a pig model of single and mixed infection. Respiratory disease, diarrhea, and anorexia were observed in all infected pigs. Signs of central nervous system (CNS) disease were observed in the highly pathogenic PRRSV (HP-PRRSV)-infected pigs (4/12) and the coinfected pigs (8/10); however, the symptoms of the coinfected pigs were clearly more severe than those of the HP-PRRSV-infected pigs. The mortality rate was significantly higher in the coinfected pigs (8/10) than in the HP-PRRSV- (2/12) and SS7-infected pigs (0/10). The deceased pigs of the coinfected group had symptoms typical of PHFS, such as high fever, anorexia, and red coloration of the ears and the body. The isolation rates of HP-PRRSV and SS7 were higher and the lesion severity was greater in the coinfected pigs than in monoinfected pigs. HP-PRRSV infection increased susceptibility to SS7 infection, and coinfection of HP-PRRSV with SS7 significantly increased the pathogenicity of SS7 to pigs.

  6. Secondary infection with Streptococcus suis serotype 7 increases the virulence of highly pathogenic porcine reproductive and respiratory syndrome virus in pigs

    Directory of Open Access Journals (Sweden)

    Xu Min

    2010-08-01

    Full Text Available Abstract Background Porcine reproductive and respiratory syndrome virus (PRRSV and Streptococcus suis are common pathogens in pigs. In samples collected during the porcine high fever syndrome (PHFS outbreak in many parts of China, PRRSV and S. suis serotype 7 (SS7 have always been isolated together. To determine whether PRRSV-SS7 coinfection was the cause of the PHFS outbreak, we evaluated the pathogenicity of PRRSV and/or SS7 in a pig model of single and mixed infection. Results Respiratory disease, diarrhea, and anorexia were observed in all infected pigs. Signs of central nervous system (CNS disease were observed in the highly pathogenic PRRSV (HP-PRRSV-infected pigs (4/12 and the coinfected pigs (8/10; however, the symptoms of the coinfected pigs were clearly more severe than those of the HP-PRRSV-infected pigs. The mortality rate was significantly higher in the coinfected pigs (8/10 than in the HP-PRRSV- (2/12 and SS7-infected pigs (0/10. The deceased pigs of the coinfected group had symptoms typical of PHFS, such as high fever, anorexia, and red coloration of the ears and the body. The isolation rates of HP-PRRSV and SS7 were higher and the lesion severity was greater in the coinfected pigs than in monoinfected pigs. Conclusion HP-PRRSV infection increased susceptibility to SS7 infection, and coinfection of HP-PRRSV with SS7 significantly increased the pathogenicity of SS7 to pigs.

  7. Susceptibility to Lower Respiratory Infections in Childhood is Associated with Perturbation of the Cytokine Response to Pathogenic Airway Bacteria.

    Science.gov (United States)

    Vissing, Nadja Hawwa; Larsen, Jeppe Madura; Rasmussen, Morten Arendt; Chawes, Bo Lund Krogsgaard; Thysen, Anna Hammerich; Bønnelykke, Klaus; Brix, Susanne; Bisgaard, Hans

    2016-05-01

    Neonatal colonization of the airways with respiratory pathogens is associated with increased risk of lower respiratory infections (LRI) in early childhood. Therefore, we hypothesized that children developing LRI have an aberrant immune response to pathogenic bacteria in infancy. The objective was to characterize in vitro the early life systemic immune response to pathogenic bacteria and study the possible association with incidence of LRI during the first 3 years of life. The Copenhagen Prospective Studies on Asthma in Childhood2000 (COPSAC2000) is a clinical birth cohort study of 411 children born of mothers with asthma. LRI incidence was prospectively captured from 6-monthly planned visits and visits at acute respiratory episodes. The in vitro systemic immune response to Haemophilus influenzae, Moraxella catarrhalis and Streptococcus pneumoniae was characterized by the production of TNF-α, IFN-γ, IL-2, IL-5, IL-10, IL-13 and IL-17 in peripheral blood mononuclear cells isolated at age 6 months from 291 infants. Data were analyzed by Poisson regression against incidence of LRI in infancy. A multivariable model including all cytokine responses from the 3 different bacterial stimulations significantly identified children at risk of LRI (P = 0.006). The immune response pattern associated with LRI was characterized by perturbed production of several cytokines rather than production of one specific cytokine, and was independent of concurrent asthma. TNF-α and IL-5 were key drivers but did not explain the entire variation in LRI susceptibility. Children at risk of future LRI present a perturbed systemic immune response upon exposure to common airway pathogens in early life.

  8. Comparison of pathogen DNA isolation methods from large volumes of whole blood to improve molecular diagnosis of bloodstream infections.

    Directory of Open Access Journals (Sweden)

    Anne J M Loonen

    Full Text Available For patients suffering from bloodstream infections (BSI molecular diagnostics from whole blood holds promise to provide fast and adequate treatment. However, this approach is hampered by the need of large blood volumes. Three methods for pathogen DNA isolation from whole blood were compared, i.e. an enzymatic method (MolYsis, 1-5 ml, the novel non-enzymatic procedure (Polaris, 1-5 ml, and a method that does not entail removal of human DNA (Triton-Tris-EDTA EasyMAG, 200 µl. These methods were evaluated by processing blood spiked with 0-1000 CFU/ml of Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans. Downstream detection was performed with real-time PCR assays. Polaris and MolYsis processing followed by real-time PCRs enabled pathogen detection at clinically relevant concentrations of 1-10 CFU/ml blood. By increasing sample volumes, concurrent lower cycle threshold (Ct values were obtained at clinically relevant pathogen concentrations, demonstrating the benefit of using larger blood volumes. A 100% detection rate at a concentration of 10 CFU/ml for all tested pathogens was obtained with the Polaris enrichment, whereas comparatively lower detection rates were measured for MolYsis (50-67% and EasyMAG (58-79%. For the samples with a concentration of 1 CFU/ml Polaris resulted in most optimal detection rates of 70-75% (MolYsis 17-50% and TTE-EasyMAG 20-36%. The Polaris method was more reproducible, less labour intensive, and faster (45 minutes (including Qiagen DNA extraction vs. 2 hours (MolYsis. In conclusion, Polaris and MolYsis enrichment followed by DNA isolation and real-time PCR enables reliable and sensitive detection of bacteria and fungi from 5 ml blood. With Polaris results are available within 3 hours, showing potential for improved BSI diagnostics.

  9. A prospective randomised trial of isolated pathogens of surgical site infections (SSI

    Directory of Open Access Journals (Sweden)

    Konstantinos Alexiou

    2017-09-01

    Conclusions: In conclusion, surgical site infections are important complications affecting the healthcare services, the cost of hospitalization and the patient himself. Future thorough studies are expected to reveal much more data, regarding predisposing and precautionary patient and hospital characteristics.

  10. Antimicrobial activity of a multispecies probiotic (Ecologic 641) against pathogens isolated from infected pancreatic necrosis

    NARCIS (Netherlands)

    Ridwan, B. U.; Koning, C. J. M.; Besselink, M. G. H.; Timmerman, H. M.; Brouwer, E. C.; Verhoef, J.; Gooszen, H. G.; Akkermans, L. M. A.

    2008-01-01

    AIMS: Although probiotic prophylaxis has been suggested to prevent small bowel bacterial overgrowth, bacterial translocation and infection of pancreatic necrosis in severe acute pancreatitis, limited data are available on their antimicrobial activity. METHODS AND RESULTS: Using the well-diffusion

  11. [Cefazolin efficacy and antibiotic sensitivity against pathogenic bacteria in pediatric with acute upper urinary tract infection].

    Science.gov (United States)

    Fuke, Toshiya; Abe, Yoshifusa; Hoshino, Akihiro; Oto, Hideyasu; Sakai, Naho; Murayama, Junichiro; Yoshida, Koichiro; Itabashi, Kazuo

    2010-05-01

    Acute upper urinary tract infection may cause sepsis, especially in neonates and infants, mandating the choice of appropriate, effective antibacterials minimizing increasing bacterial resistance. Frequently prescribing broad-spectrum cephalosporinin is one such example. Different antibacterial therapies are initiated clinically due to treatment protocol differences among institutions, disease severity, etc. We studied the efficacy of cefazolin (CEZ), a first-generation cephalosporin, as first-line parenteral treatment in acute upper urinary tract infection. We found that 88.9% of microbial infections have indications for CEZ. CEZ efficacy is 91.3%, and 97.2% of urine cultures show negative results. Escherichia coli sensitivity to antibacterial agents is 90.9% of the minimal inhibitory concentration (MIC) pediatric therapy in acute upper urinary tract infection.

  12. Aspergillus flavus induced alterations in tear protein profile reveal pathogen-induced host response to fungal infection.

    Science.gov (United States)

    Kandhavelu, Jeyalakshmi; Demonte, Naveen Luke; Namperumalsamy, Venkatesh Prajna; Prajna, Lalitha; Thangavel, Chitra; Jayapal, Jeya Maheshwari; Kuppamuthu, Dharmalingam

    2017-01-30

    in the patient tear. Negative regulators of these defense pathways were also found in patient tear indicating a fine balance between pathogen clearance and host tissue destruction during fungal infection depending upon the individual specific host - pathogen interaction. This understanding could be used to predict the progression and outcome of infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. The Influence of Infective Dose on the Virulence of a Generalist Pathogen in Rainbow Trout (Oncorhynchus mykiss and Zebra Fish (Danio rerio.

    Directory of Open Access Journals (Sweden)

    Hanna Kinnula

    Full Text Available Pathogen density and genetic diversity fluctuate in the outside-host environment during and between epidemics, affecting disease emergence and the severity and probability of infections. Although the importance of these factors for pathogen virulence and infection probability has been acknowledged, their interactive effects are not well understood. We studied how an infective dose in an environmentally transmitted opportunistic fish pathogen, Flavobacterium columnare, affects its virulence both in rainbow trout, which are frequently infected at fish farms, and in zebra fish, a host that is not naturally infected by F. columnare. We used previously isolated strains of confirmed high and low virulence in a single infection and in a co-infection. Infection success (measured as host morbidity correlated positively with dose when the hosts were exposed to the high-virulence strain, but no response for the dose increase was found when the hosts were exposed to the low-virulence strain. Interestingly, the co-infection resulted in poorer infection success than the single infection with the high-virulence strain. The rainbow trout were more susceptible to the infection than the zebra fish but, in both species, the effects of the doses and the strains were qualitatively similar. We suggest that as an increase in dose can lead to increased host morbidity, both the interstrain interactions and differences in infectivity in different hosts may influence the severity and consequently the evolution of disease. Our results also confirm that the zebra fish is a good laboratory model to study F. columnare infection.

  14. The Biology of Atherosclerosis: General Paradigms and Distinct Pathogenic Mechanisms Among HIV-Infected Patients

    OpenAIRE

    Lo, Janet; Plutzky, Jorge

    2012-01-01

    Complications of atherosclerosis, including myocardial infarction and stroke, are the leading cause of death and disability worldwide. Recent data strongly implicate cardiovascular death as a contributor to mortality among patients with human immunodeficiency virus (HIV) infection, with evidence suggesting increased incidence of atherosclerosis among these patients. Therefore, greater understanding of atherosclerotic mechanisms and how these responses may be similar or distinct in HIV-infecte...

  15. Targeted Treatment for Bacterial Infections: Prospects for Pathogen-Specific Antibiotics Coupled with Rapid Diagnostics

    OpenAIRE

    Maxson, Tucker; Mitchell, Douglas A.

    2015-01-01

    Antibiotics are a cornerstone of modern medicine and have significantly reduced the burden of infectious diseases. However, commonly used broad-spectrum antibiotics can cause major collateral damage to the human microbiome, causing complications ranging from antibiotic-associated colitis to the rapid spread of resistance. Employing narrower spectrum antibiotics targeting specific pathogens may alleviate this predicament as well as provide additional tools to expand an antibiotic repertoire th...

  16. Study on the Biocontrol Activities of Trichoderma species in Greengram with Infected Fungal Pathogens

    International Nuclear Information System (INIS)

    May Waine Wityi Htun; Myat Thu; Saw Sandar Maw

    2011-12-01

    Seven species of Trichoderma were isolated from rhizospheric soil sources and studied by cultural morphology and microscopic examinations. In dual plate assay, antifungal effects of seven Trichoderma strains were screened against three plant pathogenic fungi (Fusarium oxysporum, Rhizoctonia solani and Pythium sp.) on PDA medium and T-5 isolate showed a wide percentage of inhibitory effects on target pathogens with PIRG value. All Trichoderma strains exhibited a clear zone formation on minimal synthetic medium supplemented with 1% colloidal chitin. T-2 and T-5 were the best chitinase producer strains. In vitro screening for protease activity, the highest protease producing activity of Trichoderma isolate (T-2) were observed in pH indicator medium after 7 days incubation. In pot trial experiment, only T-5 strain exhibited more fungal suppression efficiency on green gram plant than commercial fungicide, Trisan and the other strains. So, it can be said that the effective strain was T-5 strain only which have been more antifungal producing power on three fungal pathogens than Trisan and the resting strains.

  17. The multifunctional LigB adhesin binds homeostatic proteins with potential roles in cutaneous infection by pathogenic Leptospira interrogans.

    Directory of Open Access Journals (Sweden)

    Henry A Choy

    Full Text Available Leptospirosis is a potentially fatal zoonotic disease in humans and animals caused by pathogenic spirochetes, such as Leptospira interrogans. The mode of transmission is commonly limited to the exposure of mucous membrane or damaged skin to water contaminated by leptospires shed in the urine of carriers, such as rats. Infection occurs during seasonal flooding of impoverished tropical urban habitats with large rat populations, but also during recreational activity in open water, suggesting it is very efficient. LigA and LigB are surface localized proteins in pathogenic Leptospira strains with properties that could facilitate the infection of damaged skin. Their expression is rapidly induced by the increase in osmolarity encountered by leptospires upon transition from water to host. In addition, the immunoglobulin-like repeats of the Lig proteins bind proteins that mediate attachment to host tissue, such as fibronectin, fibrinogen, collagens, laminin, and elastin, some of which are important in cutaneous wound healing and repair. Hemostasis is critical in a fresh injury, where fibrinogen from damaged vasculature mediates coagulation. We show that fibrinogen binding by recombinant LigB inhibits fibrin formation, which could aid leptospiral entry into the circulation, dissemination, and further infection by impairing healing. LigB also binds fibroblast fibronectin and type III collagen, two proteins prevalent in wound repair, thus potentially enhancing leptospiral adhesion to skin openings. LigA or LigB expression by transformation of a nonpathogenic saprophyte, L. biflexa, enhances bacterial adhesion to fibrinogen. Our results suggest that by binding homeostatic proteins found in cutaneous wounds, LigB could facilitate leptospirosis transmission. Both fibronectin and fibrinogen binding have been mapped to an overlapping domain in LigB comprising repeats 9-11, with repeat 11 possibly enhancing binding by a conformational effect. Leptospirosis

  18. Multiresistant pathogens in geriatric nursing – infection control in residential facilities for geriatric nursing in Germany

    Directory of Open Access Journals (Sweden)

    Peters, Claudia

    2014-09-01

    Full Text Available [english] Background: The increase of multidrug-resistant organisms (MDROs causes problems in geriatric nursing homes. Older people are at increased a growing risk of infection due to multimorbidity and frequent stays in hospital. A high proportion of the elderly require residential care in geriatric nursing facilities, where hygiene requirements in nursing homes are similar to those in hospitals. For this reason we examined how well nursing homes are prepared for MDROs and how effectively protect their infection control residents and staff.Methods: A cross-sectional study was performed on infection control in residential geriatric nursing facilities in Germany 2012. The questionnaire recorded important parameters of hygiene, resident and staff protection and actions in case of existing MDROs.Results: The response was 54% in Hamburg and 27% in the rest of Germany. Nursing homes were generally well equipped for dealing with infection control: There were standards for MDROs and regular hygiene training for staff. The facilities provided adequate protective clothing, affected residents are usually isolated and hygienic laundry processing conducted. There are deficits in the communication of information on infected residents with hospitals and general practitioners. 54% of nursing homes performed risk assessments for staff infection precaution.Conclusion: There is a growing interest in MDROs and infection control will be a challenge in for residential geriatric nursing facilities in the future. This issue has also drawn increasing attention. Improvements could be achieved by improving communication between different participants in the health service, together with specific measures for staff protection at work.

  19. Long-term pathogenic response to Plasmodium relictum infection in Culex pipiens mosquito.

    Science.gov (United States)

    Pigeault, Romain; Villa, Manon

    2018-01-01

    The transmission of Plasmodium within a vertebrate host population is strongly associated with the life history traits of its vector. Therefore the effect of malaria infection on mosquito fecundity and longevity has traditionally received a lot of attention. Several species of malaria parasites reduce mosquito fecundity, nevertheless almost all of the studies have focused only on the first gonotrophic cycle. Yet, during their lifetime, female mosquitoes go through several gonotrophic cycles, which raises the question of whether they are able to compensate the fecundity costs induced by the parasite. The impact of Plasmodium infection on female longevity is not so clear and has produced conflicting results. Here we measured the impact of Plasmodium relictum on its vector's longevity and fecundity during three consecutive gonotrophic cycles. In accordance with previous studies, we observed a negative impact of Plasmodium infection on mosquito (Culex pipiens) fecundity in the first gonotrophic cycle. Interestingly, despite having taken two subsequent uninfected blood meals, the negative impact of malaria parasite persisted. Nevertheless no impact of infection on mosquito longevity was observed. Our results are not in line with the hypothesis that the reduction of fecundity observed in infected mosquitoes is an adaptive strategy of Plasmodium to increase the longevity of its vector. We discuss the different underlying mechanisms that may explain our results.

  20. Targeting iron acquisition blocks infection with the fungal pathogens Aspergillus fumigatus and Fusarium oxysporum.

    Science.gov (United States)

    Leal, Sixto M; Roy, Sanhita; Vareechon, Chairut; Carrion, Steven deJesus; Clark, Heather; Lopez-Berges, Manuel S; Di Pietro, Antonio; diPietro, Antonio; Schrettl, Marcus; Beckmann, Nicola; Redl, Bernhard; Haas, Hubertus; Pearlman, Eric

    2013-01-01

    Filamentous fungi are an important cause of pulmonary and systemic morbidity and mortality, and also cause corneal blindness and visual impairment worldwide. Utilizing in vitro neutrophil killing assays and a model of fungal infection of the cornea, we demonstrated that Dectin-1 dependent IL-6 production regulates expression of iron chelators, heme and siderophore binding proteins and hepcidin in infected mice. In addition, we show that human neutrophils synthesize lipocalin-1, which sequesters fungal siderophores, and that topical lipocalin-1 or lactoferrin restricts fungal growth in vivo. Conversely, we show that exogenous iron or the xenosiderophore deferroxamine enhances fungal growth in infected mice. By examining mutant Aspergillus and Fusarium strains, we found that fungal transcriptional responses to low iron levels and extracellular siderophores are essential for fungal growth during infection. Further, we showed that targeting fungal iron acquisition or siderophore biosynthesis by topical application of iron chelators or statins reduces fungal growth in the cornea by 60% and that dual therapy with the iron chelator deferiprone and statins further restricts fungal growth by 75%. Together, these studies identify specific host iron-chelating and fungal iron-acquisition mediators that regulate fungal growth, and demonstrate that therapeutic inhibition of fungal iron acquisition can be utilized to treat topical fungal infections.

  1. Targeting iron acquisition blocks infection with the fungal pathogens Aspergillus fumigatus and Fusarium oxysporum.

    Directory of Open Access Journals (Sweden)

    Sixto M Leal

    Full Text Available Filamentous fungi are an important cause of pulmonary and systemic morbidity and mortality, and also cause corneal blindness and visual impairment worldwide. Utilizing in vitro neutrophil killing assays and a model of fungal infection of the cornea, we demonstrated that Dectin-1 dependent IL-6 production regulates expression of iron chelators, heme and siderophore binding proteins and hepcidin in infected mice. In addition, we show that human neutrophils synthesize lipocalin-1, which sequesters fungal siderophores, and that topical lipocalin-1 or lactoferrin restricts fungal growth in vivo. Conversely, we show that exogenous iron or the xenosiderophore deferroxamine enhances fungal growth in infected mice. By examining mutant Aspergillus and Fusarium strains, we found that fungal transcriptional responses to low iron levels and extracellular siderophores are essential for fungal growth during infection. Further, we showed that targeting fungal iron acquisition or siderophore biosynthesis by topical application of iron chelators or statins reduces fungal growth in the cornea by 60% and that dual therapy with the iron chelator deferiprone and statins further restricts fungal growth by 75%. Together, these studies identify specific host iron-chelating and fungal iron-acquisition mediators that regulate fungal growth, and demonstrate that therapeutic inhibition of fungal iron acquisition can be utilized to treat topical fungal infections.

  2. Cethromycin-mediated protection against the plague pathogen Yersinia pestis in a rat model of infection and comparison with levofloxacin.

    Science.gov (United States)

    Rosenzweig, Jason A; Brackman, Sheri M; Kirtley, Michelle L; Sha, Jian; Erova, Tatiana E; Yeager, Linsey A; Peterson, Johnny W; Xu, Ze-Qi; Chopra, Ashok K

    2011-11-01

    The Gram-negative plague bacterium, Yersinia pestis, has historically been regarded as one of the deadliest pathogens known to mankind, having caused three major pandemics. After being transmitted by the bite of an infected flea arthropod vector, Y. pestis can cause three forms of human plague: bubonic, septicemic, and pneumonic, with the latter two having very high mortality rates. With increased threats of bioterrorism, it is likely that a multidrug-resistant Y. pestis strain would be employed, and, as such, conventional antibiotics typically used to treat Y. pestis (e.g., streptomycin, tetracycline, and gentamicin) would be ineffective. In this study, cethromycin (a ketolide antibiotic which inhibits bacterial protein synthesis and is currently in clinical trials for respiratory tract infections) was evaluated for antiplague activity in a rat model of pneumonic infection and compared with levofloxacin, which operates via inhibition of bacterial topoisomerase and DNA gyrase. Following a respiratory challenge of 24 to 30 times the 50% lethal dose of the highly virulent Y. pestis CO92 strain, 70 mg of cethromycin per kg of body weight (orally administered twice daily 24 h postinfection for a period of 7 days) provided complete protection to animals against mortality without any toxic effects. Further, no detectable plague bacilli were cultured from infected animals' blood and spleens following cethromycin treatment. The antibiotic was most effective when administered to rats 24 h postinfection, as the animals succumbed to infection if treatment was further delayed. All cethromycin-treated survivors tolerated 2 subsequent exposures to even higher lethal Y. pestis doses without further antibiotic treatment, which was related, in part, to the development of specific antibodies to the capsular and low-calcium-response V antigens of Y. pestis. These data demonstrate that cethromycin is a potent antiplague drug that can be used to treat pneumonic plague.

  3. Experimental infection of highly pathogenic avian influenza virus H5N1 in black-headed gulls (Chroicocephalus ridibundus).

    Science.gov (United States)

    Ramis, Antonio; van Amerongen, Geert; van de Bildt, Marco; Leijten, Loneke; Vanderstichel, Raphael; Osterhaus, Albert; Kuiken, Thijs

    2014-08-19

    Historically, highly pathogenic avian influenza viruses (HPAIV) rarely resulted in infection or clinical disease in wild birds. However, since 2002, disease and mortality from natural HPAIV H5N1 infection have been observed in wild birds including gulls. We performed an experimental HPAIV H5N1 infection of black-headed gulls (Chroicocephalus ridibundus) to determine their susceptibility to infection and disease from this virus, pattern of viral shedding, clinical signs, pathological changes and viral tissue distribution. We inoculated sixteen black-headed gulls with 1 × 10(4) median tissue culture infectious dose HPAIV H5N1 (A/turkey/Turkey/1/2005) intratracheally and intraesophageally. Birds were monitored daily until 12 days post inoculation (dpi). Oropharyngeal and cloacal swabs were collected daily to detect viral shedding. Necropsies from birds were performed at 2, 4, 5, 6, 7, and 12 dpi. Sampling from selected tissues was done for histopathology, immunohistochemical detection of viral antigen, PCR, and viral isolation. Our study shows that all inoculated birds were productively infected, developed systemic disease, and had a high morbidity and mortality rate. Virus was detected mainly in the respiratory tract on the first days after inoculation, and then concentrated more in pancreas and central nervous system from 4 dpi onwards. Birds shed infectious virus until 7 dpi from the pharynx and 6 dpi from the cloaca. We conclude that black-headed gulls are highly susceptible to disease with a high mortality rate and are thus more likely to act as sentinel species for the presence of the virus than as long-distance carriers of the virus to new geographical areas.

  4. Pathological alterations in respiratory system during co-infection with low pathogenic avian influenza virus (H9N2 and Escherichia coli in broiler chickens

    Directory of Open Access Journals (Sweden)

    Jaleel Shahid

    2017-09-01

    Full Text Available Introduction: Despite the advancements in the field, there is a lack of data when it comes to co-infections in poultry. Therefore, this study was designed to address this issue. Material and Methods: Broiler birds were experimentally infected with E. coli (O78 and low pathogenic avian influenza (LPAI strain, alone or in combination. The experimental groups were negative control. Results: The infected birds showed most severe clinical signs in E. coli+LPAI group along with a significant decrease in weight and enhanced macroscopic and microscopic pathological lesions. The survival rate was 60%, 84%, and 100% in birds inoculated with E. coli+LPAI, E. coli, and LPAI virus alone, respectively. The results showed that experimental co-infection with E. coli and H9N2 strain of LPAI virus increased the severity of clinical signs, mortality rate, and gross lesions. The HI titre against LPAI virus infection in the co-infected group was significantly higher than the HI titre of LPAI group, which may indicate that E. coli may promote propagation of H9N2 LPAI virus by alteration of immune response. Conclusion: The present study revealed that co-infection with E. coli and H9N2 LPAI virus caused more serious synergistic pathogenic effects and indicates the role of both pathogens as complicating factors in poultry infections.

  5. Co-infection dynamics of a major food-borne zoonotic pathogen in chicken

    DEFF Research Database (Denmark)

    Skanseng, Beate; Trosvik, Pal; Zimonja, Monika

    2007-01-01

    , with an important reservoir in the gastrointestinal (GI) tract of chickens, was used as a model. We investigated the co-colonisation dynamics of seven C. jejuni strains in a chicken GI infection trial. The seven strains were isolated from an epidemiological study showing multiple strain infections at the farm level....... We analysed time-series data, following the Campylobacter colonisation, as well as the dominant background flora of chickens. Data were collected from the infection at day 16 until the last sampling point at day 36. Chickens with two different background floras were studied, mature ( treated...... with Broilact, which is a product consisting of bacteria from the intestinal flora of healthy hens) and spontaneous. The two treatments resulted in completely different background floras, yet similar Campylobacter colonisation patterns were detected in both groups. This suggests that it is the chicken host...

  6. Timing of positive blood samples does not differentiate pathogens causing healthcare-associated from community-acquired bloodstream infections in children in England: a linked retrospective cohort study

    OpenAIRE

    HENDERSON, K. L.; M?LLER-PEBODY, B.; WADE, A.; SHARLAND, M.; MINAJI, M.; JOHNSON, A. P.; GILBERT, R

    2014-01-01

    SUMMARY Paediatricians recognize that using the time-dependent community-acquired vs. hospital-acquired bloodstream infection (BSI) dichotomy to guide empirical treatment no longer distinguishes between causative pathogens due to the emergence of healthcare-associated BSIs. However, paediatric epidemiological evidence of the aetiology of BSIs in relation to hospital admission in England is lacking. For 12 common BSI-causing pathogens in England, timing of laboratory reports of positive paedia...

  7. [Etiology of urinary tract infections and antimicrobial susceptibility of urinary pathogens].

    Science.gov (United States)

    Correia, Carlos; Costa, Elísio; Peres, António; Alves, Madalena; Pombo, Graça; Estevinho, Letícia

    2007-01-01

    With the objective of knowing the common etiological agents in urinary infection and comparing its antimicrobial susceptibility in nosocomial and community-acquired urinary infections, we analyse all the urine bacteriological exams from the Serviço de Patologia Clínica do Centro Hospitalar do Nordeste, EPE - Unidade Hospitalar de Bragança, during a two years period (April 2004 to March 2006). During this period, 4018 urine bacteriological exams were made. The cultural exam was positive in 572 samples (144 from nosocomial infections and 428 from community-acquired urinary infections). The Escherichia coli was the more isolated strain (68,4 %), followed by Klebsiella spp (7,9%), Pseudomonas aeruginosa (6,1%) and Proteus mirabilis (5,2%). Concerning to antimicrobial susceptibility, Escherichia coli and Klebsiella spp showed a high resistance to the antimicrobials Amoxicillin, Piperacillin, Cephalothin, Ceftazidim and Quinolones. For Enterobacteriaceae Imipenem, Amikacin and Netilmicin were the antimicrobials with more level of susceptibility. Imipenem and Amikacin were the more efficient antimicrobials against Pseudomonas aeruginosa. Concerning to the susceptibility for the same etiological agent, in nosocomial and community-acquired urinary infections, we founded statistical significant differences in the antimicrobials Ticarcillin-clavulanic acid and Collistin for Pseudomonas aeruginosa and in the group of antimicrobials from Quinolones for the Proteus mirabilis. In the other identified agents there were no statistical significant differences for antimicrobials. This study it allows making use of data necessary for the knowledge of etiologic urinary infection agents in Bragança and provides the information about the antimicrobials resistance, which were necessary to initiate an adequate empirical treatment and to elaborate treatment guides.

  8. Complete genome and comparative analysis of Streptococcus gallolyticus subsp. gallolyticus, an emerging pathogen of infective endocarditis

    Directory of Open Access Journals (Sweden)

    Dreier Jens

    2011-08-01

    Full Text Available Abstract Background Streptococcus gallolyticus subsp. gallolyticus is an important causative agent of infectious endocarditis, while the pathogenicity of this species is widely unclear. To gain insight into the pathomechanisms and the underlying genetic elements for lateral gene transfer, we sequenced the entire genome of this pathogen. Results We sequenced the whole genome of S. gallolyticus subsp. gallolyticus strain ATCC BAA-2069, consisting of a 2,356,444 bp circular DNA molecule with a G+C-content of 37.65% and a novel 20,765 bp plasmid designated as pSGG1. Bioinformatic analysis predicted 2,309 ORFs and the presence of 80 tRNAs and 21 rRNAs in the chromosome. Furthermore, 21 ORFs were detected on the plasmid pSGG1, including tetracycline resistance genes telL and tet(O/W/32/O. Screening of 41 S. gallolyticus subsp. gallolyticus isolates revealed one plasmid (pSGG2 homologous to pSGG1. We further predicted 21 surface proteins containing the cell wall-sorting motif LPxTG, which were shown to play a functional role in the adhesion of bacteria to host cells. In addition, we performed a whole genome comparison to the recently sequenced S. gallolyticus subsp. gallolyticus strain UCN34, revealing significant differences. Conclusions The analysis of the whole genome sequence of S. gallolyticus subsp. gallolyticus promotes understanding of genetic factors concerning the pathogenesis and adhesion to ECM of this pathogen. For the first time we detected the presence of the mobilizable pSGG1 plasmid, which may play a functional role in lateral gene transfer and promote a selective advantage due to a tetracycline resistance.

  9. The biology of atherosclerosis: general paradigms and distinct pathogenic mechanisms among HIV-infected patients.

    Science.gov (United States)

    Lo, Janet; Plutzky, Jorge

    2012-06-01

    Complications of atherosclerosis, including myocardial infarction and stroke, are the leading cause of death and disability worldwide. Recent data strongly implicate cardiovascular death as a contributor to mortality among patients with human immunodeficiency virus (HIV) infection, with evidence suggesting increased incidence of atherosclerosis among these patients. Therefore, greater understanding of atherosclerotic mechanisms and how these responses may be similar or distinct in HIV-infected patients is needed. Key concepts in atherosclerosis are reviewed, including the evidence that inflammation and abnormal metabolism are major drivers of atherosclerosis, and connected to the current literature regarding atherosclerosis in the context of HIV.

  10. Data set of Aspergillus flavus induced alterations in tear proteome: Understanding the pathogen-induced host response to fungal infection

    Directory of Open Access Journals (Sweden)

    Jeyalakshmi Kandhavelu

    2016-12-01

    Full Text Available Fungal keratitis is one of the leading causes of blindness in the tropical countries affecting individuals in their most productive age. The host immune response during this infection is poorly understood. We carried out comparative tear proteome analysis of Aspergillus flavus keratitis patients and uninfected controls. Proteome was separated into glycosylated and non-glycosylated fractions using lectin column chromatography before mass spectrometry. The data revealed the major processes activated in the human host in response to fungal infection and reflected in the tear. Extended analysis of this dataset presented here complements the research article entitled “Aspergillus flavus induced alterations in tear protein profile reveal pathogen-induced host response to fungal infection [1]” (Jeyalakhsmi Kandhavelu, Naveen Luke Demonte, Venkatesh Prajna Namperumalsamy, Lalitha Prajna, Chitra Thangavel, Jeya Maheshwari Jayapal, Dharmalingam Kuppamuthu, 2016. The mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PRIDE:PXD003825.

  11. Conserved host response to highly pathogenic avian influenza virus infection in human cell culture, mouse and macaque model systems

    Directory of Open Access Journals (Sweden)

    McDermott Jason E

    2011-11-01

    Full Text Available Abstract Background Understanding host response to influenza virus infection will facilitate development of better diagnoses and therapeutic interventions. Several different experimental models have been used as a proxy for human infection, including cell cultures derived from human cells, mice, and non-human primates. Each of these systems has been studied extensively in isolation, but little effort has been directed toward systematically characterizing the conservation of host response on a global level beyond known immune signaling cascades. Results In the present study, we employed a multivariate modeling approach to characterize and compare the transcriptional regulatory networks between these three model systems after infection with a highly pathogenic avian influenza virus of the H5N1 subtype. Using this approach we identified functions and pathways that display similar behavior and/or regulation including the well-studied impact on the interferon response and the inflammasome. Our results also suggest a primary response role for airway epithelial cells in initiating hypercytokinemia, which is thought to contribute to the pathogenesis of H5N1 viruses. We further demonstrate that we can use a transcriptional regulatory model from the human cell culture data to make highly accurate predictions about the behavior of important components of the innate immune system in tissues from whole organisms. Conclusions This is the first demonstration of a global regulatory network modeling conserved host response between in vitro and in vivo models.

  12. Horse species symposium: a novel approach to monitoring pathogen progression during uterine and placental infection in the mare using bioluminescence imaging technology and lux-modified bacteria.

    Science.gov (United States)

    Ryan, P L; Christiansen, D L; Hopper, R M; Walters, F K; Moulton, K; Curbelo, J; Greene, J M; Willard, S T

    2011-05-01

    Uterine and placental infections are the leading cause of abortion, stillbirth, and preterm delivery in the mare. Whereas uterine and placental infections in women have been studied extensively, a comprehensive examination of the pathogenic processes leading to this unsatisfactory pregnancy outcome in the mare has yet to be completed. Most information in the literature relating to late-term pregnancy loss in mares is based on retrospective studies of clinical cases submitted for necropsy. Here we report the development and application of a novel approach, whereby transgenically modified bacteria transformed with lux genes of Xenorhabdus luminescens or Photorhabdus luminescens origin and biophotonic imaging are utilized to better understand pathogen-induced preterm birth in late-term pregnant mares. This technology uses highly sensitive bioluminescence imaging camera systems to localize and monitor pathogen progression during tissue invasion by measuring the bioluminescent signatures emitted by the lux-modified pathogens. This method has an important advantage in that it allows for the potential tracking of pathogens in vivo in real time and over time, which was hitherto impossible. Although the application of this technology in domestic animals is in its infancy, investigators were successful in identifying the fetal lungs, sinuses, nares, urinary, and gastrointestinal systems as primary tissues for pathogen invasion after experimental infection of pregnant mares with lux-modified Escherichia coli. It is important that pathogens were not detected in other vital organs, such as the liver, brain, and cardiac system. Such precision in localizing sites of pathogen invasion provides potential application for this novel approach in the development of more targeted therapeutic interventions for pathogen-related diseases in the equine and other domestic species.

  13. Pharmacodynamics and differential activity of nitrofurantoin against ESBL-positive pathogens involved in urinary tract infections

    NARCIS (Netherlands)

    Fransen, F. (Fiona); M.J.B. Melchers (Maria); J. Meletiadis (Joseph); J.W. Mouton (Johan)

    2016-01-01

    textabstractBackground: Although nitrofurantoin has been used for >60 years for the treatment of uncomplicated urinary tract infections, its pharmacodynamic properties are not fully explored. Use is increasing because of increasing resistance to other antimicrobials due to ESBLs. Methods: We tested

  14. Invasive Trichosporon Infection: A systematic review on a re-emerging fungal pathogen

    Directory of Open Access Journals (Sweden)

    João Nobrega De Almeida Júnior

    2016-10-01

    Full Text Available Objectives: This review aimed to better depict the clinical features and address the issue of therapeutic management of Trichosporon deep-seated infections.Methods: We comprehensively reviewed the cases of invasive Trichosporon infection reported in the literature from 1994 (date of taxonomic modification to 2015. Data from antifungal susceptibility testing (AST studies were also analyzed. Results: Two hundred and three cases were retained and split into four groups: hemopathy (n=79, other immunodeficiency conditions (n =41, miscellaneous (n=58 and newborns (n=25. Trichosporon asahii was the main causative species (46.7% and may exhibit cross-resistance to different antifungal classes. The unfavorable outcome rate was at 44.3%. By multivariate analysis, breakthrough infection (OR 2.45 was associated with unfavorable outcome, whilst the use of an azole-based therapy improved the prognosis (OR 0.16. Voriconazole-based treatment was associated with favorable outcome in hematological patients (73.6% vs. 41.8%; p=0.016. Compiled data from AST demonstrated that (i T. asahii exhibits the highest MICs to amphotericin B and (ii voriconazole has the best in vitro efficacy against clinical isolates of Trichosporon spp. Conclusions: Trichosporon infection is not only restricted to hematological patients. Analysis of compiled data from AST and clinical outcome support the use of voriconazole as first line therapy.

  15. Investigation of the Role of the Cytomegalovirus as a Respiratory Pathogen in HIV-Infected Patients

    Directory of Open Access Journals (Sweden)

    Rafael E de la Hoz

    1996-01-01

    Full Text Available OBJECTIVE: To investigate the occurrence of cytomegalovirus (CMV pneumonitis in the setting of human immunodeficiency virus (HIV infection and whether the presence of CMV as copathogen is associated with increased clinical severity or short term mortality in patients with Pneumocystis carinii pneumonia.

  16. A dual resistance gene system prevents infection by three distinct pathogens.

    Science.gov (United States)

    Narusaka, Mari; Kubo, Yasuyuki; Shiraishi, Tomonori; Iwabuchi, Masaki; Narusaka, Yoshihiro

    2009-10-01

    Colletotrichum higginsianum causes typical anthracnose lesions on the leaves, petioles, and stems of cruciferous plants. Inoculation of Arabidopsis thaliana ecotype Columbia leaves with C. higginsianum results in fungal growth and disease symptoms reminiscent of those induced in other cruciferous plants. We performed map-based cloning and natural variation analysis of 19 A. thaliana ecotypes to identify a dominant resistance locus against C. higginsianum. We found that the A. thaliana RCH2 (for recognition of C. higginsianum) locus encodes two NB-LRR proteins, both of which are required for resistance to C. higginsianum in the A. thaliana ecotype Ws-0. Both proteins are well-characterized R proteins involved in resistance against bacterial pathogens; RRS1 (resistance to Ralstonia solanacearum 1) confers resistance to strain Rs1000 of R. solanacearum and RPS4 to Pseudomonas syringae pv. tomato strain DC3000 expressing avrRps4 (Pst-avrRps4). Furthermore, we found that both RRS1-Ws and RPS4-Ws genes are required for resistance to Pst-avrRps4 and to Rs1002 R. solanacearum. We therefore demonstrate that a pair of neighboring genes, RRS1-Ws and RPS4-Ws, function cooperatively as a dual R-gene system against at least three distinct pathogens.

  17. In vitro activity of vaccinium macrocarpon (cranberry) on urinary tract pathogens in uncomplicated urinary tract infection

    International Nuclear Information System (INIS)

    Bukhari, S.; Tariq, S.; Alam, M.A.; Chiragh, S.; Wazir, M.S.; Suleman, M.

    2015-01-01

    Background: Urinary tract infection is the most common bacterial infection in the community, mainly caused by Escherichia coli (E coli). Due to its high incidence and recurrence, problems are faced in the treatment with antibiotics. Cranberry being herbal remedy have long been the focus of interest for their beneficial effects in preventing urinary tract infections. This study was conducted to analyse in vitro activity of cranberry (Vaccinium macrocarpon) on uropathogenic E coli in uncomplicated urinary tract infections. Method: In this laboratory based single group experimental study, anti-bacterial activity of Vaccinium macrocarpon concentrate on urinary tract E coli was investigated, in vitro. Ninety-six culture positive cases of different uropathogens were identified. Vaccinium macrocarpon concentrate at different concentrations was prepared in distilled water and put in wells punched in nutrient agar. E coli isolates were inoculated on the plates and incubated at 37 Degree C for 24 hours. A citric acid solution of the same pH as that of Vaccinium macrocarpon was used and put in a well on the same plate to exclude the effect of pH. Results: A total of 35 isolates of E coli were identified out of 96 culture positive specimens of urine and found sensitive to Vaccinium macrocarpon (p<0.000). Results revealed that Vaccinium macrocarpon has antibacterial effect against E coli. Furthermore the antibacterial activity of Vaccinium macrocarpon has dose response relationship. Acidic nature of Vaccinium macrocarpon due to its pH is not contributory towards its antibacterial effect. Conclusion: Vaccinium macrocarpon concentrate may be used in urinary tract infection caused by E coli. (author)

  18. Chlamydia trachomatis infections and subfertility: opportunities to translate host pathogen genomic data into public health.

    Science.gov (United States)

    Lal, J A; Malogajski, J; Verweij, S P; de Boer, P; Ambrosino, E; Brand, A; Ouburg, S; Morré, S A

    2013-01-01

    Chlamydia trachomatis (CT) infections in women can result in tubal pathology (TP). Worldwide 10-15% of all couples are subfertile, meaning they did not get pregnant after 1 year. Part of the routine subfertility diagnostics is the Chlamydia Antibody Test (CAT) to decide for laparoscopy or not in order to diagnose TP. The CAT positive and negative predictive value is such that many unneeded laparoscopies are done and many TP cases are missed. Addition of host genetic markers related to infection susceptibility and severity could potentially improve the clinical management of couples who suffer from subfertility. In the present study, the potential translational and clinical value of adding diagnostic host genetic marker profiles on the basis of infection and inflammation to the current clinical management of subfertility was investigated. This review provides an overview of the current state of the art of host genetic markers in relation to CT infection, proposes a new clinical diagnostic approach, and investigates how the Learning-Adapting-Leveling model (LAL, a public health genomic (PHG) model) can be of value and provide insight to see whether these host genetic markers can be translated into public health. This review shows that the preliminary basis of adding host genetic marker profiles to the current diagnostic procedures of subfertility is present but has to be further developed before implementation into health care can be achieved. CT infection is an example in the field of PHG with potential diagnostic to be taken up in the future in the field of subfertility diagnosis with a time line for integration to be dependent on enhanced participation of many stakeholders in the field of PHG which could be advanced through the LAL model. Copyright © 2013 S. Karger AG, Basel.

  19. Engineered biomaterial and biophysical stimulation as combinatorial strategies to address prosthetic infection by pathogenic bacteria.

    Science.gov (United States)

    Boda, Sunil Kumar; Basu, Bikramjit

    2017-10-01

    A plethora of antimicrobial strategies are being developed to address prosthetic infection. The currently available methods for implant infection treatment include the use of antibiotics and revision surgery. Among the bacterial strains, Staphylococcus species pose significant challenges particularly, with regard to hospital acquired infections. In order to combat such life threatening infectious diseases, researchers have developed implantable biomaterials incorporating nanoparticles, antimicrobial reinforcements, surface coatings, slippery/non-adhesive and contact killing surfaces. This review discusses a few of the biomaterial and biophysical antimicrobial strategies, which are in the developmental stage and actively being pursued by several research groups. The clinical efficacy of biophysical stimulation methods such as ultrasound, electric and magnetic field treatments against prosthetic infection depends critically on the stimulation protocol and parameters of the treatment modality. A common thread among the three biophysical stimulation methods is the mechanism of bactericidal action, which is centered on biophysical rupture of bacterial membranes, the generation of reactive oxygen species (ROS) and bacterial membrane depolarization evoked by the interference of essential ion-transport. Although the extent of antimicrobial effect, normally achieved through biophysical stimulation protocol is insufficient to warrant therapeutic application, a combination of antibiotic/ROS inducing agents and biophysical stimulation methods can elicit a clinically relevant reduction in viable bacterial numbers. In this review, we present a detailed account of both the biomaterial and biophysical approaches for achieving maximum bacterial inactivation. Summarizing, the biophysical stimulation methods in a combinatorial manner with material based strategies can be a more potent solution to control bacterial infections. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B

  20. Pathogenesis and transmissibility of highly (H7N1) and low (H7N9) pathogenic avian influenza virus infection in red-legged partridge (Alectoris rufa)

    OpenAIRE

    Bertran, Kateri; Pérez-Ramírez, Elisa; Busquets, Núria; Dolz, Roser; Ramis, Antoni; Abad, Francesc Xavier; Chaves, Aida; Vergara-Alert, Júlia; Barral, Marta; Höfle, Ursula; Majó, Natàlia

    2011-01-01

    Abstract An experimental infection with highly pathogenic avian influenza virus (HPAIV) and low pathogenic avian influenza virus (LPAIV) was carried out in red-legged partridges (Alectoris rufa) in order to study clinical signs, gross and microscopic lesions, and viral distribution in tissues and viral shedding. Birds were infected with a HPAIV subtype H7N1 (A/Chicken/Italy/5093/1999) and a LPAIV subtype H7N9 (A/Anas crecca/Spain/1460/2008). Uninoculated birds were included as contacts in bot...

  1. Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Barhoom Sima

    2008-02-01

    Full Text Available Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria formation, and prevention of autophagy cell death results in non-functional appressoria. Results We found that in the closely related plant pathogen Colletotrichum gloeosporioides, blocking of the cell cycle did not prevent spore germination and appressoria formation. The cell cycle always lagged behind the morphogenetic changes that follow spore germination, including germ tube and appressorium formation, differentiation of the penetrating hypha, and in planta formation of primary hyphae. Nuclear division was arrested following appressorium formation and was resumed in mature appressoria after plant penetration. Unlike in M. grisea, blocking of mitosis had only a marginal effect on appressoria formation; development in hydroxyurea-treated spores continued only for a limited number of cell divisions, but normal numbers of fully developed mature appressoria were formed under conditions that support appressoria formation. Similar results were also observed in other Colletotrichum species. Spores, germ tubes, and appressoria retained intact nuclei and remained viable for several days post plant infection. Conclusion We showed that in C. gloeosporioides the differentiation of infection structures including appressoria precedes mitosis and can occur without nuclear division. This phenomenon was also found to be common in other Colletotrichum species. Spore cell death did not occur during plant infection and the fungus primary infection structures remained viable

  2. Modulation of Quorum Sensing in a Gram-Positive Pathogen by Linear Molecularly Imprinted Polymers with Anti-infective Properties.

    Science.gov (United States)

    Motib, Anfal; Guerreiro, Antonio; Al-Bayati, Firas; Piletska, Elena; Manzoor, Irfan; Shafeeq, Sulman; Kadam, Anagha; Kuipers, Oscar; Hiller, Luisa; Cowen, Todd; Piletsky, Sergey; Andrew, Peter W; Yesilkaya, Hasan

    2017-12-22

    We describe the development, characterization, and biological testing of a new type of linear molecularly imprinted polymer (LMIP) designed to act as an anti-infective by blocking the quorum sensing (QS) mechanism and so abrogating the virulence of the pathogen Streptococcus pneumoniae. The LMIP is prepared (polymerized) in presence of a template molecule, but unlike in traditional molecular imprinting approaches, no cross-linker is used. This results in soluble low-molecular-weight oligomers that can act as a therapeutic agent in vitro and in vivo. The LMIP was characterized by mass spectrometry to determine its monomer composition. Fragments identified were then aligned along the peptide template by computer modeling to predict the possible monomer sequence of the LMIP. These findings provide a proof of principle that LMIPs can be used to block QS, thus setting the stage for the development of LMIPs a novel drug-discovery platform and class of materials to target Gram-positive pathogens. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. A mathematical modelling framework for linked within-host and between-host dynamics for infections with free-living pathogens in the environment.

    Science.gov (United States)

    Garira, Winston; Mathebula, Dephney; Netshikweta, Rendani

    2014-10-01

    In this study we develop a mathematical modelling framework for linking the within-host and between-host dynamics of infections with free-living pathogens in the environment. The resulting linked models are sometimes called immuno-epidemiological models. However, there is still no generalised framework for linking the within-host and between-host dynamics of infectious diseases. Furthermore, for infections with free-living pathogens in the environment, there is an additional stumbling block in that there is a gap in knowledge on how environmental factors (through water, air, soil, food, fomites, etc.) alter many aspects of such infections including susceptibility to infective dose, persistence of infection, pathogen shedding and severity of the disease. In this work, we link the two subsystems (within-host and between-host models) by identifying the within-host and between-host variables and parameters associated with the environmental dynamics of the pathogen and then design a feedback of the variables and parameters across the within-host and between-host models using human schistosomiasis as a case study. We study the mathematical properties of the linked model and show that the model is epidemiologically well-posed. Using results from the analysis of the endemic equilibrium expression, the disease reproductive number R0, and numerical simulations of the full model, we adequately account for the reciprocal influence of the linked within-host and between-host models. In particular, we illustrate that for human schistosomiasis, the outcome of infection at the individual level determines if, when and how much the individual host will further transmit the infectious agent into the environment, eventually affecting the spread of the infection in the host population. We expect the conceptual modelling framework developed here to be applicable to many infectious disease with free-living pathogens in the environment beyond the specific disease system of human

  4. Streptococcus dysgalactiae subsp. dysgalactiae isolated from milk of the bovine udder as emerging pathogens: In vitro and in vivo infection of human cells and zebrafish as biological models.

    Science.gov (United States)

    Alves-Barroco, Cinthia; Roma-Rodrigues, Catarina; Raposo, Luís R; Brás, Catarina; Diniz, Mário; Caço, João; Costa, Pedro M; Santos-Sanches, Ilda; Fernandes, Alexandra R

    2018-03-25

    Streptococcus dysgalactiae subsp. dysgalactiae (SDSD) is a major cause of bovine mastitis and has been regarded as an animal-restricted pathogen, although rare infections have been described in humans. Previous studies revealed the presence of virulence genes encoded by phages of the human pathogen Group A Streptococcus pyogenes (GAS) in SDSD isolated from the milk of bovine udder with mastitis. The isolates SDSD VSD5 and VSD13 could adhere and internalize human primary keratinocyte cells, suggesting a possible human infection potential of bovine isolates. In this work, the in vitro and in vivo potential of SDSD to internalize/adhere human cells of the respiratory track and zebrafish as biological models was evaluated. Our results showed that, in vitro, bovine SDSD strains could interact and internalize human respiratory cell lines and that this internalization was dependent on an active transport mechanism and that, in vivo, SDSD are able to cause invasive infections producing zebrafish morbidity and mortality. The infectious potential of these isolates showed to be isolate-specific and appeared to be independent of the presence or absence of GAS phage-encoded virulence genes. Although the infection ability of the bovine SDSD strains was not as strong as the human pathogenic S. pyogenes in the zebrafish model, results suggested that these SDSD isolates are able to interact with human cells and infect zebrafish, a vertebrate infectious model, emerging as pathogens with zoonotic capability. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  5. Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

    Science.gov (United States)

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

  6. Community-acquired urinary tract infections in children: pathogens, antibiotic susceptibility and seasonal changes.

    Science.gov (United States)

    Yolbaş, I; Tekin, R; Kelekci, S; Tekin, A; Okur, M H; Ece, A; Gunes, A; Sen, V

    2013-04-01

    Urinary tract infections (UTIs) are common infections affecting children. The aim of our study is to determine microorganisms that cause community-acquired urinary tract infections and their antibiotic susceptibility in children. Our investigation includes 150 cases which has positive urine culture. The cases are detected at Pediatric Polyclinics of Dicle University between June 2010 and June 2011. The study included 118 (78.7%) female and 32 (21.3%) male children. Urinary tract infections were seen in autumn 10.7% (n = 16), summer 35.3% (n = 53), winter 30.7% (n = 46) and spring 23.3% (n = 35). The culture results indicated 75.3% (n = 113) Escherichia coli; 20.7% (n = 31) Klebsiella; 2.7% (n = 4) Proteus and % 1.3 (n = 2) Pseudomonas. The antibiotic resistance against Escherichia coli was found out is amikacin (3%), ertapenem (7%), imipenem (0%), meropenem (0%), nitrofurantoin (9%), trimethoprim/sulfamethoxazole (58%), piperacillin (83%), amoxicillin/clavulanate (50%), ampicillin/sulbactam (65%), cefazolin (54%), cefotaxime (51%), cefuroxime sodium (51% ) and tetracycline (68%). The resistance ratios of Klebsiella are amikacin (0%), imipenem (0%), levofloxacin (0%), meropenem (0%), amoxicillin/clavulanate (57%), ampicillin/sulbactam (79%), ceftriaxone (68%), cefuroxime sodium (74%) and trimethoprim/sulfamethoxazole (61%). The results represent the increasing antibiotic resistance against microorganisms among the community-acquired UTI patients in a developing country such as Turkey. So, the physicians should consider resistance status of the infectious agent and choose effective antibiotics which are nitrofurantoin and cefoxitin for their empirical antibiotic treatment. Furthermore, they should be trained about selection of more effective antibiotics and check the regional studies regularly.

  7. Antivirulence effects of pomegranate peel extracts on most common urinary tract infection pathogens in pregnant women

    OpenAIRE

    Wafaa Sadeq Al-Wazni; Bashair Sami Hadi

    2016-01-01

    Objective This study includes the investigation of antibacterial and antivirulence activities of three types of pomegranate peel extracts and then determines the interaction between the extracts and antibiotic in vitro. Methods The ability of most common isolated bacteria from urinary tract infection (UTI) to produce different virulence factors were tested and the effect of plant extracts on virulence factors were determined; in addition the correlation between extracts and antibioti...

  8. Cerebrospinal Fluid Proteomics Reveals Potential Pathogenic Changes in the Brains of SIV-infected Monkeys

    OpenAIRE

    Pendyala, Gurudutt; Trauger, Sunia A.; Kalisiak, Ewa; Ellis, Ronald J.; Siuzdak, Gary; Fox, Howard S.

    2009-01-01

    The HIV-1-associated neurocognitive disorder occurs in approximately one-third of infected individuals. It has persisted in the current era of anti-retroviral therapy, and its study is complicated by the lack of biomarkers for this condition. Since the cerebrospinal fluid is the most proximal biofluid to the site of pathology, we studied the cerebrospinal fluid in a nonhuman primate model for HIV-1-associated neurocognitive disorder. Here we present a simple and efficient liquid chromatograph...

  9. Gut Microbiota-Induced Immunoglobulin G Controls Systemic Infection by Symbiotic Bacteria and Pathogens

    Science.gov (United States)

    Zeng, Melody Y.; Cisalpino, Daniel; Varadarajan, Saranyaraajan; Hellman, Judith; Warren, H. Shaw; Cascalho, Marilia; Inohara, Naohiro; Núñez, Gabriel

    2016-01-01

    The gut microbiota is compartmentalized in the intestinal lumen and induces local immune responses, but it remains unknown whether the gut microbiota can induce systemic response and contribute to systemic immunity. We report that selective gut symbiotic gram-negative bacteria were able to disseminate systemically to induce immunoglobulin G (IgG) response, which primarily targeted gram-negative bacterial antigens and conferred protection against systemic infections by E. coli and Salmonella by directly coating bacteria to promote killing by phagocytes. T cells and Toll-like receptor 4 on B cells were important in the generation of microbiota-specific IgG. We identified murein lipoprotein (MLP), a highly conserved gram-negative outer membrane protein, as a major antigen that induced systemic IgG homeostatically in both mice and humans. Administration of anti-MLP IgG conferred crucial protection against systemic Salmonella infection. Thus, our findings reveal an important function for the gut microbiota in combating systemic infection through the induction of protective IgG. PMID:26944199

  10. Endodontic pathogens causing deep neck space infections: clinical impact of different sampling techniques and antibiotic susceptibility.

    Science.gov (United States)

    Poeschl, Paul W; Crepaz, Valentina; Russmueller, Guenter; Seemann, Rudolf; Hirschl, Alexander M; Ewers, Rolf

    2011-09-01

    The aims of the present study were to compare microbial populations in patients suffering from deep neck space abscesses caused by primary endodontic infections by sampling the infections with aspiration or swabbing techniques and to determine the susceptibility rates of the isolated bacteria to commonly used antibiotics. A total of 89 patients with deep neck space abscesses caused by primary endodontic infections requiring extraoral incision and drainage under general anesthesia were included. Either aspiration or swabbing was used to sample microbial pus specimens. The culture of the microbial specimens and susceptibility testing were performed following standard procedures. A total of 142 strains were recovered from 76 patients. In 13 patients, no bacteria were found. The predominant bacteria observed were streptococci (36%), staphylococci (13%), Prevotella (8%), and Peptostreptococcus (6%). A statistically significant greater number of obligate anaerobes were found in the aspiration group. The majority of patients presented a mixed aerobic-anaerobic population of bacterial flora (62%). The antibiotic resistance rates for the predominant bacteria were 10% for penicillin G, 9% for amoxicillin, 0% for amoxicillin clavulanate, 24% for clindamycin, and 24% for erythromycin. The results of our study indicated that a greater number of anaerobes were found when sampling using the aspiration technique. Penicillin G and aminopenicillins alone are not always sufficient for the treatment of severe deep neck space abscesses; beta-lactamase inhibitor combinations are more effective. Bacteria showed significant resistant rates to clindamycin. Thus, its single use in penicillin-allergic patients has to be carefully considered. Copyright © 2011 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  11. Pathogenic outcome following experimental infection of sheep with Chlamydia abortus variant strains LLG and POS.

    Science.gov (United States)

    Livingstone, Morag; Wheelhouse, Nicholas; Ensor, Hannah; Rocchi, Mara; Maley, Stephen; Aitchison, Kevin; Wattegedera, Sean; Wilson, Kim; Sait, Michelle; Siarkou, Victoria; Vretou, Evangelia; Entrican, Gary; Dagleish, Mark; Longbottom, David

    2017-01-01

    This study investigated the pathogenesis of two variant strains (LLG and POS) of Chlamydia abortus, in comparison to a typical wild-type strain (S26/3) which is known to be responsible for late term abortion in small ruminants. Challenge with the three strains at mid-gestation resulted in similar pregnancy outcomes, with abortion occurring in approximately 50-60% of ewes with the mean gestational lengths also being similar. However, differences were observed in the severity of placental pathology, with infection appearing milder for strain LLG, which was reflected in the lower number of organisms shed in vaginal swabs post-partum and less gross pathology and organisms present in placental smears. Results for strain POS were somewhat different than LLG with a more focal restriction of infection observed. Post-abortion antibody responses revealed prominent differences in seropositivity to the major outer membrane protein (MOMP) present in elementary body (EB) preparations under denaturing conditions, most notably with anti-LLG and anti-POS convalescent sera where there was no or reduced detection of MOMP present in EBs derived from the three strains. These results and additional analysis of whole EB and chlamydial outer membrane complex preparations suggest that there are conformational differences in MOMP for the three strains. Overall, the results suggest that gross placental pathology and clinical outcome is not indicative of bacterial colonization and the severity of infection. The results also highlight potential conformational differences in MOMP epitopes that perhaps impact on disease diagnosis and the development of new vaccines.

  12. Pathogenic outcome following experimental infection of sheep with Chlamydia abortus variant strains LLG and POS.

    Directory of Open Access Journals (Sweden)

    Morag Livingstone

    Full Text Available This study investigated the pathogenesis of two variant strains (LLG and POS of Chlamydia abortus, in comparison to a typical wild-type strain (S26/3 which is known to be responsible for late term abortion in small ruminants. Challenge with the three strains at mid-gestation resulted in similar pregnancy outcomes, with abortion occurring in approximately 50-60% of ewes with the mean gestational lengths also being similar. However, differences were observed in the severity of placental pathology, with infection appearing milder for strain LLG, which was reflected in the lower number of organisms shed in vaginal swabs post-partum and less gross pathology and organisms present in placental smears. Results for strain POS were somewhat different than LLG with a more focal restriction of infection observed. Post-abortion antibody responses revealed prominent differences in seropositivity to the major outer membrane protein (MOMP present in elementary body (EB preparations under denaturing conditions, most notably with anti-LLG and anti-POS convalescent sera where there was no or reduced detection of MOMP present in EBs derived from the three strains. These results and additional analysis of whole EB and chlamydial outer membrane complex preparations suggest that there are conformational differences in MOMP for the three strains. Overall, the results suggest that gross placental pathology and clinical outcome is not indicative of bacterial colonization and the severity of infection. The results also highlight potential conformational differences in MOMP epitopes that perhaps impact on disease diagnosis and the development of new vaccines.

  13. Host-Pathogen Interactions : XXXII. A Fungal Glucan Preparation Protects Nicotianae against Infection by Viruses.

    Science.gov (United States)

    Kopp, M; Rouster, J; Fritig, B; Darvill, A; Albersheim, P

    1989-05-01

    A glucan preparation obtained from the mycelial walls of the fungus Phytophthora megasperma f.sp. glycinea and known as an elicitor of phytoalexins in soybean was shown to be a very efficient inducer of resistance against viruses in tobacco. The glucan preparation protected against mechanically transmitted viral infections on the upper and lower leaf surfaces. Whether the glucan preparation was applied by injection, inoculation, or spraying, it protected the plants if applied before, at the same time as, or not later than 8 hours after virus inoculation. At concentrations ranging from 0.1 to 10 micrograms per milliliter, the glucan preparation induced protection ranging from 50 to 100% against both symptom production (necrotic local lesions, necrotic rings, or systemic mosaic) and virus accumulation in all Nicotiana-virus combinations examined. However, no significant protection against some of the same viruses was observed in bean or turnip. The host plants successfully protected included N. tabacum (9 different cultivars), N. sylvestris, N. glutinosa, and N. clevelandii. The viruses belonged to several taxonomic groups including tobacco mosaic virus, alfalfa mosaic virus, and tomato black ring virus. The glucan preparation did not act directly on the virus and did not interfere with virus disassembly; rather, it appeared to induce changes in the host plant that prevented infections from being initiated or recently established infections from enlarging. The induced resistance does not depend on induction of pathogenesis-related proteins, the phenylpropanoid pathway, lignin-like substances, or callose-like materials. We believe the induced resistance results from a mechanism that has yet to be described.

  14. Countering a bioterrorist introduction of pathogen-infected mosquitoes through mosquito control.

    Science.gov (United States)

    Tabachnick, Walter J; Harvey, William R; Becnel, James J; Clark, Gary G; Connelly, C Roxanne; Day, Jonathan F; Linser, Paul J; Linthicum, Kenneth J

    2011-06-01

    The release of infected mosquitoes or other arthropods by bioterrorists, i.e., arboterrorism, to cause disease and terror is a threat to the USA. A workshop to assess mosquito control response capabilities to mount rapid and effective responses to eliminate an arboterrorism attack provided recommendations to improve capabilities in the USA. It is essential that mosquito control professionals receive training in possible responses, and it is recommended that a Council for Emergency Mosquito Control be established in each state to coordinate training, state resources, and actions for use throughout the state.

  15. Prevention of immunodeficiency virus induced CD4+ T-cell depletion by prior infection with a non-pathogenic virus

    International Nuclear Information System (INIS)

    TerWee, Julie A.; Carlson, Jennifer K.; Sprague, Wendy S.; Sondgeroth, Kerry S.; Shropshire, Sarah B.; Troyer, Jennifer L.; VandeWoude, Sue

    2008-01-01

    Immune dysregulation initiated by a profound loss of CD4+ T-cells is fundamental to HIV-induced pathogenesis. Infection of domestic cats with a non-pathogenic lentivirus prevalent in the puma (puma lentivirus, PLV or FIV PCO ) prevented peripheral blood CD4+ T-cell depletion caused by subsequent virulent FIV infection. Maintenance of this critical population was not associated with a significant decrease in FIV viremia, lending support to the hypothesis that direct viral cytopathic effect is not the primary cause of immunodeficiency. Although this approach was analogous to immunization with a modified live vaccine, correlates of immunity such as a serum-neutralizing antibody or virus-specific T-cell proliferative response were not found in protected animals. Differences in cytokine transcription profile, most notably in interferon gamma, were observed between the protected and unprotected groups. These data provide support for the importance of non-adaptive enhancement of the immune response in the prevention of CD4+ T-cell loss

  16. Discovery of three novel coccidian parasites infecting California sea lions (Zalophus californianus), with evidence of sexual replication and interspecies pathogenicity.

    Science.gov (United States)

    Colegrove, Kathleen M; Grigg, Michael E; Carlson-Bremer, Daphne; Miller, Robin H; Gulland, Frances M D; Ferguson, David J P; Rejmanek, Daniel; Barr, Bradd C; Nordhausen, Robert; Melli, Ann C; Conrad, Patricia A

    2011-10-01

    Enteric protozoal infection was identified in 5 stranded California sea lions (Zalophus californianus). Microscopically, the apical cytoplasm of distal jejunal enterocytes contained multiple stages of coccidian parasites, including schizonts with merozoites and spherical gametocytes, which were morphologically similar to coccidians. By histopathology, organisms appeared to be confined to the intestine and accompanied by only mild enteritis. Using electron microscopy, both sexual (microgametocytes, macrogamonts) and asexual (schizonts, merozoites) coccidian stages were identified in enterocytes within parasitophorous vacuoles, consistent with apicomplexan development in a definitive host. Serology was negative for tissue cyst-forming coccidians, and immunohistochemistry for Toxoplasma gondii was inconclusive and negative for Neospora caninum and Sarcocystis neurona. Analysis of ITS-1 gene sequences amplified from frozen or formalin-fixed paraffin-embedded intestinal sections identified DNA sequences with closest homology to Neospora sp. (80%); these novel sequences were referred to as belonging to coccidian parasites "A," "B," and "C." Subsequent molecular analyses completed on a neonatal harbor seal (Phoca vitulina) with protozoal lymphadenitis, hepatitis, myocarditis, and encephalitis showed that it was infected with a coccidian parasite bearing the "C" sequence type. Our results indicate that sea lions likely serve as definitive hosts for 3 newly described coccidian parasites, at least 1 of which is pathogenic in a marine mammal intermediate host species.

  17. Effect of Pseudomonas spp on infection of Peronosporaparasitica (Pers. Fr), the pathogen of downy mildew on Chinese cabbage

    Science.gov (United States)

    Damiri, N.; Mulawarman; Umayah, A.; Agustin, S. E.; Rahmiyah, M.

    2018-01-01

    This research was conducted to study the effect of the application of Pseudomonasspp on infection of Peronosporaparasitica (Pers. Fr), the pathogen of Downy mildew on Chinese cabbage. The research was conducted in the laboratory and greenhouse Department of Plant Pests and Diseases Faculty of Agriculture Sriwijaya University, Inderalaya, OganIlir South Sumatra Indonesia. The research was conducted in the laboratory and greenhouse Department of Plant Pests and Diseases Faculty of Agriculture Sriwijaya University, Inderalaya, Ogan Ilir South Sumatra Indonesia. The research was conducted using Completely Randomized Design with ten treatments including control. ie: isolate A, Isolate B, isolate C, isolate D, isolate E, isolate F, isolate G, isolate H, isolate I and control. Each treatment consists of four replications. Results of the study showed that the application of Pseudomonas spp. can suppress the infection of P. parasitica on Chinese cabbage. The lowest disease intensity was shown by treatment C (isolate Pseudomonas sp.) which was significantly different from control. The best treatment in suppressing disease severity of downy mildew on chinese cabbage was isolate H which had disease severity of 37.07 percent, which was significantly different from control and other treatment.

  18. DISCOVERY OF THREE NOVEL COCCIDIAN PARASITES INFECTING CALIFORNIA SEA LIONS (ZALOPHUS CALIFORNIANUS), WITH EVIDENCE OF SEXUAL REPLICATION AND INTERSPECIES PATHOGENICITY

    Science.gov (United States)

    Colegrove, Kathleen M.; Grigg, Michael E.; Carlson-Bremer, Daphne; Miller, Robin H.; Gulland, Frances M. D.; Ferguson, David J. P.; Rejmanek, Daniel; Barr, Bradd C.; Nordhausen, Robert; Melli, Ann C.; Conrad, Patricia A.

    2016-01-01

    Enteric protozoal infection was identified in 5 stranded California sea lions (Zalophus californianus). Microscopically, the apical cytoplasm of distal jejunal enterocytes contained multiple stages of coccidian parasites, including schizonts with merozoites and spherical gametocytes, which were morphologically similar to coccidians. By histopathology, organisms appeared to be confined to the intestine and accompanied by only mild enteritis. Using electron microscopy, both sexual (microgametocytes, macrogamonts) and asexual (schizonts, merozoites) coccidian stages were identified in enterocytes within parasitophorous vacuoles, consistent with apicomplexan development in a definitive host. Serology was negative for tissue cyst-forming coccidians, and immunohistochemistry for Toxoplasma gondii was inconclusive and negative for Neospora caninum and Sarcocystis neurona. Analysis of ITS-1 gene sequences amplified from frozen or formalin-fixed paraffin-embedded intestinal sections identified DNA sequences with closest homology to Neospora sp. (80%); these novel sequences were referred to as belonging to coccidian parasites ‘‘A,’’ ‘‘B,’’ and ‘‘C.’’ Subsequent molecular analyses completed on a neonatal harbor seal (Phoca vitulina) with protozoal lymphadenitis, hepatitis, myocarditis, and encephalitis showed that it was infected with a coccidian parasite bearing the ‘‘C’’ sequence type. Our results indicate that sea lions likely serve as definitive hosts for 3 newly described coccidian parasites, at least 1 of which is pathogenic in a marine mammal intermediate host species. PMID:21495828

  19. Deep sequencing-based transcriptome analysis of chicken spleen in response to avian pathogenic Escherichia coli (APEC infection.

    Directory of Open Access Journals (Sweden)

    Qinghua Nie

    Full Text Available Avian pathogenic Escherichia coli (APEC leads to economic losses in poultry production and is also a threat to human health. The goal of this study was to characterize the chicken spleen transcriptome and to identify candidate genes for response and resistance to APEC infection using Solexa sequencing. We obtained 14422935, 14104324, and 14954692 Solexa read pairs for non-challenged (NC, challenged-mild pathology (MD, and challenged-severe pathology (SV, respectively. A total of 148197 contigs and 98461 unigenes were assembled, of which 134949 contigs and 91890 unigenes match the chicken genome. In total, 12272 annotated unigenes take part in biological processes (11664, cellular components (11927, and molecular functions (11963. Summing three specific contrasts, 13650 significantly differentially expressed unigenes were found in NC Vs. MD (6844, NC Vs. SV (7764, and MD Vs. SV (2320. Some unigenes (e.g. CD148, CD45 and LCK were involved in crucial pathways, such as the T cell receptor (TCR signaling pathway and microbial metabolism in diverse environments. This study facilitates understanding of the genetic architecture of the chicken spleen transcriptome, and has identified candidate genes for host response to APEC infection.

  20. A link between virulence and homeostatic responses to hypoxia during infection by the human fungal pathogen Cryptococcus neoformans.

    Directory of Open Access Journals (Sweden)

    Cheryl D Chun

    2007-02-01

    Full Text Available Fungal pathogens of humans require molecular oxygen for several essential biochemical reactions, yet virtually nothing is known about how they adapt to the relatively hypoxic environment of infected tissues. We isolated mutants defective in growth under hypoxic conditions, but normal for growth in normoxic conditions, in Cryptococcus neoformans, the most common cause of fungal meningitis. Two regulatory pathways were identified: one homologous to the mammalian sterol-response element binding protein (SREBP cholesterol biosynthesis regulatory pathway, and the other a two-component-like pathway involving a fungal-specific hybrid histidine kinase family member, Tco1. We show that cleavage of the SREBP precursor homolog Sre1-which is predicted to release its DNA-binding domain from the membrane-occurs in response to hypoxia, and that Sre1 is required for hypoxic induction of genes encoding for oxygen-dependent enzymes involved in ergosterol synthesis. Importantly, mutants in either the SREBP pathway or the Tco1 pathway display defects in their ability to proliferate in host tissues and to cause disease in infected mice, linking for the first time to our knowledge hypoxic adaptation and pathogenesis by a eukaryotic aerobe. SREBP pathway mutants were found to be a hundred times more sensitive than wild-type to fluconazole, a widely used antifungal agent that inhibits ergosterol synthesis, suggesting that inhibitors of SREBP processing could substantially enhance the potency of current therapies.

  1. AMPK in Pathogens

    OpenAIRE

    Mesquita, Inês Morais; Moreira, Diana; Marques, Belém Sampaio; Laforge, Mireille; Cordeiro-da-Silva, Anabela; Ludovico, Paula; Estaquier, Jérôme; Silvestre, Ricardo Jorge Leal

    2016-01-01

    During host–pathogen interactions, a complex web of events is crucial for the outcome of infection. Pathogen recognition triggers powerful cellular signaling events that is translated into the induction and maintenance of innate and adaptive host immunity against infection. In opposition, pathogens employ active mechanisms to manipulate host cell regulatory pathways toward their proliferation and survival. Among these, subversion of host cell energy metabolism by pathogens is currently recogn...

  2. Human neutrophil clearance of bacterial pathogens triggers anti-microbial γδ T cell responses in early infection.

    Directory of Open Access Journals (Sweden)

    Martin S Davey

    2011-05-01

    Full Text Available Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8. In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN-γ and tumor necrosis factor (TNF-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP, requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1, and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD-associated bacterial peritonitis--characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity--show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in

  3. Viral Small-RNA Analysis of Bombyx mori Larval Midgut during Persistent and Pathogenic Cytoplasmic Polyhedrosis Virus Infection.

    Science.gov (United States)

    Zografidis, Aris; Van Nieuwerburgh, Filip; Kolliopoulou, Anna; Apostolou-Karampelis, Konstantinos; Head, Steven R; Deforce, Dieter; Smagghe, Guy; Swevers, Luc

    2015-11-01

    The lepidopteran innate immune response against RNA viruses remains poorly understood, while in other insects several studies have highlighted an essential role for the exo-RNAi pathway in combating viral infection. Here, by using deep-sequencing technology for viral small-RNA (vsRNA) assessment, we provide evidence that exo-RNAi is operative in the silkworm Bombyx mori against both persistent and pathogenic infection of B. mori cytoplasmic polyhedrosis virus (BmCPV) which is characterized by a segmented double-stranded RNA (dsRNA) genome. Further, we show that Dicer-2 predominantly targets viral dsRNA and produces 20-nucleotide (nt) vsRNAs, whereas an additional pathway is responsive to viral mRNA derived from segment 10. Importantly, vsRNA distributions, which define specific hot and cold spot profiles for each viral segment, to a considerable degree overlap between Dicer-2-related (19 to 21 nt) and Dicer-2-unrelated vsRNAs, suggesting a common origin for these profiles. We found a degenerate motif significantly enriched at the cut sites of vsRNAs of various lengths which link an unknown RNase to the origins of vsRNAs biogenesis and distribution. Accordingly, the indicated RNase activity may be an important early factor for the host's antiviral defense in Lepidoptera. This work contributes to the elucidation of the lepidopteran antiviral response against infection of segmented double-stranded RNA (dsRNA) virus (CPV; Reoviridae) and highlights the importance of viral small-RNA (vsRNA) analysis for getting insights into host-pathogen interactions. Three vsRNA pathways are implicated in antiviral defense. For dsRNA, two pathways are proposed, either based on Dicer-2 cleavage to generate 20-nucleotide vsRNAs or based on the activity of an uncharacterized endo-RNase that cleaves the viral RNA substrate at a degenerate motif. The analysis also indicates the existence of a degradation pathway that targets the positive strand of segment 10. Copyright © 2015, American

  4. Human Neutrophil Clearance of Bacterial Pathogens Triggers Anti-Microbial γδ T Cell Responses in Early Infection

    Science.gov (United States)

    Roberts, Gareth W.; Heuston, Sinéad; Brown, Amanda C.; Chess, James A.; Toleman, Mark A.; Gahan, Cormac G. M.; Hill, Colin; Parish, Tanya; Williams, John D.; Davies, Simon J.; Johnson, David W.; Topley, Nicholas; Moser, Bernhard; Eberl, Matthias

    2011-01-01

    Human blood Vγ9/Vδ2 T cells, monocytes and neutrophils share a responsiveness toward inflammatory chemokines and are rapidly recruited to sites of infection. Studying their interaction in vitro and relating these findings to in vivo observations in patients may therefore provide crucial insight into inflammatory events. Our present data demonstrate that Vγ9/Vδ2 T cells provide potent survival signals resulting in neutrophil activation and the release of the neutrophil chemoattractant CXCL8 (IL-8). In turn, Vγ9/Vδ2 T cells readily respond to neutrophils harboring phagocytosed bacteria, as evidenced by expression of CD69, interferon (IFN)-γ and tumor necrosis factor (TNF)-α. This response is dependent on the ability of these bacteria to produce the microbial metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), requires cell-cell contact of Vγ9/Vδ2 T cells with accessory monocytes through lymphocyte function-associated antigen-1 (LFA-1), and results in a TNF-α dependent proliferation of Vγ9/Vδ2 T cells. The antibiotic fosmidomycin, which targets the HMB-PP biosynthesis pathway, not only has a direct antibacterial effect on most HMB-PP producing bacteria but also possesses rapid anti-inflammatory properties by inhibiting γδ T cell responses in vitro. Patients with acute peritoneal-dialysis (PD)-associated bacterial peritonitis – characterized by an excessive influx of neutrophils and monocytes into the peritoneal cavity – show a selective activation of local Vγ9/Vδ2 T cells by HMB-PP producing but not by HMB-PP deficient bacterial pathogens. The γδ T cell-driven perpetuation of inflammatory responses during acute peritonitis is associated with elevated peritoneal levels of γδ T cells and TNF-α and detrimental clinical outcomes in infections caused by HMB-PP positive microorganisms. Taken together, our findings indicate a direct link between invading pathogens, neutrophils, monocytes and microbe-responsive γδ T cells in early

  5. Salmonella infection in healthy pet reptiles: Bacteriological isolation and study of some pathogenic characters.

    Science.gov (United States)

    Bertelloni, Fabrizio; Chemaly, Marianne; Cerri, Domenico; Gall, Françoise Le; Ebani, Valentina Virginia

    2016-06-01

    The fecal samples from 213 captive reptiles were examined, and 29 (13.61%) Salmonella enterica isolates were detected: 14/62 (22.58%) from chelonians, 14/135 (10.37%) from saurians, and 1/16 (6.25%) from ophidians. The isolates were distributed among 14 different serotypes: Miami, Ebrie, Hermannsweder, Tiergarten, Tornov, Pomona, Poona, Goteborg, Abaetetube, Nyanza, Kumasi, Typhimurium, 50:b:z6, 9,12:z29:1,5, and a non-motile serotype with antigenic formula 1,4,[5],12:-:-. Salmonella typhimurium and 50:b:z6 isolates showed the spv plasmid virulence genes, responsible of the capability to induce extra-intestinal infections. In some cases, pulsed field gel electrophoresis revealed different profiles for the strains of the same serotypes, showing different origins, whereas a common source of infection was supposed when one pulsotype had been observed for isolates of a serovar. Twenty-seven (93.10%) isolates showed resistance to one or more antibiotics. Ceftazidime was active to all the tested isolates, whereas the highest percentages of strains were no susceptible to tigecycline (93.10%), streptomycin (89.66%), and sulfonamide (86.21%).

  6. Causative pathogens and antibiotic resistance in children hospitalized for urinary tract infection.

    Science.gov (United States)

    Koçak, Mesut; Büyükkaragöz, Bahar; Çelebi Tayfur, Asli; Çaltik, Aysun; Köksoy, Adem Yasin; Çizmeci, Zeynep; Günbey, Sacit

    2016-06-01

    Urinary tract infections (UTI) are one of the most common bacterial infections in children and a major cause of hospitalization. In this study we investigated the clinical characteristics, causative uropathogens; their antibiotic susceptibility and resistance patterns, treatment modalities and efficacy in children hospitalized for UTI in a tertiary care setting. Patients hospitalized for an upper UTI between March 2009 and July 2014 were enrolled. The urine culture-antibiogram results and accompanying urinary tract abnormalities were recorded retrospectively. A total of 142 patients (104 girls, 73.2%; 38 boys, 26.8%) were enrolled. Mean patient age was 32.6 ± 4.1 months. History of recurrent UTI was present in 45.8% (n = 65), with prior hospitalization in 12.0% (n = 17). Frequency of vesicoureteral reflux was 18.3% (n = 26). Gram-negative enteric microorganisms yielded growth in all culture-positive UTI and the most common microorganism was Escherichia coli (n = 114, 80.3%). Extended spectrum beta-lactamase-producing (ESBL (+)) bacterial strains were detected in 49.3% (n = 70), with third-generation cephalosporin resistance in all and increased duration of hospitalization. The prevalence of UTI with ESBL (+) bacterial strains with multi-drug resistance is increasing in the hospitalized pediatric population, therefore rational use of antibiotics is essential. © 2015 Japan Pediatric Society.

  7. Prevalence of multidrug resistant pathogens in children with urinary tract infection: a retrospective analysis

    Directory of Open Access Journals (Sweden)

    Srinivasan S, Madhusudhan NS

    2014-11-01

    Full Text Available Urinary tract infection (UTI is one of the commonest medical problems in children. It can distress the child and may cause kidney damage. Prompt diagnosis and effective treatment can prevent complications in the child. But treatment of UTI in children has now become a challenge due to the emergence of multidrug resistant bacteria. Aims & Objectives: To know the bacteriological profile and susceptibility pattern of urinary tract infections in children and to know the prevalence of multidrug resistant uropathogens. Materials & Methods: A retrospective analysis was done on all paediatric urine samples for a period of one year. A total of 1581 samples were included in the study. Antimicrobial susceptibility testing was done on samples showing significant growth by Kirby-Bauer disc diffusion method. Statistical analysis: Prevalence and pattern were analyzed using proportions and percentages. Results: E.coli was the most predominant organism (56% causing UTI in children followed by Klebsiella sp (17%. Fifty three percent of gram negative organisms isolated from children were found to be multidrug resistant. Majority of E. coli isolates were found to be highly resistant to Ampicillin (91% and Cotrimoxazole (82% and highly sensitive to Imipenem (99% and Amikacin (93%. Conclusion: Paediatric UTI was common in children less than 5 years of age. Gram negative bacteria (E. coli and Klebsiella sp were more common than gram positive bacteria. Our study revealed that multidrug resistance was higher in E.coli.

  8. Two novel transcriptional regulators are essential for infection-related morphogenesis and pathogenicity of the rice blast fungus Magnaporthe oryzae.

    Directory of Open Access Journals (Sweden)

    Xia Yan

    2011-12-01

    Full Text Available The cyclic AMP-dependent protein kinase A signaling pathway plays a major role in regulating plant infection by the rice blast fungus Magnaporthe oryzae. Here, we report the identification of two novel genes, MoSOM1 and MoCDTF1, which were discovered in an insertional mutagenesis screen for non-pathogenic mutants of M. oryzae. MoSOM1 or MoCDTF1 are both necessary for development of spores and appressoria by M. oryzae and play roles in cell wall differentiation, regulating melanin pigmentation and cell surface hydrophobicity during spore formation. MoSom1 strongly interacts with MoStu1 (Mstu1, an APSES transcription factor protein, and with MoCdtf1, while also interacting more weakly with the catalytic subunit of protein kinase A (CpkA in yeast two hybrid assays. Furthermore, the expression levels of MoSOM1 and MoCDTF1 were significantly reduced in both Δmac1 and ΔcpkA mutants, consistent with regulation by the cAMP/PKA signaling pathway. MoSom1-GFP and MoCdtf1-GFP fusion proteins localized to the nucleus of fungal cells. Site-directed mutagenesis confirmed that nuclear localization signal sequences in MoSom1 and MoCdtf1 are essential for their sub-cellular localization and biological functions. Transcriptional profiling revealed major changes in gene expression associated with loss of MoSOM1 during infection-related development. We conclude that MoSom1 and MoCdtf1 functions downstream of the cAMP/PKA signaling pathway and are novel transcriptional regulators associated with cellular differentiation during plant infection by the rice blast fungus.

  9. Development of a chip-based multiplexed immunoassay using liposomal nanovesicles and its application in the detection of pathogens causing female lower genital tract infections

    Directory of Open Access Journals (Sweden)

    Wen-Hsiang Su

    2013-03-01

    Conclusion: This microarray chip was a rapid, easy, inexpensive and sensitive tool for detecting female lower genital tract Candida infection in a one-time vaginal sampling process, although the data on the four other pathogens were still unavailable. A larger population study is encouraged to test the validity of this multiplexed immunoassay chip.

  10. Pathogenic strains of Yersinia enterocolitica isolated from domestic dogs (Canis familiaris) belonging to farmers are of the same subtype as pathogenic Y. enterocolitica strains isolated from humans and may be a source of human infection in Jiangsu Province, China.

    Science.gov (United States)

    Wang, Xin; Cui, Zhigang; Wang, Hua; Tang, Liuying; Yang, Jinchuan; Gu, Ling; Jin, Dong; Luo, Longze; Qiu, Haiyan; Xiao, Yuchun; Xiong, Haiping; Kan, Biao; Xu, Jianguo; Jing, Huaiqi

    2010-05-01

    We isolated 326 Yersinia enterocolitica strains from 5,919 specimens from patients with diarrhea at outpatient clinics, livestock, poultry, wild animals, insect vectors, food, and the environment in the cities of Nantong and Xuzhou in Jiangsu Province, China, from 2004 to 2008. The results showed that the 12 pathogenic strains were of the O:3 serotype. Six strains were isolated from domestic dogs (Canis familiaris) belonging to farmers and were found to be the primary carriers of pathogenic Y. enterocolitica strains, especially in Xuzhou. Pulsed-field gel electrophoresis analysis of the pathogenic strains from dogs belonging to farmers showed that they shared the same patterns as strains from diarrhea patients isolated in 1994. This indicates that the strains from domestic dogs have a close correlation with the strains causing human infections.

  11. Soft tissue infections from fish spike wounds: normal commensal bacteria are more common than marine pathogens.

    Science.gov (United States)

    Collins, Hannah; Lee, Kin Mun; Cheng, Paul T-Y; Hulme, Sarah

    2018-01-01

    A fish spike injury can be sustained by anyone handling fish; during fishing, meal preparation or in retail. Case reports of fish spikes inoculating victims with virulent marine-specific pathogens and causing systemic illness led us to question whether empirical treatment of these injuries with amoxicillin and clavulanic acid is adequate. This 2-year prospective observational study was conducted at Middlemore Hospital, Auckland, New Zealand. Wound swabs and tissue samples belonging to patients presenting to the Department of Plastic and Reconstructive Surgery with an upper limb fish spike injury were sent to the laboratory (n = 60). A series of stains and cultures were performed to look specifically for marine bacteria not typically isolated in other soft tissue injuries. Patient demographic data and injury details were collected. Of the patients with adequate microbiology samples, 12% (6/50) grew clinically relevant bacteria resistant to amoxicillin and clavulanic acid. These included methicillin-resistant Staphylococcus aureus (8%, 4/50), Enterobacter cloacae (2%, 1/50) and an anaerobic sporing bacillus (2%, 1/50). Only one patient grew a true marine-specific bacteria, Photobacterium damselae, which was susceptible to amoxicillin and clavulanic acid. The authors concluded that amoxicillin and clavulanic acid is an adequate first-line antibiotic for fish spike injuries but that flucloxacillin may be more appropriate given most bacteria were from patients' own skin flora. The authors suggest that clinicians consider the presence of resistant marine-specific bacteria in cases where there is sepsis or inadequate response to initial therapy. © 2017 Royal Australasian College of Surgeons.

  12. Quorum sensing coordinates brute force and stealth modes of infection in the plant pathogen Pectobacterium atrosepticum.

    Directory of Open Access Journals (Sweden)

    Hui Liu

    2008-06-01

    Full Text Available Quorum sensing (QS in vitro controls production of plant cell wall degrading enzymes (PCWDEs and other virulence factors in the soft rotting enterobacterial plant pathogen Pectobacterium atrosepticum (Pba. Here, we demonstrate the genome-wide regulatory role of QS in vivo during the Pba-potato interaction, using a Pba-specific microarray. We show that 26% of the Pba genome exhibited differential transcription in a QS (expI- mutant, compared to the wild-type, suggesting that QS may make a greater contribution to pathogenesis than previously thought. We identify novel components of the QS regulon, including the Type I and II secretion systems, which are involved in the secretion of PCWDEs; a novel Type VI secretion system (T6SS and its predicted substrates Hcp and VgrG; more than 70 known or putative regulators, some of which have been demonstrated to control pathogenesis and, remarkably, the Type III secretion system and associated effector proteins, and coronafacoyl-amide conjugates, both of which play roles in the manipulation of plant defences. We show that the T6SS and a novel potential regulator, VirS, are required for full virulence in Pba, and propose a model placing QS at the apex of a regulatory hierarchy controlling the later stages of disease progression in Pba. Our findings indicate that QS is a master regulator of phytopathogenesis, controlling multiple other regulators that, in turn, co-ordinately regulate genes associated with manipulation of host defences in concert with the destructive arsenal of PCWDEs that manifest the soft rot disease phenotype.

  13. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection

    Directory of Open Access Journals (Sweden)

    Rekha Khandia

    2018-04-01

    Full Text Available Antibody-dependent enhancement (ADE is a phenomenon in which preexisting poorly neutralizing antibodies leads to enhanced infection. It is a serious concern with mosquito-borne flaviviruses such as Dengue virus (DENV and Zika virus (ZIKV. In vitro experimental evidences have indicated the preventive, as well as a pathogenicity-enhancing role, of preexisting DENV antibodies in ZIKV infections. ADE has been confirmed in DENV but not ZIKV infections. Principally, the Fc region of the anti-DENV antibody binds with the fragment crystallizable gamma receptor (FcγR, and subsequent C1q interactions and immune effector functions are responsible for the ADE. In contrast to normal DENV infections, with ADE in DENV infections, inhibition of STAT1 phosphorylation and a reduction in IRF-1 gene expression, NOS2 levels, and RIG-1 and MDA-5 expression levels occurs. FcγRIIA is the most permissive FcγR for DENV-ADE, and under hypoxic conditions, hypoxia-inducible factor-1 alpha transcriptionally enhances expression levels of FcγRIIA, which further enhances ADE. To produce therapeutic antibodies with broad reactivity to different DENV serotypes, as well as to ZIKV, bispecific antibodies, Fc region mutants, modified Fc regions, and anti-idiotypic antibodies may be engineered. An in-depth understanding of the immunological and molecular mechanisms of DENV-ADE of ZIKV pathogenicity will be useful for the design of common and safe therapeutics and prophylactics against both viral pathogens. The present review discusses the role of DENV antibodies in modulating DENV/ZIKV pathogenicity/infection and strategies to counter ADE to protect against Zika infection.

  14. Differential Impact of In Vivo CD8+ T Lymphocyte Depletion in Controller versus Progressor Simian Immunodeficiency Virus-Infected Macaques.

    Science.gov (United States)

    Chowdhury, Ankita; Hayes, Timothy L; Bosinger, Steven E; Lawson, Benton O; Vanderford, Thomas; Schmitz, Joern E; Paiardini, Mirko; Betts, Michael; Chahroudi, Ann; Estes, Jacob D; Silvestri, Guido

    2015-09-01

    Numerous studies have demonstrated that CD8(+) T lymphocytes suppress virus replication during human immunodeficiency virus (HIV)/simian immunodeficiency virus (SIV) infection. However, the mechanisms underlying this activity of T cells remain incompletely understood. Here, we conducted CD8(+) T lymphocyte depletion in 15 rhesus macaques (RMs) infected intravenously (i.v.) with SIVmac239. At day 70 postinfection, the animals (10 progressors with high viremia and 5 controllers with low viremia) were CD8 depleted by i.v. administration of the antibody M-T807R1. As expected, CD8 depletion resulted in increased virus replication, more prominently in controllers than progressors, which correlated inversely with predepletion viremia. Of note, the feature of CD8(+) T lymphocyte predepletion that correlated best with the increase in viremia postdepletion was the level of CD8(+) T-bet(+) lymphocytes. We next found that CD8 depletion resulted in a homogenous increase of SIV RNA in superficial and mesenteric lymph nodes, spleen, and the gastrointestinal tract of both controllers and progressors. Interestingly, the level of SIV DNA increased postdepletion in both CD4(+) central memory T lymphocytes (TCM) and CD4(+) effector memory T lymphocytes (TEM) in progressor RMs but decreased in the CD4(+) TCM of 4 out of 5 controllers. Finally, we found that CD8 depletion is associated with a greater increase in CD4(+) T lymphocyte activation (measured by Ki-67 expression) in controllers than in progressors. Overall, these data reveal a differential impact of CD8(+) T lymphocyte depletion between controller and progressor SIV-infected RMs, emphasizing the complexity of the in vivo antiviral role of CD8(+) T lymphocytes. In this study, we further dissect the impact of CD8(+) T lymphocytes on HIV/SIV replication during SIV infection. CD8(+) T lymphocyte depletion leads to a relatively homogenous increase in viral replication in peripheral blood and tissues. CD8(+) T lymphocyte depletion

  15. Differences in pathogenicity, response to vaccination, and innate immune responses in different types of ducks infected with a virulent H5N1 highly pathogenic avian influenza virus from Vietnam.

    Science.gov (United States)

    Cagle, Caran; Wasilenko, Jamie; Adams, Sean C; Cardona, Carol J; To, Thanh Long; Nguyen, Tung; Spackman, Erica; Suarez, David L; Smith, Diane; Shepherd, Eric; Roth, Jason; Pantin-Jackwood, Mary J

    2012-09-01

    In a previous study, we found clear differences in pathogenicity and response to vaccination against H5N1 highly pathogenic avian influenza (HPAI; HA dade 2.3.4) between Pekin (Anas platyrhynchos var. domestica) and Muscovy (Cairina moschata) ducks vaccinated using a commercial inactivated vaccine (Re-1). The objective of the present study was to further investigate the pathogenicity of H5N1 HPAI viruses in different species of ducks by examining clinical signs and innate immune responses to infection with a different strain of H5N1 HPAI virus (HA clade 1) in two domestic ducks, Pekin and Muscovy, and one wild-type duck, mallard (Anas platyrhynchos). Protection conferred by vaccination using the Re-1 vaccine against infection with this virus was also compared between Pekin and Muscovy ducks. Differences in pathogenicity were observed among the virus-infected ducks, as the Muscovy ducks died 2 days earlier than did the Pekin and mallard ducks, and they presented more-severe neurologic signs. Conversely, the Pekin and mallard ducks had significantly higher body temperatures at 2 days postinfection (dpi) than did the Muscovy ducks, indicating possible differences in innate immune responses. However, similar expression of innate immune-related genes was found in the spleens of virus-infected ducks at this time point. In all three duck species, there was up-regulation of IFN-alpha, IFN-gamma, IL-6, CCL19, RIG-I, and MHC class I and down-regulation of MHC class II, but variable expression of IL-18 and TLR7. As in our previous study, vaccinated Muscovy ducks showed less protection against virus infection than did Pekin ducks, as evidenced by the higher mortality and higher number of Muscovy ducks shedding virus when compared to Pekin ducks. In conclusion, infection with an H5N1 HPAI virus produced a systemic infection with high mortality in all three duck species; however, the disease was more severe in Muscovy ducks, which also had a poor response to vaccination. The

  16. Virus interference between H7N2 low pathogenic avian influenza virus and lentogenic Newcastle disease virus in experimental co-infections in chickens and turkeys

    OpenAIRE

    Costa-Hurtado, Mar; Afonso, Claudio L; Miller, Patti J; Spackman, Erica; Kapczynski, Darrell R; Swayne, David E; Shepherd, Eric; Smith, Diane; Zsak, Aniko; Pantin-Jackwood, Mary

    2014-01-01

    International audience; Low pathogenicity avian influenza virus (LPAIV) and lentogenic Newcastle disease virus (l NDV) are commonly reported causes of respiratory disease in poultry worldwide with similar clinical and pathobiological presentation. Co-infections do occur but are not easily detected, and the impact of co-infections on pathobiology is unknown. In this study chickens and turkeys were infected with a l NDV vaccine strain (LaSota) and a H7N2 LPAIV (A/turkey/VA/SEP-67/2002) simultan...

  17. Spectrum and antimicrobial susceptibility pattern of pathogens causing urinary tract infection experience in a tertiary care setting

    International Nuclear Information System (INIS)

    Amjad, A.; Mirza, I.A.; Abbasi, S.A.; Farwa, U.; Sattar, A.; Qureshi, Z.A.

    2012-01-01

    Objective: To determine the spectrum and antimicrobial susceptibility pattern of pathogens causing urinary tract infection from the samples received at AFIP Rawalpindi. Place and duration of study. The study was carried out at Department of Microbiology, Armed Forces Institute of Pathology from January 2010 to June 2010. Material and Method: This was descriptive cross-sectional study. A total of 500 bacterial isolates out of 2050 urine culture samples, for a period of six month were included in the study. Indentification was carried out by standard biochemical profile of the organisms. The antimicrobial susceptibilities of isolated organisms were performed by disk diffusion method as recommended by Clinical Laboratory Standard Institute. Results Out of the culture positive cases, gram-negative bacteria constituted the largest group with a total of 434 (87%) isolates, while gram-positive bacteria constituted only 44 (8.8%) isolates. E. coli was the most common isolate accounting for 63% of the total positive bacterial cultures followed by Klebsiella spp (9%) and P. aernginosa (7%). Susceptibility pattern of E. coli revealed that 96% of isolates were sensitive to imipenem, 91% to piperacillin-tazobactam and 87% to Nitrofurantoin. For Klebsiella spp, 86% of Isolates were susceptible to Imipenem and 71 % to piperacillin-tazobactam. As regards acinetobacter spp, 94% of Isolates were susceptible to piperacillin-tazobactam and 70 % to Imipenem an piperacilline-sulbactam. Antibiogram of P. aeruginosa revealed that 94% of isolates were sensitive to ceftazidime and 86% to imipenem. Nitrofurantoin was the most effective urinary antibiotic in case of enterococcus spp as 85% of isolates were susceptible to this compound. Conclusion: From the present study we conclude that E. coli was the predominant urinary pathogen in our set up. The antimicrobial susceptibility patterns of E. coli revealed that majority of isolates were susceptible to imipenem and piperacilline

  18. Effects of ionizing radiation over the structure, metabolism and infectivity of a pathogenic protozoan, Toxoplasma gondii

    International Nuclear Information System (INIS)

    Hiramoto, Roberto Mitsuyoshi

    1998-01-01

    The intracellular parasite Toxoplasma gondii (Apicomplexa), has as definitive host domestic and wild felines and as intermediate hosts most species of mammals and birds, Including man. The infection in man is usually asymptomatic, but can become a severe and lethal illness in some special groups like the fetus of primoinfected pregnant woman, or in AIDS and transplanted patients. The transmission is due to ingestion of food or water contaminated with oocysts from cat feces as well as raw or rare cooked cyst containing meet. There is no available vaccine against toxoplasmosis, with some reports of the use ionizing radiation in order to attenuate or suppress the parasite. These studies are promising, but more research is needed to optimize the radiation process and to clarify those alterations caused on T gondii.Using a increasing doses of 60 Co irradiation on T.gondii tachyzoites, we studied many parameters such as morphology, both at optical and electron microscopy level, detection of DNA fragmentation, metabolism alterations (cellular oxidative burst, protein, nucleic acids and DNA synthesis), determination of the parasite survival both in in vivo and in vitro models, antigenicity and immunogenicity after the process, cellular invasion and irradiated tachyzoite induced protection. After definition of 200 Gy of 60 Co irradiation as the lower radiation dose that suppress parasite growth in vitro and in vivo, we found no detectable changes in parasite viability, its cell invasion capacity or in its structural proteins. DNA fragmentation like apoptosis or alterations of the parasite metabolism were similarly not affected by radiation. Mice infection with irradiated parasites induce partial protection when these animals were re-inoculated with non irradiated virulent parasites, inducing greater specific IgG levels as well as a longer survival. Irradiated T.gondii maintains its the ability of invasion, even under radiation effects. Based on our results we conclude that

  19. Progression of pathogenic events in cynomolgus macaques infected with variola virus.

    Directory of Open Access Journals (Sweden)

    Victoria Wahl-Jensen

    Full Text Available Smallpox, caused by variola virus (VARV, is a devastating human disease that affected millions worldwide until the virus was eradicated in the 1970 s. Subsequent cessation of vaccination has resulted in an immunologically naive human population that would be at risk should VARV be used as an agent of bioterrorism. The development of antivirals and improved vaccines to counter this threat would be facilitated by the development of animal models using authentic VARV. Towards this end, cynomolgus macaques were identified as adequate hosts for VARV, developing ordinary or hemorrhagic smallpox in a dose-dependent fashion. To further refine this model, we performed a serial sampling study on macaques exposed to doses of VARV strain Harper calibrated to induce ordinary or hemorrhagic disease. Several key differences were noted between these models. In the ordinary smallpox model, lymphoid and myeloid hyperplasias were consistently found whereas lymphocytolysis and hematopoietic necrosis developed in hemorrhagic smallpox. Viral antigen accumulation, as assessed immunohistochemically, was mild and transient in the ordinary smallpox model. In contrast, in the hemorrhagic model antigen distribution was widespread and included tissues and cells not involved in the ordinary model. Hemorrhagic smallpox developed only in the presence of secondary bacterial infections - an observation also commonly noted in historical reports of human smallpox. Together, our results support the macaque model as an excellent surrogate for human smallpox in terms of disease onset, acute disease course, and gross and histopathological lesions.

  20. Appendectomy as a Risk Factor for Bacteremic Biliary Tract Infection Caused by Antibiotic-Resistant Pathogens

    Directory of Open Access Journals (Sweden)

    Koki Kawanishi

    2017-01-01

    Full Text Available Background/Aims. Recent evidence has suggested that appendix plays a pivotal role in the development and preservation of intestinal immune system. The aim of this study is to examine whether prior appendectomy is associated with an increased risk for the development of antibiotic-resistant bacteria in bacteremia from biliary tract infection (BTI. Methods. Charts from 174 consecutive cases of bacteremia derived from BTI were retrospectively reviewed. Using multivariate analysis, independent risk factors for development of antibiotic-resistant bacteria were identified among the clinical parameters, including a history of appendectomy. Results. In total, 221 bacteria strains were identified from 174 BTI events. Of those, 42 antibiotic-resistant bacteria were identified in 34 patients. Multivariate analysis revealed that prior appendectomy (Odds ratio (OR, 3.02; 95% confidence interval (CI, 1.15–7.87; p=0.026, antibiotic use within the preceding three months (OR, 3.06; 95% CI, 1.26–7.64; p=0.013, and bilioenteric anastomosis or sphincterotomy (OR, 3.77; 95% CI, 1.51–9.66; p=0.0046 were independent risk factors for antibiotic-resistant bacteria. Conclusions. Prior appendectomy was an independent risk factor for the development of antibiotic-resistant bacteria in bacteremia from BTI.

  1. Comparative genome analysis of Prevotella intermedia strain isolated from infected root canal reveals features related to pathogenicity and adaptation.

    Science.gov (United States)

    Ruan, Yunfeng; Shen, Lu; Zou, Yan; Qi, Zhengnan; Yin, Jun; Jiang, Jie; Guo, Liang; He, Lin; Chen, Zijiang; Tang, Zisheng; Qin, Shengying

    2015-02-25

    Many species of the genus Prevotella are pathogens that cause oral diseases. Prevotella intermedia is known to cause various oral disorders e.g. periodontal disease, periapical periodontitis and noma as well as colonize in the respiratory tract and be associated with cystic fibrosis and chronic bronchitis. It is of clinical significance to identify the main drive of its various adaptation and pathogenicity. In order to explore the intra-species genetic differences among strains of Prevotella intermedia of different niches, we isolated a strain Prevotella intermedia ZT from the infected root canal of a Chinese patient with periapical periodontitis and gained a draft genome sequence. We annotated the genome and compared it with the genomes of other taxa in the genus Prevotella. The raw data set, consisting of approximately 65X-coverage reads, was trimmed and assembled into contigs from which 2165 ORFs were predicted. The comparison of the Prevotella intermedia ZT genome sequence with the published genome sequence of Prevotella intermedia 17 and Prevotella intermedia ATCC25611 revealed that ~14% of the genes were strain-specific. The Preveotella intermedia strains share a set of conserved genes contributing to its adaptation and pathogenic and possess strain-specific genes especially those involved in adhesion and secreting bacteriocin. The Prevotella intermedia ZT shares similar gene content with other taxa of genus Prevotella. The genomes of the genus Prevotella is highly dynamic with relative conserved parts: on average, about half of the genes in one Prevotella genome were not included in another genome of the different Prevotella species. The degree of conservation varied with different pathways: the ability of amino acid biosynthesis varied greatly with species but the pathway of cell wall components biosynthesis were nearly constant. Phylogenetic tree shows that the taxa from different niches are scarcely distributed among clades. Prevotella intermedia ZT

  2. The Road to Infection: Host-Microbe Interactions Defining the Pathogenicity of Streptococcus bovis/Streptococcus equinus Complex Members

    Directory of Open Access Journals (Sweden)

    Christoph Jans

    2018-04-01

    Full Text Available The Streptococcus bovis/Streptococcus equinus complex (SBSEC comprises several species inhabiting the animal and human gastrointestinal tract (GIT. They match the pathobiont description, are potential zoonotic agents and technological organisms in fermented foods. SBSEC members are associated with multiple diseases in humans and animals including ruminal acidosis, infective endocarditis (IE and colorectal cancer (CRC. Therefore, this review aims to re-evaluate adhesion and colonization abilities of SBSEC members of animal, human and food origin paired with genomic and functional host-microbe interaction data on their road from colonization to infection. SBSEC seem to be a marginal population during GIT symbiosis that can proliferate as opportunistic pathogens. Risk factors for human colonization are considered living in rural areas and animal-feces contact. Niche adaptation plays a pivotal role where Streptococcus gallolyticus subsp. gallolyticus (SGG retained the ability to proliferate in various environments. Other SBSEC members have undergone genome reduction and niche-specific gene gain to yield important commensal, pathobiont and technological species. Selective colonization of CRC tissue is suggested for SGG, possibly related to increased adhesion to cancerous cell types featuring enhanced collagen IV accessibility. SGG can colonize, proliferate and may shape the tumor microenvironment to their benefit by tumor promotion upon initial neoplasia development. Bacteria cell surface structures including lipotheichoic acids, capsular polysaccharides and pilus loci (pil1, pil2, and pil3 govern adhesion. Only human blood-derived SGG contain complete pilus loci and other disease-associated surface proteins. Rumen or feces-derived SGG and other SBSEC members lack or harbor mutated pili. Pili also contribute to binding to fibrinogen upon invasion and translocation of cells from the GIT into the blood system, subsequent immune evasion, human contact

  3. The Road to Infection: Host-Microbe Interactions Defining the Pathogenicity of Streptococcus bovis/Streptococcus equinus Complex Members

    Science.gov (United States)

    Jans, Christoph; Boleij, Annemarie

    2018-01-01

    The Streptococcus bovis/Streptococcus equinus complex (SBSEC) comprises several species inhabiting the animal and human gastrointestinal tract (GIT). They match the pathobiont description, are potential zoonotic agents and technological organisms in fermented foods. SBSEC members are associated with multiple diseases in humans and animals including ruminal acidosis, infective endocarditis (IE) and colorectal cancer (CRC). Therefore, this review aims to re-evaluate adhesion and colonization abilities of SBSEC members of animal, human and food origin paired with genomic and functional host-microbe interaction data on their road from colonization to infection. SBSEC seem to be a marginal population during GIT symbiosis that can proliferate as opportunistic pathogens. Risk factors for human colonization are considered living in rural areas and animal-feces contact. Niche adaptation plays a pivotal role where Streptococcus gallolyticus subsp. gallolyticus (SGG) retained the ability to proliferate in various environments. Other SBSEC members have undergone genome reduction and niche-specific gene gain to yield important commensal, pathobiont and technological species. Selective colonization of CRC tissue is suggested for SGG, possibly related to increased adhesion to cancerous cell types featuring enhanced collagen IV accessibility. SGG can colonize, proliferate and may shape the tumor microenvironment to their benefit by tumor promotion upon initial neoplasia development. Bacteria cell surface structures including lipotheichoic acids, capsular polysaccharides and pilus loci (pil1, pil2, and pil3) govern adhesion. Only human blood-derived SGG contain complete pilus loci and other disease-associated surface proteins. Rumen or feces-derived SGG and other SBSEC members lack or harbor mutated pili. Pili also contribute to binding to fibrinogen upon invasion and translocation of cells from the GIT into the blood system, subsequent immune evasion, human contact system

  4. Investigation of the antibiotic susceptibility patterns of pathogens causing nosocomial infections

    International Nuclear Information System (INIS)

    Yaman, Akgun; Kibar, Filiz; Buyukcelik, Ozlem; Tasova, Yesim; Inal, A.S.; Saltoglu, Nese; Kurtaran, Behice; Dundal, Ismail H.

    2004-01-01

    The aim of this study is to determine the resistance patterns of bacteria causing nosocomial infections. The outcome of this resistance was followed for 3 years. This study was carried out during 2000 to 2002 at a university hospital in Turkey. The resistance patterns of 570 bacteria (390 Gram-negative, 180 Gram-positive) against meropenem, imipenem, ceftazidime, cefotaxime, cefepime, piperacillin/tazobactam, ciprofloxacin and tobramycin were investigated using the E-test. Extended-spectrum beta-lactamase (ESBL) production was determined using ceftazidime and ceftazidime/clavulanic acid E-test strips. Meropenem was the most effective antibiotic against Gram-negative organisms (89.0%); this was followed by imipenem (87.2%) and piperacillin/tazobactam (66.4%). The most active antibiotic against Gram-positive bacteria was imipenem (87.2%) and this was followed by piperacillin/tazobactam (81.7%) and meropenem (77.8%). The rates of production of ESBL by Escherichia coli were 20.9%, Klebsiella pneumoniae 50% and Serratia marcescens were 46.7%. Extended-spectrum beta-lactamase production increased each year (21.7%, 22.1% and 45.5%). All of the ESBL producing isolates were sensitive to meropenem and 98.5% sensitive to imipenem. AmpC beta-lactamase was produced by 20.9% of the Enterobacter species spp, Citrobacter spp. and Serratia marcescens. All of these were sensitive to meropenem and 77.8% to imipenem and ciprofloxacin. Multi-drug resistance rates in Acinetobacter spp were 45.4% and 37.7% in Pseudomonas aeruginosa isolates. As in the entire world, resistance to antibiotics is a serious problem in our country. Solving of this problem depends primarily on prevention of the development of resistance. (author)

  5. Experimental co-infections of domestic ducks with a virulent Newcastle disease virus and low or highly pathogenic avian influenza viruses.

    Science.gov (United States)

    Pantin-Jackwood, Mary J; Costa-Hurtado, Mar; Miller, Patti J; Afonso, Claudio L; Spackman, Erica; Kapczynski, Darrell R; Shepherd, Eric; Smith, Diane; Swayne, David E

    2015-05-15

    Infections with avian influenza viruses (AIV) of low and high pathogenicity (LP and HP) and Newcastle disease virus (NDV) are commonly reported in domestic ducks in many parts of the world. However, it is not clear if co-infections with these viruses affect the severity of the diseases they produce, the amount of virus shed, and transmission of the viruses. In this study we infected domestic ducks with a virulent NDV virus (vNDV) and either a LPAIV or a HPAIV by giving the viruses individually, simultaneously, or sequentially two days apart. No clinical signs were observed in ducks infected or co-infected with vNDV and LPAIV, but co-infection decreased the number of ducks shedding vNDV and the amount of virus shed (Pducks inoculated with only LPAIV compared to ducks co-infected with vNDV. Ducks that received the HPAIV with the vNDV simultaneously survived fewer days (Pducks that received the vNDV two days before the HPAIV. Co-infection also reduced transmission of vNDV to naïve contact ducks housed with the inoculated ducks. In conclusion, domestic ducks can become co-infected with vNDV and LPAIV with no effect on clinical signs but with reduction of virus shedding and transmission. These findings indicate that infection with one virus can interfere with replication of another, modifying the pathogenesis and transmission of the viruses. Published by Elsevier B.V.

  6. Effect of perioperative mupirocin and antiseptic body wash on infection rate and causative pathogens in patients undergoing cardiac surgery.

    Science.gov (United States)

    Kohler, Philipp; Sommerstein, Rami; Schönrath, Felix; Ajdler-Schäffler, Evelyne; Anagnostopoulos, Alexia; Tschirky, Sandra; Falk, Volkmar; Kuster, Stefan P; Sax, Hugo

    2015-07-01

    Preoperative nasal mupirocin has been shown to reduce surgical site infections (SSIs) in patients undergoing cardiac surgery. We analyzed the effect of mupirocin plus antiseptic body wash on SSI rate and etiology. Prospective SSI surveillance was done for patients undergoing cardiac surgery before and after implementation of mupirocin nasal ointment and chlorhexidine/octenidine body wash. Overall SSI rate was 8.6% (81 out of 945) for the control and 6.9% (58 out of 842) for the intervention cohort (P = .19). In multivariable analysis, the study protocol was associated with an odds ratio of 0.61 (95% confidence interval, 0.41-0.91; P = .015) with regard to any SSI. This effect was exclusively due to a reduction in superficial SSIs and was observed both in patients with preoperative and postoperative treatment initiation. Coagulase-negative staphylococci (CoNS), the most commonly isolated pathogen, were found in 37% and 48% (P = .19) of patients in the control and the intervention cohort, respectively. CoNS were methicillin resistant in 69% of cases. Mupirocin and antiseptic body wash reduced the rate of superficial but not deep or organ/space SSIs. Postoperative patient treatment may be critical in reducing the risk for superficial SSI, presumably due to a reduction of bacterial skin load. A high proportion of SSI was due to methicillin-resistant CoNS and thus not covered by routine perioperative antimicrobial prophylaxis. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  7. A Metaproteomics Approach to Elucidate Host and Pathogen Protein Expression during Catheter-Associated Urinary Tract Infections (CAUTIs)

    Science.gov (United States)

    Lassek, Christian; Burghartz, Melanie; Chaves-Moreno, Diego; Otto, Andreas; Hentschker, Christian; Fuchs, Stephan; Bernhardt, Jörg; Jauregui, Ruy; Neubauer, Rüdiger; Becher, Dörte; Pieper, Dietmar H.; Jahn, Martina; Jahn, Dieter; Riedel, Katharina

    2015-01-01

    Long-term catheterization inevitably leads to a catheter-associated bacteriuria caused by multispecies bacterial biofilms growing on and in the catheters. The overall goal of the presented study was (1) to unravel bacterial community structure and function of such a uropathogenic biofilm and (2) to elucidate the interplay between bacterial virulence and the human immune system within the urine. To this end, a metaproteomics approach combined with in vitro proteomics analyses was employed to investigate both, the pro- and eukaryotic protein inventory. Our proteome analyses demonstrated that the biofilm of the investigated catheter is dominated by three bacterial species, that is, Pseudomonas aeruginosa, Morganella morganii, and Bacteroides sp., and identified iron limitation as one of the major challenges in the bladder environment. In vitro proteome analysis of P. aeruginosa and M. morganii isolated from the biofilm revealed that these opportunistic pathogens are able to overcome iron restriction via the production of siderophores and high expression of corresponding receptors. Notably, a comparison of in vivo and in vitro protein profiles of P. aeruginosa and M. morganii also indicated that the bacteria employ different strategies to adapt to the urinary tract. Although P. aeruginosa seems to express secreted and surface-exposed proteases to escape the human innate immune system and metabolizes amino acids, M. morganii is able to take up sugars and to degrade urea. Most interestingly, a comparison of urine protein profiles of three long-term catheterized patients and three healthy control persons demonstrated the elevated level of proteins associated with neutrophils, macrophages, and the complement system in the patient's urine, which might point to a specific activation of the innate immune system in response to biofilm-associated urinary tract infections. We thus hypothesize that the often asymptomatic nature of catheter-associated urinary tract infections

  8. Changing epidemiology of central venous catheter-related bloodstream infections: increasing prevalence of Gram-negative pathogens.

    Science.gov (United States)

    Marcos, Miguel; Soriano, Alex; Iñurrieta, Amaia; Martínez, José A; Romero, Alberto; Cobos, Nazaret; Hernández, Cristina; Almela, Manel; Marco, Francesc; Mensa, Josep

    2011-09-01

    Gram-positive microorganisms have been the predominant pathogens in central venous catheter-related bloodstream infections (CRBSIs). Recent guidelines recommend empirical therapy according to this and restrict coverage for Gram-negatives to specific circumstances. This study aimed to analyse the epidemiological changes in CRBSIs over the 1991-2008 period and to analyse predictors of Gram-negative CRBSIs. A prospectively collected cohort of patients with confirmed CRBSIs was analysed. Strains isolated and antimicrobial susceptibility, as well as clinical and demographic variables were recorded. Differences observed during the study period were analysed by means of a χ² trend test and factors associated with Gram-negative CRBSIs by means of multivariable analysis. Between 1991 and 2008, 1129 episodes of monomicrobial CRBSIs were recorded. There was an increase in the incidence of CRBSIs, from 0.10 (1991-92) to 0.31 (2007-08) episodes/1000 patient-days. A significant increase in the number of Gram-negative strains among the total isolates was also found, from 3 (4.7%) in 1991-92 to 70 (40.23%) in 2007-08, with a parallel decrease in the percentage of Gram-positives. Solid organ transplantation, prior use of penicillins and hospital stay longer than 11 days were independently associated with a significantly higher risk of Gram-negative CRBSIs, while cirrhosis, diabetes and use of quinolones were associated with a higher risk of Gram-positives. Gram-negative strains are an increasing cause of CRBSIs, reaching a prevalence of 40% in the 2007-08 period in our hospital. If this trend is confirmed in other centres, a broad-spectrum empirical therapy should be considered in managing these infections.

  9. Remarkable sequence similarity between the dinoflagellate-infecting marine girus and the terrestrial pathogen African swine fever virus

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2009-10-01

    Full Text Available Abstract Heterocapsa circularisquama DNA virus (HcDNAV; previously designated as HcV is a giant virus (girus with a ~356-kbp double-stranded DNA (dsDNA genome. HcDNAV lytically infects the bivalve-killing marine dinoflagellate H. circularisquama, and currently represents the sole DNA virus isolated from dinoflagellates, one of the most abundant protists in marine ecosystems. Its morphological features, genome type, and host range previously suggested that HcDNAV might be a member of the family Phycodnaviridae of Nucleo-Cytoplasmic Large DNA Viruses (NCLDVs, though no supporting sequence data was available. NCLDVs currently include two families found in aquatic environments (Phycodnaviridae, Mimiviridae, one mostly infecting terrestrial animals (Poxviridae, another isolated from fish, amphibians and insects (Iridoviridae, and the last one (Asfarviridae exclusively represented by the animal pathogen African swine fever virus (ASFV, the agent of a fatal hemorrhagic disease in domestic swine. In this study, we determined the complete sequence of the type B DNA polymerase (PolB gene of HcDNAV. The viral PolB was transcribed at least from 6 h post inoculation (hpi, suggesting its crucial function for viral replication. Most unexpectedly, the HcDNAV PolB sequence was found to be closely related to the PolB sequence of ASFV. In addition, the amino acid sequence of HcDNAV PolB showed a rare amino acid substitution within a motif containing highly conserved motif: YSDTDS was found in HcDNAV PolB instead of YGDTDS in most dsDNA viruses. Together with the previous observation of ASFV-like sequences in the Sorcerer II Global Ocean Sampling metagenomic datasets, our results further reinforce the ideas that the terrestrial ASFV has its evolutionary origin in marine environments.

  10. A prebiotic role of Ecklonia cava improves the mortality of Edwardsiella tarda-infected zebrafish models via regulating the growth of lactic acid bacteria and pathogen bacteria.

    Science.gov (United States)

    Lee, WonWoo; Oh, Jae Young; Kim, Eun-A; Kang, Nalae; Kim, Kil-Nam; Ahn, Ginnae; Jeon, You-Jin

    2016-07-01

    In this study, the beneficial prebiotic roles of Ecklonia cava (E. cava, EC) were evaluated on the growth of lactic acid bacteria (LAB) and pathogen bacteria and the mortality of pathogen-bacteria infected zebrafish model. The result showed that the original E. cava (EC) led to the highest growth effects on three LABs (Lactobacillus brevis, L. brevis; Lactobacillus pentosus, L. pentosus; Lactobacillus plantarum; L. plantarum) and it was dose-dependent manners. Also, EC, its Celluclast enzymatic (ECC) and 100% ethanol extracts (ECE) showed the anti-bacterial activities on the fish pathogenic bacteria such as (Edwardsiella tarda; E. tarda, Streptococcus iniae; S. iniae, and Vibrio harveyi; V. harveyi). Interestingly, EC induced the higher production of the secondary metabolites from L. plantarum in MRS medium. The secondary metabolites produced by EC significantly inhibited the growth of pathogen bacteria. In further in vivo study, the co-treatment of EC and L. plantarum improved the growth and mortality of E. tarda-infected zebrafish as regulating the expression of inflammatory molecules such as iNOS and COX2. Taken together, our present study suggests that the EC plays an important role as a potential prebiotic and has a protective effect against the infection caused by E. tarda injection in zebrafish. Also, our conclusion from this evidence is that EC can be used and applied as a useful prebiotic. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Resistance among Gram-negative ESKAPE pathogens isolated from hospitalized patients with intra-abdominal and urinary tract infections in Latin American countries: SMART 2013–2015

    Directory of Open Access Journals (Sweden)

    James A. Karlowsky

    2017-05-01

    Full Text Available Gram-negative ESKAPE pathogens (Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species are important etiologic agents of nosocomial infection that are frequently resistant to broad-spectrum antimicrobial agents. Gram-negative ESKAPE pathogens were collected from hospitalized patients in 11 Latin American countries from 2013 to 2015 as part of the Study for Monitoring Antimicrobial Resistance Trends (SMART global surveillance program. In total, 2113 isolates from intra-abdominal infections (IAI and 970 isolates from urinary tract infections (UTI were tested against antimicrobial agents using standardized CLSI broth microdilution methodology. Of the agents tested, amikacin demonstrated the highest rates of susceptibility (% for K. pneumoniae (92.2, 92.3, Enterobacter spp. (97.5, 92.1, and P. aeruginosa (85.3, 75.2 isolates from both IAI and UTI, respectively. Ertapenem (68.5, 62.6 and imipenem (79.2, 75.9 showed substantially higher rates of susceptibility (% than other β-lactams, including piperacillin-tazobactam (35.9, 37.4 against ESBL-positive isolates of K. pneumoniae from IAI and UTI, respectively. Rates of susceptibility to all agents tested against A. baumannii were ≤30.9%. Gram-negative ESKAPE pathogens isolated from Latin America demonstrated compromised in vitro susceptibility to commonly prescribed broad-spectrum, parenteral antimicrobial agents. Continued surveillance is warranted. New antimicrobial agents with potent activity against Gram-negative ESKAPE pathogens are urgently needed.

  12. Protection of mice against lethal infection with highly pathogenic H7N7 influenza A virus by using a recombinant low-pathogenicity vaccine strain.

    NARCIS (Netherlands)

    V.J. Munster (Vincent); M.I. Spronken (Monique); T.M. Bestebroer (Theo); C. Baas (Chantal); W.E.Ph. Beyer (Walter); G.F. Rimmelzwaan (Guus); A.D.M.E. Osterhaus (Albert); R.A.M. Fouchier (Ron); E. de Wit (Emmie)

    2005-01-01

    textabstractIn 2003, an outbreak of highly pathogenic avian influenza occurred in The Netherlands. The avian H7N7 virus causing the outbreak was also detected in 88 humans suffering from conjunctivitis or mild respiratory symptoms and one person who died of pneumonia and acute respiratory distress

  13. [Anti-infective defence strategies and methods of escape from entomologic pathogens under immunologic control of insects].

    Science.gov (United States)

    Jarosz, J

    1996-01-01

    Insect immunity comprises a complex of several distinct systems, both haemocytic and humoral in nature, that cooperate together in a more or less coordinated way to provide protection of the body cavity from invading microorganisms. Insects can respond to infections by a selective synthesis of haemolymph immune proteins that are responsible for antibacterial immunity. Antibacterial activity of insect blood is attributable to innate compounds such as lysozome, and to induced polypeptides or small basic proteins absent in non-immunized insects. The cecropins and attacins in Lepidoptera, and diptericins in Diptera are the inducible antibacterial immune proteins well defined biochemically. Bacterial pathogens and some parasites of insects, preferably entomogenous rhabditid nematodes, have developed the mechanism by which they may counteract insect immunity. This phenomenon is realized either by escaping immune reactions or by degrading antimicrobial factors of haemolymph in an active process. Passive resistance of parasites to insect immunity is a result of a strong evolutionary pressure on parasites to develop mechanisms to escape insect immune reactions or to minimize their effectiveness through changes in the parasite itself. Active resistance to the insect non-self response system involves a partial or total destruction of immune proteins by extracellular proteinases released during parasitism.

  14. Human infection with a highly pathogenic avian influenza A (H5N6) virus in Yunnan province, China.

    Science.gov (United States)

    Xu, Wen; Li, Hong; Jiang, Li

    2016-01-01

    Highly pathogenic avian influenza A H5N6 virus has caused four human infections in China. This study reports the preliminary findings of the first known human case of H5N6 in Yunnan province. The patient initially developed symptoms of sore throat and coughing on 27 January 2015. The disease rapidly progressed to severe pneumonia, multiple organ dysfunctions and acute respiratory distress syndrome and the patient died on 6 February. Virological analysis determined that the virus belonged to H5 clade 2.3.4.4 and it has obtained partial ability for mammalian adaptation and amantadine resistance. Environmental investigation found H5 in 63% of the samples including poultry faeces, tissues, cage surface swabs and sewage from local live poultry markets by real-time RT-PCR. These findings suggest that the expanding and enhancing of surveillance in both avian and humans are necessary to monitor the evolution of H5 influenza virus and to facilitate early detection of suspected cases.

  15. Seminal fluid of honeybees contains multiple mechanisms to combat infections of the sexually transmitted pathogen Nosema apis.

    Science.gov (United States)

    Peng, Yan; Grassl, Julia; Millar, A Harvey; Baer, Boris

    2016-01-27

    The societies of ants, bees and wasps are genetically closed systems where queens only mate during a brief mating episode prior to their eusocial life and males therefore provide queens with a lifetime supply of high-quality sperm. These ejaculates also contain a number of defence proteins that have been detected in the seminal fluid but their function and efficiency have never been investigated in great detail. Here, we used the honeybee Apis mellifera and quantified whether seminal fluid is able to combat infections of the fungal pathogen Nosema apis, a widespread honeybee parasite that is also sexually transmitted. We provide the first empirical evidence that seminal fluid has a remarkable antimicrobial activity against N. apis spores and that antimicrobial seminal fluid components kill spores in multiple ways. The protein fraction of seminal fluid induces extracellular spore germination, which disrupts the life cycle of N. apis, whereas the non-protein fraction of seminal fluid induces a direct viability loss of intact spores. We conclude that males provide their ejaculates with efficient antimicrobial molecules that are able to kill N. apis spores and thereby reduce the risk of disease transmission during mating. Our findings could be of broader significance to master honeybee diseases in managed honeybee stock in the future. © 2016 The Author(s).

  16. Device-associated infections among neonatal intensive care unit patients: incidence and associated pathogens reported to the National Healthcare Safety Network, 2006-2008.

    Science.gov (United States)

    Hocevar, Susan N; Edwards, Jonathan R; Horan, Teresa C; Morrell, Gloria C; Iwamoto, Martha; Lessa, Fernanda C

    2012-12-01

    To describe rates and pathogen distribution of device-associated infections (DAIs) in neonatal intensive care unit (NICU) patients and compare differences in infection rates by hospital type (children's vs general hospitals). Neonates in NICUs participating in the National Healthcare Safety Network from 2006 through 2008. We analyzed central line-associated bloodstream infections (CLABSIs), umbilical catheter-associated bloodstream infections (UCABs), and ventilator-associated pneumonia (VAP) among 304 NICUs. Differences in pooled mean incidence rates were examined using Poisson regression; nonparametric tests for comparing medians and rate distributions were used. Pooled mean incidence rates by birth weight category (750 g or less, 751-1,000 g, 1,001-1,500 g, 1,501-2,500 g, and more than 2,500 g, respectively) were 3.94, 3.09, 2.25, 1.90, and 1.60 for CLABSI; 4.52, 2.77, 1.70, 0.91, and 0.92 for UCAB; and 2.36, 2.08, 1.28, 0.86, and 0.72 for VAP. When rates of infection between hospital types were compared, only pooled mean VAP rates were significantly lower in children's hospitals than in general hospitals among neonates weighing 1,000 g or less; no significant differences in medians or rate distributions were noted. Pathogen frequencies were coagulase-negative staphylococci (28%), Staphylococcus aureus (19%), and Candida species (13%) for bloodstream infections and Pseudomonas species (16%), S. aureus (15%), and Klebsiella species (14%) for VAP. Of 673 S. aureus isolates with susceptibility results, 33% were methicillin resistant. Neonates weighing 750 g or less had the highest DAI incidence. With the exception of VAP, pooled mean NICU incidence rates did not differ between children's and general hospitals. Pathogens associated with these infections can pose treatment challenges; continued efforts at prevention need to be applied to all NICU settings.

  17. Meta-analysis of the effects of insect vector saliva on host immune responses and infection of vector-transmitted pathogens: a focus on leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Brittany Ockenfels

    2014-10-01

    Full Text Available A meta-analysis of the effects of vector saliva on the immune response and progression of vector-transmitted disease, specifically with regard to pathology, infection level, and host cytokine levels was conducted. Infection in the absence or presence of saliva in naïve mice was compared. In addition, infection in mice pre-exposed to uninfected vector saliva was compared to infection in unexposed mice. To control for differences in vector and pathogen species, mouse strain, and experimental design, a random effects model was used to compare the ratio of the natural log of the experimental to the control means of the studies. Saliva was demonstrated to enhance pathology, infection level, and the production of Th2 cytokines (IL-4 and IL-10 in naïve mice. This effect was observed across vector/pathogen pairings, whether natural or unnatural, and with single salivary proteins used as a proxy for whole saliva. Saliva pre-exposure was determined to result in less severe leishmaniasis pathology when compared with unexposed mice infected either in the presence or absence of sand fly saliva. The results of further analyses were not significant, but demonstrated trends toward protection and IFN-γ elevation for pre-exposed mice.

  18. Experimental infection with highly pathogenic H5N8 avian influenza viruses in the Mandarin duck (Aix galericulata) and domestic pigeon (Columba livia domestica).

    Science.gov (United States)

    Kwon, Jung-Hoon; Noh, Yun Kyung; Lee, Dong-Hun; Yuk, Seong-Su; Erdene-Ochir, Tseren-Ochir; Noh, Jin-Yong; Hong, Woo-Tack; Jeong, Jei-Hyun; Jeong, Sol; Gwon, Gyeong-Bin; Song, Chang-Seon; Nahm, Sang-Soep

    2017-05-01

    Wild birds play a major role in the evolution, maintenance, and dissemination of highly pathogenic avian influenza viruses (HPAIV). Sub-clinical infection with HPAI in resident wild birds could be a source of dissemination of HPAIV and continuous outbreaks. In this study, the pathogenicity and infectivity of two strains of H5N8 clade 2.3.4.4 virus were evaluated in the Mandarin duck (Aix galericulata) and domestic pigeon (Columba livia domestica). None of the birds experimentally infected with H5N8 viruses showed clinical signs or mortality. The H5N8 viruses efficiently replicated in the virus-inoculated Mandarin ducks and transmitted to co-housed Mandarin ducks. Although relatively high levels of viral shedding were noted in pigeons, viral shedding was not detected in some of the pigeons and the shedding period was relatively short. Furthermore, the infection was not transmitted to co-housed pigeons. Immunohistochemical examination revealed the presence of HPAIV in multiple organs of the infected birds. Histopathological evaluation showed the presence of inflammatory responses primarily in HPAIV-positive organs. Our results indicate that Mandarin ducks and pigeons can be infected with H5N8 HPAIV without exhibiting clinical signs; thus, they may be potential healthy reservoirs of the H5N8 HPAIV. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Meta-analysis of the effects of insect vector saliva on host immune responses and infection of vector-transmitted pathogens: a focus on leishmaniasis.

    Science.gov (United States)

    Ockenfels, Brittany; Michael, Edwin; McDowell, Mary Ann

    2014-10-01

    A meta-analysis of the effects of vector saliva on the immune response and progression of vector-transmitted disease, specifically with regard to pathology, infection level, and host cytokine levels was conducted. Infection in the absence or presence of saliva in naïve mice was compared. In addition, infection in mice pre-exposed to uninfected vector saliva was compared to infection in unexposed mice. To control for differences in vector and pathogen species, mouse strain, and experimental design, a random effects model was used to compare the ratio of the natural log of the experimental to the control means of the studies. Saliva was demonstrated to enhance pathology, infection level, and the production of Th2 cytokines (IL-4 and IL-10) in naïve mice. This effect was observed across vector/pathogen pairings, whether natural or unnatural, and with single salivary proteins used as a proxy for whole saliva. Saliva pre-exposure was determined to result in less severe leishmaniasis pathology when compared with unexposed mice infected either in the presence or absence of sand fly saliva. The results of further analyses were not significant, but demonstrated trends toward protection and IFN-γ elevation for pre-exposed mice.

  20. Cross-modulation of pathogen-specific pathways enhances malnutrition during enteric co-infection with Giardia lamblia and enteroaggregative Escherichia coli.

    Science.gov (United States)

    Bartelt, Luther A; Bolick, David T; Mayneris-Perxachs, Jordi; Kolling, Glynis L; Medlock, Gregory L; Zaenker, Edna I; Donowitz, Jeffery; Thomas-Beckett, Rose Viguna; Rogala, Allison; Carroll, Ian M; Singer, Steven M; Papin, Jason; Swann, Jonathan R; Guerrant, Richard L

    2017-07-01

    Diverse enteropathogen exposures associate with childhood malnutrition. To elucidate mechanistic pathways whereby enteric microbes interact during malnutrition, we used protein deficiency in mice to develop a new model of co-enteropathogen enteropathy. Focusing on common enteropathogens in malnourished children, Giardia lamblia and enteroaggregative Escherichia coli (EAEC), we provide new insights into intersecting pathogen-specific mechanisms that enhance malnutrition. We show for the first time that during protein malnutrition, the intestinal microbiota permits persistent Giardia colonization and simultaneously contributes to growth impairment. Despite signals of intestinal injury, such as IL1α, Giardia-infected mice lack pro-inflammatory intestinal responses, similar to endemic pediatric Giardia infections. Rather, Giardia perturbs microbial host co-metabolites of proteolysis during growth impairment, whereas host nicotinamide utilization adaptations that correspond with growth recovery increase. EAEC promotes intestinal inflammation and markers of myeloid cell activation. During co-infection, intestinal inflammatory signaling and cellular recruitment responses to EAEC are preserved together with a Giardia-mediated diminishment in myeloid cell activation. Conversely, EAEC extinguishes markers of host energy expenditure regulatory responses to Giardia, as host metabolic adaptations appear exhausted. Integrating immunologic and metabolic profiles during co-pathogen infection and malnutrition, we develop a working mechanistic model of how cumulative diet-induced and pathogen-triggered microbial perturbations result in an increasingly wasted host.

  1. Association of serum Clara cell protein CC16 with respiratory infections and immune response to respiratory pathogens in elite athletes.

    Science.gov (United States)

    Kurowski, Marcin; Jurczyk, Janusz; Jarzębska, Marzanna; Moskwa, Sylwia; Makowska, Joanna S; Krysztofiak, Hubert; Kowalski, Marek L

    2014-04-15

    Respiratory epithelium integrity impairment caused by intensive exercise may lead to exercise-induced bronchoconstriction. Clara cell protein (CC16) has anti-inflammatory properties and its serum level reflects changes in epithelium integrity and airway inflammation. This study aimed to investigate serum CC16 in elite athletes and to seek associations of CC16 with asthma or allergy, respiratory tract infections (RTIs) and immune response to respiratory pathogens. The study was performed in 203 Olympic athletes. Control groups comprised 53 healthy subjects and 49 mild allergic asthmatics. Serum levels of CC16 and IgG against respiratory viruses and Mycoplasma pneumoniae were assessed. Allergy questionnaire for athletes was used to determine symptoms and exercise pattern. Current versions of ARIA and GINA guidelines were used when diagnosing allergic rhinitis and asthma, respectively. Asthma was diagnosed in 13.3% athletes, of whom 55.6% had concomitant allergic rhinitis. Allergic rhinitis without asthma was diagnosed in 14.8% of athletes. Mean CC16 concentration was significantly lower in athletes versus healthy controls and mild asthmatics. Athletes reporting frequent RTIs had significantly lower serum CC16 and the risk of frequent RTIs was more than 2-fold higher in athletes with low serum CC16 (defined as equal to or less than 4.99 ng/ml). Athletes had significantly higher anti-adenovirus IgG than healthy controls while only non-atopic athletes had anti-parainfluenza virus IgG significantly lower than controls. In all athletes weak correlation of serum CC16 and anti-parainfluenza virus IgG was present (R = 0.20, p athletes a weak positive correlations of CC16 with IgG specific for respiratory syncytial virus (R = 0.29, p = 0.009), parainfluenza virus (R = 0.31, p = 0.01) and adenovirus (R = 0.27, p = 0.02) were seen as well. Regular high-load exercise is associated with decrease in serum CC16 levels. Athletes with decreased CC16 are

  2. Pathogen intelligence

    Directory of Open Access Journals (Sweden)

    Michael eSteinert

    2014-01-01

    Full Text Available Different species inhabit different sensory worlds and thus have evolved diverse means of processing information, learning and memory. In the escalated arms race with host defense, each pathogenic bacterium not only has evolved its individual cellular sensing and behaviour, but also collective sensing, interbacterial communication, distributed information processing, joint decision making, dissociative behaviour, and the phenotypic and genotypic heterogeneity necessary for epidemiologic success. Moreover, pathogenic populations take advantage of dormancy strategies and rapid evolutionary speed, which allow them to save co-generated intelligent traits in a collective genomic memory. This review discusses how these mechanisms add further levels of complexity to bacterial pathogenicity and transmission, and how mining for these mechanisms could help to develop new anti-infective strategies.

  3. Regulation of stomatal tropism and infection by light in Cercospora zeae-maydis: evidence for coordinated host/pathogen responses to photoperiod?

    OpenAIRE

    Hun Kim; John B Ridenour; Larry D Dunkle; Burton H Bluhm

    2011-01-01

    Cercospora zeae-maydis causes gray leaf spot of maize, which has become one of the most widespread and destructive diseases of maize in the world. C. zeae-maydis infects leaves through stomata, which is predicated on the ability of the pathogen to perceive stomata and reorient growth accordingly. In this study, the discovery that light was required for C. zeae-maydis to perceive stomata and infect leaves led to the identification of CRP1, a gene encoding a putative blue-light photoreceptor ho...

  4. Inflammasome and Fas-Mediated IL-1β Contributes to Th17/Th1 Cell Induction in Pathogenic Bacterial Infection In Vivo.

    Science.gov (United States)

    Uchiyama, Ryosuke; Yonehara, Shin; Taniguchi, Shun'ichiro; Ishido, Satoshi; Ishii, Ken J; Tsutsui, Hiroko

    2017-08-01

    CD4 + Th cells play crucial roles in orchestrating immune responses against pathogenic microbes, after differentiating into effector subsets. Recent research has revealed the importance of IFN-γ and IL-17 double-producing CD4 + Th cells, termed Th17/Th1 cells, in the induction of autoimmune and inflammatory diseases. In addition, Th17/Th1 cells are involved in the regulation of infection caused by the intracellular bacterium Mycobacterium tuberculosis in humans. However, the precise mechanism of Th17/Th1 induction during pathogen infection is unclear. In this study, we showed that the inflammasome and Fas-dependent IL-1β induces Th17/Th1 cells in mice, in response to infection with the pathogenic intracellular bacterium Listeria monocytogenes In the spleens of infected wild-type mice, Th17/Th1 cells were induced, and expressed T-bet and Rorγt. In Pycard -/- mice, which lack the adaptor molecule of the inflammasome (apoptosis-associated speck-like protein containing a caspase recruitment domain), Th17/Th1 induction was abolished. In addition, the Fas-mediated IL-1β production was required for Th17/Th1 induction during bacterial infection: Th17/Th1 induction was abolished in Fas -/- mice, whereas supplementation with recombinant IL-1β restored Th17/Th1 induction via IL-1 receptor 1 (IL-1R1), and rescued the mortality of Fas -/- mice infected with Listeria IL-1R1, but not apoptosis-associated speck-like protein containing a caspase recruitment domain or Fas on T cells, was required for Th17/Th1 induction, indicating that IL-1β stimulates IL-1R1 on T cells for Th17/Th1 induction. These results indicate that IL-1β, produced by the inflammasome and Fas-dependent mechanisms, contributes cooperatively to the Th17/Th1 induction during bacterial infection. This study provides a deeper understanding of the molecular mechanisms underlying Th17/Th1 induction during pathogenic microbial infections in vivo. Copyright © 2017 by The American Association of Immunologists

  5. The effect of age on the pathogenesis of a highly pathogenic avian influenza (HPAI) H5N1 virus in Pekin ducks (Anas platyrhynchos) infected experimentally

    OpenAIRE

    L?ndt, Brandon Z.; N??ez, Alejandro.; Banks, Jill; Alexander, Dennis J.; Russell, Christine; Richard? L?ndt, Angela C.; Brown, Ian H.

    2009-01-01

    Background? Highly pathogenic avian influenza (HPAI) H5N1 viruses have recently displayed increased virulence for wild waterfowl. Objectives? To study the effect of host age on the shedding and tissue dissemination of a HPAI H5N1 virus in infected Pekin ducks. Methods? Pekin ducks in two age?matched groups (n?=?18), 8 and 12?weeks old (wo) were each infected with 106 EID50/0?1?ml of HPAI A/turkey/Turkey/1/05 (H5N1, clade 2?2). Each day for 5?days, birds were monitored clinically, and cloacal ...

  6. Patients' potential role in the transmission of health care-associated infections: prevalence of contamination with bacterial pathogens and patient attitudes toward hand hygiene.

    Science.gov (United States)

    Istenes, Nancy; Bingham, James; Hazelett, Susan; Fleming, Eileen; Kirk, Jane

    2013-09-01

    Transmission of health care-associated infections (HAIs) has been primarily attributed to health care workers, and hand hygiene is considered the most important means to reduce transmission. Whereas hand hygiene research has focused on reducing health care worker hand contamination and improving hand hygiene compliance, contamination of patients' hands and their role in the transmission of HAIs remains unknown. Patients' hands were sampled by a "glove juice" recovery method and enumerated for the presence of common health care-associated pathogens. Patient demographics and other covariates were collected to determine their association with patient hand contamination. Patient attitudes and practices toward hand hygiene were also surveyed and analyzed. Of the 100 patients in the study, 39% of hands were contaminated with at least 1 pathogenic organism, and 8% were contaminated with 2 or more pathogens 48 hours after admission. Patient admission from or discharge to an outside institution and self-reported functional limitations were the only covariates that were significantly associated with hand contamination. Pathogenic organisms can be frequently detected on hands of acute care patients. Future studies are needed to better understand the relationship between patient hand contamination and the acquisition of HAIs in addition to the role patient hand hygiene can play in reducing HAIs. Copyright © 2013 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

  7. Utilizing virus-induced gene silencing for the functional characterization of maize genes during infection with the fungal pathogen Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Doehlemann, Gunther

    2013-01-01

    While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.

  8. Pathogenesis and transmissibility of highly (H7N1 and low (H7N9 pathogenic avian influenza virus infection in red-legged partridge (Alectoris rufa

    Directory of Open Access Journals (Sweden)

    Bertran Kateri

    2011-02-01

    Full Text Available Abstract An experimental infection with highly pathogenic avian influenza virus (HPAIV and low pathogenic avian influenza virus (LPAIV was carried out in red-legged partridges (Alectoris rufa in order to study clinical signs, gross and microscopic lesions, and viral distribution in tissues and viral shedding. Birds were infected with a HPAIV subtype H7N1 (A/Chicken/Italy/5093/1999 and a LPAIV subtype H7N9 (A/Anas crecca/Spain/1460/2008. Uninoculated birds were included as contacts in both groups. In HPAIV infected birds, the first clinical signs were observed at 3 dpi, and mortality started at 4 dpi, reaching 100% at 8 dpi. The presence of viral antigen in tissues and viral shedding were confirmed by immunohistochemistry and quantitative real time RT-PCR (qRRT-PCR, respectively, in all birds infected with HPAIV. However, neither clinical signs nor histopathological findings were observed in LPAIV infected partridges. In addition, only short-term viral shedding together with seroconversion was detected in some LPAIV inoculated animals. The present study demonstrates that the red-legged partridge is highly susceptible to the H7N1 HPAIV strain, causing severe disease, mortality and abundant viral shedding and thus contributing to the spread of a potential local outbreak of this virus. In contrast, our results concerning H7N9 LPAIV suggest that the red-legged partridge is not a reservoir species for this virus.

  9. Pathogenesis and transmissibility of highly (H7N1) and low (H7N9) pathogenic avian influenza virus infection in red-legged partridge (Alectoris rufa).

    Science.gov (United States)

    Bertran, Kateri; Pérez-Ramírez, Elisa; Busquets, Núria; Dolz, Roser; Ramis, Antonio; Darji, Ayub; Abad, Francesc Xavier; Valle, Rosa; Chaves, Aida; Vergara-Alert, Júlia; Barral, Marta; Höfle, Ursula; Majó, Natàlia

    2011-02-07

    An experimental infection with highly pathogenic avian influenza virus (HPAIV) and low pathogenic avian influenza virus (LPAIV) was carried out in red-legged partridges (Alectoris rufa) in order to study clinical signs, gross and microscopic lesions, and viral distribution in tissues and viral shedding. Birds were infected with a HPAIV subtype H7N1 (A/Chicken/Italy/5093/1999) and a LPAIV subtype H7N9 (A/Anas crecca/Spain/1460/2008). Uninoculated birds were included as contacts in both groups. In HPAIV infected birds, the first clinical signs were observed at 3 dpi, and mortality started at 4 dpi, reaching 100% at 8 dpi. The presence of viral antigen in tissues and viral shedding were confirmed by immunohistochemistry and quantitative real time RT-PCR (qRRT-PCR), respectively, in all birds infected with HPAIV. However, neither clinical signs nor histopathological findings were observed in LPAIV infected partridges. In addition, only short-term viral shedding together with seroconversion was detected in some LPAIV inoculated animals. The present study demonstrates that the red-legged partridge is highly susceptible to the H7N1 HPAIV strain, causing severe disease, mortality and abundant viral shedding and thus contributing to the spread of a potential local outbreak of this virus. In contrast, our results concerning H7N9 LPAIV suggest that the red-legged partridge is not a reservoir species for this virus.

  10. Evaluating the Trends of Bloodstream Infections among Pediatric and Adult Patients at a Teaching Hospital of Kathmandu, Nepal: Role of Drug Resistant Pathogens

    Directory of Open Access Journals (Sweden)

    Narayan Prasad Parajuli

    2017-01-01

    Full Text Available Bloodstream infections (BSIs are among the significant causes of morbidity and mortality for patients of all age groups. However, very little is known about the trends of bacterial bloodstream infections and antimicrobial susceptibilities among pediatric and adult population from Nepal. In this study, we have investigated the different etiological agents responsible for bloodstream infections among pediatric and adult patients and the role of drug resistant organisms in these infections at a tertiary care teaching hospital of Kathmandu, Nepal. A total of 3,088 blood culture specimens obtained from pediatric and adult patients suspected to have bloodstream infections were processed by standard microbiological methods. Significant bacterial pathogens were identified by morphological, biochemical, and serological methods as suggested by American Society for Microbiology. In vitro antimicrobial susceptibility testing was performed by Kirby-Bauer disk diffusion method and interpreted according to the guidelines of Clinical and Laboratory Standards Institute. Overall, incidence of bloodstream infections among the suspected patients was 7.48%. Pediatric patients (n=90, 9.37% were the significant subgroup of patients affected with bloodstream infections compared to adults (p<0.05, CI-95%. Gram positive (n=49, 54.4% bacteria in pediatric and gram negative bacteria (n=141, 78.7% in adult patients were the most common isolates for BSI. Staphylococcus aureus (n=41, 45.6% in pediatric patients and Salmonella enterica (n=40, 28.3% in adult patients were the leading pathogens. Trends of antimicrobial resistance among isolated bacterial strains were significantly high in adults compared to pediatric patients. Methicillin resistant Staphylococcus aureus (MRSA (31.4%, extended spectrum beta-lactamase (ESBL (12.5%, and metallo-beta-lactamase (MBL (3.9% producing gram negatives were major resistant strains. Our study shows higher rates of bloodstream infections in

  11. Novel Fungal Pathogenicity and Leaf Defense Strategies Are Revealed by Simultaneous Transcriptome Analysis of Colletotrichum fructicola and Strawberry Infected by This Fungus

    OpenAIRE

    Liqing Zhang; Xin Huang; Chengyong He; Chengyong He; Qing-Yu Zhang; Xiaohua Zou; Ke Duan; Ke Duan; Qinghua Gao

    2018-01-01

    Colletotrichum fructicola, which is part of the C. gloeosporioides species complex, can cause anthracnose diseases in strawberries worldwide. However, the molecular interactions between C. fructicola and strawberry are largely unknown. A deep RNA-sequencing approach was applied to gain insights into the pathogenicity mechanisms of C. fructicola and the defense response of strawberry plants at different stages of infection. The transcriptome data showed stage-specific transcription accompanied...

  12. The Arabidopsis microtubule-associated protein MAP65-3 supports infection by filamentous biotrophic pathogens by down-regulating salicylic acid-dependent defenses.

    Science.gov (United States)

    Quentin, Michaël; Baurès, Isabelle; Hoefle, Caroline; Caillaud, Marie-Cécile; Allasia, Valérie; Panabières, Franck; Abad, Pierre; Hückelhoven, Ralph; Keller, Harald; Favery, Bruno

    2016-03-01

    The oomycete Hyaloperonospora arabidopsidis and the ascomycete Erysiphe cruciferarum are obligate biotrophic pathogens causing downy mildew and powdery mildew, respectively, on Arabidopsis. Upon infection, the filamentous pathogens induce the formation of intracellular bulbous structures called haustoria, which are required for the biotrophic lifestyle. We previously showed that the microtubule-associated protein AtMAP65-3 plays a critical role in organizing cytoskeleton microtubule arrays during mitosis and cytokinesis. This renders the protein essential for the development of giant cells, which are the feeding sites induced by root knot nematodes. Here, we show that AtMAP65-3 expression is also induced in leaves upon infection by the downy mildew oomycete and the powdery mildew fungus. Loss of AtMAP65-3 function in the map65-3 mutant dramatically reduced infection by both pathogens, predominantly at the stages of leaf penetration. Whole-transcriptome analysis showed an over-represented, constitutive activation of genes involved in salicylic acid (SA) biosynthesis, signaling, and defense execution in map65-3, whereas jasmonic acid (JA)-mediated signaling was down-regulated. Preventing SA synthesis and accumulation in map65-3 rescued plant susceptibility to pathogens, but not the developmental phenotype caused by cytoskeleton defaults. AtMAP65-3 thus has a dual role. It positively regulates cytokinesis, thus plant growth and development, and negatively interferes with plant defense against filamentous biotrophs. Our data suggest that downy mildew and powdery mildew stimulate AtMAP65-3 expression to down-regulate SA signaling for infection. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  13. Physician's knowledge, attitudes, and practices regarding seasonal influenza, pandemic influenza, and highly pathogenic avian influenza A (H5N1) virus infections of humans in Indonesia

    OpenAIRE

    Mangiri, Amalya; Iuliano, A. Danielle; Wahyuningrum, Yunita; Praptiningsih, Catharina Y.; Lafond, Kathryn E.; Storms, Aaron D.; Samaan, Gina; Ariawan, Iwan; Soeharno, Nugroho; Kreslake, Jennifer M.; Storey, J. Douglas; Uyeki, Timothy M.

    2016-01-01

    Indonesia has reported highest number of fatal human cases of highly pathogenic avian influenza (HPAI) A (H5N1) virus infection worldwide since 2005. There are limited data available on seasonal and pandemic influenza in Indonesia. During 2012, we conducted a survey of clinicians in two districts in western Java, Indonesia, to assess knowledge, attitudes, and practices (KAP) of clinical diagnosis, testing, and treatment of patients with seasonal influenza, pandemic influenza, or HPAI H5N1 vir...

  14. The common enteric bacterial pathogens and their antimicrobial susceptibility pattern among HIV-infected individuals attending the antiretroviral therapy clinic of Hawassa university hospital, southern Ethiopia

    Directory of Open Access Journals (Sweden)

    Ayele Kebede

    2017-12-01

    Full Text Available Abstract Background The frequent occurrence of bacterial gastroenteritis among HIV-infected individuals together with increased antimicrobial drug resistance pose a significant public health challenge in developing countries. This study aimed to determine the prevalence of enteric bacterial pathogens and their antimicrobial susceptibility pattern among HIV-infected patients in a tertiary hospital in southern Ethiopia. Methods A hospital-based cross-sectional study was conducted at Hawassa University Comprehensive Specialized Hospital from February to May, 2016. A consecutive 215 HIV-infected patients, with complaints of gastrointestinal tract disease, were enrolled. Data on socio-demography and related factors was collected using a structured questionnaire. A stool sample was collected from each study participant and cultured to isolate enteric bacterial pathogens; isolates were characterized using biochemical tests. Antimicrobial susceptibility was determined using the Kirby- Bauer disk diffusion technique. Results Out of 215 patients, 27(12.6% were culture positive for various bacterial pathogens. Campylobacter species was the most common bacterial isolate (6.04%, followed by Salmonella species (5.1%. The majority of isolates was sensitive to norfloxacin, nalidixic acid, gentamicin, ceftriaxone and ciprofloxacin and showed resistance to trimethoprim sulfamethoxazole (SXT and chloramphenicol. Consumption of raw food was the only risk factor found to be significantly associated with enteric bacterial infection (crude odds ratio 3.41 95% CI 1.13–10.3. Conclusions The observed rate of enteric bacterial pathogens and their antimicrobial resistance pattern to the commonly prescribed antibiotics highlights the need to strengthen intervention efforts and promote rational use of antimicrobials. In this regard, the need to strengthen antimicrobial stewardship efforts should be emphasized to slow grown antimicrobial resistance among this population

  15. Exposure to a low pathogenic A/H7N2 virus in chickens protects against highly pathogenic A/H7N1 virus but not against subsequent infection with A/H5N1.

    Directory of Open Access Journals (Sweden)

    Júlia Vergara-Alert

    Full Text Available Recent evidences have demonstrated that the presence of low pathogenic avian influenza viruses (LPAIV may play an important role in host ecology and transmission of avian influenza viruses (AIV. While some authors have clearly demonstrated that LPAIV can mutate to render highly pathogenic avian influenza viruses (HPAIV, others have shown that their presence could provide the host with enough immunological memory to resist re-infections with HPAIV. In order to experimentally study the role of pre-existing host immunity, chickens previously infected with H7N2 LPAIV were subsequently challenged with H7N1 HPAIV. Pre-infection of chickens with H7N2 LAPIV conferred protection against the lethal challenge with H7N1 HPAIV, dramatically reducing the viral shedding, the clinical signs and the pathological outcome. Correlating with the protection afforded, sera from chickens primed with H7N2 LPAIV reacted with the H7-AIV subtype in hemagglutination inhibition assay and specifically with the N2-neuraminidase antigen. Conversely, subsequent exposure to H5N1 HPAIV resulted in a two days-delay on the onset of disease but all chickens died by 7 days post-challenge. Lack of protection correlated with the absence of H5-hemagglutining inhibitory antibodies prior to H5N1 HPAIV challenge. Our data suggest that in naturally occurring outbreaks of HPAIV, birds with pre-existing immunity to LPAIV could survive lethal infections with HA-homologous HPAIV but not subsequent re-infections with HA-heterologous HPAIV. These results could be useful to better understand the dynamics of AIV in chickens and might help in future vaccine formulations.

  16. Regulation of stomatal tropism and infection by light in Cercospora zeae-maydis: evidence for coordinated host/pathogen responses to photoperiod?

    Directory of Open Access Journals (Sweden)

    Hun Kim

    2011-07-01

    Full Text Available Cercospora zeae-maydis causes gray leaf spot of maize, which has become one of the most widespread and destructive diseases of maize in the world. C. zeae-maydis infects leaves through stomata, which is predicated on the ability of the pathogen to perceive stomata and reorient growth accordingly. In this study, the discovery that light was required for C. zeae-maydis to perceive stomata and infect leaves led to the identification of CRP1, a gene encoding a putative blue-light photoreceptor homologous to White Collar-1 (WC-1 of Neurospora crassa. Disrupting CRP1 via homologous recombination revealed roles in multiple aspects of pathogenesis, including tropism of hyphae to stomata, the formation of appressoria, conidiation, and the biosynthesis of cercosporin. CRP1 was also required for photoreactivation after lethal doses of UV exposure. Intriguingly, putative orthologs of CRP1 are central regulators of circadian clocks in other filamentous fungi, raising the possibility that C. zeae-maydis uses light as a key environmental input to coordinate pathogenesis with maize photoperiodic responses. This study identified a novel molecular mechanism underlying stomatal tropism in a foliar fungal pathogen, provides specific insight into how light regulates pathogenesis in C. zeae-maydis, and establishes a genetic framework for the molecular dissection of infection via stomata and the integration of host and pathogen responses to photoperiod.

  17. Regulation of stomatal tropism and infection by light in Cercospora zeae-maydis: evidence for coordinated host/pathogen responses to photoperiod?

    Science.gov (United States)

    Kim, Hun; Ridenour, John B; Dunkle, Larry D; Bluhm, Burton H

    2011-07-01

    Cercospora zeae-maydis causes gray leaf spot of maize, which has become one of the most widespread and destructive diseases of maize in the world. C. zeae-maydis infects leaves through stomata, which is predicated on the ability of the pathogen to perceive stomata and reorient growth accordingly. In this study, the discovery that light was required for C. zeae-maydis to perceive stomata and infect leaves led to the identification of CRP1, a gene encoding a putative blue-light photoreceptor homologous to White Collar-1 (WC-1) of Neurospora crassa. Disrupting CRP1 via homologous recombination revealed roles in multiple aspects of pathogenesis, including tropism of hyphae to stomata, the formation of appressoria, conidiation, and the biosynthesis of cercosporin. CRP1 was also required for photoreactivation after lethal doses of UV exposure. Intriguingly, putative orthologs of CRP1 are central regulators of circadian clocks in other filamentous fungi, raising the possibility that C. zeae-maydis uses light as a key environmental input to coordinate pathogenesis with maize photoperiodic responses. This study identified a novel molecular mechanism underlying stomatal tropism in a foliar fungal pathogen, provides specific insight into how light regulates pathogenesis in C. zeae-maydis, and establishes a genetic framework for the molecular dissection of infection via stomata and the integration of host and pathogen responses to photoperiod.

  18. Pathogen translocation and histopathological lesions in an experimental model of Salmonella Dublin infection in calves receiving lactic acid bacteria and lactose supplements

    Science.gov (United States)

    Zbrun, María V.; Soto, Lorena P.; Bertozzi, Ezequiel; Sequeira, Gabriel J.; Marti, Luis E.; Signorini, Marcelo L.; Armesto, Roberto Rodríguez; Rosmini, Marcelo R.

    2012-01-01

    The purpose of this study was to evaluate the capacity of a lactic acid bacteria (LAB) inoculum to protect calves with or without lactose supplements against Salmonella Dublin infection by evaluating histopathological lesions and pathogen translocation. Fifteen calves were divided into three groups [control group (C-G), a group inoculated with LAB (LAB-G), and a group inoculated with LAB and given lactose supplements (L-LAB-G)] with five, six, and four animals, respectively. The inoculum, composed of Lactobacillus (L.) casei DSPV 318T, L. salivarius DSPV 315T, and Pediococcus acidilactici DSPV 006T, was administered with milk replacer. The LAB-G and L-LAB-G received a daily dose of 109 CFU/kg body weight of each strain throughout the experiment. Lactose was provided to the L-LAB-G in doses of 100 g/day. Salmonella Dublin (2 × 1010 CFU) was orally administered to all animals on day 11 of the experiment. The microscopic lesion index values in target organs were 83%, 70%, and 64.3% (p < 0.05) for the C-G, LAB-G, and L-LAB-G, respectively. Administration of the probiotic inoculum was not fully effective against infection caused by Salmonella. Although probiotic treatment was unable to delay the arrival of pathogen to target organs, it was evident that the inoculum altered the response of animals against pathogen infection. PMID:23000583

  19. α-Ketol linolenic acid (KODA) application affects endogenous abscisic acid, jasmonic acid and aromatic volatiles in grapes infected by a pathogen (Glomerella cingulata).

    Science.gov (United States)

    Wang, Shanshan; Saito, Takanori; Ohkawa, Katsuya; Ohara, Hitoshi; Shishido, Masahiro; Ikeura, Hiromi; Takagi, Kazuteru; Ogawa, Shigeyuki; Yokoyama, Mineyuki; Kondo, Satoru

    2016-03-15

    Effects of α-ketol linolenic acid (KODA) application on endogenous abscisic acid (ABA), jasmonic acid (JA), and aromatic volatiles were investigated in 'Kyoho' grapes (Vitis labrusca×Vitis vinifera) infected by a pathogen (Glomerella cingulata). The expressions of 9-cis-epoxycarotenoid dioxygenase (VvNCED1), ABA 8'-hydroxylase (VvCYP707A1), lipoxygenase (VvLOX), and allene oxide synthase (VvAOS) were also examined. The grape berries were dipped in 0.1mM KODA solution before inoculation with the pathogen and stored at 25°C for 12 days. The development of infection was significantly suppressed upon KODA treatment. Endogenous ABA, JA and phaseic acid (PA) were induced in inoculated berries. KODA application before inoculation increased endogenous ABA, PA and JA through the activation of VvNCED1, VvCYP707A1 and VvAOS genes, respectively. In addition, terpenes, methyl salicylate (Me-SA) and C6-aldehydes such as (E)-2-hexenal and cis-3-hexenal associated with fungal resistance also increased in KODA-treated berries during storage. These results suggest that the synergistic effect of JA, ABA, and some aromatic volatiles induced by KODA application may provide resistance to pathogen infection in grape berries. Copyright © 2016 Elsevier GmbH. All rights reserved.

  20. Quantification of Salmonella Survival and Infection in an In vitro Model of the Human Intestinal Tract as Proxy for Foodborne Pathogens

    Directory of Open Access Journals (Sweden)

    Lucas M. Wijnands

    2017-06-01

    Full Text Available Different techniques are available for assessing differences in virulence of bacterial foodborne pathogens. The use of animal models or human volunteers is not expedient for various reasons; the use of epidemiological data is often hampered by lack of crucial data. In this paper, we describe a static, sequential gastrointestinal tract (GIT model system in which foodborne pathogens are exposed to simulated gastric and intestinal contents of the human digestive tract, including the interaction of pathogens with the intestinal epithelium. The system can be employed with any foodborne bacterial pathogens. Five strains of Salmonella Heidelberg and one strain of Salmonella Typhimurium were used to assess the robustness of the system. Four S. Heidelberg strains originated from an outbreak, the fifth S. Heidelberg strain and the S. Typhimurium strain originated from routine meat inspections. Data from plate counts, collected for determining the numbers of surviving bacteria in each stage, were used to quantify both the experimental uncertainty and biological variability of pathogen survival throughout the system. For this, a hierarchical Bayesian framework using Markov chain Monte Carlo (MCMC was employed. The model system is able to distinguish serovars/strains for in vitro infectivity when accounting for within strain biological variability and experimental uncertainty.

  1. Enhancement of innate immunity with granulocyte colony-stimulating factor did not mitigate disease in pigs infected with a highly pathogenic Chinese PRRSV strain.

    Science.gov (United States)

    Schlink, Sarah N; Lager, Kelly M; Brockmeier, Susan L; Loving, Crystal L; Miller, Laura C; Vorwald, Ann C; Yang, Han-Chun; Kehrli, Marcus E; Faaberg, Kay S

    2016-10-15

    Porcine reproductive and respiratory syndrome virus (PRRSV) is responsible for one of the most economically important diseases in swine worldwide. It causes reproductive failure in sows and pneumonia in pigs that predisposes them to secondary bacterial infections. Methods to control PRRSV and/or limit secondary bacterial infections are desired to reduce the impact of this virus on animal health. Neutrophils play a major role in combatting infection; they can act as phagocytes as well as produce and release lytic enzymes that have potent antimicrobial effects leading to the destruction and clearance of bacterial pathogens. Granulocyte-colony stimulating factor (G-CSF) is a cytokine that controls the production, differentiation and function of granulocytes (including neutrophils) from the bone marrow. Recent work from our laboratory has shown that encoding porcine G-CSF in a replication-defective adenovirus (Ad5-G-CSF) and delivering a single dose to pigs induced a neutrophilia lasting more than two weeks. As secondary bacterial infection is a common occurrence following PRRSV infection, particularly following challenge with highly pathogenic (HP)-PRRSV, the aim of the current study was to evaluate the effectiveness of a single prophylactic dose of adenovirus-encoded G-CSF to mitigate secondary bacterial disease associated with HP-PRRSV infection. Administration of Ad5-G-CSF induced a significant neutrophilia as expected. However, between 1 and 2days following HP-PRRSV challenge the number of circulating neutrophils decreased dramatically in the HP-PRRSV infected group, but not the non-infected Ad5-G-CSF group. Ad5-G-CSF administration induced monocytosis as well, which was also reduced by HP-PRRSV challenge. There was no difference in the progression of disease between the Ad5-G-CSF and Ad5-empty groups following HP-PRRSV challenge, with pneumonia and systemic bacterial infection occurring in both treatment groups. Given the impact of HP-PRRSV infection on the

  2. Direct and indirect effects of climate change on the risk of infection by water-transmitted pathogens

    NARCIS (Netherlands)

    Sterk, A.; Schijven, J.F.; de Nijs, T.; de Roda Husman, A.M.

    2013-01-01

    Climate change is likely to affect the infectious disease burden from exposure to pathogens in water used for drinking and recreation. Effective intervention measures require quantification of impacts of climate change on the distribution of pathogens in the environment and their potential effects

  3. Virus interference between H7N2 low pathogenic avian influenza virus and lentogenic Newcastle disease virus in experimental co-infections in chickens and turkeys.

    Science.gov (United States)

    Costa-Hurtado, Mar; Afonso, Claudio L; Miller, Patti J; Spackman, Erica; Kapczynski, Darrell R; Swayne, David E; Shepherd, Eric; Smith, Diane; Zsak, Aniko; Pantin-Jackwood, Mary

    2014-01-06

    Low pathogenicity avian influenza virus (LPAIV) and lentogenic Newcastle disease virus (lNDV) are commonly reported causes of respiratory disease in poultry worldwide with similar clinical and pathobiological presentation. Co-infections do occur but are not easily detected, and the impact of co-infections on pathobiology is unknown. In this study chickens and turkeys were infected with a lNDV vaccine strain (LaSota) and a H7N2 LPAIV (A/turkey/VA/SEP-67/2002) simultaneously or sequentially three days apart. No clinical signs were observed in chickens co-infected with the lNDV and LPAIV or in chickens infected with the viruses individually. However, the pattern of virus shed was different with co-infected chickens, which excreted lower titers of lNDV and LPAIV at 2 and 3 days post inoculation (dpi) and higher titers at subsequent time points. All turkeys inoculated with the LPAIV, whether or not they were exposed to lNDV, presented mild clinical signs. Co-infection effects were more pronounced in turkeys than in chickens with reduction in the number of birds shedding virus and in virus titers, especially when LPAIV was followed by lNDV. In conclusion, co-infection of chickens or turkeys with lNDV and LPAIV affected the replication dynamics of these viruses but did not affect clinical signs. The effect on virus replication was different depending on the species and on the time of infection. These results suggest that infection with a heterologous virus may result in temporary competition for cell receptors or competent cells for replication, most likely interferon-mediated, which decreases with time.

  4. Persistence of highly pathogenic avian influenza virus (H7N1) in infected chickens: feather as a suitable sample for diagnosis.

    Science.gov (United States)

    Busquets, Núria; Abad, F Xavier; Alba, Anna; Dolz, Roser; Allepuz, Alberto; Rivas, Raquel; Ramis, Antonio; Darji, Ayub; Majó, Natàlia

    2010-09-01

    Selection of an ideal sample is a vital element in early detection of influenza infection. Rapid identification of infectious individuals or animals is crucial not only for avian influenza virus (AIV) surveillance programmes, but also for treatment and containment strategies. This study used a combination of quantitative real-time RT-PCR with an internal positive control and a cell-titration system to examine the presence of virus in different samples during active experimental AIV infection and its persistence in the infected carcasses. Oropharyngeal/cloacal swabs as well as feather pulp and blood samples were collected from 15-day-old chicks infected with H7N1 highly pathogenic AIV (HPAIV) and the kinetics of virus shedding during active infection were evaluated. Additionally, several samples (muscle, skin, brain, feather pulp and oropharyngeal and cloacal swabs) were examined to assess the persistence of virus in the HPAIV-infected carcasses. Based on the results, feather pulp was found to be the best sample to detect and isolate HPAIV from infected chicks from 24 h after inoculation onwards. Kinetic studies on the persistence of virus in infected carcasses revealed that tissues such as muscle could potentially transmit infectious virus for 3 days post-mortem (p.m.), whilst other tissues such as skin, feather pulp and brain retained their infectivity for as long as 5-6 days p.m. at environmental temperature (22-23 degrees C). These results strongly favour feather as a useful sample for HPAIV diagnosis in infected chickens as well as in carcasses.

  5. SNP design from 454 sequencing of Podosphaera plantaginis transcriptome reveals a genetically diverse pathogen metapopulation with high levels of mixed-genotype infection.

    Directory of Open Access Journals (Sweden)

    Charlotte Tollenaere

    Full Text Available Molecular tools may greatly improve our understanding of pathogen evolution and epidemiology but technical constraints have hindered the development of genetic resources for parasites compared to free-living organisms. This study aims at developing molecular tools for Podosphaera plantaginis, an obligate fungal pathogen of Plantago lanceolata. This interaction has been intensively studied in the Åland archipelago of Finland with epidemiological data collected from over 4,000 host populations annually since year 2001.A cDNA library of a pooled sample of fungal conidia was sequenced on the 454 GS-FLX platform. Over 549,411 reads were obtained and annotated into 45,245 contigs. Annotation data was acquired for 65.2% of the assembled sequences. The transcriptome assembly was screened for SNP loci, as well as for functionally important genes (mating-type genes and potential effector proteins. A genotyping assay of 27 SNP loci was designed and tested on 380 infected leaf samples from 80 populations within the Åland archipelago. With this panel we identified 85 multilocus genotypes (MLG with uneven frequencies across the pathogen metapopulation. Approximately half of the sampled populations contain polymorphism. Our genotyping protocol revealed mixed-genotype infection within a single host leaf to be common. Mixed infection has been proposed as one of the main drivers of pathogen evolution, and hence may be an important process in this pathosystem.The developed SNP panel offers exciting research perspectives for future studies in this well-characterized pathosystem. Also, the transcriptome provides an invaluable novel genomic resource for powdery mildews, which cause significant yield losses on commercially important crops annually. Furthermore, the features that render genetic studies in this system a challenge are shared with the majority of obligate parasitic species, and hence our results provide methodological insights from SNP calling to field

  6. Resistance among Gram-negative ESKAPE pathogens isolated from hospitalized patients with intra-abdominal and urinary tract infections in Latin American countries: SMART 2013-2015.

    Science.gov (United States)

    Karlowsky, James A; Hoban, Daryl J; Hackel, Meredith A; Lob, Sibylle H; Sahm, Daniel F

    Gram-negative ESKAPE pathogens (Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) are important etiologic agents of nosocomial infection that are frequently resistant to broad-spectrum antimicrobial agents. Gram-negative ESKAPE pathogens were collected from hospitalized patients in 11 Latin American countries from 2013 to 2015 as part of the Study for Monitoring Antimicrobial Resistance Trends (SMART) global surveillance program. In total, 2113 isolates from intra-abdominal infections (IAI) and 970 isolates from urinary tract infections (UTI) were tested against antimicrobial agents using standardized CLSI broth microdilution methodology. Of the agents tested, amikacin demonstrated the highest rates of susceptibility (%) for K. pneumoniae (92.2, 92.3), Enterobacter spp. (97.5, 92.1), and P. aeruginosa (85.3, 75.2) isolates from both IAI and UTI, respectively. Ertapenem (68.5, 62.6) and imipenem (79.2, 75.9) showed substantially higher rates of susceptibility (%) than other β-lactams, including piperacillin-tazobactam (35.9, 37.4) against ESBL-positive isolates of K. pneumoniae from IAI and UTI, respectively. Rates of susceptibility to all agents tested against A. baumannii were ≤30.9%. Gram-negative ESKAPE pathogens isolated from Latin America demonstrated compromised in vitro susceptibility to commonly prescribed broad-spectrum, parenteral antimicrobial agents. Continued surveillance is warranted. New antimicrobial agents with potent activity against Gram-negative ESKAPE pathogens are urgently needed. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  7. Plant growth-promoting endophytic bacteria versus pathogenic infections: an example of Bacillus amyloliquefaciens RWL-1 and Fusarium oxysporum f. sp. lycopersici in tomato

    Directory of Open Access Journals (Sweden)

    Raheem Shahzad

    2017-03-01

    Full Text Available Fungal pathogenic attacks are one of the major threats to the growth and productivity of crop plants. Currently, instead of synthetic fungicides, the use of plant growth-promoting bacterial endophytes has been considered intriguingly eco-friendly in nature. Here, we aimed to investigate the in vitro and in vivo antagonistic approach by using seed-borne endophytic Bacillus amyloliquefaciens RWL-1 against pathogenic Fusarium oxysporum f. sp. lycopersici. The results revealed significant suppression of pathogenic fungal growth by Bacillus amyloliquefaciens in vitro. Further to this, we inoculated tomato plants with RWL-1 and F. oxysporum f. sp. lycopersici in the root zone. The results showed that the growth attributes and biomass were significantly enhanced by endophytic-inoculation during disease incidence as compared to F. oxysporum f. sp. lycopersici infected plants. Under pathogenic infection, the RWL-1-applied plants showed increased amino acid metabolism of cell wall related (e.g., aspartic acid, glutamic acid, serine (Ser, and proline (Pro as compared to diseased plants. In case of endogenous phytohormones, significantly lower amount of jasmonic acid (JA and higher amount of salicylic acid (SA contents was recorded in RWL-1-treated diseased plants. The phytohormones regulation in disease incidences might be correlated with the ability of RWL-1 to produce organic acids (e.g., succinic acid, acetic acid, propionic acid, and citric acid during the inoculation and infection of tomato plants. The current findings suggest that RWL-1 inoculation promoted and rescued plant growth by modulating defense hormones and regulating amino acids. This suggests that bacterial endophytes could be used for possible control of F. oxysporum f. sp. lycopersici in an eco-friendly way.

  8. Human Primary Epithelial Cells Acquire an Epithelial-Mesenchymal-Transition Phenotype during Long-Term Infection by the Oral Opportunistic Pathogen, Porphyromonas gingivalis

    Directory of Open Access Journals (Sweden)

    Jungnam Lee

    2017-12-01

    Full Text Available Porphyromonas gingivalis is a host-adapted oral pathogen associated with chronic periodontitis that successfully survives and persists in the oral epithelium. Recent studies have positively correlated periodontitis with increased risk and severity of oral squamous cell carcinoma (OSCC. Intriguingly, the presence of P. gingivalis enhances tumorigenic properties independently of periodontitis and has therefore been proposed as a potential etiological agent for OSCC. However, the initial host molecular changes induced by P. gingivalis infection which promote predisposition to cancerous transformation through EMT (epithelial-mesenchymal-transition, has never been studied in human primary cells which more closely mimic the physiological state of cells in vivo. In this study, we examine for the first time in primary oral epithelial cells (OECs the expression and activation of key EMT mediators during long-term P. gingivalis infection in vitro. We examined the inactive phosphorylated state of glycogen synthase kinase-3 beta (p-GSK3β over 120 h P. gingivalis infection and found p-GSK3β, an important EMT regulator, significantly increases over the course of infection (p < 0.01. Furthermore, we examined the expression of EMT-associated transcription factors, Slug, Snail, and Zeb1 and found significant increases (p < 0.01 over long-term P. gingivalis infection in protein and mRNA expression. Additionally, the protein expression of mesenchymal intermediate filament, Vimentin, was substantially increased over 120 h of P. gingivalis infection. Analysis of adhesion molecule E-cadherin showed a significant decrease (p < 0.05 in expression and a loss of membrane localization along with β-catenin in OECs. Matrix metalloproteinases (MMPs 2, 7, and 9 are all markedly increased with long-term P. gingivalis infection. Finally, migration of P. gingivalis infected cells was evaluated using scratch assay in which primary OEC monolayers were wounded and treated with

  9. Experimentally infected domestic ducks show efficient transmission of Indonesian H5N1 highly pathogenic avian influenza virus, but lack persistent viral shedding.

    Science.gov (United States)

    Wibawa, Hendra; Bingham, John; Nuradji, Harimurti; Lowther, Sue; Payne, Jean; Harper, Jenni; Junaidi, Akhmad; Middleton, Deborah; Meers, Joanne

    2014-01-01

    Ducks are important maintenance hosts for avian influenza, including H5N1 highly pathogenic avian influenza viruses. A previous study indicated that persistence of H5N1 viruses in ducks after the development of humoral immunity may drive viral evolution following immune selection. As H5N1 HPAI is endemic in Indonesia, this mechanism may be important in understanding H5N1 evolution in that region. To determine the capability of domestic ducks to maintain prolonged shedding of Indonesian clade 2.1 H5N1 virus, two groups of Pekin ducks were inoculated through the eyes, nostrils and oropharynx and viral shedding and transmission investigated. Inoculated ducks (n = 15), which were mostly asymptomatic, shed infectious virus from the oral route from 1 to 8 days post inoculation, and from the cloacal route from 2-8 dpi. Viral ribonucleic acid was detected from 1-15 days post inoculation from the oral route and 1-24 days post inoculation from the cloacal route (cycle threshold ducks seroconverted in a range of serological tests by 15 days post inoculation. Virus was efficiently transmitted during acute infection (5 inoculation-infected to all 5 contact ducks). However, no evidence for transmission, as determined by seroconversion and viral shedding, was found between an inoculation-infected group (n = 10) and contact ducks (n = 9) when the two groups only had contact after 10 days post inoculation. Clinical disease was more frequent and more severe in contact-infected (2 of 5) than inoculation-infected ducks (1 of 15). We conclude that Indonesian clade 2.1 H5N1 highly pathogenic avian influenza virus does not persist in individual ducks after acute infection.

  10. TLR3 signaling is either protective or pathogenic for the development of Theiler's virus-induced demyelinating disease depending on the time of viral infection

    Directory of Open Access Journals (Sweden)

    Jin Young-Hee

    2011-12-01

    Full Text Available Abstract Background We have previously shown that toll-like receptor 3 (TLR3-mediated signaling plays an important role in the induction of innate cytokine responses to Theiler's murine encephalomyelitis virus (TMEV infection. In addition, cytokine levels produced after TMEV infection are significantly higher in the glial cells of susceptible SJL mice compared to those of resistant C57BL/6 mice. However, it is not known whether TLR3-mediated signaling plays a protective or pathogenic role in the development of demyelinating disease. Methods SJL/J and B6;129S-Tlr3tm1Flv/J (TLR3KO-B6 mice, and TLR3KO-SJL mice that TLR3KO-B6 mice were backcrossed to SJL/J mice for 6 generations were infected with Theiler's murine encephalomyelitis virus (2 × 105 PFU with or without treatment with 50 μg of poly IC. Cytokine production and immune responses in the CNS and periphery of infected mice were analyzed. Results We investigated the role of TLR3-mediated signaling in the protection and pathogenesis of TMEV-induced demyelinating disease. TLR3KO-B6 mice did not develop demyelinating disease although they displayed elevated viral loads in the CNS. However, TLR3KO-SJL mice displayed increased viral loads and cellular infiltration in the CNS, accompanied by exacerbated development of demyelinating disease, compared to the normal littermate mice. Late, but not early, anti-viral CD4+ and CD8+ T cell responses in the CNS were compromised in TLR3KO-SJL mice. However, activation of TLR3 with poly IC prior to viral infection also exacerbated disease development, whereas such activation after viral infection restrained disease development. Activation of TLR3 signaling prior to viral infection hindered the induction of protective IFN-γ-producing CD4+ and CD8+ T cell populations. In contrast, activation of these signals after viral infection improved the induction of IFN-γ-producing CD4+ and CD8+ T cells. In addition, poly IC-pretreated mice displayed elevated PDL-1 and

  11. Infections with the Sexually Transmitted Pathogen Nosema apis Trigger an Immune Response in the Seminal Fluid of Honey Bees (Apis mellifera).

    Science.gov (United States)

    Grassl, Julia; Peng, Yan; Baer-Imhoof, Barbara; Welch, Mat; Millar, A Harvey; Baer, Boris

    2017-01-06

    Honey bee (Apis mellifera) males are highly susceptible to infections with the sexually transmitted fungal pathogen Nosema apis. However, they are able to suppress this parasite in the ejaculate using immune molecules in the seminal fluid. We predicted that males respond to infections by altering the seminal fluid proteome to minimize the risk to sexually transmit the parasite to the queen and her colony. We used iTRAQ isotopic labeling to compare seminal fluid proteins from infected and noninfected males and found that N. apis infections resulted in significant abundance changes in 111 of the 260 seminal fluid proteins quantitated. The largest group of proteins with significantly changed abundances consisted of 15 proteins with well-known immune-related functions, which included two significantly more abundant chitinases in the seminal fluid of infected males. Chitinases were previously hypothesized to be involved in honey bee antifungal activity against N. apis. Here we show that infection with N. apis triggers a highly specific immune response in the seminal fluid of honey bee males.

  12. Persistent environmental contamination with USA300 methicillin-resistant Staphylococcus aureus and other pathogenic strain types in households with S. aureus skin infections.

    Science.gov (United States)

    Eells, Samantha J; David, Michael Z; Taylor, Alexis; Ortiz, Nancy; Kumar, Neha; Sieth, Julia; Boyle-Vavra, Susan; Daum, Robert S; Miller, Loren G

    2014-11-01

    To understand the genotypic spectrum of environmental contamination of Staphylococcus aureus in households and its persistence. Prospective longitudinal cohort investigation. Index participants identified at 2 academic medical centers. Adults and children with S. aureus skin infections and their household contacts in Los Angeles and Chicago. Household fomites were surveyed for contamination at baseline and 3 months. All isolates underwent genetic typing. We enrolled 346 households, 88% of which completed the 3-month follow-up visit. S. aureus environmental contamination was 49% at baseline and 51% at 3 months. Among households with a USA300 methicillin-resistant S. aureus (MRSA) body infection isolate, environmental contamination with an indistinguishable MRSA strain was 58% at baseline and 63% at 3 months. Baseline factors associated with environmental contamination by the index subject's infection isolate were body colonization by any household member with the index subject's infection isolate at baseline (odds ratio [OR], 10.93 [95% confidence interval (CI), 5.75-20.79]), higher housing density (OR, 1.47 [95% CI, 1.10-1.96]), and more frequent household fomite cleaning (OR, 1.62 [95% CI, 1.16-2.27]). Household environmental contamination with the index subject's infection strain at 3 months was associated with USA300 MRSA and a synergistic interaction between baseline environmental contamination and body colonization by any household member with the index subject's infection strain. We found that infecting S. aureus isolates frequently persisted environmentally in households 3 months after skin infection. Presence of pathogenic S. aureus strain type in the environment in a household may represent a persistent reservoir that places household members at risk of future infection.

  13. Chromobacterium Csp_P reduces malaria and dengue infection in vector mosquitoes and has entomopathogenic and in vitro anti-pathogen activities.

    Science.gov (United States)

    Ramirez, Jose Luis; Short, Sarah M; Bahia, Ana C; Saraiva, Raul G; Dong, Yuemei; Kang, Seokyoung; Tripathi, Abhai; Mlambo, Godfree; Dimopoulos, George

    2014-10-01

    Plasmodium and dengue virus, the causative agents of the two most devastating vector-borne diseases, malaria and dengue, are transmitted by the two most important mosquito vectors, Anopheles gambiae and Aedes aegypti, respectively. Insect-bacteria associations have been shown to influence vector competence for human pathogens through multi-faceted actions that include the elicitation of the insect immune system, pathogen sequestration by microbes, and bacteria-produced anti-pathogenic factors. These influences make the mosquito microbiota highly interesting from a disease control perspective. Here we present a bacterium of the genus Chromobacterium (Csp_P), which was isolated from the midgut of field-caught Aedes aegypti. Csp_P can effectively colonize the mosquito midgut when introduced through an artificial nectar meal, and it also inhibits the growth of other members of the midgut microbiota. Csp_P colonization of the midgut tissue activates mosquito immune responses, and Csp_P exposure dramatically reduces the survival of both the larval and adult stages. Ingestion of Csp_P by the mosquito significantly reduces its susceptibility to Plasmodium falciparum and dengue virus infection, thereby compromising the mosquito's vector competence. This bacterium also exerts in vitro anti-Plasmodium and anti-dengue activities, which appear to be mediated through Csp_P -produced stable bioactive factors with transmission-blocking and therapeutic potential. The anti-pathogen and entomopathogenic properties of Csp_P render it a potential candidate for the development of malaria and dengue control strategies.

  14. Standardization of an inactivated H17N1 avian influenza vaccine and efficacy against A/Chicken/Italy/13474/99 high-pathogenicity virus infection.

    Science.gov (United States)

    Di Trani, L; Cordioli, P; Falcone, E; Lombardi, G; Moreno, A; Sala, G; Tollis, M

    2003-01-01

    The minimum requirements for assessing the immunogenicity of an experimental avian influenza (AI) vaccine prepared from inactivated A/Turkey/Italy/2676/99 (H7N1) low-pathogenicity (LP) AI (LPAI) virus were determined in chickens of different ages. A correlation between the amount of hemagglutinin (HA) per dose of vaccine and the protection against clinical signs of disease and infection by A/Chicken/Italy/13474/99 highly pathogenic (HP) AI (HPAI) virus was established. Depending on the vaccination schedule, one or two administrations of 0.5 microg of hemagglutinin protected chickens against clinical signs and death and completely prevented virus shedding from birds challenged at different times after vaccination.

  15. Epidemiology of human infections with highly pathogenic avian influenza A(H7N9) virus in Guangdong, 2016 to 2017.

    Science.gov (United States)

    Kang, Min; Lau, Eric H Y; Guan, Wenda; Yang, Yuwei; Song, Tie; Cowling, Benjamin J; Wu, Jie; Peiris, Malik; He, Jianfeng; Mok, Chris Ka Pun

    2017-07-06

    We describe the epidemiology of highly pathogenic avian influenza (HPAI) A(H7N9) based on poultry market environmental surveillance and laboratory-confirmed human cases (n = 9) in Guangdong, China. We also compare the epidemiology between human cases of high- and low-pathogenic avian influenza A(H7N9) (n = 51) in Guangdong. Case fatality and severity were similar. Touching sick or dead poultry was the most important risk factor for HPAI A(H7N9) infections and should be highlighted for the control of future influenza A(H7N9) epidemics. This article is copyright of The Authors, 2017.

  16. Changes in the Aggressiveness and Fecundity of Hot Pepper Anthracnose Pathogen (Colletotricum acutatum under Elevated CO₂ and Temperature over 100 Infection Cycles

    Directory of Open Access Journals (Sweden)

    Tae-Hoon Koo

    2016-06-01

    Full Text Available We observed the changes in aggressiveness and fecundity of the anthracnose pathogen Colletotrichum acutatum on hot pepper, under the ambient and the twice-ambient treatments. Artificial infection was repeated over 100 cycles for ambient (25°C/400 ppm CO₂ and twice-ambient (30°C/700 ppm CO₂ growth chamber conditions, over 3 years. During repeated infection cycles (ICs on green-pepper fruits, the aggressiveness (incidence [% of diseased fruits among 20 inoculated fruits] and severity [lesion length in mm] of infection and fecundity (the average number of spores per five lesions of the pathogen were measured in each cycle and compared between the ambient and twice-ambient treatments, and also between the early (ICs 31–50 and late (ICs 81–100 generations. In summary, the pathogen’s aggressiveness and fecundity were significantly lower in the late generation. It is likely that aggressiveness and fecundity of C. acutatum may be reduced as global CO₂ and temperatures increase.

  17. Antimicrobial activity of ceftaroline and other anti-infective agents against microbial pathogens recovered from the surgical intensive care patient population: a prevalence analysis.

    Science.gov (United States)

    Edmiston, Charles E; Krepel, Candace J; Leaper, David; Ledeboer, Nathan A; Mackey, Tami-Lea; Graham, Mary Beth; Lee, Cheong; Rossi, Peter J; Brown, Kellie R; Lewis, Brian D; Seabrook, Gary R

    2014-12-01

    Ceftaroline is a new parenteral cephalosporin agent with excellent activity against methicillin-sensitive (MSSA) and resistant strains of Staphylococcus aureus (MRSA). Critically ill surgical patients are susceptible to infection, often by multi-drug-resistant pathogens. The activity of ceftaroline against such pathogens has not been described. Three hundred thirty-five consecutive microbial isolates were collected from surgical wounds or abscesses, respiratory, urine, and blood cultures from patients in the surgical intensive care unit (SICU) of a major tertiary medical center. Using Clinical and Laboratory Standards Institute (CLSI) standard methodology and published breakpoints, all aerobic, facultative anaerobic isolates were tested against ceftaroline and selected comparative antimicrobial agents. All staphylococcal isolates were susceptible to ceftaroline at a breakpoint of ≤1.0 mcg/mL. In addition, ceftaroline exhibited excellent activity against all streptococcal clinical isolates and non-ESBL-producing strains of Enterobacteriaceae (93.5%) recovered from SICU patients. Ceftaroline was inactive against ESBL-producing Enterobacteriaceae, Pseudomonas aeruginosa, vancomycin-resistant enterococci, and selective gram-negative anaerobic bacteria. At present, ceftaroline is the only cephalosporin agent that is active against community and healthcare-associated MRSA. Further studies are needed to validate the benefit of this novel broad-spectrum anti-infective agent for the treatment of susceptible serious infections in the SICU patient population.

  18. Bursal immunopathology responses of specific-pathogen-free chickens and red jungle fowl infected with very virulent infectious bursal disease virus.

    Science.gov (United States)

    Farhanah, Mohd Isa; Yasmin, Abdul Rahaman; Khanh, Nguyen Phuc; Yeap, Swee Keong; Hair-Bejo, Mohd; Omar, Abdul Rahman

    2018-04-06

    Very virulent infectious bursal disease virus (vvIBDV) targets B lymphocytes in the bursa of Fabricius (BF), causing immunosuppression and increased mortality rates in young birds. There have been few studies on the host immune response following vvIBDV infection at different inoculum doses in chickens with different genetic backgrounds. In this study, we characterized the immune responses of specific-pathogen-free (SPF) chickens and Malaysian red jungle fowl following infection with vvIBDV strain UPM0081 at 10 3.8 and 10 6.8 times the 50% embryo infectious dose (EID 50 ). The viral burden, histopathological changes, immune cell populations, and expression of immune-related genes were measured and compared between infected and uninfected bursa at specific intervals. The populations of KUL1 + , CD3 + CD4 + and CD3 + CD8 + cells were significantly increased in both types of chickens at 3 dpi, and there was significant early depletion of IgM + B cells at 1 dpi in the red jungle fowl. vvIBDV infection also induced differential expression of genes that are involved in Th1 and pro-inflammatory responses, with groups receiving the higher dose (10 6.8 EID 50 ) showing earlier expression of IFNG, IL12B, IL15, IL6, CXCLi2, IL28B, and TLR3 at 1 dpi. Although both chicken types showed equal susceptibility to infection, the red jungle fowl were clinically healthier than the SPF chickens despite showing more depletion of IgM + B cells and failure to induce IFNB activation. In conclusion, high-dose vvIBDV infection caused an intense early host immune response in the infected bursa, with depletion of IgM + B cells, bursal lesions, and cytokine expression as a response to mitigate the severity of the infection.

  19. Unique morphological changes in plant pathogenic phytoplasma-infected petunia flowers are related to transcriptional regulation of floral homeotic genes in an organ-specific manner.

    Science.gov (United States)

    Himeno, Misako; Neriya, Yutaro; Minato, Nami; Miura, Chihiro; Sugawara, Kyoko; Ishii, Yoshiko; Yamaji, Yasuyuki; Kakizawa, Shigeyuki; Oshima, Kenro; Namba, Shigetou

    2011-09-01

    Abnormal flowers are often induced by infection of certain plant pathogens, e.g. phytoplasma, but the molecular mechanisms underlying these malformations have remained poorly understood. Here, we show that infection with OY-W phytoplasma (Candidatus Phytoplasma asteris, onion yellows phytoplasma strain, line OY-W) affects the expression of the floral homeotic genes of petunia plants in an organ-specific manner. Upon infection with OY-W phytoplasma, floral morphological changes, including conversion to leaf-like structures, were observed in sepals, petals and pistils, but not in stamens. As the expression levels of homeotic genes differ greatly between floral organs, we examined the expression levels of homeotic genes in each floral organ infected by OY-W phytoplasma, compared with healthy plants. The expression levels of several homeotic genes required for organ development, such as PFG, PhGLO1 and FBP7, were significantly downregulated by the phytoplasma infection in floral organs, except the stamens, suggesting that the unique morphological changes caused by the phytoplasma infection might result from the significant decrease in expression of some crucial homeotic genes. Moreover, the expression levels of TER, ALF and DOT genes, which are known to participate in floral meristem identity, were significantly downregulated in the phytoplasma-infected petunia meristems, implying that phytoplasma would affect an upstream signaling pathway of floral meristem identity. Our results suggest that phytoplasma infection may have complex effects on floral development, resulting in the unique phenotypes that were clearly distinct from the mutant flower phenotypes produced by the knock-out or the overexpression of certain homeotic genes. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  20. [The method and result analyses of pathogenic bacteria culture on chronic periprosthetic joint infection after total knee arthroplasty and total hip arthroplasty].

    Science.gov (United States)

    Ji, Baochao; Xu, Enjie; Cao, Li; Yang, Desheng; Xu, Boyong; Guo, Wentao; Aili, Rehei

    2015-02-01

    To analyze the results of pathogenic bacteria culture on chronic periprosthetic joint infection after total knee arthroplasty (TKA) and total hip arthroplasty (THA). The medical data of 23 patients with chronic periprosthetic joint infection after TKA or THA from September 2010 to March 2014 were reviewed. Fifteen cases of TKA and 8 cases of THA were included in this study. There were 12 male and 11 female patients with the mean age of 62 years (range from 32 to 79 years), and among them 9 patients with sinus. All patients discontinued antibiotic therapy for a minimum of 2 weeks before arthrocentesis, taking pathogenic bacteria culture and antimicrobial susceptibility test by using synovial fluid taken preoperatively and intraoperatively of revision. Common pathogenic bacteria culture and pathological biopsy were taken on tissues intraoperatively of revision. Culture-negative specimens were prolonged the period of incubation for 2 weeks. The overall culture-positive rate of all 23 patients for 1 week before revision was 30.4% (7/23), and the positive rate of culture-negative samples which prolonged for 2 weeks was 39.1% (9/23). The overall culture-positive rate of patients for 1 week intraoperatively of revision was 60.9% (14/23), and the positive rate of culture-negative samples which prolonged for 2 weeks was 82.6% (19/23). The incubation results of 7 cases (30.4%) preoperatively conformed to that of intraoperation. The culture-positive rate of pathogenic bacteria culture can be increased evidently by discontinuing antimicrobial therapy for a minimum of 2 weeks prior to the definite diagnosis.

  1. Increased likelihood of bacterial pathogens in the coronal sulcus and urethra of uncircumcised men in a diverse group of HIV infected and uninfected patients in India

    Directory of Open Access Journals (Sweden)

    John A Schneider

    2012-01-01

    Full Text Available Background: The biological mechanism of circumcision as potentiating HIV prevention is poorly understood. Foreskin microbiota has been postulated as having a potential role; however, little is known about the relationship between bacterial pathogens and circumcision in adults. Materials and Methods: We sampled the coronal sulcus of a diverse group of circumcised and uncircumcised men (n=315 from a government chest hospital and fertility clinic in Hyderabad, Andhra Pradesh, India. Genital examination was conducted on three groups of men: Group 1 - HIV infected; Group 2 - TB infected; Group 3 - control. Aerobic and anaerobic specimens were cultured according to standard clinical protocols, and results were analyzed following multivariate logistic regression models. Results: Three hundred fifteen study participants - 47.6% of Group 1, 36.5% of Group 2, and 15.9% of Group 3 - were enrolled in the study and included in all analyses. Overall 37.1% of the participants were circumcised without variation across groups (P=0.29. Smegma was observed in 18.7% of the participants with no cases observed in Group 3 (P<0.001. Gram-negative pathogens were more prevalent among study participants in Group 1 (22.7% and Group 2 (30.4% as compared with those in Group 3 (6.0% (P=0.003. In multivariate regression analysis, controlling for group, age, and presence of smegma, uncircumcised men were more likely to be colonized with gram positives [Adjusted Odds Ratio (AOR 1.9; P<0.05], gram negatives (AOR 2.4; P<0.05, or any pathogen (AOR 2.8; P<0.005. Conclusions: Uncircumcised men in this population in South India are more likely to harbor bacterial pathogens in the coronal sulcus than do their circumcised counterparts. Future studies should examine the relationship between foreskin microbiota and HIV transmission.

  2. PCR diagnosis of tick-borne pathogens in Maharashtra state, India indicates fitness cost associated with carrier infections is greater for crossbreed than native cattle breeds.

    Directory of Open Access Journals (Sweden)

    Sunil W Kolte

    Full Text Available Tick-borne pathogens (TBP are responsible for significant economic losses to cattle production, globally. This is particularly true in countries like India where TBP constrain rearing of high yielding Bos taurus, as they show susceptibility to acute tick borne disease (TBD, most notably tropical theileriosis caused by Theileria annulata. This has led to a programme of cross breeding Bos taurus (Holstein-Friesian or Jersey with native Bos indicus (numerous breeds to generate cattle that are more resistant to disease. However, the cost to fitness of subclinical carrier infection in crossbreeds relative to native breeds is unknown, but could represent a significant hidden economic cost. In this study, a total of 1052 bovine blood samples, together with associated data on host type, sex and body score, were collected from apparently healthy animals in four different agro-climatic zones of Maharashtra state. Samples were screened by PCR for detection of five major TBPs: T. annulata, T. orientalis, B. bigemina, B. bovis and Anaplasma spp.. The results demonstrated that single and co-infection with TBP are common, and although differences in pathogen spp. prevalence across the climatic zones were detected, simplistic regression models predicted that host type, sex and location are all likely to impact on prevalence of TBP. In order to remove issues with autocorrelation between variables, a subset of the dataset was modelled to assess any impact of TBP infection on body score of crossbreed versus native breed cattle (breed type. The model showed significant association between infection with TBP (particularly apicomplexan parasites and poorer body condition for crossbreed animals. These findings indicate potential cost of TBP carrier infection on crossbreed productivity. Thus, there is a case for development of strategies for targeted breeding to combine productivity traits with disease resistance, or to prevent transmission of TBP in India for economic

  3. PCR diagnosis of tick-borne pathogens in Maharashtra state, India indicates fitness cost associated with carrier infections is greater for crossbreed than native cattle breeds.

    Science.gov (United States)

    Kolte, Sunil W; Larcombe, Stephen D; Jadhao, Suresh G; Magar, Swapnil P; Warthi, Ganesh; Kurkure, Nitin V; Glass, Elizabeth J; Shiels, Brian R

    2017-01-01

    Tick-borne pathogens (TBP) are responsible for significant economic losses to cattle production, globally. This is particularly true in countries like India where TBP constrain rearing of high yielding Bos taurus, as they show susceptibility to acute tick borne disease (TBD), most notably tropical theileriosis caused by Theileria annulata. This has led to a programme of cross breeding Bos taurus (Holstein-Friesian or Jersey) with native Bos indicus (numerous) breeds to generate cattle that are more resistant to disease. However, the cost to fitness of subclinical carrier infection in crossbreeds relative to native breeds is unknown, but could represent a significant hidden economic cost. In this study, a total of 1052 bovine blood samples, together with associated data on host type, sex and body score, were collected from apparently healthy animals in four different agro-climatic zones of Maharashtra state. Samples were screened by PCR for detection of five major TBPs: T. annulata, T. orientalis, B. bigemina, B. bovis and Anaplasma spp.. The results demonstrated that single and co-infection with TBP are common, and although differences in pathogen spp. prevalence across the climatic zones were detected, simplistic regression models predicted that host type, sex and location are all likely to impact on prevalence of TBP. In order to remove issues with autocorrelation between variables, a subset of the dataset was modelled to assess any impact of TBP infection on body score of crossbreed versus native breed cattle (breed type). The model showed significant association between infection with TBP (particularly apicomplexan parasites) and poorer body condition for crossbreed animals. These findings indicate potential cost of TBP carrier infection on crossbreed productivity. Thus, there is a case for development of strategies for targeted breeding to combine productivity traits with disease resistance, or to prevent transmission of TBP in India for economic benefit.

  4. Novel Fungal Pathogenicity and Leaf Defense Strategies Are Revealed by Simultaneous Transcriptome Analysis of Colletotrichum fructicola and Strawberry Infected by This Fungus

    Directory of Open Access Journals (Sweden)

    Liqing Zhang

    2018-04-01

    Full Text Available Colletotrichum fructicola, which is part of the C. gloeosporioides species complex, can cause anthracnose diseases in strawberries worldwide. However, the molecular interactions between C. fructicola and strawberry are largely unknown. A deep RNA-sequencing approach was applied to gain insights into the pathogenicity mechanisms of C. fructicola and the defense response of strawberry plants at different stages of infection. The transcriptome data showed stage-specific transcription accompanied by a step-by-step strawberry defense response and the evasion of this defense system by fungus. Fungal genes involved in plant cell wall degradation, secondary metabolism, and detoxification were up-regulated at different stage of infection. Most importantly, C. fructicola infection was accompanied by a large number of highly expressed effectors. Four new identified effectors function in the suppression of Bax-mediated programmed cell death. Strawberry utilizes pathogen-associated molecular patterns (PAMP-triggered immunity and effector-triggered immunity to prevent C. fructicola invasion, followed by the initiation of downstream innate immunity. The up-regulation of genes related to salicylic acid provided evidence that salicylic acid signaling may serve as the core defense signaling mechanism, while jasmonic acid and ethylene pathways were largely inhibited by C. fructicola. The necrotrophic stage displayed a significant up-regulation of genes involved in reactive oxygen species activation. Collectively, the transcriptomic data of both C. fructicola and strawberry shows that even though plants build a multilayered defense against infection, C. fructicola employs a series of escape or antagonizing mechanisms to successfully infect host cells.

  5. Effect of respiratory syncytial virus (RSV) infection on the adherence of pathogenic bacteria to human epithelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Faden, H.; Hong, J.J.; Ogra, P.L.

    1986-03-01

    The effect of RSV infection on the adherence of Streptococcus pneumoniae (SP), Haemophilus influenzae (HI) and Staphylococcus aureus (SA) to human epithelial cells was determined. RSV-infected Hep-2 cell cultures at different stages of expression of surface viral antigens and bacteria labeled with /sup 3/H-thymidine were employed to examine the kinetics of bacterial adherence to virus-infected cells. RSV infection did not alter the magnitude of adherence of HI or SA to HEp-2 cells. However, adherence of SP to HEp-2 cells was significantly (P < 0.01) enhanced by prior RSV infection. The degree of adherence was directly related to the amount of viral antigen expressed on the cell surface. The adherence was temperature dependent, with maximal adherence observed at 37/sup 0/C. Heat-inactivation of SP did not alter adherence characteristics. These data suggest that RSV infection increases adherence of SP to the surface of epithelial cells in vitro. Since attachment of bacteria to mucosal surfaces is the first step in many infections, it is suggested that viral infections of epithelial cells render them more susceptible to bacterial adherence. Thus, RSV infection in vivo may predispose children to SP infections, such as in otitis media, by increasing colonization with SP.

  6. Host cytokine responses of pigeons infected with highly pathogenic Thai avian influenza viruses of subtype H5N1 isolated from wild birds.

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Hayashi

    Full Text Available Highly pathogenic avian influenza virus (HPAIV of the H5N1 subtype has been reported to infect pigeons asymptomatically or induce mild symptoms. However, host immune responses of pigeons inoculated with HPAIVs have not been well documented. To assess host responses of pigeons against HPAIV infection, we compared lethality, viral distribution and mRNA expression of immune related genes of pigeons infected with two HPAIVs (A/Pigeon/Thailand/VSMU-7-NPT/2004; Pigeon04 and A/Tree sparrow/Ratchaburi/VSMU-16-RBR/2005; T.sparrow05 isolated from wild birds in Thailand. The survival experiment showed that 25% of pigeons died within 2 weeks after the inoculation of two HPAIVs or medium only, suggesting that these viruses did not cause lethal infection in pigeons. Pigeon04 replicated in the lungs more efficiently than T.sparrow05 and spread to multiple extrapulmonary organs such as the brain, spleen, liver, kidney and rectum on days 2, 5 and 9 post infection. No severe lesion was observed in the lungs infected with Pigeon04 as well as T.sparrow05 throughout the collection periods. Encephalitis was occasionally observed in Pigeon04- or T.sparrow05-infected brain, the severity, however was mostly mild. To analyze the expression of immune-related genes in the infected pigeons, we established a quantitative real-time PCR analysis for 14 genes of pigeons. On day 2 post infection, Pigeon04 induced mRNA expression of Mx1, PKR and OAS to a greater extent than T.sparrow05 in the lungs, however their expressions were not up-regulated concomitantly on day 5 post infection when the peak viral replication was observed. Expressions of TLR3, IFNα, IL6, IL8 and CCL5 in the lungs following infection with the two HPAIVs were low. In sum, Pigeon04 exhibited efficient replication in the lungs compared to T.sparrow05, but did not induce excessive host cytokine expressions. Our study has provided the first insight into host immune responses of pigeons against HPAIV infection.

  7. Dissecting Candida albicans Infection from the Perspective of C. albicans Virulence and Omics Approaches on Host–Pathogen Interaction: A Review

    Directory of Open Access Journals (Sweden)

    Voon Kin Chin

    2016-10-01

    Full Text Available Candida bloodstream infections remain the most frequent life-threatening fungal disease, with Candida albicans accounting for 70% to 80% of the Candida isolates recovered from infected patients. In nature, Candida species are part of the normal commensal flora in mammalian hosts. However, they can transform into pathogens once the host immune system is weakened or breached. More recently, mortality attributed to Candida infections has continued to increase due to both inherent and acquired drug resistance in Candida, the inefficacy of the available antifungal drugs, tedious diagnostic procedures, and a rising number of immunocompromised patients. Adoption of animal models, viz. minihosts, mice, and zebrafish, has brought us closer to unraveling the pathogenesis and complexity of Candida infection in human hosts, leading towards the discovery of biomarkers and identification of potential therapeutic agents. In addition, the advancement of omics technologies offers a holistic view of the Candida-host interaction in a non-targeted and non-biased manner. Hence, in this review, we seek to summarize past and present milestone findings on C. albicans virulence, adoption of animal models in the study of C. albicans infection, and the application of omics technologies in the study of Candida–host interaction. A profound understanding of the interaction between host defense and pathogenesis is imperative for better design of novel immunotherapeutic strategies in future.

  8. Opportunism of Conidiobolus obscurus stems from depression of infection in situ to progeny colonies of host alatae as disseminators of the aphid-pathogenic fungus.

    Science.gov (United States)

    Zhang, Guo-Zhong; Feng, Ming-Guang; Chen, Chun; Ying, Sheng-Hua

    2007-04-01

    Conidiobolus (Entomophthorales: Ancylistaceae) includes common aphid pathogens but causes sporadic mycosis worldwide. This epizootiological opportunism was explored herein by examining the potential of mycosis transmission in the progeny colonies of 513 Myzus persicae alates as disseminators of C. obscurus often infecting aphids. The alates exposed to spore showers were flown for 2.05 (0.01-8.95) km on flight mills and then reared individually on cabbage at 20-23 degrees C for 14 day colonization. All truly infected alates were mycosed within 6 days and averagely left 3.9 (0-15) nymphs while those uninfected produced 11.6 (0-35) nymphs during the same period. Secondary and tertiary infections occurred only in 16.2% and 4.8% of the progeny colonies of the mycosed alates respectively, due to c. 60% of the cadavers forming resting spores. Most of the contagious infections appeared on days 4-8 after colonization and no more occurred from day 11 onwards. Trends of colony sizes (last-day averaging 51.5 aphids) and mycosis transmission (sixth-day maximum 6.3%) fit well to logistic (r2 = 0.99) and Gompertz growth models (r2 = 0.91) respectively. The results confirm that the opportunism of C. obscurus stems from depression of contagious infection after dissemination by host alates and suggest that it be overwhelmed by the prevalence of other non-resting fungal species.

  9. Localization and dynamics of Wolbachia infection in Asian citrus psyllid Diaphorina citri, the insect vector of the causal pathogens of Huanglongbing.

    Science.gov (United States)

    Ren, Su-Li; Li, Yi-Han; Ou, Da; Guo, Yan-Jun; Qureshi, Jawwad A; Stansly, Philip A; Qiu, Bao-Li

    2018-03-23

    Wolbachia is a group of intracellular bacteria that infect a wide range of arthropods including the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama. This insect is the vector of Candidatus Liberibacter asiaticus (CLas), the causal pathogen of Huanglongbing or citrus greening disease. Here, we investigated the localization pattern and infection dynamics of Wolbachia in different developmental stages of ACP. Results revealed that all developmental stages of ACP including egg, 1st-5th instar nymphs, and adults of both gender were infected with Wolbachia. FISH visualization of an ACP egg showed that Wolbachia moved from the egg stalk of newly laid eggs to a randomly distributed pattern throughout the egg prior to hatching. The infection rate varied between nymphal instars. The titers of Wolbachia in fourth and fifth instar nymphs were significantly higher than those in the first and second instar nymphs. Wolbachia were scattered in all nymphal stages, but with highest intensity in the U-shaped bacteriome located in the abdomen of the nymph. Wolbachia was confined to two symmetrical organizations in the abdomen of newly emerged female and male adults. The potential mechanisms of Wolbachia infection dynamics are discussed. © 2018 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  10. The Clavibacter michiganensis subsp. michiganensis-tomato interactome reveals the perception of pathogen by the host and suggests mechanisms of infection

    Energy Technology Data Exchange (ETDEWEB)

    Savidor, Alon [Tel Aviv University; Teper, [Tel Aviv University; Gartemann, KH [Tel Aviv University; Eichenlaub, R [Tel Aviv University; Chalupowicz, L [Tel Aviv University; Manulis-Sasson, S [Tel Aviv University; Barash, I [Tel Aviv University; Tews, H [Tel Aviv University; Mayer, K [Tel Aviv University; Giannone, Richard J [ORNL; Hettich, Robert {Bob} L [ORNL; Sessa, G [Tel Aviv University

    2012-01-01

    The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis (Cmm) causes wilt and canker disease of tomato (Solanum lycopersicum). Mechanisms of Cmm pathogenicity and tomato response to Cmm infection are not well understood. To explore the interaction between Cmm and tomato, multidimensional protein identification technology (MudPIT) and tandem mass spectrometry were used to analyze in vitro and in planta generated samples. The results show that during infection Cmm senses the plant environment, transmits signals, induces, and then secretes multiple hydrolytic enzymes, including serine proteases of the Pat-1, Ppa, and Sbt familes, the CelA, XysA, and NagA glycosyl hydrolases, and other cell wall-degrading enzymes. Tomato induction of pathogenesis-related (PR) proteins, LOX1, and other defense-related proteins during infection indicates that the plant senses the invading bacterium and mounts a basal defense response, although partial with some suppressed components including class III peroxidases and a secreted serine peptidase. The tomato ethylene-synthesizing enzyme ACC-oxidase was induced during infection with the wild-type Cmm but not during infection with an endophytic Cmm strain, identifying Cmm-triggered host synthesis of ethylene as an important factor in disease symptom development. The proteomic data were also used to improve Cmm genome annotation, and thousands of Cmm gene models were confirmed or expanded.

  11. Application of the EPR technique to examine free radical qualities reducing infection of spring wheat grain with pathogenic fungi by He-Ne laser irradiation

    International Nuclear Information System (INIS)

    Gagoś, M.; Koper, R.; Sujak, A.; Misiak, L.E.; Kowalczuk, E.

    2000-01-01

    Samples of spring wheat grain, Jasna cv., infected with pathogenic fungi (Aspergillus niger, Penicillium sp., Fusarium, Mucor) were examined using an EPR technique. Considering the quantity of generated free radicals the fungi belonged to most toxine generating. Their toxicity was connected with the number of free radicals generated in examined grain. Grain was irradiated with He-Ne laser at known wavelength, power density and time of exposure what gave the mycostatic effect appearing in decrease of free radicals in grain samples. However, this process was not stable as the increase of free radicals was observed again with the regrowth of fungi after some days

  12. Loss of Anti-Viral Immunity by Infection with a Virus Encoding a Cross-Reactive Pathogenic Epitope

    OpenAIRE

    Chen, Alex T.; Cornberg, Markus; Gras, Stephanie; Guillonneau, Carole; Rossjohn, Jamie; Trees, Andrew; Emonet, Sebastien; de la Torre, Juan C.; Welsh, Raymond M.; Selin, Liisa K.

    2012-01-01

    Author Summary The purpose of vaccination against viruses is to induce strong neutralizing antibody responses that inactivate viruses on contact and strong T cell responses that attack and kill virus-infected cells. Some viruses, however, like HIV and hepatitis C virus, are only weakly controlled by neutralizing antibody, so T cell immunity is very important for control of these infections. T cells recognize small virus-encoded peptides, called epitopes, presented on the surface of infected c...

  13. Effect of respiratory syncytial virus (RSV) infection on the adherence of pathogenic bacteria to human epithelial cells

    International Nuclear Information System (INIS)

    Faden, H.; Hong, J.J.; Ogra, P.L.

    1986-01-01

    The effect of RSV infection on the adherence of Streptococcus pneumoniae (SP), Haemophilus influenzae (HI) and Staphylococcus aureus (SA) to human epithelial cells was determined. RSV-infected Hep-2 cell cultures at different stages of expression of surface viral antigens and bacteria labeled with 3 H-thymidine were employed to examine the kinetics of bacterial adherence to virus-infected cells. RSV infection did not alter the magnitude of adherence of HI or SA to HEp-2 cells. However, adherence of SP to HEp-2 cells was significantly (P 0 C. Heat-inactivation of SP did not alter adherence characteristics. These data suggest that RSV infection increases adherence of SP to the surface of epithelial cells in vitro. Since attachment of bacteria to mucosal surfaces is the first step in many infections, it is suggested that viral infections of epithelial cells render them more susceptible to bacterial adherence. Thus, RSV infection in vivo may predispose children to SP infections, such as in otitis media, by increasing colonization with SP

  14. IL-27 Receptor Signalling Restricts the Formation of Pathogenic, Terminally Differentiated Th1 Cells during Malaria Infection by Repressing IL-12 Dependent Signals

    Science.gov (United States)

    Villegas-Mendez, Ana; de Souza, J. Brian; Lavelle, Seen-Wai; Gwyer Findlay, Emily; Shaw, Tovah N.; van Rooijen, Nico; Saris, Christiaan J.; Hunter, Christopher A.; Riley, Eleanor M.; Couper, Kevin N.

    2013-01-01

    The IL-27R, WSX-1, is required to limit IFN-γ production by effector CD4+ T cells in a number of different inflammatory conditions but the molecular basis of WSX-1-mediated regulation of Th1 responses in vivo during infection has not been investigated in detail. In this study we demonstrate that WSX-1 signalling suppresses the development of pathogenic, terminally differentiated (KLRG-1+) Th1 cells during malaria infection and establishes a restrictive threshold to constrain the emergent Th1 response. Importantly, we show that WSX-1 regulates cell-intrinsic responsiveness to IL-12 and IL-2, but the fate of the effector CD4+ T cell pool during malaria infection is controlled primarily through IL-12 dependent signals. Finally, we show that WSX-1 regulates Th1 cell terminal differentiation during malaria infection through IL-10 and Foxp3 independent mechanisms; the kinetics and magnitude of the Th1 response, and the degree of Th1 cell terminal differentiation, were comparable in WT, IL-10R1−/− and IL-10−/− mice and the numbers and phenotype of Foxp3+ cells were largely unaltered in WSX-1−/− mice during infection. As expected, depletion of Foxp3+ cells did not enhance Th1 cell polarisation or terminal differentiation during malaria infection. Our results significantly expand our understanding of how IL-27 regulates Th1 responses in vivo during inflammatory conditions and establishes WSX-1 as a critical and non-redundant regulator of the emergent Th1 effector response during malaria infection. PMID:23593003

  15. An outbreak of enterotoxigenic Escherichia coli (ETEC) infection in Norway, 2012: a reminder to consider uncommon pathogens in outbreaks involving imported products.

    Science.gov (United States)

    MacDonald, E; Møller, K E; Wester, A L; Dahle, U R; Hermansen, N O; Jenum, P A; Thoresen, L; Vold, L

    2015-02-01

    We investigated an outbreak of gastroenteritis following a Christmas buffet served on 4-9 December 2012 to ~1300 hotel guests. More than 300 people were reported ill in initial interviews with hotel guests. To identify possible sources of infection we conducted a cohort investigation through which we identified 214 probable cases. Illness was associated with consumption of scrambled eggs (odds ratio 9·07, 95% confidence interval 5·20-15·84). Imported chives added fresh to the scrambled eggs were the suspected source of the outbreak but were unavailable for testing. Enterotoxigenic Escherichia coli (ETEC) infection was eventually confirmed in 40 hotel guests. This outbreak reinforces that ETEC should be considered in non-endemic countries when the clinical picture is consistent and common gastrointestinal pathogens are not found. Following this outbreak, the Norwegian Food Safety Authority recommended that imported fresh herbs should be heat-treated before use in commercial kitchens.

  16. No evidence of transmission of H5N1 highly pathogenic avian influenza to humans after unprotected contact with infected wild swans.

    Science.gov (United States)

    Wallensten, A; Salter, M; Bennett, S; Brown, I; Hoschler, K; Oliver, I

    2010-02-01

    Highly pathogenic avian influenza (HPAI) subtype H5N1 remains a public health threat as long as it circulates in wild and domestic birds. Information on the transmissibility of H5N1 HPAI from wild birds is needed for evidence-based public health advice. We investigated if transmission of H5N1 HPAI had taken place in people that had unprotected contact with infected wild mute swans during an incident at the Abbotsbury Swannery in Dorset, England. Thirteen people who had been exposed to infected swans were contacted and actively followed up for symptoms. Serology was taken after 30 days. We did not find evidence of transmission of H5N1 HPAI to humans during the incident. The incident provided a rare opportunity to study the transmissibility of the virus from wild birds to humans.

  17. Multidrug-resistant Enterobacteriaceae including metallo-β-lactamase producers are predominant pathogens of healthcare-associated infections in an Indian teaching hospital

    Directory of Open Access Journals (Sweden)

    J B Sarma

    2011-01-01

    Full Text Available Purpose: A study was carried out in an Indian teaching hospital in 2009 to detect the rate of surgical site infections (SSI and peripheral vascular access site infections. Materials and Methods: The study was a point-prevalence study involving over 300 patients. The presence of infection was determined according to the CDC criteria. Swabs were taken from the infected sites and identification and sensitivity were carried out using VITEK® 2 automated system. Characterisation of β-lactamase was carried out at ARRML, Colindale, London. Results: The rate of SSI was 15% for the clean and clean-contaminated categories while that for the dirty contaminated category was 85% (NNIS risk index 0. Cultures yielded definite or probable pathogens from 64% (9/14 of the patients with SSI. In 1/3 rd of the cultures, Staphylococcus aureus was grown and the rest had Enterobacteriaceae, either extended-spectrum β-lactamase (ESBL producers or Amp-C hyperproducers and, alarmingly, three isolates were positive for newly recognised New Delhi metallo-β-lactamase-1 (NDM-1. In medicine, 87% (n = 99 of the patients had a peripheral IV access device, 55% developed associated phlebitis/infection and, in seven, probable pathogens were isolated (Candida species and Escherichia coli producing ESBL and NDM-1, respectively, Staphylococcus aureus and Enterococcus faecium. All ESBL and metallo-β-lactamase producers were resistant to multiple classes of antimicrobials, the latter being sensitive only to colistin and tigecycline. The study also found that all post-operative patients were on antibiotics, 92% on IV [213 defined daily doses (DDD/100 post-op patients] limited mainly to the third-generation cephalosporins (26% and aminoglycosides (24% and imidazole derivatives (30%. In medicine, 83% (n = 82 were on IV antibiotics (123 DDD/100 bed-days, limited mainly to the third-generation cephalosporins (74%. Conclusion: Indiscriminate use of antibiotics is a major problem

  18. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  19. A Broad-Spectrum Infection Diagnostic that Detects